Philippine Journal of Crop Science 2003, 28(1): 3-19 Copyright 2005, Crop Science Society of the Philippines Released January 2005

DNA MARKER-AIDED SELECTION & EVALUATION OF IR64, PSB RC14 & BPI RI-10 FOR RESISTANCE TO BACTERIAL LEAF BLIGHT

RE TABIEN1,2, MC ABALOS1,2, MP FERNANDO1, ER CORPUZ1, YA DIMAANO1, GM OSOTEO1, RC SAN GABRIEL1, TF PADOLINA1, GM BABB1, DA TABANAO1, H RAPUSAS1, JP RILLON1 & LS SEBASTIAN1

1 Philippine Rice Research Institute, Maligaya, Science City of Muñoz, Nueva Ecija, Philippines. 2 Current address: Texas A&M University, Agricultural Research and Extension Center, 1509 Aggie Drive, Beaumont, TX 77713, USA

Improvement of popular varieties has been the approach of most breeders to meet the demand of farmers for quality new or improved varieties. This requires a series of backcrossing to generate recombinants with the desired traits in a given genetic background. With the generation of DNA markers linked to any trait of interest, the long tedious backcrossing can be shortened, thus hastening the identification of desirable genotypes.

Elite lines generated after a series of backcrossing using three popular rice varieties (IR64, PSB Rc14 and BPI Ri-10) as recipients and two lines (IRBB5-21 for the xa5 and Xa21 and IR59183 for the Om gene) as donor parents for bacterial leaf blight (BLB) resistance genes. DNA marker-aided selection for gene transfer and pyramiding was done using STS for RG556a linked to xa5, primer OPL 13 for the Om from Oryza minuta and pTA248 for Xa21 while 10 RAPD markers were used to evaluate progenies of the third and last backcross. Four elite lines are currently undergoing national testing for yield and one line, AR32-19-3-4, is under adaptation trials in 22 locations, the last stage before varietal release. All lines have shown resistance to nine races of BLB and have had grain qualities similar to the recurrent parent. The most advanced lines have had an average yield of 5-6 t/ha in wet season farmers’ trials in BLB hotspot areas. Moreover, these lines are now important germplasm in anther culture, transformation and hybridization aimed at transferring or keeping the desirable traits of the 3 popular varieties under study. The elite lines developed are the first successful products of marker-aided selection in rice reported from the Philippines.

Keywords backcrossing, bacterial leaf blight, BPI Ri-10, DNA marker-aided selection, IR64, Oryza minuta, PSB Rc14, pyramiding, RAPD markers, rice

INTRODUCTION

Popular plant varieties, adopted in large-scale production, may have some undesirable traits. These cultivars are generally high-yielding but may be highly susceptible to the attack of a certain disease or insect. In some cases, these are of poor grain quality, and thus command lower prices in the market. Also, long-term cultivation of single variety with wide adoption can lead to a shift in race or biotype frequency and ultimately cause resistance breakdown (Mew et al 1992).

One way to delay loss of resistance is called gene pyramiding or gene stacking (Davierwala et al 2001, Singh et al 2001). Thus, to further extend the use of these popular varieties, new traits or genes are being introduced through a series of backcrossing (Tabien et al 2001c). However, pyramiding is difficult or impossible using the conventional approach due to masking and/or epistatic effects of the genes being combined (Huang et al 1997). Moreover, some genes have similar reactions to 2 or more races or biotypes; thus they prove rather difficult to identify and transfer through conventional

DNA Marker-Aided Selection Of Hybrid Rice 4

approaches (Singh et al 2001). Most of the rice varieties in the Philippines

have Xa4 and xa5 genes for bacterial leaf blight (BLB) and some have no resistance at all (Tabien et al 2001b). With the identification of new genes like Xa21, Xa22 and Xa23 or the Om gene from Oryza minuta, varieties developed earlier can be improved through the incorporation of these new important genes (Tabien et al 2000). IR64 and BPI Ri-10 are two of the most popular rice varieties for irrigated lowlands due to their high yields and good grain quality. PSB Rc14 is also a popular direct-seeded rice variety with desirable grain qualities.

Inoculation tests showed these varieties were generally susceptible to 9 races of BLB found in the country (Tabien, unpublished data). Since most farmers prefer these varieties, an improvement in their resistance especially to BLB will enable farmers to plant these even during the wet season (WS) even where major pests and diseases, eg, BLB, are prevalent.

Several genes for BLB have been mapped and tagged using DNA markers and these can be explored in improving resistance (Tabien & Sebastian 2000). Among the more than two dozen genes reported (Khush & Kinoshita 1991, Kinoshita 1995, Lin et al 1996, Gao et al 2001, Chen et al 2002), 8 genes (Xa3, Xa4, xa5, Xa7, xa8, Xa10, xa13 and Xa21) have been transferred or pyramided in common genetic background using marker-aided selection (Yoshimura et al 1996, Huang et al 1997, Sanchez et al 2000, Borines 2001, Davierwala et al 2001, Singh et al 2001). Lines with single or combinations of genes have been identified using different DNA markers closely linked to the genes. Classical transfer of new genes is being done through a series of backcrossing and selection, and this procedure needs a longer time and requires large resources. The use of DNA as markers for selection has streamlined and facilitated the whole process even without inoculation (Tabien et al 2000).

This study is aimed at using DNA to mark target genes for improving BLB resistance of IR64, PSB Rc14 and BPI Ri-10. Specifically, the work is aimed at pyramiding xa5, Xa21 and transferring the Om gene to the 3 varieties and evaluating the performance of elite lines thus generated through marker-aided selection (MAS) both in on-station trials and farmers’ fields. The paper presents the generation and

evaluation of elite lines conducted in three years (2000-2002).

MATERIALS & METHODS

Crossing and Generation Advance Two lines, IRBB5-21 and IR59183, kindly

provided by the Asian Biotechnology Network (ARBN) of the International Rice Research Institute (IRRI), were selected as donors for three genes, namely xa5, Xa21 and the Om, found effective in resisting the attack of majority of the BLB races in the Philippines. Likewise, three popular rice varieties in the Philippines with high grain yield and excellent grain qualities – IR64, BPI Ri-10 and PSB Rc14) – were selected as the recipients or recurrent parents. A series of backcrossing with conventional and marker-aided selections using PCR was done to pyramid and/or transfer BLB resistance genes to these modern rice varieties. Three cycles of backcrossing were subsequently done (Figure 1).

Field selection at the pedigree nursery (PN) commenced at the BC3F3 lines to evaluate uniformity and phenotypic resemblance to the recurrent parent and to determine the transfer of resistance genes. Uniform lines as determined based on phenotypes and BLB resistance were then advanced to the yield trials.

