Domain Swapping and Gene Shuffling Identify Sequences Required for Induction of an Avr-Dependent Hypersensitive Response by the Tomato Cf-4 and Cf-9 Proteins
Brande B. H. Wulff,
1
Colwyn M. Thomas,
1,2
Matthew Smoker, Murray Grant,
3
and Jonathan D. G. Jones
4
Sainsbury Laboratory, John Innes Centre, Norwich Research Park, Colney Lane, Norwich NR4 7UH, United Kingdom
The tomato
Cf-4
and
Cf-9
genes confer resistance to infection by the biotrophic leaf mold pathogen Cladosporium.Their protein products induce a hypersensitive response (HR) upon recognition of the fungus-encoded Avr4 and Avr9peptides. Cf-4 and Cf-9 share
.
91% sequence identity and are distinguished by sequences in their N-terminal domainsA and B, their N-terminal leucine-rich repeats (LRRs) in domain C1, and their LRR copy number (25 and 27 LRRs, re-spectively). Analysis of
Cf-4/Cf-9
chimeras, using several different bioassays, has identified sequences in Cf-4 and Cf-9that are required for the Avr-dependent HR in tobacco and tomato. A 10–amino acid deletion within Cf-4 domain B rel-ative to Cf-9 was required for full Avr4-dependent induction of an HR in most chimeras analyzed. Additional sequencesrequired for Cf-4 function are located in LRRs 11 and 12, a region that contains only eight of the 67 amino acids thatdistinguish it from Cf-9. One chimera, with 25 LRRs that retained LRR 11 of Cf-4, induced an attenuated Avr4-dependentHR. The substitution of Cf-9 N-terminal LRRs 1 to 9 with the corresponding sequences from Cf-4 resulted in attenua-tion of the Avr9-induced HR, as did substitution of amino acid A433 in LRR 15. The amino acids L457 and K511 in Cf-9
LRRs 16 and 18 are essential for induction of the Avr9-dependent HR. Therefore, important sequence determinants ofCf-9 function are located in LRRs 10 to 18. This region contains 15 of the 67 amino acids that distinguish it from Cf-4,
in addition to two extra LRRs. Our results demonstrate that sequence variation within the central LRRs of domain C1and variation in LRR copy number in Cf-4 and Cf-9 play a major role in determining recognition specificity in theseproteins.
INTRODUCTION
A major goal in plant pathology is to determine the molecu-lar mechanism of pathogen perception by plants. In gene-for-gene interactions, it has been postulated that plant dis-ease resistance (
R
) genes encode receptors for the prod-ucts of pathogen-encoded avirulence (
Avr
) genes (reviewedin Ellis et al., 2000). The tomato
Cf-2
,
Cf-4
,
Cf-5
, and
Cf-9
genes confer resistance to the biotrophic leaf mold patho-gen Cladosporium through recognition of different fungal-encoded Avr proteins (Avr2, Avr4, Avr5, and Avr9, respec-tively).
Cf
genes encode extracytoplasmic membrane-anchored glycoproteins (Piedras et al., 2000) composedpredominantly of leucine-rich repeats (LRRs) and a short cy-
toplasmic domain that lacks an obvious signaling function(Thomas et al., 1998).
Most plant
R
genes that have been characterized encodeproteins that contain LRRs (Ellis et al., 2000). LRR proteinsare thought to have evolved independently in many organ-isms and are involved in protein–protein interactions (Kobeand Deisenhofer, 1994; Kajava, 1998). It has been postu-lated that the solvent-exposed amino acids of a conserved
b
-strand/
b
-turn structural motif are the major determinantsof recognition specificity in this class of proteins (Kobe andDeisenhofer, 1994; Jones and Jones, 1997; Kajava, 1998).
The analysis of
Cf-9
paralogs (
Hcr9
s, for homologs of Cla-dosporium resistance gene 9) at several loci on the shortarm of chromosome 1 (Parniske et al., 1997, 1999; Thomaset al., 1997; Parniske and Jones, 1999) has identified hy-pervariable sequences in these highly homologous genes.Consistent with their proposed role as determinants of rec-ognition specificity, most variation between
Hcr9
s is in se-quences encoding the putative solvent-exposed aminoacids of the LRR
b
-strand/
b
-turn structural motif. A similaranalysis of
Cf-2
homologs (
Hcr2
s) at the
Cf-2/Cf-5
locus onchromosome 6 was also performed (Dixon et al., 1998).
1
These authors contributed equally to this work.
2
Current address: School of Biological Sciences, University of EastAnglia, Norwich NR4 7TJ, UK.
3
Current address: Department of Biological Sciences, Wye College,Wye, Ashford, Kent TN25 5AH, UK.
4
To whom correspondence should be addressed. E-mail [email protected]; fax 44-1603-450011.
256 The Plant Cell
Figure 1.
Predicted Amino Acid Sequence of the Tomato Cf-4 Protein (Thomas et al., 1997).
Structural domains A to G of Cf-4 (Jones and Jones, 1997) are indicated at left. Cf-4 LRRs within domains C1 and C3 that are common to Cf-4
Recognition Specificity in Cf-4 and Cf-9 257
From these analyses, it was concluded that sequences en-coding the putative solvent-exposed amino acids of theirN-terminal LRRs, together with variation in their N-terminalLRR copy number, determine recognition specificity in Cfproteins (Dixon et al., 1998; Thomas et al., 1998). However,the molecular mechanism of Avr protein perception has notbeen determined (Dixon et al., 2000).
We have shown previously that Cf-4 and Cf-9 share
.
91% amino acid identity (Thomas et al., 1997). Some ofthe amino acids that distinguish Cf-4 and Cf-9 are located intheir N-terminal domains A and B, but most correspond toputative solvent-exposed residues of the LRR
b
-strand/
b
-turn structural motif (see Figure 1). Cf-4 and Cf-9 are dis-tinguished further by their LRR copy number (25 and 27LRRs, respectively). To determine which of these structuraldifferences are important for Cf-4 and Cf-9 function, wetested
Cf-4/Cf-9
chimeras for their ability to induce an Avr-dependent hypersensitive response (HR).
An analysis of sequences that determine recognition speci-ficity in Cf-4 and Cf-9 is possible because they discriminatebetween two Cladosporium Avr determinants (Avr4 and Avr9)that have been cloned (Van den Ackerveken et al., 1992;Joosten et al., 1994). When Cf-4 or Cf-9 are expressed in to-mato or tobacco, they induce an HR in the presence of thecognate Avr protein. This has facilitated the development ofrapid and reliable assays of
Cf-4/Cf-9
gene function in tomatoand several tobacco species (Hammond-Kosack et al., 1994,1995, 1998; Joosten et al., 1997; Thomas et al., 1997, 2000;Kamoun et al., 1999; Van der Hoorn et al., 2000).
We used a variety of these bioassays to analyze defined
Cf-4/Cf-9
domain swaps and chimeras generated by polymer-ase chain reaction (PCR)–mediated gene shuffling (Stemmer,1994; Crameri et al., 1998). Gene shuffling is a powerfultechnique for generating large numbers of chimeras whoseprotein products can exhibit dramatically increased enzy-matic activity (Stemmer, 1994; Crameri et al., 1998). This re-port describes the use of gene shuffling for the functionalanalysis of plant genes, which has enabled us to identify im-portant sequence determinants of Cf-4 and Cf-9 function.Our data demonstrate that sequence changes within thecentral LRRs of domain C1 together with variation in LRRcopy number are important determinants of recognitionspecificity in this unique class of plant R proteins.
RESULTS
Construction and Analysis of
Cf-4
/
Cf-9
Chimeras
Domains A and B and the N-terminal LRRs in domain C1 ofCf-4 and Cf-9 contain all of the amino acids that distinguishthese proteins (Figure 1). The clones
Cf-4
DS and
Cf-9
DS,which encode the wild-type Cf-4 and Cf-9 proteins (seeMethods), contain restriction sites that facilitated the ex-change of sequences encoding domains A and B and vari-able numbers of N-terminal LRRs. Alternately, chimeras wereprepared by PCR-mediated gene shuffling. The chimeraswere tested for their ability to induce an Avr4- or Avr9-depen-dent HR by using one or more of the following bioassays:
(1)
Cf-4/Cf-9
chimeras cloned in T-DNA vectors were testedfor their ability to induce an Avr-dependent HR by Agro-bacterium-mediated transient expression in leaves of to-bacco or
Nicotiana benthamiana
expressing 35S:
Avr4
or35S:
Avr9
(Thomas et al., 2000; Van der Hoorn et al., 2000).(2) Chimeras were stably expressed in transgenic tobacco.
Tobacco and tomato plants expressing
Cf-4
or
Cf-9
in-duce an F
1
seedling lethal phenotype when crossed tolines expressing 35S:
Avr4
or 35S:
Avr9
(Hammond-Kosack et al., 1994, 1998; Thomas et al., 1997, 2000).
(3) Transgenic tobacco plants were tested for their ability toresist infection by recombinant potato virus X (PVX).Plants expressing
Cf-4
or
Cf-9
exhibit necrotic lesionson inoculated leaves when inoculated with PVX:
Avr4
orPVX:
Avr9
, respectively, and are resistant to virus infec-tion (Kamoun et al., 1999; Thomas et al., 2000).
(4) Transgenic tomato plants expressing specific chimeraswere tested for resistance to infection by Cladosporium.
(5) Transgenic tomato plants were infected with recombi-nant PVX-expressing
Avr4
or
Avr9
(PVX:
Avr4
and PVX:
Avr9
)that induce a systemic necrosis in plants expressing
Cf-4
or
Cf-9
(Hammond-Kosack et al., 1995; Joosten et al.,1997; Thomas et al., 1997).
The predicted amino acid sequences of the
Cf-4/Cf-9
chi-meras described below are shown in Figures 2 and 6 to-gether with a summary of bioassay data that summarizetheir capacity to induce an Avr-dependent HR.
and Cf-9 are numbered in black at right, LRRs specific to Cf-4 are shown in blue, and the corresponding Cf-9 LRRs are shown in parentheses inred. The amino acids that distinguish Cf-4 from Cf-9 are shown in blue, and deleted amino acids relative to Cf-9 are indicated by black dots. Se-quences that form part of the putative
b
-strand/
b
-turn structural motif in LRR proteins (Kobe and Deisenhofer, 1994; Jones and Jones, 1997) aredelimited by vertical lines. The consensus sequence for plant extracellular LRRs is shown boxed below the amino acid sequence, and consen-sus residues with a possible
b
-strand configuration are shown in red. The location of restriction enzyme sites that facilitated the construction of
Cf-4/Cf-9
chimeras also are shown. Sites in
Cf-4
DS and
Cf-9
DS genomic clones for ClaI, BglII, HindIII, and PvuII (indicated at right) are representedby yellow boxes outlined in black. Restriction sites for EcoRI and HindIII in sequences encoding LRRs 13 and 19 of
Cf-4
and LRRs 15 and 21 of
Cf-9
, respectively, are indicated as green boxes.
