+ All Categories
Home > Documents > DNA Typing

DNA Typing

Date post: 24-Jan-2016
Category:
Upload: bracha
View: 33 times
Download: 0 times
Share this document with a friend
Description:
DNA Typing. bsapp.com. bsapp.com. DNA strands come from the nucleus or the mitochondria. bsapp.com. DNA Strands. Building block of genetic makeup A complete copy of an individuals entire genome exist in nearly every cell Each persons genome is made up of billions of base pairs - PowerPoint PPT Presentation
Popular Tags:
23
DNA Typing DNA Typing bsapp.com bsapp.com
Transcript
Page 1: DNA Typing

DNA TypingDNA Typing

bsapp.combsapp.com

Page 2: DNA Typing

bsapp.combsapp.com

Page 3: DNA Typing

DNA strands DNA strands come from the come from the nucleus or the nucleus or the mitochondriamitochondria

bsapp.combsapp.com

Page 4: DNA Typing

DNA StrandsDNA StrandsBuilding block of genetic makeup Building block of genetic makeup A complete copy of an individuals A complete copy of an individuals

entire genome exist in nearly entire genome exist in nearly every cell every cell

Each persons genome is made up Each persons genome is made up of billions of base pairsof billions of base pairs

Most base pairs are “junk” DNAMost base pairs are “junk” DNAbsapp.combsapp.com

Page 5: DNA Typing

DNA is made up DNA is made up of chromosomes of chromosomes

which contain which contain matching genes matching genes

called allelescalled alleles

bsapp.combsapp.com

Page 6: DNA Typing

Base pairs exist at Base pairs exist at the basic level of the basic level of

DNADNA

bsapp.combsapp.com

Page 7: DNA Typing

Base PairsBase Pairs

AdenineAdenineThymineThymineGuanineGuanineCytosine Cytosine

bsapp.combsapp.com

Page 8: DNA Typing

Variable Number Tandem Variable Number Tandem RepeatersRepeaters (VNTR) (VNTR)

Portions of DNA sequences are repeatedPortions of DNA sequences are repeatedThese repetitions vary among individualsThese repetitions vary among individuals

CACATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATTGC

bsapp.combsapp.com

Page 9: DNA Typing

Forensic DNA Testing Forensic DNA Testing

Only one-tenth of a percent of DNA Only one-tenth of a percent of DNA differs from one human to the next differs from one human to the next

This still leaves millions of bases to This still leaves millions of bases to analyze for differences analyze for differences

bsapp.combsapp.com

Page 10: DNA Typing

Types of DNA Testing Types of DNA Testing PCR PCR

(Polymorphism Chain Reaction) (Polymorphism Chain Reaction) RFLP RFLP

(Restriction Fragment Length (Restriction Fragment Length Polymorphism)Polymorphism)

STR STR (Short Tandem Repeat)(Short Tandem Repeat)

mtDNAmtDNA(Mitochondrial DNA Analysis) (Mitochondrial DNA Analysis)

bsapp.combsapp.com

Page 11: DNA Typing

PCR PCR (Polymorphism Chain Reaction)(Polymorphism Chain Reaction)

Doesn't accomplish DNA typingDoesn't accomplish DNA typingIncreases the amount of DNA Increases the amount of DNA

available for typing by producing available for typing by producing millions of copiesmillions of copies

Use to amplify tiny quantities and Use to amplify tiny quantities and degraded samples degraded samples

Extremely sensitive to contaminationExtremely sensitive to contaminationbsapp.combsapp.com

Page 12: DNA Typing

Basic Procedure for Basic Procedure for TypingTyping

bsapp.combsapp.com

Page 13: DNA Typing

DNA is cut into different size DNA is cut into different size VNTR’s by the use of restriction VNTR’s by the use of restriction

enzymesenzymes

bsapp.combsapp.com

Page 14: DNA Typing

Fragments Fragments are placed on are placed on

a gel platea gel plate

bsapp.combsapp.com

Page 15: DNA Typing

Fragments are separated by Fragments are separated by electrophoresiselectrophoresis

bsapp.combsapp.com

Page 16: DNA Typing

The DNA is then transferred from The DNA is then transferred from the gel plate and made visible the gel plate and made visible

bsapp.combsapp.com

Page 17: DNA Typing

RFLP RFLP (Restriction Fragment Length Polymorphism)(Restriction Fragment Length Polymorphism)

Oldest/Cheapest testOldest/Cheapest testRequires large amounts of non-Requires large amounts of non-

degraded DNAdegraded DNAUtilizes the longer sequences of Utilizes the longer sequences of

VNTR’sVNTR’s

bsapp.combsapp.com

Page 18: DNA Typing

STR (Short Tandem Repeat) or STR (Short Tandem Repeat) or SSR (Simple Sequence Repeats)SSR (Simple Sequence Repeats)

Used to evaluate specific regions (loci) Used to evaluate specific regions (loci) of DNA strandsof DNA strands

Utilizes shorter stands than VNTR’sUtilizes shorter stands than VNTR’sMay by used on much smaller, older, May by used on much smaller, older,

and more degraded samplesand more degraded samplesUsually requires PCR prior to testingUsually requires PCR prior to testing

bsapp.combsapp.com

Page 19: DNA Typing

mtDNAmtDNA (Mitochondrial DNA)(Mitochondrial DNA)

Uses DNA from a cellular organelle called Uses DNA from a cellular organelle called a mitochondriona mitochondrion

Mitochondrial DNA degrades at a much Mitochondrial DNA degrades at a much slower rate than nuclear DNAslower rate than nuclear DNA

Allows analysis of older biological Allows analysis of older biological samples, such as hair and bonessamples, such as hair and bones

Not as precise as STRNot as precise as STRExtremely expensive and time consumingExtremely expensive and time consuming

bsapp.combsapp.com

Page 20: DNA Typing

Reading DNA TestsReading DNA Tests

bsapp.combsapp.com

Page 21: DNA Typing

bsapp.combsapp.com

Page 22: DNA Typing

bsapp.combsapp.com

Page 23: DNA Typing

bsapp.combsapp.com


Recommended