Marker-aided selection & inoculation More than 2000 resistant plants from 6

crosses showed typical Xa21 reactions after inoculation with PXO99. There were potential lines for MAS at the third backcross generation. Bulked DNAs of 2394 BC3F3 plants from a given BC3F2 were analyzed using RG556a primer for xa5, pTA248 primer for Xa21, and gene primer OPL 13 for the Om (Table 1). DNA samples of the 800 plants from the last backcross population were further analyzed using 10 RAPD markers, and their phenotypes compared with those of the three recurrent parents

DNA isolation for PCR analysis was conducted following the procedure described by Dellaporta et al (1993). The PCR procedure and reaction mixture used were from ARBN laboratory at IRRI. Briefly, the cocktail was composed of 2.5 μl each of MgCl2 (15 mM), dNTP’s (2.0 mM), 10X PCR buffer, F primer (33 ng/μl), and R primer (33 ng/μl), 1.0 μl taq polymerase, 3.0 μl DNA template (25 ng/μl), and 8.5μl sterile dH2O while the PCR profile had 5

RE Tabien et al 5

Donor Parents (DP) Recurrent Parents (RP)IRBB5-21 IR 64 IR59183 PSB Rc14

BPI Ri10

Generation of Single Crosses 1995 DS

F1 x RP 1st Backcross 1995 WS

BC1F1 x RP 2nd Backcross

1996 DS

BC2F1 x RP 3rd Backcross MAS

1996 WS

BC3F1-F2

Generation advanced Phenotyping/MAS Marker-Aided Selection

1997 DS/WS BC3F3-F4

Generation Advanced Phenotyping/MAS Identification of isolines

1998 DS/WS BC3F5-F6

Field testing for phenotypic uniformity and yield 1999 DS/WS BC3F7-F8

Field testing AON, PYT, & GYT testing

2000 DS/WS * MAS - Marker-aided selection NCT – National Cooperative Test AON - Adbvanced Observational Nut\rsery MAT – Multi-Adaptation Trial PYT - Preliminary Yield Trial GYT - General Yield Trial

Figure 1: Flowchart (Breeding Scheme)

X

X

X

X

Farmer’s Field/NCT/MAT Yield Trial

2000 DS - Current

RP

RP

RP

F1

BC1F1

BC2F1

DNA Marker-Aided Selection Of Hybrid Rice

min hold at 94°C, 30 cycles with 30 sec at 94°C for denaturation, 30 sec at 55°C for primer annealing, 60 sec at 72°C for primer extension and final extension of 5 min at 94°C. The products were resolved in 1.5% agarose gel having 1X TAE buffer.

Lines were advanced to BC3F4 generation based on the results of DNA analyses and to PXO99 inoculation. Lines with positive signals indicated by the presence of the band were advanced and further selected for relevant traits relative to the recurrent parent.

Inoculation tests using the 9 races of BLB found in the Philippines, particularly for Race 6 (PXO99) were done in the screenhouse following the methodology presented by Sanchez et al (2000), with some modifications. Evaluation of lesion length and rating were done 2 weeks

after inoculation. Those with lesions longer than 6.0 cm were considered susceptible based on the National Cooperative Test (NCT) scale.

On-Station Yield Trials The lines were evaluated in 3 on-station

trials for at least 2 WS and 1 dry season (DS). Five panicles obtained from each uniform

line at the PN were evaluated in the first yield trial at the advanced observational nursery (AON). This non-replicated trial had 5-m long rows per entry planted in systematic plot arrangement. Lines were grouped by maturity date, and the yields were compared with those of the maturity checks, namely PSB Rc28 for Group I, PSB Rc30 for Group II, and PSB Rc18 for Group III. Seedlings were planted 20 x 20 cm and fertilizer was applied at 100-60-60 kg/ha of

N, P2O5 and K2O. Data gathered included the date at 50% flowering, plant height, number of productive tillers, maturity, general phenotypic uniformity, pest resistance, yield, and grain quality.

The best entries at the AON were elevated to the second yield trial, the preliminary yield trial (PYT), for at least 2 seasons. All entries including maturity check varieties were arranged in RCBD with 3 replications. Seedlings were transplanted in 5 rows, 5-m row plots at 20 x 20 cm distance and 2-3 seedlings per hill. Similar agronomic data as the AON were collected including the 1000-seed weight. Promising lines at the PYT were further advanced to the last on-station trial, the general yield trial (GYT) in three locations: Maligaya in Nueva Ecija (Central Luzon), San Mateo in

Isabela (Northern Luzon) and RTR in Agusan del Norte (Northern Mindanao). These trials were set in RCBD with 3 replications. Seedlings were transplanted in 15 rows, 5-m row plots. Distance of planting, fertilizer rate, other cultural management practices and data gathered were similar to those at PYT.

Table 1. Primers used in evaluating presence or absence of xa5, Xa21 and Om from Oryza minuta

Primers Used Primer Sequence R Genes for BLB

Gene Sources

PTA248 5’AGACGCGGAAGGGTGGTTCCCGGA3’

5’AGACCGGTAATCGAAAGATGAAAA3’

Xa21 IRBB5-21

RG556a 5’TAGCTGCTGCCGTGCTGTGC3’

5’AATATTTCAGTGTGCATCTC3’

xa5 IRBB5-21

OPL 13 5’ ACCGCCTGCT 3’ Om IR59183

All data gathered for all trials were subjected to analysis of variance while mean comparisons were based on the check variety. The lines were also evaluated for resistance to major pests and diseases, and grain quality following the general protocols in the National Cooperative Test (NCT) Manual (1996).

National Cooperative Yield Trials The elite lines were nominated to the NCT

after 2-3 seasons at the GYT. This had two

6

RE Tabien et al

phases: NCT Phase 1 conducted in 6 locations, and the multi-location adaptation trial (MAT) with 22 sites across the country. Each line had to complete 3 seasons, usually 1 DS and 2 WS before final evaluation. The best lines that had completed the MAT trials and been thoroughly deliberated by the National Rice Technical Working Group (RTWG) would be recommended to the NSIC (National Seed Industry Council) as a new variety (Tabien et al 2002). The trials were conducted following all the guidelines stated at the NCT Manual. Reactions to major pests and diseases like blast were gathered and grain physico-chemical analyses were also conducted following the NCT protocols.

Farmers’ Field Trials in Hotspot Areas Five elite lines found uniform, nearly

similar with the recurrent parent and found to have the pyramided Xa21 and xa5 based on MAS, were evaluated in farmers’ fields. These elite lines were: AR32-19-3-2, AR32-19-3-3, AR32-19-3-4, AR32-4-33-1 and AR32-4-58-2. The first three had IR64 background and the rest BPI Ri-10 background. These lines were tested in BLB hotspots in the provinces of Aurora and Nueva Ecija during the 2000 DS/WS, and in Northern/Eastern Samar, Ilocos Norte, Abra, Southern Leyte, Aurora, Nueva Ecija and Oriental Mindoro during the 2001/2002 WS. With each farmer-cooperator, at least 0.25 hectare irrigated land was allotted to the 5 entries for testing, replicated across sites and not within sites. All cultural management practices used were based on farmer-cooperator practices, except for fertilizer which was based on the recommendations of the Bureau of Soils and Water Management.