Figure 1.
(continued).
258 The Plant Cell
Sequences within Cf-4 Domains A and B or Amino Acid E84 in LRR 1 Are Required for Induction ofAvr4-Dependent HR in Tobacco and Tomato
Transgenic tobacco plants expressing different chimeraswere tested for their ability to induce a seedling lethal phe-notype after crossing to lines expressing 35S:
Avr4
or35S:
Avr9
(Table 1). The
Cf-4
[9CB] chimera contains se-quences encoding domains A and B of Cf-9 and the puta-tive solvent-exposed variant amino acid A94 in LRR 1(Figure 2A). The F
1
progeny of a
Cf-4
DS
3
35S:
Avr4
cross-segregated for the wild type and a seedling-lethal pheno-type (Thomas et al., 2000). In the progeny of
Cf-4
[9CB]
3
35S:
Avr4
crosses, half appeared normal and were indistin-guishable from progeny of a
Cf-4
[9CB]
3
35S:
Avr9
cross(Figure 3A). The remaining seedlings were stunted and pro-duced only two to three chlorotic or necrotic leaves thateventually died (Figure 3A). The self-progeny of
Cf-4
[9CB]transgenic plants were also susceptible to PVX:
Avr4
infection(Table 1). These data suggest the Avr4-dependent HR in-duced by this chimera is attenuated compared with
Cf-4
DS.Several
Cf-4
[9CB] transgenic tomato plants were also an-alyzed. In contrast with progeny from
Cf-4
DS
3
35S
:Avr4
crosses (Thomas et al., 1997), the progeny from
Cf-4
[9CB]
3
35S:
Avr4
crosses were phenotypically normal at the seed-ling stage and grew to maturity. Approximately half of theplants at the six- to seven-leaf stage exhibited chlorotic andnecrotic sectors on their oldest leaves (Figures 3B and 3C).This phenotype was due to weak activation of an Avr4-depen-dent response because it was not observed in progeny from
Cf-4
[9CB]
3
35S:
Avr9
crosses (Figure 3B). Tomato
Cf-4
[9CB]
transgenic plants were also susceptible to infection by Cla-dosporium race 5 that expresses
Avr4
and
Avr9
(Figure 3F).When the progeny of
Cf-4
[9CB] transgenic plants were in-oculated with PVX:
Avr4
at the two-leaf stage, only a weakresponse to PVX:
Avr4
was observed. This response wasmanifested as leaf epinasty and chlorosis in systemically in-fected leaves, and occasionally as small necrotic lesions(Figure 3D). No systemic necrosis was observed, as was ob-served in
Cf-4
DS controls (results not shown), and virus-infected plants grew to maturity (results not shown).
Together, these data suggest that
Cf-4
[9CB] triggers agreatly attenuated Avr4-dependent HR. Sequences withinCf-4 domain A, the putative signal peptide sequence (Jonesand Jones, 1997), domain B, or amino acid E84 in LRR 1 arerequired for full induction of an Avr4-dependent HR in to-bacco and tomato, and for resistance to Cladosporium
in-fection in tomato.
10–Amino Acid Deletion in Cf-4 Domain B Is Required for Full Avr4-Dependent HR
Two additional chimeras were tested to determine which ofthe sequences described above are required for full induc-tion of the Avr4-dependent HR. Sequences encoding theadditional 10 amino acids in Cf-9 domain B were deletedfrom
Cf-9
DS (amino acids I56 to Y65), as described in Meth-ods. Sequences encoding Cf-9 domain A, the modifieddomain B, and A94 from LRR 1 were inserted into the corre-sponding region in
Cf-4
to generate
Cf-4
[
D
9B] (Figure 2A). In
Cf-4
[
1
10B], DNA encoding the additional 10 amino acids in
Table 1.
Characterization of
Cf-4/Cf-9
Chimeras in Transgenic
Nicotiana tabacum
Plants
Transgene
a
Transgenics Analyzed
b
3
35S:Avr4c 335S:Avr9 PVXd PVX:Avr4 PVX:Avr9
Cf-4DS 3 WT 1 SL WT C I CCf-4[9CB] 4 WT 1 SC/N WT C C CCf-4[9CH] 4 WT WT nd nd CCf-4[9CP] 5 WT WT nd nd CCf-4[9PE] 4 WT WT nd nd CCf-4[9HE] 3 WT WT nd nd CCf-4[9BE] 4 WT WT nd nd CCf-4[LK] 3 WT 1 SL WT C I CCf-9DS 4 WT WT 1 SL C C ICf-9[4CB] 5 WT WT 1 SL C C ICf-9[4CH] 4 WT WT 1 SL C C ICf-9[4CP] 3 WT WT 1 SL C C ICf-9[FN] 5 WT WT C C C
a See Figure 2 for details of Cf-4/Cf-9 chimeras.b Number of independent single-locus transgenics analyzed.c Phenotype of F1 seedlings from hemizygous transgenic plants crossed to either a 35S:Avr4 or a 35S:Avr9 line. WT, wild type; SL, seedling le-thal; SC/N, stunted and chlorotic/necrotic.d Phenotypes of kanamycin-resistant T2 progeny after inoculation with PVX, PVX:Avr4, or PVX:Avr9. C, compatible interaction; I, incompatible in-teraction; nd, not determined.
Recognition Specificity in Cf-4 and Cf-9 259
Cf-9 domain B (IRTYVDIQSY) was inserted into Cf-4DS be-tween sequences encoding amino acids D55 and R56 (Fig-ure 2A).
Both chimeras were tested for their ability to induce anAvr4-dependent HR in Nicotiana benthamiana. Cf-4[D9B] in-duced an HR that was only slightly weaker than the Cf-4DScontrol (Figure 3H). Cf-4[110B] induced a weak Avr4-depen-dent HR similar to that induced by Cf-4[9CB] (Figure 3I). To-gether, these data demonstrate that the four variant aminoacids within Cf-4 domain B, the variant amino acids withindomain A, and amino acid E84 in LRR 1 can be substitutedsimultaneously with the corresponding sequences from Cf-9without compromising Cf-4 function. Therefore, at least in thechimeras tested here, the absence of a 10–amino acid se-quence in Cf-4 domain B is required for full Cf-4 function.
Additional Sequences Required for Cf-4 Function Are Located in LRRs 8 to 16
Two other chimeras were tested that contained sequencesencoding Cf-9 domains A and B and amino acid A94. TheCf-4[9CH] chimera also contained sequences encoding Cf-9LRRs 1 to 3 and amino acid C162 from LRR 4 (Figure 2A). InCf-4[9CP], the substituted region was more extensive andincluded sequences encoding the seven N-terminal LRRs ofCf-9 (Figure 2A). Neither of these chimeras induced an aber-rant seedling-lethal phenotype when crossed to a 35S:Avr4line (Table 1). To determine whether this was due to the pres-ence of Cf-9 domain B, we tested two additional chimeras.
The new chimeras contained the native Cf-4 domains Aand B, amino acid E84 from LRR 1, and sequences encod-ing N-terminal LRRs from Cf-9. A cassette encoding LRRs 1to 3 and the single variant amino acid in LRR 4 of Cf-9(C162) was substituted into the corresponding region of Cf-4DS to generate Cf-4[9BH] (Figure 2A). In Cf-4[9BP] se-quences encoding Cf-9, LRRs 1 to 7 were substituted forthe corresponding region in Cf-4DS (Figure 2A). Both Cf-4[9BH] and Cf-4[9BP] induced a strong Avr4-dependent HRthat was comparable to the Cf-4 control when tested intransient expression assays (Figures 3J and 3K).
These data demonstrate that substitution of N-terminalLRRs 1 to 7 of Cf-4 with the corresponding sequences fromCf-9 does not compromise its ability to induce an Avr4-depen-dent HR in tobacco. These LRRs contain 32 of the 67 aminoacids that distinguish Cf-4 from Cf-9 (Figures 1 and 2).
Several other chimeras tested contained sequences en-coding Cf-4 domains A and B and amino acid E84 togetherwith variable numbers of Cf-9 N-terminal LRRs (Table 1).The chimeras Cf-4[9PE], Cf-4[9HE], and Cf-4[9BE] con-tained substituted regions encoding Cf-9 LRRs 8 to 15,LRRs 4 to 15, and LRRs 1 to 15, respectively (Figure 2A).None of the transgenic tobacco plants expressing these chi-meras induced an Avr4-dependent HR (Table 1). Together,these data demonstrate that additional sequences requiredfor Cf-4 function must be located within LRRs 8 to 16.
Cf-9 Function Is Not Compromised by Substitution with Cf-4 Domains A and B and Amino Acid E84
In Cf-9[4CB] sequences encoding Cf-4 domains A and Band amino acid E84 from LRR 1 were substituted into thecorresponding region of Cf-9DS (Figure 2B). When Cf-9[4CB] was tested in transient expression assays, a strongHR was observed similar to that induced by the Cf-9DS con-trol (Figure 4A). When transgenic tobacco plants expressingCf-9[4CB] were crossed to a 35S:Avr9 line, half of their F1
progeny exhibited a seedling-lethal phenotype as in Cf-9DS 335S:Avr9 controls (Table 1 and Figure 4B). The self-progenyof Cf-9[4CB] transgenic plants were also resistant toPVX:Avr9 infection (Table 1).
When the progeny of three Cf-9[4CB] transgenic tomatoplants were inoculated with PVX:Avr9, the leaves of infectedplants exhibited systemic necrosis that was indistinguish-able from Cf-9DS controls (Figures 4C and 4D). Tomato Cf-9[4CB] transgenic plants were also resistant to Cladospo-rium race 5 infection (Figure 4E). To confirm that the resis-tance was due to recognition of Avr9, we inoculated T2
progeny with the isogenic Cladosporium race 5.9 in whichAvr9 has been deleted (Marmeisse et al., 1993). No resistanceto Cladosporium race 5.9 was observed, demonstrating thatresistance to infection was Avr9 dependent (Figure 4E).
