DNA

DNA

• must carry information• must be replicatable (inheritance)• must be changeable (mutation)

DNA

DNA structure

deoxyribonucleic acid - two directional polynucleotide strands in a double helix

A brief digression for terminology:

O

C

CC

C4 1

23

Carbon moleculesin rings are numbered….

C5

two directional polynucleotide strands in double helix

start with a ribosesugar…

two directional polynucleotide strands in double helix

start with a ribosesugar…

remove an oxygen atcarbon 2’….

two directional polynucleotide strands in double helix

start with a ribosesugar…

remove an oxygen atcarbon 2’…. add a phosphate group at 5’ side

add a nitrogenous base at 1’ side= a nucleotide

two directional polynucleotide strands in double helix

A nucleotide, or base

Bases = purines (adenine, guanine) and pyrimidines (cytosine, thymine)

5’ end

3’ end

nucleotides are linked in chains with a phosphodiester bondfree ends of chain will have 5’ phosphate at one end,

3’ hydroxyl at the other end

two directional polynucleotide strands in double helix

phosphodiesterbond

5’ end

3’ end

nucleotides are linked in chains with a phosphodiester bondfree ends of chain will have 5’ phosphate at one end,

3’ hydroxyl at the other end

two directional polynucleotide strands in double helix

two directional polynucleotide strands in double helixHydrogen bonds

Two strands pair up, nucleotides linked with hydrogen bondsadenosine pairs with thyminecytosine pairs with guanine

two directional polynucleotide strands in double helix

Two strands pair up, nucleotides linked with hydrogen bondsadenosine pairs with thyminecytosine pairs with guanine

- abbreviated as “base pairs”

two directional polynucleotide strands in double helix

two directional polynucleotide strands in double helix

Strands have polarity - 5'-hydroxyl group of first nucleotide at one end, 3'-hydroxyl group at other end (5’ to 3’ strand)

Strands run antiparallel: (5' -> 3') ATGGAATTCTCGCTC    (3' <- 5') TACCTTAAGAGCGAG

DNA replication: two strands are both available as templates for new strand result is doubling (2 complete new double helices)

DNA replication: is semiconservative always occurs in 5’ to 3’ direction

DNA replication: occurs at multiple replication forks (bubbles) along the DNA strand

Important:

there are several DNA polymerases involved in replication DNA polymerases have a proof-reading and editing function

(exonuclease activity)

TRANSCRIPTION

Consider:

if all DNA was actively used:- most mutations would be lethal- there would be no ‘raw material’ for evolutionary change- what would happen to genes de-activated by mutation?

In fact, many errors and duplications leave ‘extra’ DNA

Consider:

If there is excess DNA, it may be- only between genes- also interspersed within genes

Consider:

If there is excess DNA, it may be- only between genes- also interspersed within genes

Consider:

Not all gene products are required simultaneously; needs for proteins change or differ

- during development (e.g., milk digesting enzymes)- over time (e.g., digestive enzymes)- among organs (e.g., liver enzymes not used in muscle)- in response to stimuli (e.g., melanin, adrenalin)

therefore regulation of gene activity is needed

Transcription:

Uses RNA as an intermediary - to assemble genes - to transmit the right information when/where it is needed

(regulation)

Transcription:

Uses RNA as an intermediary - to assemble genes - to transmit the right information when/where it is needed

(regulation)

RNA is ribonucleic acid- has uracil instead of thymine- sugar is ribose instead of deoxyribose

There are three types of RNA:

mRNA: messenger RNA – carries the code for a gene

rRNA: ribosomal RNA – used to construct ribosomes

tRNA: transfer RNA – short adapters to carry amino acid and its anti-codon

DNA strand (double, helical) - permanent(5' -> 3') ATGGAATTCTCGCTC    (coding, sense strand)

(3' <- 5') TACCTTAAGAGCGAG   (template, antisense strand)

DNA strand (double, helical) - permanent(5' -> 3') ATGGAATTCTCGCTC    (coding, sense strand)

(3' <- 5') TACCTTAAGAGCGAG   (template, antisense strand)

mRNA strand (single, linear) – temporary, as needed(5' -> 3') AUGGAAUUCUCGCUC  (from template strand)

DNA strand (double, helical) - permanent(5' -> 3') ATGGAATTCTCGCTC    (coding, sense strand)

(3' <- 5') TACCTTAAGAGCGAG   (template, antisense strand)

mRNA strand (single, linear) – temporary, as needed(5' -> 3') AUGGAAUUCUCGCUC  (from template strand)

note: by taking information from the template (antisense) strand

of DNA, mRNA becomes the coding sequence

DNA strand (double, helical) - permanent(5' -> 3') ATGGAATTCTCGCTC    (coding, sense strand)