RESULTS & DISCUSSION

Evaluation of parentals, backcrossing and generation advance

The two donor parents, IRBB5-21 for xa5 and Xa21, and IR59183 for Om, were found highly resistant to 9 races while the recipient parents, IR64, PSB Rc14 and BPI Ri-10, had variable reactions to 2-3 races but were highly susceptible to the virulent race, PXO99. The first cross (donor x recipient) was done in the DS of 1995 using the 5 parentals. More than a dozen F1s for each cross combination were generated and backcrossed to the recurrent parent to keep the desirable traits. DNA

extracts from 2,394 BC3F3 plants were made and 893 were evaluated for the presence of the genes using DNA markers. Positive reaction or presence of the markers was obtained in 220 plants; consequently, these were advanced to the next generation. The last backcrossing was done in the 1996 WS while the genotypic selection using PCR-based markers was completed in the 1998 WS. After the last backcrossing, a total of 1,600 progeny rows were evaluated at PN for 3 years. An average of 44 plants/crosses were selected per season based on the phenotypic similarity with the recurrent parents.

The three popular varieties were good parents for yield and grain quality, although largely, elite lines at more advanced yield trials were from crosses involving BPI Ri-10. The BLB genes from IRBB5-21 and IR59183 were effective against most races and were fully expressed in subsequent advanced generation

Marker-aided selection (MAS) In the laboratory, DNA samples amplified

through PCR and resolved in agarose gel electrophoresis for fingerprinting, clearly separated desirable genotypes. Typical gel for Xa21 gene detection following the protocol for sequenced tagged sites (STS) is shown in Figure 2. The upper DNA band (at 1.4 kb size) indicates resistance or presence of Xa21 gene. An isoline, IRBB21, served as resistant check and IR24 variety as susceptible check

Around 114-185 lines per cross were retained for evaluation after MAS. This is way below the hundreds of lines kept following the conventional method. The RAPD DNA markers facilitated the identification of plants closely similar to the recipient parent. Only a quarter of the 893 materials with DNA were selected and advanced; in contrast, the population for advancement would have been more than 2,000 lines using the conventional method. This nearly 10% retention after MAS to pyramid genes saved a lot of resources. Conventionally, random plants would be advanced and a large number kept; in contrast, the RAPD data helped in lessening the number of lines for advancement.

The phenotypic resemblances of the lines and the recurrent parents during early generation were also observed and compared. In addition, the DNA markers linked to the resistance gene further reduced the materials

7

DNA Marker-Aided Selection Of Hybrid Rice 8

for subsequent selection. A total of 91% of the lines eliminated, thus greatly reducing the area needed to evaluate these lines. DNA markers also enhanced the identification of lines with desired gene combinations. These pyramided lines would have been difficult to isolate or screened out using the traditional inoculation and selection method (Tabien et al 2000), but the use of DNA markers improved the efficiency of selection. Lines with 2 to 4 Xa genes had been generated even without inoculation (Yoshimura

et al 1996, Huang et al 1997, Sanchez et al 2000, Borines 2001, Davierwala et al 2001, Singh et al 2001).

On-Station Yield Trials The materials generated in the past three

years are shown in Table 2. These are the elite lines selected after MAS. Increasing number was noted since uniformity was common in the later generation but the yield range was narrower and higher. Moreover, higher yields were obtained in more advanced yield trials due to strong selection pressure for higher yield. In 2002, more than 200 elite lines containing xa5 and/or Xa21 and Om were evaluated either at AON, PYT or GYT. These lines were closely similar to their recurrent parents (IR64, PSB Rc14 and BPI Ri-10) in terms of phenotype and grain quality.

Advanced Observational Nursery At the AON, 43 lines were evaluated in 2000

and 1/3 of the lines were comparable with or better than the check, PSB Rc28 (Table 2). The highest yield of 4.9 t/ha during WS was obtained from AR32-2-82-6, a progeny of IR64//IRBB5-21/PSB Rc14 cross. Five high-yielding lines were elevated to the next trial. In the DS trial, 8 lines were comparable with or better than PSB Rc18 and 12 were nearly similar with or better than PSB Rc28. Three lines, AR32-18-13-1,

AR32-3-7-4 and AR32-11-35-2, yielded more than 7 t/ha, but 9 high-yielding lines were elevated to the PYT. In the following year, the AON evaluated 67 lines, after which 4 elite lines were elevated to the PYT for 2002 WS. These lines were of excellent kernel quality, had high-yield potential and resistance to pests and diseases, specially BLB. They were: AR32-11-76-7-1-1-B-B-MB (PSB Rc14 background); AR32-11-83-3-7-2; AR32-11-83-5-3-2-2 and AR32-2-62-1-1-3 (BPI Ri10 background). In 2002, 300 uniform lines were evaluated and 12 lines out of 140 lines selected were elevated to the PYT. The highest WS yield (6.47 t/ha) was obtained from AR32-2-66-4-7-1 (BPI Ri10 type), while the highest DS yield 11.61 t/ha was from AR32-2-11-3 (BPI Ri10 type) (Table 3).

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 161 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16Legend: 1- IR 24; 2 – IRBB 21; 3 – AR32-19-3-4; 4 – AR32-19-3-3; 5 – AR32-19-3-2; 6 – AR32-4-58-2; 7 - AR32-4-33-1;

8 – AR32-13-50-2-1-2-2-B; 9 – AR32-2-66-1-3-1-B-B; 10 – AR32-11-76-9-2-1-B-B; 11 – AR32-4-5-2; 12 – AR32-4-5-3; 13 – AR32-3-57-4; 14 – AR32-2-84-2; 15 – AR32-1-5-2; 16 - Blank assay.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 161 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

1.4 kb1.3 kb

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 161 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16Legend: 1- IR 24; 2 – IRBB 21; 3 – AR32-19-3-4; 4 – AR32-19-3-3; 5 – AR32-19-3-2; 6 – AR32-4-58-2; 7 - AR32-4-33-1;

8 – AR32-13-50-2-1-2-2-B; 9 – AR32-2-66-1-3-1-B-B; 10 – AR32-11-76-9-2-1-B-B; 11 – AR32-4-5-2; 12 – AR32-4-5-3; 13 – AR32-3-57-4; 14 – AR32-2-84-2; 15 – AR32-1-5-2; 16 - Blank assay.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

1.4 kb1.3 kb

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16

Figure 2. Result of STS analysis using Xa21 primer. Lines with IR 64 background (lanes 3 & 4) and PSB Rc14 background (lane 10) showed that the Xa21 gene was successfully transferred from IRBB5-21.