Therefore, in contrast to Cf-4, domain B of Cf-9 can be re-placed with the corresponding sequence from Cf-4 withoutcompromising its ability to induce an Avr9-dependent HR intobacco and tomato or to confer resistance to Cladospo-rium infection.
Additional Sequences Required for Cf-9 Function Are Located in LRRs 8 to 18
In Cf-9[4CH] sequences encoding Cf-4 domains A and B,LRRs 1 to 3 and amino acid S152 from LRR 4 were insertedinto the corresponding region in Cf-9DS (Figure 2B). A moreextensive region was substituted in clone Cf-9[4CP], whichincluded sequences encoding Cf-4 LRRs 5, 6, and 7 (Figure2B). The progeny of transgenic tobacco plants expressingCf-9[4CH] or Cf-9[4CP] crossed to a 35S:Avr9 line exhibiteda seedling-lethal phenotype (Figure 4G and Table 1). Thedevelopment of the seedling-lethal phenotype in progeny ofthe Cf-9[4CH] 3 35S:Avr9 cross was indistinguishable fromthe Cf-9DS 3 35S:Avr9 control (Thomas et al., 2000) butwas delayed in progeny from the Cf-9[4CP] 35S:Avr9 cross(Figure 4K), suggesting that Cf-9 function is attenuated. How-ever, the self-progeny from Cf-9[4CH] and Cf-9[4CP] trans-genic plants were resistant to PVX:Avr9 infection (Table 1).
Cf-9[4CH] and Cf-9[4CP] also were tested in transient ex-pression assays. Cf-9[4CH] induced a slightly attenuatedHR compared with Cf-9DS (Figure 4F). Cf-9[4CP] induced adelayed Avr9-dependent HR compared with Cf-9DS and Cf-9[4CH] (Figure 4J), consistent with the data above. To iden-tify sequences within Cf-9 LRRs 4 to 7 that are required for
260 The Plant Cell
full Cf-9 function, we constructed additional chimeras thatcontained substitutions of 4, 5, or 6 N-terminal LRRs of Cf-4(Cf-9[4/4LRR], Cf-9[4/5LRR], and Cf-9[4/6LRR], respec-tively, see Figure 2B). However, when these sequenceswere tested in N. benthamiana, all induced an Avr9-depen-
dent HR comparable to Cf-9[4CP] (Figure 2B; results notshown).
When the progeny from three Cf-9[4CH] transgenic to-mato plants were inoculated with PVX:Avr9, they exhibited asystemic necrotic reaction that was delayed compared with
Figure 2. Amino Acid Sequences of Chimeras Used to Identify Functional Domains in Cf-4 and Cf-9.
Only amino acids that distinguish Cf-4 (blue letters) and Cf-9 (red letters) are shown (see Figure 1). Their location within domain A (A)—the puta-tive signal peptide (SP)—domain B (B), and LRRs of domain C1 are indicated in (A). LRRs that are common to Cf-4 and Cf-9 are numbered inblack, Cf-4–specific LRRs are numbered in blue, and Cf-9–specific LRRs are numbered in red. The location of the additional 10 amino acids indomain B of Cf-9 (10 amino acids [aa]) and the two additional LRRs (2LRR) in domain C1 are indicated by red boxes. Amino acids that corre-spond to putative solvent-exposed residues of the LRR b-strand/b-turn structural motif (see Figure 1) are indicated in boldface type beneath aboldface x. The location of sequences for ClaI, BglII, HindIII, PvuII, and EcoRI in the corresponding DNA sequences are indicated by C, B, H, P,and E, respectively. The Cf-4/Cf-9 chimeras are listed at left. The column labeled “Specificity” summarizes data from at least one type of bio-assay for Cf-4 or Cf-9 function in tobacco and tomato. Chimeras that induce an Avr4-dependent HR are indicated with a blue 1 in (A), andthose that induce an Avr9-dependent HR by a red 1 in (B). Their relative activity compared with Cf-4DS and Cf-9DS controls is also indi-cated. All chimeras that failed to induce an Avr4- or Avr9-dependent HR are indicated by a 0. Several chimeras that conferred, or failed toconfer, resistance to Cladosporium race 5 infection in transgenic tomato plants are indicated with a boldface R or S, respectively, in theSpecificity column.
Recognition Specificity in Cf-4 and Cf-9 261
Cf-9DS control plants (Figure 4H). Therefore, the substitutedN-terminal LRRs in this chimera have a slight attenuating ef-fect on development of the Avr9-dependent HR in tomato,as was observed in tobacco. However, the progeny of thesetransgenic plants exhibited Avr9-dependent resistance toCladosporium infection (Figure 4I).
The progeny of three Cf-9[4CP] transgenic plants infectedwith PVX:Avr9 showed a delayed systemic necrosis com-pared with Cf-9DS controls and Cf-9[4CH] progeny (Figure4L). Also, when the progeny of Cf-9[4CP] transgenic plantswere inoculated with Cladosporium race 5 (Figure 4M),some restricted areas of fungal sporulation were observedon the abaxial leaf surface compared with Cf4 and Cf9 con-trols. However, these plants were significantly less sensitiveto infection than Cf0 controls and siblings inoculated with C.fulvum race 5.9 (Figure 4M). Therefore, a correlation was ob-served between the ability to induce an Avr9-dependent HRand the ability of transgenic plants to resist Cladosporiuminfection (Figure 4).
In conclusion, as was observed for Cf-4, sequences en-coding LRRs 1 to 7 of Cf-9 can be substituted without abol-ishing the induction of an Avr9-dependent HR. However,LRRs 1 to 7 of Cf-9 contain sequences that are required forfull induction of the Avr9-dependent HR in tobacco and to-mato and for resistance to Cladosporium infection.
The Cf-9 Amino Acids L457 and K511 in LRRs 16 and 18 Are Essential for Function
Most Cf-4/Cf-9 chimeras contained the 39 half of Cf-4 thatencodes the two variant amino acids F400 and N454 fromLRRs 14 and 16 (Figure 1). None of the transgenic plants ex-pressing chimeras that contained these two amino acidswere able to induce an Avr9-dependent HR, and none oftheir progeny were resistant to PVX:Avr9 infection (Table 1).This included plants transformed with Cf-9[FN] whose pro-tein product contains all Cf-9 variant amino acids exceptL457 and K511 in LRRs 16 and 18 (Figure 2B). Therefore,one or both of these amino acids appear to be essential forCf-9 function, and chimeras were constructed to test thispossibility.
Two sequence variants were generated that encode sin-gle amino acid substitutions corresponding to the twoamino acids present in Cf-4 (F400 and N454). These cloneswere used to substitute the 39 terminal halves of Cf-9, andtwo chimeras containing single amino acid substitutions, Cf-9[L457F] and Cf-9[K511N], were generated (Figure 2B).When these chimeras were tested in transient expressionassays, neither Cf-9[L457F] nor Cf-9[K511N] could inducean Avr9-dependent HR (Figures 5A and 5B). Therefore, nei-ther of the amino acids F400 or N454 in LRRs 14 and 16 ofCf-4 could substitute functionally for L457 and K511 inLRRs 16 and 18 of Cf-9.
In contrast, the two Cf-4 variants Cf-4[F400L] and Cf-4[N454K] could induce an HR that was indistinguishable
from the Cf-4DS control (Figures 5C and 5D). When the vari-ant Cf-4[LK] was tested (which contains both Cf-9 aminoacids; see Figure 2A), a slight attenuation in the develop-ment of the HR was observed compared with the Cf-4DScontrol (results not shown). Also, when tobacco Cf-4[LK]transgenic plants were crossed to a 35S:Avr4 line, theirprogeny exhibited a seedling-lethal phenotype similar tothat induced by Cf-4DS 3 35S:Avr4 controls (Thomas et al.,2000), and the progeny of Cf-4[LK] transgenic tobaccoplants were also resistant to PVX:Avr4 infection (Table 1).Therefore, substitution of either of the Cf-4 amino acidsF400 and N454 with the corresponding sequences fromCf-9 does not compromise the ability of Cf-4 to induce anAvr4-dependent HR.
Cf-4 and Cf-9 LRR Copy Number Variants
Cf-4 and Cf-9 differ in the number of their N-terminal LRRswithin domain C1 (Thomas et al., 1997). Cf-4 contains a dele-tion of 46 amino acids relative to Cf-9 that corresponds totwo complete LRRs (Figure 1). To determine the effect ofvarying LRR copy number in Cf-4 and Cf-9, we constructedtwo sequence variants. In Cf-4[12LRR], sequences from Cf-9encoding the two additional LRRs were inserted into Cf-4 be-tween sequences encoding amino acids G316 and P317 (Fig-ure 2A). In the second construct, Cf-9 sequences encodingthe same region (P328 to G373) were deleted to generate Cf-9[D2LRR] that encodes a Cf-9 variant lacking 2 LRRs (Figure2B). Both sequences were tested for their ability to induce anAvr4- or Avr9-dependent HR in N. benthamiana leaves. Nei-ther Cf-4[12LRR] (Figure 5E) nor Cf-9[D2LRR] (Figure 5F)could induce an Avr-dependent HR, demonstrating that alter-ing LRR copy number compromises Cf-4 and Cf-9 function.
Characterization of Cf-4 and Cf-9 Gene-Shuffled Clones
PCR-mediated gene shuffling (Stemmer, 1994) of Cf-4 andCf-9 was performed to increase the number of Cf-4/Cf-9chimeras that could be analyzed (Figure 6A). Agrobacteriumstrain GV3101 clones containing shuffled sequences in aT-DNA vector under control of the CaMV 35S promoterwere selected at random and assayed for their ability to in-duce an Avr-dependent HR in transgenic N. benthamianaplants expressing 35S:Avr4 and 35S:Avr9.
Of the 364 shuffled clones tested 108 (29%) induced anHR on test plants. Seventy-two of these HR-inducing cloneswere tested on N. benthamiana plants expressing either35S:Avr4 or 35S:Avr9. Fifty-seven of the clones induced anAvr4-dependent HR, and 15 induced an Avr9-dependentHR. None of the clones induced an HR on nontransformedN. benthamiana leaves, and no clones induced an HR in re-sponse to both Avr4 and Avr9.
The predicted amino acid sequences of 27 clones thatinduced an Avr4-dependent HR and 12 that induced an
262 The Plant Cell
Figure 3. Identification of Functional Domains in Cf-4.
