DNA Structure and Function

Chapter 12

Discovery of DNA

Nucleic Acids were discovered in 1869 by Friedrich Mieschner as a substance contained within nuclei

1929 Phoebus Levene discovered that DNA was a polymer of nucleotides

During the ’30s & 40’s proteins rather than DNA was thought to hold genetic information

Griffith Discovers Transformation 1928 Attempting to develop a vaccine Isolated two strains of Streptococcus

pneumoniaeRough strain was harmlessSmooth strain was pathogenic

1. Mice injected with live cells of harmless strain R.

2. Mice injected with live cells of killer strain S.

3. Mice injected with heat-killed S cells.

4. Mice injected with live R cells plus heat-killed S cells.

Mice die. Live S cells in their blood.

Mice live. No live R cells in their blood.

Mice die. Live S cells in their blood.

Mice live. No live S cells in their blood.

Transformation

Transformation

What happened in the fourth experiment? The harmless R cells had been

transformed by material from the dead S cells

Descendents of the transformed cells were also pathogenic

Why?

Oswald & Avery

What is the transforming material? Cell extracts treated with protein-digesting

enzymes could still transform bacteria Cell extracts treated with DNA-digesting

enzymes lost their transforming ability Concluded that DNA, not protein,

transforms bacteria

Bacteriophages Viruses that infect

bacteria Consist of protein and

DNA Inject their hereditary

material into bacteria cytoplasm

bacterial cell wall plasma

membrane

Figure 13.4bPage 219

Hershey & Chase’s Experiments

Created labeled bacteriophagesRadioactive sulfur – Labels ProteinsRadioactive phosphorus – Labels Nucleic Acids

Allowed labeled viruses to infect bacteria Asked: Where are the radioactive labels after

infection?

Hershey – Chase Experiment

What is DNA?

DNA is a Nucleic Acid Polymer of Nucleotides Each nucleotide consists of

Deoxyribose (5-carbon sugar) Phosphate groupA nitrogen-containing base

Four basesAdenine, Guanine, Thymine, Cytosine

Nucleotide Structure

Composition of DNA

Chargaff showed:Amount of adenine relative to guanine differs

among species

Amount of adenine always equals amount of

thymine and amount of guanine always

equals amount of cytosine

A=T and G=C

Rosalind Franklin’s Work

Was an expert in X-ray crystallography Used this technique to examine DNA fibers Concluded that DNA was some sort of helix

Watson-Crick Model

DNA consists of two nucleotide strands:

Double Helix Strands run in opposite directions - Antiparallel Strands are held together by hydrogen bonds

between bases A binds with T and C with G The sides of the ladder are a sugar-phosphate

backbone, while the “rungs” of the ladder are the bases

DNA is antiparallel

The four bases of DNA are:

Adenine (A) Guanine (G) Thymine (T) Cytosine (C)

Adenine always hydrogen bonds with Thymine (A-T)

Guanine always hydrogen bonds with Cytosine (G-C)

These bonding patterns are called base pairings (bp)

Base-pairing rule

The pattern of base pairing is the mechanism by which DNA holds information.

Humans have a > 6 billion of these base pairings

Less than 5% of our DNA actually forms genes

There about 30,000 genes encoded in our DNA, nearly half of these genes either have yet to be discovered or their function is unknown

DNA is written out like this:

CTCGAGGGGCCTAGACATTGCCCTCCAGAGAGAGCACCCAACACCCTCCAGGCTTGACCGGCCAGGGTGTCCCCTTCCTACCTTGGAGAGAGCAGCCCCAGGGCATCCTGCAGGGGGTGCTGGGACACCAGCTGGCCTTCAAGGTCTCTGCCTCCCTCCAGCCACCCCACTACACGCTGCTGGGATCCTGGA

DNA replication

Before mitosis and meiosis, all of the DNA in the cell must be copied or replicated

How does this happen?

How does DNA replicate?

Possibilities:

DNA Replication

The mechanism by which DNA is replicated is considered semi-conservative

Semi-conservative replication: Half of the original parent DNA molecule is conserved in each of the daughter molecules.

This allows for the parent DNA to serve as a template for generating the daughter DNA molecules

Half of the replicated DNA strand is “old” and the other half is “new”

newnew old old

DNA Replication Semi-

Conservative

Basepairing During Replication

• Each old strand serves as a template for the new complementary strand

Enzymes Required for Replication

Helicase: “Melts” or opens up the double strand so that the DNA is single stranded

DNA polymerase: multiple types, responsible for the actual synthesis of DNA

Ligase: Joins together small newly synthesized pieces of DNA called Okazaki fragments

Primase: Adds an RNA primer so that DNA synthesis can begin

• DNA is synthesized 5’ to 3’

• Energy for synthesis comes from the removal of the two phosphates of the in coming nucleotide

DNA Replication

DNA Replication

Since DNA is antiparallel, synthesis occurs in opposite directions

One strand in continuously synthesized - leading strand (5’3’)

The other is synthesized in short discontinuous strands - lagging strand (3’5’)

Because of this DNA synthesis is called Semidiscontinuous

DNA Replication

DNA Replication

DNA Replication: Fast & Accurate!

It takes E. coli <1 hour to copy 5 million base pairs in its single chromosome & divide to form 2 identical daughter cells

Human cell copies its 6 billion bases & divide into daughter cells in only few hours

Remarkably accurateonly ~1 error per 100 million bases~30 errors per cell cycle

DNA Repair

Mistakes can occur during replication DNA polymerase can read correct

sequence from complementary strand and, together with DNA ligase, can repair mistakes in incorrect strand