RE Tabien et al

Preliminary Yield Trials In 2000 WS, 10 elite lines were evaluated

and 8 of these originated from BPI Ri-10. The yields during the WS were close to the highest-yielding check, PSB Rc28, and lines ranged from good to excellent in kernel quality. The highest yield was obtained from line AR32-11-32-3, a progeny of PSB Rc14/IRBB5-21. During the DS, the highest yield was obtained from the same line with 7.13 t/ha followed by 6.44 t/ha from a sister line, AR32-11-38-7-1, and by 6.15 t/ha from AR32-4-33-1, a line from a BPI Ri-10/IRBB5-21 cross. A total of 123 lines were evaluated during the 2001 trials and 11 high-

yielding lines were advanced to the GYT. In the WS, 33 lines had higher yields than BPI Ri-10 (4.96 t/ha), 26 surpassed PSB Rc14 (5.17 t/ha) while 22 lines out-yielded IR64 (5.25 t/ha). All entries were resistant to BLB and were of good to excellent grain quality. Among the entries evaluated at the PYT in 2002, 8 lines were found promising and were advanced to the GYT (Table 3). These lines had higher yields than the check variety, PSB Rc28 and were good to

excellent in kernel quality. AR32-11-76-1-2-2, AR32-11-83-3-3-3 and AR32-2-11-3 yielded more than 11 t/ha maturity of 123-128 days (Table 3).

General Yield Trials At the GYT in 2000, 5 elite lines were

evaluated in the WS and 10 elite lines in the DS. Three lines were from IR64/IRBB5-21 cross and the rest were from BPI Ri-10 and PSB Rc14 crosses. With consistent high yields, surpassing those of IR72, PSB Rc18 and PSB Rc30 for two seasons and being of good kernel quality, AR32-19-3-4 was elevated to the NCT Phase 1.

In 2001 DS, 11 elite lines were evaluated in

the GYT. Eight lines had yields ranging from 5.71 t/ha to 8.64 t/ha, significantly higher than those of the two check varieties (Table 4). In 2001 WS, 3 were dropped due to poor phenotype and grain quality, while 3 new lines were entered for testing. Seven lines out of 8 had higher yields than PSB Rc28 and IR72 for 2 seasons. Line AR32-4-5-2, with BPI Ri-10 background, was elevated to the NCT Phase 2002 DS because of consistent high yield,

Table 2. Breeding materials generated after backcrossing and marker-aided selection or gene transfer 2000-2002

Grain Yield Range (t/ha)

Trial Year Evaluated Lines

Selected lines

WS DS

Remarks

2000 863 183 - - 2 lines to AON

2001 264 500 - -

Pedigree Nursery (PN)

2002 500 300 - - 300 lines to AON

2000 43 36 3.0-6.0 1.7-7.0 9 lines to PYT

2001 67 14 1.0-5.0 2.0-7.0 12 lines to PYT

Advance Observational Nursery (AON)

2002 300 140 1.0-6.5 2.0-11.7 12 lines to PYT

2000 43 25 3.0-5.0 4.0-7.1 7 lines to GYT

2001 123 86 3.0-6.0 4.0-7.1 11 lines to GYT

Preliminary Yield Trial (PYT)

2002 60 55 3.0-6.0 4.0-7.2 8 lines to GYT

2000 15 11 4.7-5.4 5.0-7.0 1 line to NCT

2001 11 21 4.4-5.7 6.1-8.6 1 line to NCT

General Yield Trial (GYT)

2002 21 8 4.7-5.7 6.7-9.2 2 lines to NCT

9

DNA Marker-Aided Selection Of Hybrid Rice 1

excellent grain quality, very good phenotype, and resistance to insect pest and diseases,

There were 2

especially BLB.

5 elite lines evaluated in 2002 usin

Reaction of elite lines at different yield trials to 9 races of BLB

Re-evaluation of the elite lines for BLB

d races used in the

evaluation. However, the degree of resistance

varig PSB Rc30 and IR72 as check varieties,

and 2 were elevated to NCT Phase 1. All lines had significantly higher yields than PSB Rc30 for 2 seasons while 11 lines out-yielded IR72 in the DS. In the WS, 8 new lines from PYT were included and almost all elite lines had higher yields than IR72 and had good to excellent kernel quality (Table 4).

resistance showed that all lines had the desireresistance to most of the

Table 3. Grain yield (t/ha) of selected MAS derived lines at AON and PYT 2002

Line Genetic Background

DS WS Average

Elite lines at AON PSB Rc28 Check 8.06 2.67 5.36 AR32-7-20-1-10-1-B-B-MB PSB Rc14 7.00 6.41 6.70 AR32-2-66-A4-B-B-MB BPI Ri-10 8.58 5.38 6.98 AR32-11-9-15 PSB Rc14 7.75 5.27 6.51 AR32-8-82-1-2-2 PSB Rc14 8.41 5.13 6.77 AR32-7-129-1-6-1 PSB Rc14 7.50 4.97 6.23 AR32-11-76-5-1-1-1-B-B-MB PSB Rc14 7.05 4.95 6.00 AR32-11-83-6-1-2-2 PSB Rc14 7.09 4.95 6.02 AR32-11-83-3-7-1-B-B-MB PSB Rc14 7.80 4.87 6.33 AR32-15-28-3-3-1-3-B-B-MB IR64 9.20 4.68 6.94 AR32-6-71-4-3-1 PSB Rc14 7.09 4.20 5.64 Elite lines at PYT PSB Rc28 Check 9.80 4.36 7.08 AR32-2-2-84-2-6-2 BPI Ri-10 11.19 6.21 8.70 AR32-2-66-4-4-2 BPI Ri-10 10.40 5.65 AR32-11-9-1-1 PSB Rc14 10.19 5.19 AR32-14-63-1-1-2 IR64 10.17 5.00 AR32-2-2-3-3-3 BPI Ri-10 9.82 5.34 7.58 AR32-82-1-1-3 PSB Rc14 9.79 5.00 AR32-2-66-4-7-1 BPI Ri-10 9.72 6.47 AR32-11-83-1-1-3 PSB Rc14 9.54 6.14 AR32-4-58-2 BPI Ri-10 9.43 5.49 AR32-11-83-5-3-2-4 PSB Rc14 9.38 5.20 7.29 AR32-2-2-84-2-3-1 BPI Ri-10 9.15 5.95 7.55

8.02 7.69 7.58

7.39 8.09 7.84 7.46

ed. These differences could be attributed to the genes present in the elite line after several phenotypic selections had been made. Although these were found to have the 2 genes at the initial stage, segregation might have occurred between unlike genes, thus a line might contain just a single gene. Gene xa5 was mapped in chromosome 5 (Yoshimura et al 1995) while Xa21 was located in chromosome 12 (Ronald et al 1992); as such, the likelihood of their combination was very low. A typical xa5 reaction had been observed among the elite lines in various yield trials but 2-gene

0

RE Tabien et al 11

combinations were difficult to detect by just inoculation. It was only through MAS that we could separate lines with Xa21 alone from lines

with xa5 and Xa21 gene combinations. Combinations of 2 Xa genes showed better resistance than single genes in that all combinations of xa5 and Xa21 had shorter lesions for races 1 to 9. This confirms the previous reports on BLB gene pyramiding (Yoshimura et al 1995, Huang et al 1997, Sanchez et al 2000, Singh et al 2001, Davierwala et al 2001).