(A) to (F) Shown are the results of several bioassays to test the function of the Cf-4[9CB] chimera in tobacco and tomato.(A) Phenotypes of randomly selected progeny from crosses between tobacco plants heterozygous for the Cf-4[9CB] transgene and lines ex-pressing 35S:Avr9 or 35S:Avr4. Approximately half of the Cf-4[9CB] 3 35S:Avr4 seedlings were wild type in appearance whereas the rest werestunted, and their leaves and cotyledons were chlorotic or necrotic.(B) Seven-week-old F1 tomato plants from Cf-4[9CB] 3 35S:Avr9 or Cf-4[9CB] 3 35S:Avr4 crosses. Progeny from the cross to 35S:Avr9 were allphenotypically normal and indistinguishable from Cf-4[9CB] self-progeny (results not shown).(C) The older leaves in progeny from crosses to 35S:Avr4 exhibited an epinastic response, and their leaves contained chlorotic and necrotic sec-tors as shown in detail. The plants grew to maturity and produced viable seed.(D) Necrotic and chlorotic sectors and leaf epinasty observed in leaves of tomato Cf-4[9CB] transgenics infected with PVX:Avr4 at 17 days afterinfection. No systemic necrosis was observed in these infected plants, which also developed to maturity and produced seed.(E) and (F) Leaves from resistant Cf4 controls (E) and a disease-sensitive T2 tomato plant expressing Cf-4[9CB] (F) at 14 days after inoculationwith Cladosporium race 5.(G) to (K) Shown are the results of transient expression assays in N. benthamiana leaves that express 35S:Avr4. Agrobacteria expressing Cf-4DSwere infiltrated into the left-hand side of the leaf, and all were photographed at 5 days after infiltration. (G) to (I) show the results of assays to de-termine the function of sequences in domains A and B and LRR1 of Cf-4 (chimeras Cf-4[9CB], Cf-4[D9B], and Cf-4[110B], respectively). (J) and(K) show the results of assays with Cf-4[9BH] and Cf-4[9BP], respectively, that demonstrate that N-terminal LRRs 1 to 7 of Cf-4 can be substi-tuted with the corresponding sequences from Cf-9.
Recognition Specificity in Cf-4 and Cf-9 263
Avr9-dependent HR are shown in Figure 6B. Most of theclones encoded Cf-9 domain B, along with amino acid K511in LRR 18 and amino acid A94 in LRR 1. This suggests thatsome Cf-9 sequences were preferentially incorporatedduring reassembly. No clones contained point mutations(zero mutations in 80 kb), sequence duplications, deletions,or insertions. On average, one template switch was ob-served every 225 bases (results not shown). Sequence anal-ysis also demonstrated that z50% of template switcheswere not separated by restriction sites for any of the en-zymes used to fragment Cf-4 and Cf-9 templates beforeshuffling. Therefore, this strategy can be used for efficientshuffling of homologous sequences.
Cf-4 LRRs 11 and 12 Are Required for anAvr4-Dependent HR
Data from the analysis of clones that induced an Avr4-depen-dent HR were mostly consistent with the results reportedabove for Cf-4/Cf-9 domain swaps and enabled the identifi-cation of additional sequence determinants of Cf-4 function.However, several functional clones contained the additional10 amino acids from Cf-9 domain B (A05, E18, and C07; seeFigure 6B). This contrasts with the data above in which Cf-4[9CB] and Cf-4[110B] in tomato and tobacco transgenicsinduced an attenuated Avr4-dependent HR (Figures 3G and3I). For example, clone A05 induced a strong HR and en-codes a protein similar to Cf-4[110B] apart from four addi-tional Cf-9 amino acids within its N-terminal LRRs (Figure6B). Other clones containing Cf-9 domain B and various Cf-9LRR substitutions induced a weak HR similar to that in-duced by Cf-4[9CB] and Cf-4[110B] (Figures 3G and 3I).
All sequences that induced an Avr4-dependent HR lackedthe two additional LRRs present in Cf-9, consistent with thedata reported above (Figure 5E). Most of the clones retainedsequences encoding LRRs 11 to 14 of Cf-4. The analysis ofother clones in this class (C04, A02, A01, E02, V05, E24,and V12) suggests that amino acids T376 and P387 in LRR13 can be substituted with the corresponding amino acidsA433 and R444 from LRR 15 of Cf-9 (Figure 6B). Also, be-cause amino acids F400 and N454 in LRRs 14 and 16 canbe substituted (Figures 5C and 5D), this suggests that all ofthe variant amino acids in LRRs 13, 14, and 16 of Cf-4 canbe substituted by the corresponding Cf-9 amino acids with-out compromising Cf-4 function.
In clone A11, Cf-4 LRRs 1, 3, 4, 6, 7, 8, 9, and 10 weresubstituted with the corresponding sequences from Cf-9(Figure 6B). It is possible, therefore, that the only variantamino acids required for Cf-4 function are located in LRRs11 and 12. This region contains eight variant amino acids,of which five are putative solvent-exposed residues (Figure6B). In one other clone (V12), two variant amino acids, I353and G354, in LRR 12 were substituted by the Cf-9 aminoacids V410 and E411 (Figure 6B). A weak but reproducibleHR was induced by this chimera. The weak HR induced by
this chimera may be due to the presence of Cf-9 domain B,or alternately, to substitution of amino acids I353 andG354 in Cf-4 LRR 12. In the former case, this would local-ize the variant amino acids that are important for Cf-4 func-tion to LRR 11, a region containing only six amino acids(V322, R326, Q329, I330, W332, and N337) that distinguishit from Cf-9.
Important Sequences for Cf-9 Function Are Located in LRRs 10 to 18
All shuffled clones that induced an Avr9-dependent HR con-tained the amino acids L457 and K511 in LRRs 16 and 18and sequences encoding the two additional LRRs of Cf-9,as predicted from the data above (Figures 5A, 5B, and 5F).We also demonstrated that LRRs 1 to 7 of Cf-9 could besubstituted without abolishing the Avr9-dependent HR (Fig-ures 4J to 4M). One other clone (G24) retains a strong HR-inducing activity 6 days after infiltration and contains a sub-stituted region encompassing LRRs 1 to 9 of Cf-4 (Figure6B). Therefore, important sequences for Cf-9 function mustbe located in a region between LRRs 10 to 18. This regionencompasses the two additional LRRs in Cf-9 and 15 of the67 amino acids that distinguish it from Cf-4.
Several clones were identified (A16, E16, E19, E23, C03,and C20) that encode chimeras in which Cf-9 amino acidA433 in LRR 15 was substituted by T376 from Cf-4 (Figure6B). This substitution results in a weak but reproducibleAvr9-induced HR 6 days after infiltration. These chimerasalso contain additional sequence substitutions in LRRs 1 to4, but as shown above, these substitutions do not signifi-cantly affect Cf-9 function in tobacco. Therefore, in contrastwith amino acids L457 and K511, which cannot be substi-tuted with the corresponding Cf-4 amino acids, A433 in LRR15 of Cf-9 is only required for full induction of the Avr9-depen-dent HR in common with other sequences within LRRs 1 to9 that have not been identified.
DISCUSSION
Domain swapping was previously used to identify se-quences in tomato Pto that are required for avrPto recogni-tion (Scofield et al., 1996; Tang et al., 1996), and domains inflax L alleles that confer resistance to specific races of flaxrust (Ellis et al., 2000). Here, we report our analyses of Cf-4/Cf-9 chimeras that show that only a fraction of the variantamino acids that distinguish Cf-4 and Cf-9 are required forinduction of an Avr-dependent HR in tobacco and tomato.Variant amino acids within the central LRRs in domain C1 ofCf-4 and Cf-9, together with variation in their LRR copynumber, make a major contribution to recognition specificityin these proteins.
264 The Plant Cell
Cf-4 and Cf-9 Domains A and B
Some of the amino acids that distinguish Cf-4 and Cf-9 arelocated in domains A and B (Figure 1). Domain A is a pre-dicted signal peptide that is cleaved during the maturationof Cf proteins (Jones and Jones, 1997), and sequenceswithin this domain are unlikely to determine recognitionspecificity. Our experiments with Cf-4/Cf-9 domain A and Bchimeras demonstrated that the variant amino acids within
domain A could be substituted without compromising Cf-4or Cf-9 function (Figures 3H and 4A).
Domain B of Cf proteins, the predicted mature N termi-nus, shows no homology with the plant extracellular LRRconsensus sequence. A similar domain is present in otherplant LRR proteins such as polygalacturonase-inhibitingproteins (PGIPs) and LRR receptor-kinases (Jones et al.,1994; Jones and Jones, 1997). Structural modeling of do-main B suggests that it may adopt an a-helical fold (results
Figure 4. Identification of Functional Domains in Cf-9.
Shown are the results of several bioassays in tobacco and tomato plants. (A) to (E) show the results of bioassays with the chimera Cf-9[4CB]. Inall transient expression assays ([A], [F], and [J]), Agrobacteria containing Cf-9DS were infiltrated into the left-hand side of N. benthamianaleaves expressing 35S:Avr9. Bacteria containing the test construct were infiltrated into the right-hand side. All leaves were photographed 6 daysafter infiltration.(A) Avr9-dependent HR induced by Cf-9[4CB].(B) Segregation for wild-type and seedling-lethal phenotypes 14 days after germination in progeny from a cross between a transgenic tobaccoplant heterozygous for the Cf-9[4CB] transgene and a line expressing 35S:Avr9.(C) The development of leaf epinasty and necrotic lesions in a kanamycin-resistant T2 tomato seedling expressing Cf-9[4CB] 5 days after infec-tion with PVX:Avr9 was indistinguishable from Cf-9DS controls (results not shown).(D) Systemic necrosis in leaves of a 4-week-old Cf-9[4CB] seedling 14 days after infection with PVX:Avr9.(E) Leaves from T2 siblings expressing Cf-9[4CB] 14 days after infection with Cladosporium race 5 or race 5.9. Cf0 controls were susceptible toboth races, Cf4 controls were resistant to both races, and Cf9 controls were only susceptible to infection by race 5.9 (results not shown).(F) Avr9-dependent HR inducing activity of Cf-9[4CH].(G) Segregation for wild-type and seedling-lethal phenotypes 14 days after germination in tobacco progeny from a Cf-9[4CH] 3 35S:Avr9 cross.(H) Development of leaf epinasty and systemic necrosis in 4-week-old tomato seedlings expressing Cf-9[4CH] 14 days after infection withPVX:Avr9. The leaflet in the inset is shown expanded to reveal details of the necrotic lesions.(I) Leaves from T2 siblings expressing Cf-9[4CH] 14 days after infection with Cladosporium race 5 or race 5.9.(J) Avr9-dependent HR-inducing activity of Cf-9[4CP].(K) Delayed development of a seedling-lethal phenotype in progeny from a cross between a tobacco plant expressing Cf-9[4CP] and 35S:Avr920 days after germination.(L) Delayed systemic necrosis in a 4-week-old tomato plant expressing Cf-9[4CP] 14 days after infection with PVX:Avr9. The leaflet in the inset isshown expanded to reveal the necrotic lesions.(M) The leaves of Cf-9[4CP] transgenic T2 tomato plants inoculated with Cladosporium race 5 contained some restricted areas of fungal sporu-lation but significantly less than Cf0 controls (results not shown) or plants inoculated with Cladosporium race 5.9.