(3' <- 5') TACCTTAAGAGCGAG   (template, antisense strand)

mRNA strand (single, linear) – temporary, as needed(5' -> 3') AUGGAAUUCUCGCUC  (from template strand)

protein sequence (single, with 1, 2, 3, 4 structure) Met-Glu-Phe-Ser-Leu...

promoter region: immediately upstream (5’ end) of its gene

Gene structure

Steps in transcription:

1. initiation RNA polymerase recognizes and binds to promoter sequence - these contain TATAAA and TTGACA or CCAAT codes

Steps in transcription:

1. initiation RNA polymerase recognizes and binds to promoter sequence - these contain TATAAA and TTGACA or CCAAT codes

2. elongation - similar to DNA replication - only one strand (template) is used

Steps in transcription:

1. initiation RNA polymerase recognizes and binds to promoter sequence - these contain TATAAA and TTGACA or CCAAT codes 2. elongation - similar to DNA replication - only one strand (template) is used

3. termination - transcription keeps going for 1000-2000 bases beyond

end of ‘gene’

After transcription: RNA processing

capping polyadenylation intron removal

UTR= untranslated region

promoter elements

TRANSLATION:

The Genetic Code

The genetic code

DNA and RNA have 4 types of basesproteins are composed of amino acids, of which there are 20

- so how do 4 bases encode 20 amino acids?

The genetic code

“words” with a single base allow no combinations (4 words)

“words” with two bases allow 16 combinations (42)

“words” with three bases allow 64 combinations (43)= more than enough combinations for 20 amino acids

The genetic code

• composed of nucleotide triplets (codons)

mRNA AUG GAA UUC UCG CUC  

protein sequence Met Glu Phe Ser Leu

 

The genetic code

• composed of nucleotide triplets (codons)• non-overlapping

mRNA AUG GAA UUC UCG CUC  

protein sequence Met Glu Phe Ser Leu

NOT AUGGAAUUCUCGCUC  

The genetic code

• composed of nucleotide triplets (codons)• non-overlapping• unambiguous – each codon only specifies one amino acid• degenerate – most amino acids specified by several codons

firs

t pos

itio

n

second position

third position

Reading frame must be uniquely specified:

theredfoxatethehotdog

t her edf oxa tet heh otd og

th ere dfo xat eth eho tdo g

the red fox ate the hot dog

start codon

Reading frame must be uniquely specified:

mRNA code begins with start codon (AUG)

protein is constructed along open reading frame

translation stops at stop codon (UAA, UAG, or UGA)(only in frame: sequence out of frame does not work)

Reading frame must be uniquely specified:

mRNA code begins with start codon (AUG)

protein is constructed along open reading frame

translation stops at stop codon (UAA, UAG, or UGA)(only in frame: sequence out of frame does not work)

GUCCCGUGAUGCCGAGUUGGAGUAAGUAACCU met pro ser trp ser lys stop

5’ 3’

The genetic code

• composed of nucleotide triplets (codons)

• non-overlapping

• unambiguous

• degenerate

• nearly universal – except for portions of mitochondrial

DNA and a few procaryotes

TRANSLATION:

assembling proteins

Three types of RNA:

mRNA: messenger RNA – carries the code for a gene

GUCCCGUGAUGCCGAGUUGGAGUAGAUAACCU5’ 3’

Three types of RNA:

mRNA: messenger RNA – carries the code for a generRNA: ribosomal RNA – used to construct ribosomes

- four types, used to make two-unit ribsome

(30 S)

(60 S)

Three types of RNA:

mRNA: messenger RNA – carries the code for a generRNA: ribosomal RNA – used to construct ribosomestRNA: transfer RNA – short adapters to carry amino acid and its anti-codon

anticodon

Steps in translation:

1. initiation ribosomal subunits recognize, bind to 5’ cap on mRNA initiator tRNA (with UAC anticodon) binds to AUG start codon

Steps in translation:

1. initiation2. elongation next tRNA pairs with its codon peptidyl transferase

1. catalyzes formation of peptide bond between amino acids

Steps in translation:

1. initiation2. elongation next tRNA pairs with its codon peptidyl transferase

1. catalyzes formation of peptide bond between amino acids2. breaks amino acid bond with previous tRNA

ribosome shifts over one codon

Steps in translation:

1. initiation2. elongation3. termination stop codon is recognized, bound to by release factor, polypeptide

is freed

Protein structureprimary: amino acid sequencesecondary: helix or pleated sheet, held with hydrogen bondstertiary: collapsed molecule with internal bondsquaternary: protein subunits combine to form functional protein

Protein structure

quaternary: protein subunits combine to form functional protein

subunits may be from same gene, or differentmay need two (dimers), three (trimers), or more

Protein function

enzymes – catalyze chemical reactions; most common proteinsusually have active sites (tertiary structure) that mediate function

structural proteinscollagen, keratin

transportershemoglobin

contractile – tissue and muscle movementactin, myosin

intercellular communicationinsulin, other hormones

Fig. 9-20