National Cooperative Trials Line AR32-19-3-4, with IR64 background,

was the first line selected and elevated to the NCT. This elite line was entered in the 2001 DS

d both for and WS trials and evaluate

Figure 3. Advanced BC lines, sister lines with IR64 background, AR32-19-3-3, AR32-19-3-4 and AR32-19-3-2 with BLB resistance planted in Nueva Ecija 2001 WS

transplanting and direct-seeding. Its agronomic traits and yield performances at various levels at the national testing are shown in Tables 5 and 6. The yield was higher than the check under transplanting but lower, although close to the check varieties, under direct-seeding. This line is one of the 5 lines being evaluated in BLB hotspot areas while being evaluated at NCT Phase 1. In the past 3 seasons, this line has had a consistent grain yield and resistance to BLB especially during the WS. At the MAT for final testing conducted in 22 sites, AR32-19-3-4

Figure 4. Advanced BC lines AR32-19-3-3 and AR32-19-3-4 with BLB resistance planted in Agusan del Norte 2001 WS (picture courtesy of Noel Mabayag)

DNA Marker-Aided Selection Of Hybrid Rice 1

ranked 4th among the group 2 entries, had higher yield than PSB Rc30, and was comparable to PSB Rc18 during the 2002 DS.

In 2002, 3 new elite lines, AR32-19-3-3 (IR 64 background), AR32-11-63-3 (PSB Rc14 background), and AR32-4-5-2 (BPI Ri-10 background), were elevated to the NCT Phase 1 bas

both xa5 and Xa21 genes known to be effective

om IR 64//IRBB5-21/PSB Rc14 population were found positive to Xa21 gene through STS analysis using Xa21 (reverse & forward) primer. These confirmed the

ation at ge with race 6. The 3

line

BLB for confirmation of resistance including

exhibited high resistance to 9 races (Table 7). The two

ited d 6, typical for a

line

ed on their higher yield potentials, having significantly out-yielded PSB Rc28 and PSB Rc30 at the GYT (Table 4). The new IR64- and PSB Rc14-derived lines were elevated to the NCT Phase 1 during the last DS while the improved BPI was advanced during the WS. Similar to the above lines, these 3 lines have

against 9 races of BLB, and have phenotypic acceptability closely similar to their recurrent parents. AR32-19-3-3 is a sister line of AR32-19-3-4, now at the MAT and similarly at the farmers’ yield tests.

Elite lines for farmers’ trials in BLB hot spot areas

In 2000, 10 elite lines were selected for DNA analyses. Three lines fr

resistance obtained through inoculmaximum tillering sta

s namely, AR32-19-3-4, AR32-19-3-3, and AR32-19-3-2, together with lines from BPI Ri10/IRBB5-21 namely, AR32-4-5-2 and AR32-4-5-8, were recommended for evaluation in farmers' fields where BLB had been generally observed. Phenotypic appearances of these elite lines are shown in Figures 3 and 4.

Reaction of 5 elite lines to 9 races of BLB, blast & other pests

The 5 lines planted in farmers’ fields were re-inoculated in the screenhouse with 9 races of

IRBB21 as resistant check and IR24 as susceptible check. All except 2 entries

Table 4. Yield of elite lines generated using marker-aided selection for BLB resistance at General Yield Trial 2002 WS and DS.

Yield (t/ha) Line Genetic Background

2002 DS 2002 WS

Average

PSB Rc30 (check) Check 6.81 3.30 5.05

IR72 (check) Check 8.04 3.64 5.84

AR32-4-5-2* BPI Ri10 7.68 4.80 6.24

AR32-2-84-2-10-2 BPI Ri10 8.28 4.61 6.44

AR32-2-2-1-3-3 BPI Ri10 8.02 4.16 6.09

AR32-2-66-5-6-1 BPI Ri10 8.24 4.35 6.03

AR32-19-3-3* IR64 7.44 4.74 6.09

AR32-7-129-1-2-2-B-15 PSB Rc14 8.04 4.31 6.17

AR32-11-83-1-4-1 PSB Rc14 9.21 5.05 7.13

AR32-11-76-5-3-3 PSB Rc14 8.56 4.08 6.32

*advanced to NCT I

lines, AR32-19-3-2 and AR32-4-33-1 exhibsusceptibility to races 2, 3 an

with xa5 gene alone. In a study to evaluate the blast resistance conducted at Maligaya by the Crop Protection Division of PhilRice, AR32-19-3-4 and AR32-19-3-3 exhibited an intermediate reaction compared with IR50, which showed susceptibility to rice blast, while the rest of the entries showed resistance (Rillon, personal communication). These two lines may

2

RE Tabien et al 13

not have retained the blast resistance gene in the recurrent parent, IR64. In various trials, these lines were found resistant to stemborer and sheath blight relative to PSB Rc28.

Grain Quality of 5 Elite Lines Results of grain quality tests conducted by

the Rice Chemistry and Food Science Division (Dante Aquino, Henry Corpuz, Rene Valdez,

personal communication) at PhilRice Maligaya showed that the 5 elite lines had grade 1 to premium head rice when milled,

showed that the 5 elite lines had grade 1 to premium head rice when milled, low to intermediate amylose content, medium to soft

ng recovery (Ta

-3-4 in the MAT (Table 9). The same 5 lines were also planted in Southern Leyte,

ija, Aur

B and sheath blight compared with the PSB

low to intermediate amylose content, medium to soft

ng recovery (Ta

-3-4 in the MAT (Table 9). The same 5 lines were also planted in Southern Leyte,

ija, Aur

B and sheath blight compared with the PSB

gel consistency, and premium milligel consistency, and premium millible 8). The data support the contention that

the grain qualities of the recurrent parents had been retained and the new trait, BLB resistance, had been added as shown above. Generally, millers prefer varieties that have high milling recovery, high percent head rice recovery, and slender grain shape that command higher prices. Consumers, on the other hand, demand rice like the IR64 when cooked.

Yield of 5 elite lines at farmers’ fields Seeds of 5 advanced elite lines were given to

farmers in Nueva Ecija and 2 sites in Aurora during the 2000 DS for evaluation. AR32-19-3-3 ranked 1st followed by AR32-19-3-4. AR32-19-3-3 is currently planted in the NCT Phase 1 and AR32-19

ble 8). The data support the contention that the grain qualities of the recurrent parents had been retained and the new trait, BLB resistance, had been added as shown above. Generally, millers prefer varieties that have high milling recovery, high percent head rice recovery, and slender grain shape that command higher prices. Consumers, on the other hand, demand rice like the IR64 when cooked.

Yield of 5 elite lines at farmers’ fields Seeds of 5 advanced elite lines were given to

farmers in Nueva Ecija and 2 sites in Aurora during the 2000 DS for evaluation. AR32-19-3-3 ranked 1

Eastern and Northen Samar, Nueva EcEastern and Northen Samar, Nueva Ecora and Oriental Mindoro during the 2001

and 2002 WS where BLB was prevalent (Table

9). The yield of the current NCT I entry, AR32-19-3-3, was highest followed by the sister line, which is currently at the MAT. Under favorable conditions, the same 2 lines had yields of 8-10 t/ha.