Recognition Specificity in Cf-4 and Cf-9 265
not shown), and a 10–amino acid deletion in Cf-4 wouldremove approximately two a-helical turns. This may be impor-tant for the recognition specificity of ligand binding, subsequentsignaling functions, or alternatively for Cf-4 protein stability.
The results of our analysis of Cf-4/Cf-9 chimeras ex-pressed in transgenic tobacco and tomato plants weremostly consistent with the analysis of shuffled clones identi-fied on the basis of their ability to induce an Avr-dependentHR in N. benthamiana leaves. Our analysis of domain B vari-ants suggested that the native Cf-4 domain B is required forfull Cf-4 function (Figure 3). Most shuffled clones that inducedan Avr4-dependent HR comparable to Cf-4 did contain Cf-4domain B (Figure 6B). However, several Cf-4/Cf-9 shuffledclones containing Cf-9 domain B, and other amino acids fromdomain C1 of Cf-9, did induce a strong Avr4-dependent HR(Figure 6B). For example, clone A05 encodes a protein highlyhomologous with that encoded by Cf-4[9CB] apart from fourCf-9 amino acids in LRRs 1, 8, 9, and 18 (Figure 6B). In fact,most shuffled clones that were analyzed contained the addi-tional 10 amino acids of Cf-9 domain B. Some Cf-9 se-quences may have been preferentially incorporated duringthe reassembly reaction (Figure 6B). Consequently, our analy-sis may have been biased toward the identification of chime-ras containing the additional 10 amino acids of Cf-9 domain Bthat retained the capacity to induce an Avr4-dependent HR.
In contrast, the Cf-9[4CB] chimera induced a strong Avr9-dependent HR in transgenic tobacco, and tomato plantsdemonstrating Cf-9 domain B can be substituted withoutsignificantly affecting Cf-9 function (Figure 3). However,some exceptions were observed. For example, clone C09(which contains the native Cf-9 domain B) induced a stron-ger Avr9-dependent HR 6 days after infiltration than the nearidentical clone Cf-9[4CP] that contains Cf-4 domain B (Fig-ure 6B). It is possible that minor sequence variation in Cf-4/Cf-9 chimeras may affect their tertiary structure or stability,the ability to recognize their cognate ligands, or their abilityto interact with signaling proteins that activate the plant de-fense response. Despite the fact that Cf-4 and Cf-9 are
.91% identical, our analysis cannot exclude the possibilitythat null phenotypes (Table 1) or variations in the severity of theHR are due to an inherent instability or reduced expression ofsome chimeras. Future experiments with epitope-taggedversions of these proteins (Piedras et al., 2000) will deter-mine whether differential protein accumulation can accountfor null phenotypes or variation in the severity of the HR.
LRR Sequences Required for Cf-4 and Cf-9 Function
The proposed structure of a plant extracellular LRR protein,PGIP, has been reported recently (Leckie et al., 1999).PGIPs and Cf proteins have similar LRR consensus se-quences, and they may adopt similar tertiary structures(Jones and Jones, 1997). As in porcine ribonuclease inhibitor(Kobe and Deisenhofer, 1994), the LRRs in PGIPs were pro-posed to form a curvilinear b-sheet. Also, the putative solvent-exposed flanking residues of the b-strand/b-turn structuralmotif form an extensive ligand binding surface (Leckie et al.,1999). It was also shown that substitution of a single putativesolvent-exposed amino acid in PGIP-2 enabled it to bind anovel substrate (Leckie et al., 1999). Molecular analysis ofHcr9s has revealed that sequences encoding these solvent-exposed amino acids have undergone diversifying selectionconsistent with their proposed role in determining recogni-tion specificity in these proteins (Parniske et al., 1997, 1999;Thomas et al., 1997; Parniske and Jones, 1999).
Most of the amino acids that distinguish Cf-4 and Cf-9are putative solvent-exposed amino acids of the b-strand/b-turn structural motif (Figure 1). Our analysis has shownthat only a fraction of these variant amino acids are requiredfor Cf-4 and Cf-9 function. The analysis of chimeras that in-duced an Avr4-dependent HR demonstrated that importantvariant amino acids required for Cf-4 function are located inLRRs 11 and 12 (Figure 6B). Four times as many Cf-4/Cf-9shuffled clones that could induce an HR recognized Avr4(Figure 6B). This may reflect the fact that important sequence
Figure 5. Characterization of Single Amino Acid and LRR Copy Number Variants of Cf-4 and Cf-9.
Suspensions of Agrobacteria containing Cf-4DS or Cf-9DS were infiltrated into the left-hand side of leaves of transgenic N. benthamiana plantsexpressing 35S:Avr4 or 35S:Avr9. Agrobacteria containing test constructs were infiltrated into the right-hand side of each leaf. The ability to in-duce an Avr9-dependent HR by Cf-9[L457F] and Cf-9[K511N] was compared with Cf-9DS in (A) and (B), respectively. The Avr4-dependent HRsinduced by Cf-4[F400L] and Cf-4[N454K] were compared with a Cf-4DS control in (C) and (D). Leaves were infiltrated with Agrobacteria contain-ing the LRR copy number variants Cf-4[12LRR] or Cf-9[D2LRR] in (E) and (F), respectively.
266 The Plant Cell
Figure 6. Schematic Representation of Cf-4/Cf-9 Shuffling and Protein Sequences of Chimeras That Induce an Avr4- or Avr9-Dependent HR.
Recognition Specificity in Cf-4 and Cf-9 267
determinants of Cf-4 function are located on two contiguousLRRs. Analysis of clone V12 suggests that the most impor-tant variant amino acids for Cf-4 function may be located inLRR 11 (Figure 6B). This will be tested in the future by sub-stituting variant amino acids of Cf-4 LRRs 11 and 12 withthe corresponding amino acids from Cf-9. Cf-4 LRRs 11 and12 contain only eight amino acids that distinguish it from Cf-9,five of which are putative solvent-exposed residues (Q329,I330, and W332 in LRR 11, I353 and G354 in LRR 12).Amino acids I330 and W332 in LRR 11 and G354 in LRR 12of Cf-4 are located where maximum variation in amino acidcomposition (seven in total for each position) was observedin a comparison of 18 Hcr9 sequences (Figure 6B). This isconsistent with a previous suggestion that the hypervariablesequences within the central LRRs of domain C1 are impor-tant determinants of recognition specificity in Hcr9 proteins(Parniske et al., 1997).
In Cf-9, some variant amino acids required for full Avr9-dependent induction of an HR are located in LRRs 1 to 9(Figures 4 and 6B). Therefore, in Cf-9 the sequences re-quired for function may be dispersed over a greater numberof LRRs. Additional sequences required for Cf-9 functionmay also be located in the region delimited by LRRs 10 to15, and these may be identified from the analysis of addi-tional Cf-4/Cf-9 chimeras. This region contains the two ad-ditional LRRs in Cf-9 and 13 of the 67 variant amino acidsthat distinguish it from Cf-4, nine of which are putative sol-vent-exposed residues of the b-strand/b-turn structural mo-tif. Two solvent-exposed amino acids, L457 and K511, inLRRs 16 and 18 could not be substituted with the corre-sponding Cf-4 amino acids F400 and N454 (Figures 5A and5B), and these residues appear to be absolutely required forCf-9 function. In the comparison of 18 Hcr9 sequences (Fig-ure 6B), five different amino acids were found at the positionoccupied by L457 in Cf-9 LRR 16, demonstrating that thisposition is also hypervariable, whereas only two were foundat the position occupied by K511 in LRR 18. In contrast with
amino acid A433 in LRR15 and other sequences in LRRs 1 to9 of Cf-9, L457 and K511 may be essential residues that con-tact with the Cf-9 ligand or a signaling partner protein that ac-tivates the plant defense response (Dixon et al., 2000).
Although our analysis has identified functional variantamino acids in Cf-4 and Cf-9, it could not address the po-tential role of conserved sequences in ligand recognition orsignaling. The substitution of LRRs 1 to 10 of Cf-4 with se-quences from Cf-9 did not compromise its function, sug-gesting that none of the variant amino acids in this regionare required for Cf-4 function. Alternately, these amino acidsmay be effectively substituted with the corresponding se-quences from Cf-9, or additional functional sequences inthis region might be conserved between Cf-4 and Cf-9. Theidentification of additional functional sequences will be ad-dressed in the future by analyzing functional chimeras pro-duced by shuffling Cf-4 and Cf-9 together with manypolymorphic Hcr9s (Parniske et al., 1997, 1999; Thomas etal., 1997; Parniske and Jones, 1999).
LRR Copy Number Variation in Cf Proteins
If the only important sequence determinants of Cf-4 functionare located in Cf-4 LRRs 11 and 12, the insertion of addi-tional LRRs distal to this region might not compromise itsfunction. However, both the Cf-4 and Cf-9 LRR copy num-ber variants tested were unable to induce an HR in tobaccoleaves (Figures 5E and 5F). Also, all of the Cf-4/Cf-9 shuffledclones that induced an Avr4-dependent HR contained 25LRRs, as in Cf-4 (Figure 6B). DNA sequence analysis ofrandomly selected clones revealed several chimeras thatcontained Cf-4 LRRs 11 to 16 plus insertions of the two ad-ditional Cf-9 LRRs (data not shown). Therefore, the absenceof clones that recognize Avr4 and that contained 27 LRRs, asin Cf-9, was not due to their absence from the population ofCf-4/Cf-9 shuffled clones. Similarly, all chimeras that induced
Figure 6. (continued).
(A) Shuffling Cf-4 and Cf-9. Gel-purified XhoI (X) to SacI (S) fragments incorporating Cf-4 and Cf-9 sequences extending from an engineeredrecognition sequence for ClaI (C) at their translation start sites to an internal HindIII (H) site in LRR 19 of Cf-4 and LRR 21 of Cf-9 (see Figure 1)were digested with the restriction enzymes shown. The sites for restriction enzymes in template DNAs are represented by vertical white lines.Restriction fragments were mixed in various combinations, as indicated in the figure, and shuffled according to the scheme shown. Additionaldetails are described in Methods. Hypothetical shuffled clones are indicated at right.(B) As in Figure 2, only the amino acids that distinguish Cf-4 and Cf-9 are shown. Labeling of the various structural domains is also as describedin Figure 2. Amino acids that correspond to solvent-exposed residues of the LRR b-strand/b-turn structural motif are indicated with a boldface x.The colored boxes illustrate the number of different amino acids found at the same location when the sequences of 18 Hcr9 proteins were com-pared (Parniske et al., 1997, 1999; Thomas et al., 1997; Parniske and Jones, 1999). Red, seven amino acids; yellow, six amino acids; green, fiveamino acids; blue, four amino acids; light gray, three amino acids; dark gray, two amino acids. The predicted amino acid sequences of clonesthat induce an Avr4- (middle section) or Avr9- (bottom section) dependent HR are shown. The names of individual clones are indicated at left.The HR-inducing activity of clones that recognize Avr4 (blue 1) or Avr9 (red 1) at 3 and 6 days after infiltration (dpi) also are shown. The clonesare ranked according to the severity of the HR they induced at six dpi: (1111), fully necrotic leaf panel; (111), necrosis in 75% of leaf panel;(11), necrosis in 50% of leaf panel; (1), necrotic lesions in infiltrated panel. All scores represent the mean values from at least four independentassays in N. benthamiana.
268 The Plant Cell
an Avr9-dependent HR contained 27 LRRs, as in Cf-9 (Figure6B). As in other LRR proteins, such as porcine ribonucleaseinhibitor (Kobe and Deisenhofer, 1994), it is likely that thespacing between specific functional sequences that contactwith the ligand (as determined by the number of interveningLRRs) is critical for Cf protein function. Whether this criticalspacing is required between LRRs 11 and 12 of Cf-4, andLRRs 16 and 18 of Cf-9, and sequences located proximally(such as domain B) or distally in each protein is unknown.
Unequal crossing-over in R genes resulting in variation inLRR copy number in R proteins is thought to be an impor-tant process for generating novel recognition specificities(Ellis et al., 2000). In Hcr2 proteins, more extensive variationin LRR copy number was observed in the LRRs of domainC1 than was observed in Hcr9s (Parniske et al., 1997; Dixon
et al., 1998; Thomas et al., 1998). For example, the Cf-5 andHcr2-5D proteins differ only in the number of their N-termi-nal LRRs (32 and 34 LRRs, respectively), but only Cf-5 de-termines Avr5-dependent resistance to C. fulvum infection(Dixon et al., 1998). Successive rounds of duplication anddeletion events involving sequences encoding LRRs alsohas also been proposed to account for the generation ofnovel recognition specificities at the RPP5 locus in Arabi-dopsis and the flax L and M loci (Ellis et al., 2000).
We have demonstrated that sequence variation in thecentral LRRs of domain C1 and variation in LRR copy num-ber make a crucial contribution to recognition specificity inthe tomato Cf-4 and Cf-9 proteins. This report describes theuse of gene shuffling to characterize plant genes. Furtheranalysis of gene chimeras should facilitate the identification
Table 2. Oligonucleotide Primers Used in This Study
Name Sequence Polarity Comments
CTOM1 TTACACAACCCATCGATGCACTAAAAAa (2) Cf-4 ClaI at ATGCTOM2 GCAACGGAGATCTAGCTCAATCACTTG (2) Cf-4/9 insert BglII siteCTOM3 CATGTTCTTGAACTCAAGAAGAGCAAG (2) Cf-4 remove 59 XbaI/EcoRICTOM4 TTGATCTAGCTCGGCTGGAGTTGTCAC (2) Cf-4/9 remove 39 PvuIICTOM5 GGGAAACCTAACCGTCAGCTGGGGATT (2) Cf-4/9 insert 59 PvuIICTOM6 ATTTGATCTCAAACTTAAAATCTTCAA (2) Cf-4/9 remove 39 HindIIICTOM7 ACGAAGAACGTAAAGCTTAGAAAGATG (2) Cf-4 insert 59 HindIIICTOM8 ACGAAGAACGTGAAGCTTAGAAAGGTG (2) Cf-9 insert 59 HindIIICTOM9 TCCAACAAGATCCCCAATAATGCTTGG (2) Cf-4/9 remove 39 BglIISJT-15 GTTTTACACAATCCATCGATGCACTAA (2) Cf-9 ClaI at ATGSJT-16 TTGGCTGCAACGGAGATCTAGCGCAAT (2) Cf-9 insert BglII site35S1 CTCTGCCGACAGTGGTCCCAAAGA (1) CaMV 35S primer F2 GCTTGGAATATGACCTTCAAATCTG Cf-9 primerF5 GAGAAGTAATTGTAGGTTCTTCTGG Cf-9 primerF6 GAGTTCAAGTCCAAAACATTAAGTG Cf-9 primerF19 ATAAGAACATACGTAGAC Cf-9 primerM1 TATTCCGAATTCACTCCTAAACCAGAAGAACCTACAATTTCTTCTCCT (1) Cf-9 primer for clone Cf-9[L457F]-EcoRI siteM2 TCGCATTTGGATCTTAGCAACAACAGACTTAGT (1) Cf-9 primer for clone Cf-9[K510N]-BstYI siteM3 ACTAAGTCTGTTGTTGCTAAGATCCAAATGCGA (2) Cf-9 primer for clone Cf-9[K510N]-BstYI siteM4 GGATCCGATATCACCAAGGTGCAAAAACACTAT (2) Cf-9 primer for clone Cf-9[D2LRR]-EcoRV siteM5 GGATCCGTTAACCATCTTGAAGGACCAATTCCATCCAACATAAGCGGA (1) Cf-9 primer for clone Cf-9[D2LRR]-HpaI siteM12 GGATCCGATATCGTAACAATAATCAGAAGCATTAGG (2) Cf-9 primer for clone Cf-4[D9B]-EcoRV siteM13 GGATCCAGGCCTAGAACTCTTTCTTGGAACAAAAGC (1) Cf-9 primer for clone Cf-4[D9B]-StuI siteM14 GGATCCAATATTCAGTCATATAGAAGAACTCTTTCTTGGAAC (1) Cf-4 primer for clone Cf-4[110B]-SspI siteM15 GGATCCGATATCTACGTATGTTCTTATGTCGTAACAATAATCAGAAGC (2) Cf-4 primer for clone Cf-4[110B]-EcoRV siteM16 CTTGAAGGGCCCATTTCCCATTTCACGATA (1) Cf-4 primer for clone Cf-4[12LRR]-ApaI siteM17 TGGAATGGGCCCAGTTAGGGAATTGGATGA (2) Cf-4 primer for clone Cf-4[12LRR]-ApaI siteM18 GGATCCGGGCCCATTCCATCCAACGTAAGCGGA (1) Cf-9 primer for clone Cf-4[12LRR]-ApaI siteM19 GGATCCGGGCCCTTCAAGATGGTTATTATTAAG (2) Cf-9 primer for clone Cf-4[12LRR]-ApaI siteM20 GAATTCAATATTCTTAAGAAGCAATTCAAAATT (2) Cf-4 primer for clone Cf-9[4/4LRR]-SspI site M21 GAATTCGAGCTCACCCAATTAAGAGAACTCAACCTT (1) Cf-9 primer for clone Cf-9[4/4LRR]-EcoICRI siteM22 GAATTCCACGTGAGAAGAGAAATTCAAAGGAATAGT (2) Cf-4 primer for clone Cf-9[4/5LRR]-PmlI siteM23 GAATTCGAGCTCACAACTCTACAACTTTCAGGC (1) Cf-9 primer for clone Cf-9[4/5LRR]-EcoICRI siteM24 GAATTCCACGTGGAAAACTCTTTCGGGCAATATCCC (2) Cf-4 primer for clone Cf-9[4/6LRR]-PmlI siteM25 GAATTCGAGCTCTCCAACTTACAATCCCTTCAT (1) Cf-9 primer for clone Cf-9[4/6LRR]-EcoICRI siteSR1 AGAACTAGTGGATCCCCCGGG Gene shuffling primerSF2 CGAGGTCGACGGTATCGATGG Gene shuffling primer
a Sequences shown in boldface type correspond to specific restriction enzyme sites.
Recognition Specificity in Cf-4 and Cf-9 269
of additional functional sequences in these proteins. Geneshuffling of Hcr9s could also be used to generate large librariesof chimeras with a potentially vast spectrum of recognition spe-cificities. As a result, it may be possible to identify R proteinsthat recognize defined pathogen-encoded proteins as a meansto engineer novel disease resistance specificities in plants.
METHODS
Construction of Clones Cf-4DS and Cf-9DS
To facilitate the construction of Cf-4/Cf-9 chimeras, we generatedtwo clones (Cf-4DS and Cf-9DS) by oligonucleotide mutagenesisthat contained sites for ClaI, BglII, HindIII, and PvuII in the 59 halvesof each gene (Figure 1). Recognition sequences for these enzymeswere removed from their 39 halves. The novel restriction sites wereintroduced in sequences at the 59 end of the open reading frames(ClaI) or in sequences that encode identical amino acids in each pro-tein (BglII, HindIII, and PvuII). None of the nucleotide substitutions af-fect the predicted amino acid composition of Cf-4 and Cf-9.
Cf-4DS and Cf-9DS were constructed as follows. A 6.0-kb PstIfragment encompassing Cf-4 and 3.0 kb of 59 flanking DNA (Thomaset al., 1997) was isolated from clone p129P6 (Thomas et al., 1997).A 7.5-kb PstI fragment encompassing Cf-9 was isolated frompSLJ8146 (Hammond-Kosack et al., 1998). Both fragments werecloned into pSLJ8131, a pUC119 derivative that contains sites forXbaI, SalI, PstI, and BamHI only. Single-stranded DNA containing thesense (1) strand of Cf-4 or Cf-9 was prepared as template for oligo-nucleotide mutagenesis as described by Jones et al. (1992). Pairs ofmutagenic primers were used sequentially to introduce novel sites forthe restriction enzymes ClaI, BglII, HindIII, and PvuII into the 59 halvesof Cf-4 and Cf-9 and to remove existing sites for these enzymes fromtheir 39 halves. Details of all oligonucleotides used in this study areshown in Table 2. The coding sequences of the mutagenized Cf-4 andCf-9 clones were verified by DNA sequence analysis on an AppliedBiosystems 377 sequencer (Foster City, CA). The mutagenized Cf-4and Cf-9 clones that contained the 39 untranslated region, an intron,and transcription termination sequences (Thomas et al., 1997) wereexcised as ClaI-BamHI fragments. The ClaI-BamHI cassettes werecloned into a modified version of pBluescript KS1 that lacked sites forEcoRI, HindIII, and PvuII to facilitate the reciprocal exchange of DNAfragments; these clones were designated Cf-4DS and Cf-9DS.