These lines were also planted at PhilRice Agusan and 2 farmers’ fields during the 2001 WS. Line AR32-19-3-2 obtained the highest yields in all 3 locations. Lower yields, however, were obtained at the farmers’ fields than at the PhilRice station due to heavy stemborer infestation. All lines tested were found resistant to BL

ora and Oriental Mindoro during the 2001 and 2002 WS where BLB was prevalent (Table

9). The yield of the current NCT I entry, AR32-19-3-3, was highest followed by the sister line, which is currently at the MAT. Under favorable conditions, the same 2 lines had yields of 8-10 t/ha.

These lines were also planted at PhilRice Agusan and 2 farmers’ fields during the 2001 WS. Line AR32-19-3-2 obtained the highest yields in all 3 locations. Lower yields, however, were obtained at the farmers’ fields than at the PhilRice station due to heavy stemborer infestation. All lines tested were found resistant to BL

Rc28 check variety. The 2 sister lines now under the national

testing consistently had higher yields in most locations, proving that in these lines the target genes were transferred during backcrossing, the

Rc28 check variety. The 2 sister lines now under the national

testing consistently had higher yields in most locations, proving that in these lines the target genes were transferred during backcrossing, the

st followed by AR32-19-3-4. AR32-19-3-3 is currently planted in the NCT Phase 1 and AR32-19

Table 4. Yield of elite lines generated using marker-aided selection for BLB resistance at General Yield Trial 2002 WS and DS.

Yield (t/ha) Line Genetic Background

2002 DS 2002 WS

Average

PSB Rc30 (check) Check 6.81 3.30 5.05

IR72 (check) Check 8.04 3.64 5.84

AR32-4-5-2* BPI Ri10 7.68 4.80 6.24

AR32-2-84-2-10-2 BPI Ri10 8.28 4.61 6.44

AR32-2-2-1-3-3 BPI Ri10 8.02 4.16 6.09

AR32-2-66-5-6-1 BPI Ri10 8.24 4.35 6.03

AR32-19-3-3* IR64 7.44 4.74 6.09

AR32-7-129-1-2-2-B-15 PSB Rc14 8.04 4.31 6.17

AR32-11-83-1-4-1 PSB Rc14 9.21 5.05 7.13

AR32-11-76-5-3-3 PSB Rc14 8.56 4.08 6.32

*advanced to NCT I

DNA Marker-Aided Selection Of Hybrid Rice 1

genes that increase resistance to BLB. These genes gave the high BLB resistance observed by farmers in trial sites. Furthermore, these lines had resistance to stemborer and sheath blight in som

ization to combine the 3 BLB genes started in 1999. Four crosses were made from

IR64 and BPI Ri-10 backgrounds during the DS,

es were ma . From the F2 population, 163

gen

newly approved hybrid var

e sites.

Other uses of MAS-generated elite lines

a) Pyramiding 3 or more BLB & other resistance genes The elite lines generated with 1-2 genes

were now in 3 desirable genetic backgrounds;

thus, hybrid

4

elite lines with the xa5, Xa21 and Om genes in

and 10 additional crosses using other linde during the WS plants were selected for advancement. In

2000, 14 crosses involving BPI Ri10, IR64 and PSB Rc14 were generated and another 52 new pyramided crosses were done in 2001. During the 2002 trials, 75 new crosses to combine 3 genes (xa5, Xa21, Om gene) were further added.

These elite lines were also crossed to ‘Matatag’ lines to combine BLB and tungro resistance, and later, with introduction of blast genes in the same genetic background. Eleven crosses have been completed and are ready for generation advance.

Released hybrid rices are highly susceptible to BLB. To improve their resistance, the same

es under study were also transferred to parentals of hybrids. Three BLB genes including Xa21 were transferred and combined using MAS in several maintainers (Borines 2001). Two

restorers, IR60819R and IR62161R, the parental lines of

ieties found susceptible to race 6 in the screenhouse inoculation, are currently being improved. These restorers have been crossed to 4 elite lines containing xa5 and Xa21 genes for BLB resistance.

Being good recipients of important genes especially the lines with IR64 background, the 2 lines at the NCT are currently being used in transformation, hybrid rice breeding and anther culture projects (PhilRice breeders, personal

Table 5. Grain yield and agronomic data of selected MAS derived lines either at NCT or MAT 2002

Parameter Yield (t/ha)

Maturity (days)

Plant Height (cm)

Productive tillers

Group I1

AR32-19-3-3 7.44* 113 100 16

AR32-11-63-3 8.41* 118 111 16

AR32-19-3-4 5.81** 117 89 17

PSB Rc18 (ck) 5.84 123 102 16

PSB Rc30 (ck) 5.63 121 93 17

Group II2

AR32-4-5-2 5.22* 102 76 150@

PSB Rc28 (ck) 6.34 106 86 133@

AR32-19-3-4 5.90** 105 82 143@

PSB Rc18 (ck) 5.98 114 93 140@

PSB Rc30 (ck) 5.43 113 84 130@

*Average of 6 locations, **Average of 22 locations, 1Group I – belongs to medium maturing lines/Transplanted, 2Group II – belongs to early maturing lines/Direct-seeded, @Number of tillers per linear meter

RE Tabien et al 1

communication), to improve further resistance qualities.

b)

IR64 background developed by PhilRice, now in farmers’ fields (Tabien et al

2001a), were evaluated for 3 seasons. Pure

hig

ssisted

selection clearly indicate the bright prospects of DNA markers in imp

s

are

India (Singh et al 200

Elite lines in the development of multi-lines Through collaboration with ARBN scientists

in the development of multi-lines with IR64 background for BLB control, Bio 1 containing xa5 and and Bio 2 containing Xa7 from Indonesia (Bustamam et al 2002) and 3 lines also with

5

stands of 2 lines in the NCT had significantlyher yields than those of IR64 and PSB Rc28

and the combinations of original susceptible IR64 with improved IR64 in 1:1 ratio had nearly comparable yields due to higher BLB resistance, and the grain qualities were typical of the pure IR64 (Tabien et al 2003, in preparation).

BREEDING IMPLICATIONS

The elite lines developed are the first successful products of MAS in rice reported from the Philippines. They are nearing the varietal-release stage. The elite lines have retained most of the traits of the recurrent parent as well as added new traits through marker-a

and backcrossing. The results

roving popular released variety like IR64. The above lines developed through MAS are

not only potential candidates for varietal release but are themselves already a genetic resource, germplasm available for various uses. As shown above, these can be useful in combining genes in the same background, for the development of multi-lines and a recipient of new genes in transformation. Furthermore, since the gene

Table 6. Yield of MAS derived elite lines with BLB resistance at GYT or NCT phase I

Yield(t/ha)/Season Remarks Lines

2001 WS 2002 DS

AR32-19-3-3*** 5.70a 7.44 a at 2nd season in NCT -I

AR32-11-63-3*** 5.52a 8.41a at 2nd season in NCT -I

AR32-4-5-2** 5.30a 7.68a at NCT-I in 2003 DS

PSB Rc30 Na 6.81a Yield Check

PSB Rc28 4.57a na GYT check

NCT -Phase 1*

AR32-19-3-4 4.67b 5.90b 2nd season in MAT

PSB Rc18 5.24b 5.98b Yield Check

PSB Rc30 na 5.43b Yield Check

na – yield data not available, **direct seeded trial only, ***transplanted and direct seeded trial. a - average yield at the General Yield Trial, b- average yield at the NCT Phase 1

now in highly desirable genetic backgrounds unlike the other released isolines, these are perfect parentals in crosses aimed at further improving varieties or getting the desirable traits from these parentals.

Thus, MAS has facilitated the identification of desirable lines. From the initial crosses done in 1995, the first elite lines were in the first yield trials after 8 seasons. These were at the BC3F4 generation but resembled the parentals in phenotypic appearance. It was at the same generation that elite lines were obtained in the improvement of PR106 of

1). Moreover, these lines have the genes of interest. In the conventional approach, a large number of crosses would have had to be made in each backcross generation; MAS reduced them

DNA Marker-Aided Selection Of Hybrid Rice 1

to a few but well-directed pairings. As can be seen in the RAPD data, these are specific lines having more of the recurrent parent genotype.

Combining several genes, or gene pyramiding, has been known to enhance durability of resistance. However, these gene combinations are difficult to detect using the

AcknowleThe authors would like to thanks ARBN-IRRprovincial and municipal agriculturists in the co

con

dI nd demita for

technical help, and the NCT staff for summary data.

aguna, 163p Thesis (PhD), University of the Philippines Los Baños

Bustamam M, RE Tabien, Suwarno, MC I Oña, M Bernardo, CM Vera Cruz & H Leung. 2002. Asian Rice Biotechnology Network: Improving popular cultivars through marker-

Che hang. 2002. New gene for bacterial blight resistance in rice located on

Dav

Del 993. A plant DNA mini-preparation: version II. Plant Molecular

Gao

Newsletter 18: 66-68

CT staff for summary data.

aguna, 163p Thesis (PhD), University of the Philippines Los Baños

Bustamam M, RE Tabien, Suwarno, MC I Oña, M Bernardo, CM Vera Cruz & H Leung. 2002. Asian Rice Biotechnology Network: Improving popular cultivars through marker-

Che hang. 2002. New gene for bacterial blight resistance in rice located on

Dav

Del 993. A plant DNA mini-preparation: version II. Plant Molecular

Gao

Newsletter 18: 66-68

ventional methods of screening. Gene Xa21, when combined with xa5, is difficult to identify through inoculation tests. In contrast, the markers linked to the genes are very useful in selecting genotypes with accuracy, as earlier reported by Sanchez et al (2000) and Singh et al (2001), and as observed in this study.

gement for financial support, the farmer-cooperators, uct of the field trials, Dr Rhodora Al

Table 7. Reaction of five elite lines to 9 races of bacterial leaf blight and blast nursery reaction 2001

BLB Races Blast 1 2 3 4 5 6 7 8 9

Lines Genetic Background

*Lesion length (cm) IR24 BLB S check 31 24 16 24 11 21 8 28 19 R IRBB21 BLB R check 5 2 2 2 3 5 3 5 3 R AR32-4-33-1 BPI Ri-10 5 8 9 8 2 15 3 2 6 R AR32-4-58-2 BPI Ri-10 1 7 6 3 1 6 1 2 4 R AR32-19-3-2 IR64 4 13 14 7 3 19 3 7 5 R AR32-19-3-3 IR64 1 4 2 2 1 4 1 2 2 I AR32-19-3-4 IR64 2 8 9 1 5 6 1 2 1 I IR64 Blast R check - - - - - - - - - R BPI Ri-10 Blast R check - - - - - - - - - R IR50 IR 50 - - - - - - - - - S

*Scale: less than 6 cm – R; more than 6 cm – S, **Average of 5 replication (5 plants) 3 leaves/plant

REFERENCES REFERENCES

Borines LM. 2001. Marker-aided pyramiding of bacterial blight resistance genes in maintainer lines of rice (Oryza sativa L.) hybrids. Los Baños, L

Borines LM. 2001. Marker-aided pyramiding of bacterial blight resistance genes in maintainer lines of rice (Oryza sativa L.) hybrids. Los Baños, L

Abalos, TS Kadir,Abalos, TS Kadir,

assisted backcrossing by the NARES. Poster presented at the International Rice Congress, Beijing, China. 16-20 Sept 2002 n HL, SP Wang & QF Z

assisted backcrossing by the NARES. Poster presented at the International Rice Congress, Beijing, China. 16-20 Sept 2002 n HL, SP Wang & QF Zchromosome 12 identified from Minghui 63, and elite restorer line. Phytopathology 92(7): 750-754 ierwala AP, AP Reddy, MD Lagu, PK Ranjekar & VS Gupta. 2001. Marker assisted selection of bacterial blight resistance genes in rice. Biochemical Genetics 39(7/8): 261-278 laporta SL, J Woo & JB Hicks. 1

chromosome 12 identified from Minghui 63, and elite restorer line. Phytopathology 92(7): 750-754 ierwala AP, AP Reddy, MD Lagu, PK Ranjekar & VS Gupta. 2001. Marker assisted selection of bacterial blight resistance genes in rice. Biochemical Genetics 39(7/8): 261-278 laporta SL, J Woo & JB Hicks. 1Biology Reports 1:19-21 DY, ZG Xu, ZY Chen, LH Sun, QM Sun, F Lu, BS Hu, YF Liu & LH Tang. 2001. Identification of Biology Reports 1:19-21 DY, ZG Xu, ZY Chen, LH Sun, QM Sun, F Lu, BS Hu, YF Liu & LH Tang. 2001. Identification of a new gene for resistance to bacterial blight in a somaclonal mutant HX-3 (indica). Rice Genetics a new gene for resistance to bacterial blight in a somaclonal mutant HX-3 (indica). Rice Genetics

6

RE Tabien et al 1

Hua Bennett &

PCR. Theoretical & Applied Genetics 95(3): 313-320

Kin rt of the committee on gene symbolization, nomenclature, and linkage

Lin156-1159

:1029-1032

Ron K Wu, S McCouch & S Tanksley. 1992. Genetic and

001. Pyramiding

Tab los, MG Padilla, RC San Gabriel, YA Dimaano, JBA Duldulao, MJC Casayuran

riculture

ng N, ER Angeles, J Domingo, G Magpantay, S Singh, G Zhang, N Kumaravadivel, J GS Khush. 1997. Pyramiding of bacterial blight resistance genes in rice: marker-assisted selection using RFLP and

Khush GS & T Kinoshita. 1991. Rice karyotype, marker gene and linkage groups. In GS Khush & GH Toenniessen (ed). Rice Biotechnology. CABI Int Wallingford, UK, pp83-108 oshita T. 1995. Repogroups. Rice Genetics Newsletter 12:9-153

XH, DP Zhang, YF Xie, HP Gao & Q Zhang. 1996. Identifying and mapping a new gene for bacterial blight resistance in rice based on RFLP markers. Phytopathology 86:1