Chimeras Generated by Polymerase ChainReaction–Mediated Mutagenesis
Additional constructs containing sequence insertions/deletions, vari-able numbers of leucine-rich repeats (LRRs), reciprocal exchanges ofLRRs, or defined single amino acid exchanges (Figure 2) were gener-ated by polymerase chain reaction (PCR)–mediated mutagenesis.PCR amplification (20 cycles of 948C for 15 sec, 558C for 15 sec, and728C for 45 sec) was performed with a mixture of Amplitaq DNA poly-merase (Gibco BRL, Paisley, UK) and native Pfu DNA polymerase(Promega) at a unit ratio of 160:1. Suitable cassettes for cloning wereproduced by PCR amplification of two products that were digestedwith restriction enzymes to leave blunt termini that were ligated withT4 DNA ligase (Gibco BRL). The ligation products were reamplified
with two of the original 59 flanking primers and digested with two re-striction enzymes for cloning into Cf-9DS or Cf-4DS.
Recombinant domain B fragments were synthesized as follows. Forclone Cf-4[D9B], two fragments were amplified from a clone contain-ing 35S:Cf-9DS by using primer pairs 35S1/M12 and M13/CTOM8.The fragments were digested with EcoRV and StuI, respectively, li-gated, and then reamplified with 35S1/CTOM8. The final amplificationproduct was digested with ClaI and BglII and cloned into the corre-sponding region in Cf-4DS. For clone Cf-4[110B], two DNA fragmentswere PCR amplified from a clone containing 35S:Cf-4DS with primerpairs 35S1/M15 and M14/CTOM7. The products were digested withSspI and EcoRV, respectively, ligated, and then reamplified with 35S1and CTOM7. The PCR product was digested with ClaI and BglII andcloned into the corresponding region of Cf-4DS (Figure 2).
In construct Cf-9[D2LRR], two LRRs were deleted from Cf-9DS.Two fragments were amplified from Cf-9DS by using primer pairsF19/M4 and M5/F5. The PCR products were digested with HindIII-EcoRV and HpaI-EcoRI, respectively, and ligated directly into HindIII-EcoRI–digested Cf-9DS. To insert two LRRs from Cf-9 into Cf-4, wefirst introduced an ApaI site (GGGCCC) into Cf-4DS at sequencesencoding G316 and P317 of Cf-4. This was achieved by PCR ampli-fication with primer pairs 35S1/M17 and M16/F5 using Cf-4DS as atemplate. The PCR products were digested with PvuII-ApaI andApaI-EcoRI and cloned into PvuII-EcoRI–digested Cf-4DS. A PCRproduct encoding two LRRs from Cf-9 between P328 and G373, anddelimited by ApaI sites, was amplified from Cf-9DS using primersM18 and M19. The DNA was digested with ApaI and cloned into theApaI-digested vector described above after treatment with shrimpalkaline phosphatase. Clones with ApaI inserts in the desired orien-tation were identified by PCR analysis with primers 35S1/M19 anddesignated Cf-4[12LRR].
The clones Cf-9[4/4LRR], Cf-9[4/5LRR], and Cf-9[4/6LRR] weregenerated by a similar strategy. For clone Cf-9[4/4LRR], two frag-ments were amplified using primers M14/M20 and M21/F5 that weredigested with SspI and EcoICRI, respectively. For clone Cf-9[4/5LRR], fragments were amplified with M14/M22 and M23/F5 and di-gested with PmlI and EcoICRI; for clone Cf-9[4/6LRR], fragmentswere generated with M14/M24 and M25/F5 and also digested withPmlI and EcoICRI. Appropriate fragment pairs were ligated, reampli-fied with M14 and F5, digested with BglII and PvuII, and cloned intothe corresponding region of Cf-9[4CP] (see Figure 2).
Two clones containing single amino acid substitutions in the 39 halfof Cf-9 were generated as follows. Primers M1 and F2 were used toamplify a product from a wild-type Cf-9 clone. The PCR product wasdigested with EcoRI and HindIII. This fragment was used to replacethe corresponding region in a wild-type Cf-9 clone. The 39 half of thisclone was excised as an EcoRI-BamHI fragment and used to replacethe corresponding region in Cf-9DS and Cf-4DS to generate clonesCf-9[L457F] and Cf-4[N454K]. A similar strategy was used to gener-ate Cf-9[K511N]. Two fragments were PCR amplified using primersF6/M3 and M2/F2. The products were digested with EcoRI-BstYIand HindIII-BstYI, respectively, and cloned directly into the corre-sponding region of the wild-type Cf-9 clone. The EcoRI-BamHI frag-ment was subcloned as described above into Cf-9DS and Cf-4DS togenerate clones Cf-9[K511N] and Cf-4[F400L].
Cf-4 and Cf-9 Gene Shuffling
Two XhoI-SacII fragments from pSLJ12574 and pSLJ12575 thatcontained sequences extending from the 59end of the Cf-4 and Cf-9
270 The Plant Cell
reading frames to their internal HindIII sites were prepared fromagarose gels. These fragments were flanked by pBluescript KS1 poly-linker sequences and contained all of the polymorphic sequencesthat distinguish Cf-4 from Cf-9.
The purified fragments were fragmented further by restriction en-zyme digestion to increase the frequency of template switching duringreassembly (Kikuchi et al., 1999). Four micrograms of Cf-9 DNA was di-gested with Tsp509I or a combination of Tru9I and RsaI. Four micro-grams of the Cf-4 fragment was digested with VIJI* (Chimerx,Milwaukee, WI) or a combination of AluI and XmnI. The DNAs wereelectrophoresed in a nondenaturing 6.5% (w/v) polyacrylamide gel, andfragments in the length range 20 to 400 bp were eluted overnight at378C in a buffer containing 0.5 M ammonium acetate, 10 mM magne-sium acetate, 1 mM EDTA, pH 8.0, and 0.1% (w/v) SDS. The DNA wasrecovered by phenol:chloroform extraction and ethanol precipitation.
Equimolar amounts of Cf-4 and Cf-9 restriction fragments weremixed in different combinations (see Figure 6A) and used in a primer-free amplification reaction at a final concentration of 10 ng/mL. Allamplification steps were performed with native Pfu DNA polymerasefrom Pyrococcus furiosus strain Vc1 DSM3638 (Promega, Madison,WI) to reduce the frequency of point mutations (Zhao and Arnold,1997). Reactions were incubated at 958C for 2 min and then 15 cy-cles of 958C for 30 sec, 558C for 30 sec, and 738C for 1 min (110 secper cycle). The reaction products were then treated at 958C for 30sec and 558C for 30 sec. The four mixtures were combined (see Fig-ure 6A), and a second round of primer-free PCR was performed asfollows: 738C for 3 min 40 sec followed by 25 cycles of 958C for 30sec, 558C for 30 sec, and 738C for 3 min 40 sec followed by a finalextension phase of 7 min at 738C. To recover shuffled Cf-4 and Cf-9sequences, we amplified aliquots of this mixture with pBluescript prim-ers SR1 and SF2 (Table 2) as follows: 958C for 2 min and 31 cycles of958C for 15 sec, 648C for 30 sec, and 738C for 3 min 30 sec. The re-action was completed by a further incubation at 738C for 7 min.
Expression Vectors for Domain Swap Constructs and Cf-4/Cf-9 Shuffled Clones
For stable expression in tomato (Lycopersicon esculentum) or to-bacco (Nicotiana tabacum), chimeras were excised as ClaI-BamHIfragments and cloned into a derivative of the T-DNA binary vectorpSLJ7291 containing the native Cf-4 promoter (Thomas et al., 1997).For Agrobacterium tumefaciens–mediated transient expression, theClaI-BamHI cassettes were cloned into pBin19 containing a 1.4-kbDNA fragment derived from vector pSLJ4K1 (Jones et al., 1992) thatcontains the cauliflower mosaic virus (CaMV) 35S promoter.
The products of Cf-4/Cf-9 gene shuffling were digested with ClaIand HindIII and ligated into the vector pSLJ12904 that had been di-gested with ClaI and HindIII and gel purified. This pBin19-derived vec-tor contains the CaMV 35S promoter and a ClaI-HindIII cassetteencoding part of the jellyfish green fluorescent protein fused to a HindIII-BamHI fragment that contains the 39 terminal coding sequences and39 untranslated region of the Cf-9 gene. The ligation products wereelectroporated into Agrobacterium strain GV3101, and kanamycin-resis-tant clones were picked into 384-well microtiter plates.
Initially, Cf-4/Cf-9 chimeras were cloned into pBin19 and electropo-rated into Agrobacterium strain C58C1 containing the helper plasmid
pCH32 that overexpresses the virD2 and virE genes (Hamilton et al.,1996). Transformants were selected on nutrient agar plates contain-ing tetracycline (2 mg mL21) and kanamycin (40 mg mL21). Single col-onies subsequently were streaked on minimal medium agar platescontaining tetracycline and kanamycin. These clones and Cf-4/Cf-9shuffled clones in Agrobacterium strain GV3101 were prepared fortransient expression in plants as follows. Stationary phase bacterialcultures were suspended in a solution containing 10 mM 2-[N-mor-pholino]ethanesulfonic acid, pH 6.0, 10 mM MgCl2, and 150 mM ace-tosyringone for 3 hr at room temperature.
Bacterial suspensions usually were infiltrated into N. benthamianaleaves by using a syringe as described previously (Thomas et al.,2000). Reproducible results also were obtained after infiltration intotobacco. In most experiments reported here, Agrobacterium suspen-sions were infiltrated into leaves of transgenic N. benthamiana or to-bacco plants expressing either 35S:Avr4 or 35S:Avr9. For preliminaryscreening experiments, F1 hybrids expressing both transgenes wereanalyzed. Occasionally, mixtures of Agrobacterium suspensions ex-pressing a test construct and Agrobacteria expressing 35S:Avr4 or35S:Avr9 were coinfiltrated into leaves of wild-type N. benthamianaplants. However, the development of the hypersensitive response(HR) in these assays was slower than in the assays described above.