Table 8. Physico-chemical analysis of 5 elite lines with bacterial leaf blight resistance 2001 WS

Lines Analysis

AR32-4-33-1 (BPI RI10

back-ground)

AR32-4-58-2 (BPI-RI10

back-ground)

AR32-19-3-4 (IR64 back-

ground)

AR32-19-3-3 (IR64 back-

ground)

AR32-19-3-2 (IR64 back-

ground)

IR64 variety

Grain Size (mm) 6.10 6.4 6.60 6.54 6.64 6.5

Grain Shape (mm) 3.0 3.2 3.1 3.1 3.1 3.1

Head Rice % 58.74 56.94 58.70 57.31 56.68 48.38

Chalky Grains % 23.30 13.24 10.80 11.42 11.98 -

Gel Temperature 4.33 L/HI 6.75 L/I 4.17 L/I/HI 3.50 L/I/HI 3.50 HI/I 3.50 HI/I

Crude Protein % 8.13 8.30 7.88 7.32 7.36 -

Gel Consistency* 90.0 43.0 56.0 54.0 65.0 67

Moisture content % 11.47 11.46 11.18 11.30 11.50 12.1

Amylose % 11.78 18.16 18.16 18.24 17.29 23.22

Milling Recovery % 66.87 71.62 71.05 70.88 70.87 69.25

Grain Size (mm): 6.60-7.49 - Long; 5.50-6.59 - Medium; 5.49 below - Short. Grain Shape (mm): 3.10 above - Slender; 2-3 - Intermediate; 1.99 below - Bold. Head Rice %: 71% above - Premium; 65%-70% - Grade 1. Chalkiness: 11.80-23.30 – Grade 3. Gel consistency: 25-40 – Hard; 41-60 – Medium; 61-100 – Soft. Amylose %: 10.1-20 - Low; 20.1-25 - Intermediate; 25% above - High. Milling Recovery%: 70.1% above - Premium; 65.1-70% - Grade 1

Mew TW, CM Vera Cruz & ED Medella. 1992. Change in gene frequency of Xanthomonas oryzae pv oryzae in response to planting of rice cultivars in the Philippines. Plant Diseases 76

National Cooperative Testing Guidelines. 1996. Philippine Rice Research Institute ald PC, B Albano, RE Tabien, L Abenes, physical analysis of the rice bacterial blight disease resistance locus, Xa21. Molecular Genetics 236:113-120

Sanchez A, C Brar, DS Huang, N Li & Z Khush, G S. 2000. Sequence tagged site marker-assisted selection for three bacterial blight resistance genes in rice. Crop Science 40(3): 792-797

Singh S Sidhu, JS Huang, N Vikal, Y Li, Z Brar, DS Dhaliwal & HS Khush, GS. 2three bacterial blight resistance genes (xa5, xa13 and Xa21) using marker-assisted selection into indica rice cultivar PR106. Theoretical & Applied Genetics 102(6/7): 1011-1015 ien RE, MC Aba& LSS Sebastian. 2001a. Transplanted lowland rice with xa-5 and Xa-21 genes for bacterial blight pathogen, Xathomonas oryzae pv. oryzae. Poster presented at the Asian AgCongress, Manila, Philippines, April 24-27, 2001

7

Table 9. Grain yield (t/ha) of 5 MAS derived lines in farmers’ field 2001-2002.

Elite Lines Location/Season

AR32-19-3-4*

AR32- 19-3-3**

AR32-19-3-2

AR32-

4-33-1

AR32-

4-58-2

2000 DS

Buhangin, Baler, Aurora 6.43 7.70 5.56 4.36 4.12

Calabuanan, Baler, Aurora 5.90 6.65 3.25 4.50 7.80

La Torre, Talavera, Nueva Ecija 5.16 8.50 5.77 5.00 5.55

Average 5.83 7.62 4.86 4.62 5.82

2001 WS

Northern Samar 6.54 6.07 3.30 6.90 5.35

Baler, Aurora 6.16 7.17 4.40 4.43 5.96

Ilocos, Norte 4.80 4.91 5.14 6.21 5.89

Abra 4.24 3.28 3.28 3.68 3.32

San Jorge, Samar 3.08 2.84 2.68 2.83 2.25

Maligaya, Nueva Ecija 5.16 8.50 5.77 5.00 5.55

Average 4.99 5.46 4.09 4.84 4.72

2002 WS

Cabanatuan City, Nueva Ecija 8.23 8.23 6.16 6.16 8.23

James Samson Nueva Ecija 5.0 5.0 - - 5.14

St. Rosa, Nueva Ecija 4.60 5.28 - - 5.31

Alfredo Mateo Nueva Ecija 5.67 5.99 - - 4.86

Southern Leyte 4.16 3.66 4.26 3.30 3.78

Eastern Samar 8.30 10.0 6.30 7.60 8.0

Baler, Aurora - 5.20 - - 4.50

Or. Mindoro 3.72 5.03 3.84 6.86 5.83

Average 5.66 6.04 5.14 5.98 5.70

Average across season (t/ha) 5.5 6.4 4.7 5.1 5.0

* MAT entry, ** NCT I entry

Tabd Planning

Tab

ien RE, MC Abalos, MG Padilla & B Tadly. 2001b. Improving resistance of PSB rice varieties to bacterial blight. Poster presented at the 14th National Rice R&D Review anWorkshop, March 7-9 2001. PhilRice, Maligaya, Science City of Muñoz, Philippines ien RE, MC Abalos, MG Padilla & B Tadly. 2001c. Use of DNA Marker Technology in Rice Improvement. In Philippine Rice R&D Highlights 2001. Philippine Rice Research Institute. pp 35-37

Tabien RE & LS Sebastian. 2000. Improving resistance to bacterial leaf blight at the Philippine Rice Research Institute. Paper presented at the International Rice Genetics Conference, Oct.23-27 2000. IRRI, College, Laguna

Tabien RE, TF Padolina, HC de la Cruz, ER Corpuz, J Fariñas. 2002. New NSIC rive varieties for

DNA Marker-Aided Selection Of Hybrid Rice 18

RE Tabien et al 1

cool elevated, saline prone and upland areas of the Philippines. Plenary paper presented at the 15th National Rice R&D Review and Planning Workshop, April 10-12, 2002. PhilRice, Maligaya,

Tabf blight resistance. Paper presented at the 13th National Rice R&D

Yos

1(4): 375-387

Science City of Muñoz, Philippines ien RE, MC Abalos, YA Dimaano, LR Hipolito, DA Tabanao & LS Sebastian. 2000. Marker-aided derived lines for bacterial leaConference. March 1-32000. PhilRice, Muñoz, Nueva Ecija, Philippines himura S, A Yoshimura, N Iwata, SR McCouch, ML Abenes, MR Baraoidan, TW Mew & RJ Nelson. 1995. Tagging and Combining Bacterial Blight Resistance Genes in Rice Using RAPD and RFLP Markers. Molecular Breeding

9