Inoculations with Cladosporium fulvum
Three- to 4-week-old plants were inoculated with C. fulvum race 5 orrace 5.9 spore suspensions and scored for resistance or diseasesensitivity 14 days after inoculation as described previously (Thomaset al., 1997).
Transformation of Cf0 Tomato
Binary vector plasmids were mobilized from Escherichia coli DH5a
into Agrobacterium strain LBA4404 as described by Jones et al.(1992). Transformation of tomato Cf0 Moneymaker cotyledons andplant regeneration were performed as described previously (Thomaset al., 1997).
ACKNOWLEDGMENTS
The Sainsbury Laboratory is funded by the Gatsby Charitable Foun-dation. Part of this research was funded by a grant from the EuropeanCommunity (EC Biotech BIO4 CT96 0515). B.B.H.W received fundingfrom the Danish Research Academy. We thank Andrew Davis forplant photography, Sara Perkins and Justine Campling for their ex-cellent horticultural assistance, and David Baker and Patrick Bovillfor DNA sequencing. We are grateful to Saijun Tang for providingp8131 and several oligonucleotides, Julia Krueger and Leif Schauserfor constructive comments on the manuscript, and Martin Parniskeand Paul Schulze-Lefert for useful discussions on gene shuffling. Weare also grateful to three reviewers for their suggestions on improvingthe manuscript.
Received August 21, 2000; accepted November 10, 2000.
Recognition Specificity in Cf-4 and Cf-9 271
REFERENCES
Crameri, A., Raillard, S.-A., Bermudez, E., and Stemmer, W.P.C.(1998). DNA shuffling of a family of genes from diverse speciesaccelerates directed evolution. Nature 391, 288–291.
Dixon, M.S., Hatzixanthis, K., Jones, D.A., Harrison, K., andJones, J.D.G. (1998). The tomato Cf-5 disease resistance geneand six homologs show pronounced allelic variation in leucine-rich repeat copy number. Plant Cell 10, 1915–1925.
Dixon, M.S., Golstein, C., Thomas, C.M., Van der Biezen, E.A.,and Jones, J.D.G. (2000). Genetic complexity of pathogen per-ception by plants: The example of Rcr3, a tomato gene requiredspecifically by Cf-2. Proc. Natl. Acad. Sci. USA 97, 8807–8814.
Ellis, J., Dodds, P., and Pryor, T. (2000). Structure, function andevolution of plant disease resistance genes. Curr. Opin. Plant Biol.3, 278–284.
Hamilton, C.M., Frary, A., Lewis, C., and Tanksley, S.D. (1996).Stable transfer of intact high-molecular-weight DNA into plantchromosomes. Proc. Natl. Acad. Sci. USA 93, 9975–9979.
Hammond-Kosack, K.E., Harrison, K., and Jones, J.D.G. (1994).Developmentally regulated cell death on expression of the fungalavirulence gene Avr9 in tomato seedlings carrying the disease-resistance gene Cf-9. Proc. Natl. Acad. Sci. USA 91, 10445–10449.
Hammond-Kosack, K.E., Staskawicz, B.J., Jones, J.D.G., andBaulcombe, D.C. (1995). Functional expression of a fungal aviru-lence gene from a modified Potato Virus X. Mol. Plant-MicrobeInteract. 8, 181–185.
Hammond-Kosack, K.E., Tang, S.J., Harrison, K., and Jones,J.D.G. (1998). The tomato Cf-9 disease resistance gene functionsin tomato and potato to confer responsiveness to the fungal aviru-lence gene product Avr9. Plant Cell 10, 1251–1266.
Jones, D.A., and Jones, J.D.G. (1997). The role of leucine-richrepeat proteins in plant defences. Adv. Bot. Res. Inc. Adv. PlantPathol. 24, 89–167.
Jones, D.A., Thomas, C.M., Hammond-Kosack, K.E., Balint-Kurti, P.J., and Jones, J.D.G. (1994). Isolation of the tomato Cf-9gene for resistance to Cladosporium fulvum by transposon tag-ging. Science 266, 789–793.
Jones, J.D.G., Shlumukov, L., Carland, F.J., Scofield, S., Bishop,G., and Harrison, K. (1992). Effective vectors for transformation,expression of heterologous genes, and assaying transposon exci-sion in transgenic plants. Transgenic Res. 1, 285–297.
Joosten, M.H.A.J., Cozijnsen, T.J., and De Wit, P.J.G.M. (1994).Host resistance to a fungal tomato pathogen lost by a singlebase-pair change in an avirulence gene. Nature 367, 384–386.
Joosten, M.H.A.J., Vogelsang, R., Cozijnsen, T.J., Verberne,M.C., and De Wit, P.J.G.M. (1997). The biotrophic fungus Cla-dosporium fulvum circumvents Cf-4-mediated resistance by pro-ducing unstable AVR4 elicitors. Plant Cell 9, 367–379.
Kajava, A.V. (1998). Structural diversity of leucine-rich repeat pro-teins. J. Mol. Biol. 277, 519–527.
Kamoun, S., Honee, G., Weide, R., Lauge, R., Kooman-Gersmann,
M., De Groot, K., Govers, F., and De Wit, P.J.G.M. (1999). The fun-gal gene Avr9 and the oomycete gene inf1 confer avirulence topotato virus X on tobacco. Mol. Plant-Microbe Interact. 12, 459–462.
Kikuchi, M., Ohnishi, K., and Harayama, S. (1999). Novel familyshuffling methods for the in vitro evolution of enzymes. Gene 236,159–167.
Kobe, B., and Deisenhofer, J. (1994). The leucine-rich repeat: Aversatile binding motif. Trends Biochem. Sci. 19, 415–421.
Leckie, F., Mattei, B., Capodicasa, C., Hemmings, A., Nuss, L.,Aracri, B., De Lorenzo, G., and Cervone, F. (1999). The specific-ity of polygalacturonase-inhibiting protein (PGIP): A single aminoacid substitution in the solvent-exposed b-strand/b-turn region ofthe leucine-rich repeats (LRRs) confers a new recognition capabil-ity. EMBO J. 18, 2352–2363.
Marmeisse, R., Van den Ackervecken, G.F.J.M., Goosen, T., DeWit, P.J.G.M., and Van den Broek, H.W.J. (1993). Disruption ofthe avirulence gene Avr9 in 2 races of the tomato pathogen Cla-dosporium fulvum causes virulence on tomato genotypes with thecomplementary resistance gene Cf-9. Mol. Plant-Microbe Inter-act. 6, 412–417.
Parniske, M., and Jones, J.D.G. (1999). Recombination betweendiverged clusters of the tomato Cf-9 plant disease resistancegene family. Proc. Natl. Acad. Sci. USA 96, 5850–5855.
Parniske, M., Hammond-Kosack, K.E., Golstein, C., Thomas,C.M., Jones, D.A., Harrison, K., Wulff, B.B.H., and Jones,J.D.G. (1997). Novel disease resistance specificities result fromsequence exchange between tandemly repeated genes at the Cf-4/9 locus. Cell 91, 821–832.
Parniske, M., Wulff, B.B.H., Bonnema, G., Thomas, C.M., Jones,D.A., and Jones, J.D.G. (1999). Homologues of the Cf-9 diseaseresistance gene (Hcr9s) are present at multiple loci on the shortarm of tomato chromosome 1. Mol. Plant-Microbe Interact. 12,93–102.
Piedras, P., Rivas, S., Droge, S., Hillmer, S., and Jones, J.D.G.(2000). Functional, c-myc-tagged Cf-9 resistance gene productsare plasma-membrane localized and glycosylated. Plant J. 21,529–536.
Scofield, S.R., Tobias, C.M., Rathjen, J.P., Chang, J.H., Lavalle,D.T., Michelmore, R.W., and Staskawicz, B.J. (1996). Molecularbasis of gene-for-gene specificity in bacterial speck disease oftomato. Science 274, 2063–2065.
Stemmer, W.P.C. (1994). Rapid evolution of a protein in vitro byDNA shuffling. Nature 370, 389–391.
Tang, X., Frederick, R.D., Zhou, J., Halterman, D.A., Jia, Y., andMartin, G.B. (1996). Initiation of plant disease resistance by phys-ical interaction of AvrPto and Pto kinase. Science 274, 2060–2063.
Thomas, C.M., Jones, D.A., Parniske, M., Harrison, K., Balint-Kurti, P.J., Hatzixanthis, K., and Jones, J.D.G. (1997). Charac-terization of the tomato Cf-4 gene for resistance to Cladosporiumfulvum identifies sequences that determine recognitional specific-ity in Cf-4 and Cf-9. Plant Cell 9, 2209–2224.
Thomas, C.M., Dixon, M.S., Parniske, M., Golstein, C., andJones, J.D.G. (1998). Genetic and molecular analysis of tomato
272 The Plant Cell
Cf genes for resistance to Cladosporium fulvum. Philos. Trans. R.Soc. Lond. B Biol. Sci. 353, 1413–1424.
Thomas, C.M., Tang, S., Hammond-Kosack, K.E., and Jones,J.D.G. (2000). Comparison of the hypersensitive responseinduced by the tomato Cf-4 and Cf-9 genes in Nicotiana spp. Mol.Plant-Microbe Interact. 13, 465–469.
Van den Ackerveken, G.F.J.M., Van Kan, J.A.L., and De Wit,P.J.G.M. (1992). Molecular analysis of the avirulence gene Avr9 of
the fungal pathogen Cladosporium fulvum fully supports thegene-for-gene hypothesis. Plant J. 2, 359–366.
Van der Hoorn, R.A.L., Laurent, F., Roth, R., and De Wit, P.J.G.M.(2000). Agroinfiltration is a versatile tool that facilitates compara-tive analyses of Avr9/Cf-9-induced and Avr4/Cf-4-induced necro-sis. Mol. Plant-Microbe Interact. 13, 439–446.
Zhao, H., and Arnold, F.H. (1997). Optimization of DNA shuffling forhigh fidelity recombination. Nucleic Acids Res. 25, 1307–1308.
DOI 10.1105/tpc.13.2.255 2001;13;255-272Plant Cell
Brande B. H. Wulff, Colwyn M. Thomas, Matthew Smoker, Murray Grant and Jonathan D. G. JonesAvr-Dependent Hypersensitive Response by the Tomato Cf-4 and Cf-9 Proteins
Domain Swapping and Gene Shuffling Identify Sequences Required for Induction of an
This information is current as of May 23, 2018
References /content/13/2/255.full.html#ref-list-1
This article cites 29 articles, 13 of which can be accessed free at:
