1
Peptidyl-prolyl isomerase, ppiB, is essential for proteome homeostasis and 1
virulence in Burkholderia pseudomallei 2
3
Nicole M. Bzdyl1, Nichollas E. Scott2, Isobel H. Norville3, Andrew E. Scott3, Timothy 4
Atkins3, Stanley Pang4, Derek S. Sarovich5, Geoffrey Coombs4,6, Timothy J. J. Inglis1,6,7, 5
Charlene M. Kahler1 and Mitali Sarkar-Tyson1 6
7
1Marshall Centre for Infectious Diseases Research and Training, School of Biomedical 8
Sciences, University of Western Australia, Perth, WA, Australia 9
2Department of Microbiology and Immunology, University of Melbourne at the Peter 10
Doherty Institute for Infection and Immunity, Parkville, VIC 3010 Australia 11
3Defence Science Technology Laboratory (Dstl), Porton Down, Salisbury, United 12
Kingdom 13
4School of Veterinary and Life Sciences, Murdoch University, Murdoch, Australia. 14
5GeneCology Research Centre, University of the Sunshine Coast, Sippy Downs, QLD, 15
Australia 16
6PathWest Laboratory Medicine WA, Perth, WA, Australia 17
7School of Medicine, University of Western Australia, Perth, WA, Australia 18
19
Correspondence Address: 20
IAI Accepted Manuscript Posted Online 22 July 2019Infect. Immun. doi:10.1128/IAI.00528-19Copyright © 2019 American Society for Microbiology. All Rights Reserved.
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
2
Dr Mitali Sarkar-Tyson 21
Marshall Centre for Infectious Diseases Research and Training 22
School of Biomedical Sciences 23
University of Western Australia 24
Perth, WA, Australia 25
E-mail: [email protected] 26
Tel: +61 8 6457 4872 27
28
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
3
Abstract 29
Burkholderia pseudomallei is the causative agent of melioidosis, a disease endemic in 30
South-East Asia and northern Australia. Mortality rates in these areas are high even 31
with antimicrobial treatment, and there are few options for effective therapy. Therefore 32
there is a requirement to identify anti-bacterial targets for the development of novel 33
treatments. Cyclophilins are a family of highly conserved enzymes important in multiple 34
cellular processes. Cyclophilins catalyse the cis-trans isomerization of xaa-proline 35
bonds, a rate limiting step in protein folding which has been shown to be important for 36
bacterial virulence. B. pseudomallei encodes a putative cyclophilin B gene, ppiB, the 37
role of which was investigated. A mutant strain, BpsΔppiB, demonstrates impaired 38
biofilm formation and reduced motility. Macrophage invasion and survival assays 39
showed that although BpsΔppiB retained the ability to infect macrophages, it had 40
reduced survival and lacked the ability to spread cell-to-cell, indicating ppiB is essential 41
for B. pseudomallei virulence. This is reflected in the BALB/c mouse infection model 42
demonstrating the requirement of ppiB for in vivo disease dissemination and 43
progression. Proteomic analysis demonstrates that the loss of PpiB leads to pleiotropic 44
effects supporting the role of PpiB in maintaining proteome homeostasis. The loss of 45
PpiB leads to decreased abundance of multiple virulence determinants including 46
flagellar machinery and alterations in Type VI secretion system proteins. In addition, the 47
loss of ppiB leads to increased sensitivity towards multiple antibiotics including 48
meropenem and doxycycline, highlighting ppiB inhibition as a promising anti-virulence 49
target to both treat B. pseudomallei infections and increase antibiotic efficacy. 50
51
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
4
Introduction 52
Burkholderia pseudomallei is a Gram-negative soil saprophyte found in tropical and 53
sub-tropical areas around the world such as in South-East Asia and northern Australia 54
(1-3). It is the causative agent of melioidosis and has been reported in 45 countries with 55
a predicted global burden of 165,000 cases and 89,000 deaths annually (4). Melioidosis 56
can present as a variety of clinical syndromes ranging from non-healing skin lesions to 57
intra-abdominal abscesses to pneumonia and septicaemia (5), leading to difficulty in 58
prompt diagnosis particularly in non-endemic regions. Mortality rates vary depending on 59
geographic location with rates ranging from 14% in Darwin (5) to 49% in North-East 60
Thailand (6). Treatment of melioidosis is prolonged, consisting of two phases; a two-61
week intensive intravenous phase followed by a 3 to 6-month oral eradication phase (7, 62
8). Due to intrinsic resistance to antimicrobials (9) treatment of B. pseudomallei infection 63
can be further complicated by the limited number of viable antimicrobial alternatives. 64
Relapse of infection is common and is associated with increased mortality, particularly 65
in cases were treatment is unsuccessful or an incomplete course of antimicrobial 66
therapy is taken (10, 11). 67
B. pseudomallei infections can be difficult to overcome due to the bacterium encoding 68
for an array of defence mechanisms which enables successful survival in diverse 69
environments including inside mammalian host cells. The ability of B. pseudomallei to 70
form biofilms allows it to persist in the environment and has been implicated in infection 71
(12-14). B. pseudomallei encodes flagellin, important for disease dissemination and 72
virulence in BALB/c mouse infection models (15, 16). Intracellular survival is reliant on 73
B. pseudomallei rapidly escaping from the phagolysosome and establishing a replicative 74
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
5
niche in the cytosol of eukaryotic cells (17). The ability to escape into the cytosol is 75
dependent on multiple secretion systems which function to deliver specialised secreted 76
proteins known as effectors into the host which enhance bacterial survival and enable 77
the spread of B. pseudomallei into neighbouring cells (18). Three different Type-III 78
Secretion Systems (T3SS-1, -2, -3) are found in B. pseudomallei with only T3SS-3 79
required for full virulence in a hamster model of infection (17, 19-21). Following 80
phagosome escape and replication in the cytosol, expression of Type-VI Secretion 81
Systems (T6SS) is induced and is essential for in vivo virulence (22-24). A well-82
documented phenomena of B. pseudomallei is the formation of multinucleated giant 83
cells (MNGC). This formation has been attributed to the T6SS-5 (T6SS Cluster 1) 84
effector VgrG-5 which is required to stimulate cell fusion and leading to the spread of 85
infection (22, 25, 26). Six clusters of T6SS are found in B. pseudomallei with T6SS 86
Cluster 1, as defined by Shalom et al (24) as tss5, shown to play a role in the formation 87
of MNGC and cellular cytotoxicity (26, 27) Throughout this paper the Schell et al (28) 88
nomenclature for T6SS will be used . 89
90
Cyclophilins are part of the immunophilin superfamily, with bacteria generally encoding 91
two cyclophilin genes, ppiA and ppiB with one located in the cytoplasm and the other in 92
the periplasm or outer membrane respectively (29). Cyclophilins catalyse the cis-trans 93
isomerisation of xaa-proline bonds, a rate limiting step in protein folding, which is 94
required for proteome homeostasis (30, 31). Not only are cyclophilins required for 95
optimal protein folding but in multiple bacterial systems cyclophilins are important for 96
stress response and infectivity, suggesting a role in folding virulence factors. In Brucella 97
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
6
abortus the expression of both CypA and CypB become elevated during intracellular 98
infection with deletion of these genes resulting in virulence attenuation, reduced 99
intracellular survival and increased susceptibility to acidic and oxidative stress (32). 100
Further evidence of the role of cyclophilins in virulence is demonstrated in Legionella 101
pneumophila where the cyclophilin gene cyp18 is essential for optimal intracellular 102
survival in Acanthaemoba castellanii (33). Cyclophilins also play an important role in 103
biofilm formation with Escherichia coli ppiB shown to be a negative regulator of both 104
motility and biofilm formation, mutagenesis of E. coli ppiB results in hypermotility and 105
increased biofilm formation (34). The pleiotropic role of cyclophilins in bacteria is also 106
demonstrated in E. coli where interaction of PpiB with the protein, FtsZ, is important for 107
correct cell division, with deletion of ppiB resulting in aberrant cell division and formation 108
of filamentous cells (35). 109
110
B. pseudomallei encodes a ppiB gene, the role of which was investigated by 111
construction of a null mutant strain Bps∆ppiB. In vitro characterisation of Bps∆ppiB 112
demonstrates a loss of multiple virulence determinants including reduced motility and 113
biofilm production. Intracellular survival of Bps∆ppiB was significantly reduced with 114
bacteria confined within the macrophage cell, lacking the ability to spread cell-to-cell, 115
indicating ppiB is important for B. pseudomallei virulence. This is reflected in the BALB/c 116
mouse infection model in which BpsΔppiB was avirulent, demonstrating the important 117
role for ppiB in in vivo disease dissemination and progression. Proteomic analysis 118
confirms widespread alterations within BpsΔppiB, that are partially restored by 119
complementation of ppiB. Consistent with this, complementation restored 120
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
7
multinucleated cell formation and cell disruption. Finally, we demonstrate that loss of 121
ppiB leads to increased susceptibly to first-line treatment antibiotics such as 122
meropenem and doxycycline. Thus, this study shows the importance of ppiB for 123
virulence of B. pseudomallei and how disruption of proteome homeostasis may be 124
targeted to sensitize B. pseudomallei to antibiotic regimes. 125
126
Results 127
Deletion of ppiB gene in B. pseudomallei. 128
BPSL2246 (UnitProt Entry Q63SS5) encodes a putative cytoplasmic cyclophilin, ppiB 129
homologue in B. pseudomallei (Supplementary Fig 1). There is 66.3% and 57.7% 130
protein identity with cyclophilin B homologues from E. coli and L. pneumophila 131
respectively, with residues involved in enzymatic activity also being conserved 132
(Supplementary Fig 1) (36). To determine the role of ppiB in B. pseudomallei strain 133
K96243, the gene was deleted by construction of an in-frame null mutation strain, 134
Bps∆ppiB (37). Deletion of ppiB in Bps∆ppiB was confirmed by whole genome 135
sequencing. In comparison to the parent K96243, strain there was one additional SNP 136
in Bps∆ppiB that resulted in a missense mutation in rpoZ (RpoZLeu10Pro). No differences 137
in growth were observed between the BpsWT and Bps∆ppiB mutant strain in either 138
Luria Bertani broth or M9 minimal media (Supplementary Fig 2). 139
140
Bps∆ppiB can infect mouse murine macrophage cells in vitro but has reduced 141
intracellular numbers 6 and 9 hours post infection. 142
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
8
Mouse murine macrophages, J774.1 cells, were infected with either the wild-type or 143
Bps∆ppiB strain, bacteria were enumerated at various time points post infection (Fig 1). 144
There were no significant differences in the levels of adherence and invasion of 145
macrophages (data not shown). Significant differences in the numbers of intracellular 146
bacteria at 6 (14-fold, P-value 0.0159, Mann Whitney U-test) and 9 (36.8-fold, P-value 147
0.0159, Mann Whitney U-test) hours post infection were seen with Bps∆ppiB 148
demonstrating reduced survival and/or replication. At 12 hours Bps∆ppiB was able to 149
overcome the reduced growth phenotype showing similar levels of intracellular bacteria 150
to that of the BpsWT parental control. At 24 hours although the levels of intracellular 151
bacteria in both BpsWT and Bps∆ppiB appears to be similar, there was a substantial 152
reduction in cell cytotoxicity caused by Bps∆ppiB compared to BpsWT using LDH 153
cytotoxicity screening (Supplementary Fig 3). Together these results demonstrate 154
Bps∆ppiB has reduced growth and/or survival in macrophage cells. 155
156
ppiB is essential for in vivo infection 157
As in vitro results demonstrated a decrease in intracellular counts during early time 158
points the role of ppiB during infection was further investigated using the BALB/c mouse 159
infection model of B. pseudomallei. Groups of mice were challenged by the 160
intraperitoneal route with either BpsWT or BpsΔppiB (Fig 2A). At the end of the 161
experiment 100% of the animals challenged with Bps∆ppiB survived compared to 33% 162
in the group challenged with BpsWT (P-value 0.0183 by Log-rank (Mantel-Cox) test). 163
Disease progression was also monitored by measuring weight loss during the infection 164
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
9
study, all except two mice infected with BpsWT showed considerable weight loss (Fig 165
2B). In contrast, mice infected with BpsΔppiB demonstrated no weight loss throughout 166
the experiment (Figs 2C). The lungs, livers and spleens in survivors were enumerated 167
for bacteraemia, all were clear from infection at the conclusion of the experiment. This 168
demonstrates that ppiB is essential for B. pseudomallei to successfully establish in vivo 169
infection. 170
171
BpsΔppiB demonstrates reduced ability to form MNGC. 172
The in vitro cell infection study suggests BpsΔppiB is attenuated, in contrast the mouse 173
infection studies demonstrate that BpsΔppiB is avirulent. To investigate this in more 174
detail a complemented strain was constructed, BpsΔppiB/ppiB, and was further 175
characterised in macrophage cells. BpsWT, Bps∆ppiB, Bps∆ppiB/ppiB infected cells 176
were analysed by immunofluorescence microscopy 12 hours post infection. Fig 3A 177
shows that during a later time point of 12 hours post infection, macrophage cells 178
infected with BpsWT has multiple MNGC formations. In contrast, Bps∆ppiB infected 179
cells demonstrate a significant reduction in multinucleated giant cell (MNGC) formation, 180
although actin protrusions are still observed (Fig 3B). Complementation of ppiB 181
demonstrates restoration to a BpsWT phenotype (Fig 3C). Enumeration of nuclei within 182
multi-nucleated cells relative to mononucleated cells shows that there is a 67.4% 183
reduction in nuclei associated with MNGCs in macrophage monolayers infected with 184
Bps∆ppiB, this is significantly restored in the complemented strain, Bps∆ppiB/ppiB (Fig 185
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
10
3D), confirming the role of ppiB in the virulence of B. pseudomallei during intracellular 186
infection. 187
188
BpsΔppiB reveals marked changes in the proteome 189
To understand the changes driving the alterations in virulence, we analysed the 190
proteome of Bps∆ppiB, its complement Bps∆ppiB/ppiB and BpsWT strains. Using label 191
free based quantitative (LFQ) proteomics, we identified 2091 proteins with high 192
consistency observed across biological replicates as determined by Pearson 193
correlations (average: 0.95, Supplementary Fig 4). Consistent with the role of PpiB in 194
multiple cellular pathways, 734 proteins underwent statistically significant alterations 195
within the proteome of BpsΔppiB compared to BpsWT (Supplementary Table 1) with 196
these proteins predicted to be localized to multiple cellular compartments (Fig 4A). 197
Consistent with the loss of PpiB in BpsΔppiB, this protein demonstrated the largest fold 198
difference of -10.14 log2 within the proteome with the majority of altered proteins also 199
showing a decreased abundance in response to loss of PpiB (Fig 4B). Upon 200
complementation, PpiB levels were restored to 10% of the level of wild-type, yet 201
consistent with phenotypic assays, this led to restoration of proteins observed to 202
increase (Fig 4C) and decrease (Fig 4D) to near wild-type levels. Within the categories 203
of proteins that had reduced abundance upon the loss of PpiB, we observed alterations 204
in multiple proteins associated with motility, consistent with the reductions in BpsΔppiB 205
including BPSL3305 (CheW, -2.78587 log2, -log10(P-value): 4.38) and BPSL3301 206
(CheB1, -2.48162 log2, -log10(P-value): 6.03) as well as the flagellin (BPSL3319, FliC -207
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
11
3.38141 log2, -log10(P-value): 5.81). Again, consistent with phenotypic assay 208
complementation only partial restoration of these proteins occurred with FliC only 209
restored by 0.9 log2. Other changes observed in response to the loss of PpiB including 210
reduction in capsule-associated proteins BSPL2799 (WcbI, -1.32 log2, -log10(P-value): 211
4.30), BSPL2800 (WcbH, -0.47 log2, -log10(P-value): 1.36), BPSL2807 (WcbC, -0.36 212
log2, -log10(P-value): 1.61) (highlighted in green in Fig 4D) and BPSL2810 (ManC, 0.80 213
log2, -log10(P-value): 2.33), as well as increases in multiple components of the Type VI 214
T6SS-3 including BPSS2099 (TssC3, 4.49 log2, -log10(P-value): 3.38) and BPSS2098 215
(Hcp3, 3.99 log2, -log10(P-value): 4.28) (highlighted in blue in Fig 4B). A KEGG 216
pathway analysis was undertaken to determine what functional pathways were being 217
affected in Bps∆ppiB (Fig 5). Metabolism accounted for 268 of differentially present 218
proteins, with 170 being increased while 98 were decreased. Genetic Information 219
Processing, Signalling and Cellular Processes, and Environmental Information 220
Processing related proteins were a majority of proteins affected. In addition, many 221
hypothetical or unassigned proteins were also differentially present. 222
223
BpsΔppiB has decreased motility and biofilm formation under nutrient rich 224
conditions. 225
Motility of B. pseudomallei has been shown to be important for successful establishment 226
of in vitro and in vivo infections (15, 16). The motility of Bps∆ppiB was determined 227
using a swarming assay (Fig 6). The mean bacterial spread from the site of inoculation 228
of the BpsWT parental strain was 48.5 mm after 24 hours. In comparison the spread of 229
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
12
Bps∆ppiB was reduced to 24.5 mm (P-value 0.0022, Mann Whitney U-test), but was not 230
restored in the complemented strain, consistent with the partial restoration of motility 231
associated proteins levels as shown by the proteomics studies. This suggests a role for 232
PpiB in motility although further research is required to determine if this is a direct effect 233
on the flagellum or due to regulatory or sensory deficits. 234
235
Another important survival mechanism in the environment and potentially for 236
establishing a chronic infection is the ability to form a biofilm. BpsΔppiB demonstrates 237
significant attenuation in the formation of biofilms under nutrient rich conditions 238
compared to BpsWT (P-value 0.0022, Mann-Whitney U-test), again this was not 239
restored in the complemented strain (Fig 6B). 240
241
BpsΔppiB has greater susceptibility to antimicrobial and intracellular stresses. 242
The reduced survival of Bps∆ppiB under both in vitro and in vivo conditions may be a 243
consequence of incorrect folding of proteins involved in resistance to intracellular 244
stresses such as peroxide and acid tolerance. This was determined by minimum 245
inhibitory concentrations (MIC) of Bps∆ppiB to hydrogen peroxide and hydrochloric acid. 246
BpsΔppiB demonstrates greater sensitivity towards oxidative stress, with a significant 3-247
fold reduction in the MIC of hydrogen peroxide exposure compared to BpsWT, which is 248
partially restored in Bps∆ppiB/ppiB (Fig 7). There was however, no increased 249
susceptibility to acid stress perhaps reflected in the ability of Bps∆ppiB to survive in 250
cells (Supplementary Table 2). 251
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
13
252
B. pseudomallei is intrinsically resistant to antimicrobials which are cleared by active 253
efflux pumps (9). It is feasible that PpiB may be involved in protein folding of some efflux 254
pumps, as such the susceptibility to antimicrobials was investigated. In particular the 255
MIC to antimicrobials that are currently used for B. pseudomallei treatment was 256
determined (Table 1). BpsΔppiB displayed a 4-fold increase in susceptibility (128 257
µg/mL to 8 µg/mL) to the 3rd-generation cephalosporin ceftriaxone. B. pseudomallei is 258
intrinsically resistant to 3rd-generation cephalosporins, indicating that some mechanism 259
of resistance is being modulated by PpiB. There was a 2-fold decrease in resistance to 260
tetracycline (2 µg/mL to 0.5 µg/mL) and its derivative doxycycline (1 µg/mL to <0.25 261
µg/mL). Tetracyclines are involved in protein synthesis inhibition and the main 262
mechanism of resistance in B. pseudomallei is efflux out of the cell, confirming a 263
potential role for ppiB in the correct folding of efflux pumps. The complemented strain, 264
Bps∆ppiB/ppiB, partially restores resistance to those of wild type levels. 265
266
Discussion 267
Previous work has demonstrated that cyclophilin B plays a role in modulating virulence 268
in a number of bacterial species resulting in attenuation in vivo (32, 33, 38, 39). 269
Consistent with these studies we demonstrate that Cyclophilin B in B. pseudomallei 270
influences multiple virulence associated phenotypes with loss of the ppiB gene resulting 271
in complete attenuation in the BALB/c mouse infection model (Fig 2). Although most 272
work has focused on the role of cyclophilins in virulence, recently the direct interaction 273
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
14
of cyclophilin B with intracellular proteins important for bacterial growth and survival 274
such as DnaK, AccC and FtsZ has been reported (34, 35, 39-41). It is shown here that 275
B. pseudomallei deletion of ppiB leads to pleiotropic effects including stress intolerance, 276
reduction in motility and biofilm formation. Furthermore, the direct effect of ppiB loss on 277
the proteome homeostasis of B. pseudomallei has been defined. Key pathways 278
important for virulence modulation have been identified and disrupted, providing 279
evidence of the importance of PpiB in bacterial protein folding and overall virulence. 280
281
B. pseudomallei is able to infect a wide range of cells in order to survive and cause 282
disease (42). Infection of murine macrophages demonstrated that BpsΔppiB retained its 283
ability to adhere and invade macrophage cells with reduced survival 6 and 9 hours post 284
infection (Fig 1), with intracellular counts similar to the parental control reached by 12 285
hours. This delayed growth phenotype has been shown with the disruption of type VI/III 286
secretion systems and is important in cell-to-cell spread of B. pseudomallei (27, 43, 44). 287
BpsΔppiB is unable to effectively spread intracellularly as determined by 288
immunofluorescence and cause cell fusion into MNGC, with complementation studies 289
showing restoration of the BpsWT phenotype (Fig 3B). As seen 12 hours post-infection 290
BpsWT and the complemented strain BpsΔppiB/ppiB display marked bacterial 291
movement throughout the monolayer and cellular fusion into MNGC (Fig 3A and 3C). 292
Enumeration of nuclei also indicates a significant reduction in the formation of MNGC in 293
BpsΔppiB, which is restored in the complement BpsΔppiB/ppiB (Fig 3D). 294
Complementation is observed despite only a 10% restoration of PpiB protein levels, 295
demonstrating that even low levels of PpiB is sufficient to overcome some virulence 296
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
15
deficiencies, something which has been previously noted in Saccharomyces cerevisiae 297
(45). This lack of cell-to-cell spread is characteristic of various mutants of the T6SS 298
cluster-1 (26, 27, 46), in particular T6SS Cluster 1 mutants ∆hcp1 and ∆vgrG1 (26, 27). 299
It is hypothesized that PpiB is playing a role in either folding or regulating the expression 300
of Type VI Secretion Systems in B. pseudomallei. It is reported that T6SSs in B. 301
pseudomallei are kept under strict transcriptional control and are only induced upon 302
invasion of macrophages (24), yet despite this our proteomic data showed an increase 303
in BPSS2098 (Hcp-1, 1.10 log2, -log10(P-value): 3.05) and BPSS2099 (Tss-1, 4.06 log2, 304
-log10(P-value): 1.8), two proteins belonging to T6SS-3, a cluster which is usually not 305
expressed in nutrient media (27, 47). Interestingly BPSL3097 (-1.28 log2, -log10(P-306
value): 6.12), BPSL3099 (-0.87 log2, -log10(P-value): 2.89), BPSL3105 (-0.75 log2, -307
log10(P-value): 3.31), BPSL3106 (-0.51 log2, -log10(P-value): 2.45) and BPSl3108 (-308
0.82 log2, -log10(P-value): 4.37) were all decreased in BpsΔppiB. These belong to 309
T6SS Cluster 6 which has been shown to be the only T6SS expressed in nutrient media 310
(27). This again points to a dysregulation of transcriptional or translational control. 311
Additionally, a MarR-family regulator (BPSL3431) shown to be involved in regulation of 312
T6SS transcription was downregulated (-0.67 log2, -log10(P-value): 3.40) (48). This 313
indicates that T6SS proteins are escaping their tight transcriptional control in nutrient 314
media, and it is hypothesized the same is occurring upon infection in cells resulting in a 315
malfunctional T6SS and hence the loss of MNGC formation. Further assessment of the 316
transcriptome and proteome of BpsΔppiB upon invasion of macrophages would be 317
useful to verify if PpiB is playing a role at the transcriptional or translational level of 318
T6SS regulators or machinery. This also explains the clearance of infection in the 319
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
16
BALB/c mouse studies where no viable bacteria were recovered at the end of the 320
experiment demonstrating the essential role of PpiB and its potential as a novel anti-321
virulence target. 322
323
Motility and biofilm formation are important for establishing B. pseudomallei infection 324
(13, 15). Deletion of the flagellum, ΔfliC, has been shown to be important for virulence in 325
the BALB/c mouse infection model (15, 49). Here a decrease in the protein levels of 326
FliC (BPSL3319, -3.38 log2, -log10(P-value): 5.81) is observed, consistent with the 327
reduction in motility in BpsppiB with recent studies have demonstrated that PpiB from 328
Clostridioides difficle interacts with FliC using bacterial two-hybrid systems (50). 329
Furthermore, reduced levels of CheB1 (BPSL3301, -2.48 log2, -log10(P-value): 6.02) 330
and CheW (BPSL3305, -2.78 log2, -log10(P-value): 4.38) (Fig 6B), important for 331
chemotactic directed motility (51-54), may also contribute to the observed reduction in 332
motility. As BpsΔppiB only displayed a decrease in motility, not a complete loss, there is 333
potentially a dysregulation of the signal transduction pathways leading to a delay or 334
absence of appropriate signalling to begin movement, rather than elimination of the 335
flagellum in BpsΔppiB, although additional studies are required to validate this. Motility 336
has also been implicated as an important factor for biofilm production with ΔfliC mutants 337
showing a decrease in biofilm production (55). Transcriptomics have identified B. 338
pseudomallei genes important in biofilm formation (56) and of these genes flagged as 339
differentially regulated, 12 were present at opposing protein abundance in BpsΔppiB 340
possibly explaining the decrease in biofilm formation by BpsΔppiB (Fig 6B), with genes 341
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
17
such as universal stress proteins (BPSS0837, -1.16 log2, -log10(P-value): 4.66; 342
BPSS1140, -0.57 log2, -log10(P-value): 2.03), receptors (BPSS1742, -1.22 log2, -343
log10(P-value): 4.10) and efflux pumps (BPSL0816, 0.35 log2, -log10(P-value): 2.13) 344
being differentially expressed. This decrease in biofilm formation is in stark contrast to 345
what has been reported in E. coli where PpiB is a negative regulator of both biofilm and 346
motility with deletion of ppiB resulting in hypermotility and increased biofilm production 347
(34). This disparity may indicate different roles for PpiB in E. coli and B. pseudomallei, 348
but a lack of in vivo data with ΔppiB makes it difficult to determine the overall effect on 349
virulence. 350
351
Cyclophilin B in Gram-negatives are known to play a role in response to a variety of 352
stresses encountered during infection (32). B. pseudomallei is exposed to reactive 353
oxidising species within phagocytes, a natural defence mechanism for eukaryotic cells 354
(57), with loss of ppiB increasing the susceptibility to oxidative stress (Fig 7). Others 355
have shown that there are a variety of mechanisms by which B. pseudomallei responds 356
to and tolerates oxidative stress, with quorum sensing regulating gene expression of 357
genes important in protecting the cell against DNA damage as well as polyphosphate 358
kinases playing a role (55, 58, 59). Although none of these genes appear in the 359
proteomics screen, proteins involved in stress (BPSS0837 -1.3 log2, -log10(P-value): 360
3.63, BPSS1140 -0.57 log2, -log10(P-value): 2.03) and OmpR, an oxidative stress two-361
component system transcriptional regulator (BPSL2094, -0.53 log2, -log10(P-value): 362
2.69), are decreased and may play an as of yet unknown role in oxidative stress 363
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
18
response. These results indicate that other currently unknown mechanisms may exist to 364
combat oxidative stress and this warrants further investigation. 365
366
B. pseudomallei has a number of chromosomally encoded genes associated with 367
antimicrobial resistance and hence is intrinsically resistant to most antibiotics used to 368
treat serious infections (9). BpsΔppiB has increased susceptibility to ceftriaxone, 369
tetracycline and doxycycline, antibiotics currently used for treatment of melioidosis 370
(Table 1) (7, 8). Resistance to these antibiotics is shown to be moderated by 371
Resistance-Nodulation Division (RND) efflux pumps (60), of which B. pseudomallei 372
strain K96243 has 10 annotated within its genome, as well as by beta-lactamases (9, 373
61). Differences in the protein levels of the efflux pump components, AmrA (BPSL1804, 374
-1.66 log2, -log10(P-value): 2.98), BpeB (BPSL0815 0.2 log2, -log10(P-value): 1.97) and 375
OprB (BPSL2094, -0.53, -log10(P-value): 2.69), indicate that loss of PpiB may result in 376
malfunctioning pumps. It is hypothesized that deletion of ppiB results in a reduction of 377
the pump components, making ineffective pumps and restoring susceptibility to certain 378
antibiotics. 379
380
There are many reports on the pleiotropic effects that immunophilin proteins have in 381
cells, this study demonstrates that virtually every compartment within the cell displays 382
gross proteomic changes, especially those involved in metabolism and genetic 383
information processing (32, 34, 38, 50, 62). It has recently been shown by Rasch et al 384
(38) that proteins from the immunophilin family also have the ability to compensate one 385
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
19
another, in this case the macrophage infectivity potentiator (Mip) protein, belonging to 386
the FK506-binding protein family, is able to compensate for the loss of PpiB in L. 387
pneumophila (38). This compensatory effect has always been theorised, these studies 388
show that there is an increase in the protein levels of three immunophilin proteins, Mip 389
(BPSS1823, 0.98 log2, -log10(P-value): 2.42), PpiA (BPSL2245, 1.1 log2, -log10(P-390
value): 3.05) and SurA (BPSL0659, 0.53 log2, -log10(P-value): 2.53), whether these 391
proteins can compensate and to what degree for PpiB loss in B. pseudomallei requires 392
further investigation. 393
394
To conclude, PpiB in B. pseudomallei is essential for virulence with the deletion mutant 395
BpsΔppiB displaying pleiotropic effects on virulence determinants such as the flagella, 396
biofilm production and antimicrobial susceptibility. Infection of macrophages with 397
BpsΔppiB displayed a delayed growth phenotype and an inability to cause fulminant 398
disease in BALB/c mice. On closer investigation it was shown that this was due to 399
BpsΔppiB being unable to spread cell-to-cell and form MNGCs, indicating that 400
clearance of infection occurs in vivo. Whole cell proteomic analysis reveals marked 401
changes in the proteome including proteins previously shown to be important for cell-to-402
cell spread and virulence of B. pseudomallei and has also identified a plethora of new 403
proteins potentially playing an important role in infection. Although further work still 404
needs to be conducted to demonstrate the direct interactions of PpiB with its folding 405
partners, it is clear that PpiB is essential for the correct protein folding of virulence 406
determinants in B. pseudomallei, thus making it indispensable for virulence. 407
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
20
408
Materials and methods 409
Bacterial strains and growth conditions. The bacterial strains used in this study are 410
shown in Table 2. All bacterial strains were grown in Luria Bertani (LB) broth overnight 411
at 37°C with agitation unless stated otherwise. Antibiotics were used at final 412
concentrations of: ampicillin, 50 µg/ml; chloramphenicol, 30 µg/ml; kanamycin, 50 µg/ml. 413
414
Construction of in-frame deletion mutant of ppiB. Construction of B. pseudomallei 415
in-frame deletion mutants was performed using the technique previously described by 416
Logue et al (37). For ppiB a 449-bp upstream flanking region and a 403-bp downstream 417
flanking region were amplified by Polymerase Chain Reaction (PCR) from B. 418
pseudomallei K96243 genomic DNA (obtained using Qiagen Gentra Purgene 419
Yeast/Bact Kit) using the primer pairs ppiB_UP_F/ppiB_UP_R 420
(TCTAGATTCCATCGCGTGATCAAGGG/ AGATCTTGGTTCCTTCGATGGATGGG) 421
and ppiB_DN_F/ppiB_DN_R (AGATCTGGGATGTTGCAGGAGACACC/ 422
TCTAGATTGCCGAACGCGACGATG). Restriction sites were incorporated into the 423
primers to allow for the ligation of the flanks to one another (using BglII) and XbaI to 424
allow for the insertion of the joint flanks into the suicide plasmid, pDM4. Upon 425
construction of an upstream-downstream fragment and its subsequent ligation into 426
pDM4, the construct was transformed by heat shock into E. coli S17-1 λpir which were 427
made calcium competent, and selected for with the antibiotic chloramphenicol. 428
Following conjugation with B. pseudomallei K96243, merodiploid integrants that has 429
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
21
successfully integrated the upstream-downstream-pDM4 construct were identified using 430
double antibiotic selection of ampicillin/chloramphenicol. A merodiploid integrant was 431
plated onto LB agar lacking sodium chloride but containing 10 % sucrose. sacB counter-432
selection was used to select for the excision of the pDM4 backbone, resulting in an in-433
frame unmarked deletion. Colonies were subsequently screened for chloramphenicol 434
sensitivity and analysed by PCR to determine their phenotype; wild-type revertant or in-435
frame deletion mutant. Colonies determined to be in-frame deletion mutants had the site 436
of recombination sequenced (Sanger sequencing) to confirm a 492-bp deletion of ppiB. 437
The mutant strain, B. pseudomallei∆ppiB (BpsΔppiB) and the parent B. pseudomallei 438
K96243 strain was sequenced using Illumina MiSeq (Murdoch University, Perth, 439
Western Australia) or HiSeq2500 (Australian Genome Research Facility, Melbourne, 440
Australia) respectively. Whole genome sequencing data was aligned to the K96243 441
reference genome (versions NC_006350.1 [chromosome 1] and NC_006350.1 442
[chromosome 2]) and variants were identified using the SPANDx pipeline (62). 443
444
J774A.1 murine macrophage infection assay. J774A.1 murine macrophages were 445
seeded into a 24-well tissue culture treated plate at a concentration of 4 x 105 cells/mL 446
in Dulbecco’s modified eagle’s medium (DMEM) (Gibco) supplemented with a final 447
concentration of 1 % GlutaMAX (Gibco, Life Technologies) and 10 % heat-inactivated 448
fetal calf serum (Gibco, Life Technologies, Lot #1939338) and incubated for 20 hours at 449
37°C with 5 % CO2. B. pseudomallei strains were grown overnight at 37°C for 18 hrs 450
and adjusted in Leibovitz L-15 medium (Gibco) supplemented with 1 % GlutaMAX and 451
10 % heat-inactivated fetal calf serum to an absorbance between 0.35 and 0.4 at 580 452
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
22
nm using a PLP Colourimeter. Strains were serially diluted in L-15 medium and 1 mL of 453
bacteria was added to each well at a multiplicity of infection (MOI) of 10 and incubated 454
30 minutes at 37°C. To determine the exact starting inoculum at time of infection 455
bacteria were further serially diluted and plated on LB agar. Bacteria were aspirated off 456
the cell monolayer and infected cells were gently washed three times with PBS (Life 457
Technologies, autoclaved and filter sterilised) and then incubated with L-15 medium 458
containing 1 mg/mL kanamycin for a further 30 minutes at 37°C to kill extracellular 459
bacteria. The supernatant was removed and infected cells were then incubated with L-460
15 media containing 250 µg/mL kanamycin for 12 hours. At 0, 3, 6, 9 and 12 hours post-461
infection, cell monolayers were lysed with 1 mL MilliQ water and serially diluted in 1 mL 462
PBS and plated onto LB agar for bacterial enumeration. 463
464
Determination of Minimum Inhibitory Concentration (MIC) and susceptibility to 465
stress. Broth microdilutions were tested against a variety of antibiotic classes as 466
described in (63) with the following modifications. Strains were incubated overnight in 467
Mueller Hinton Broth (MHB) at 37°C. Overnight cultures were diluted 1:50 in fresh MHB 468
and were incubated at 37°C for 1 hour with agitation. Antibiotics were 2-fold serially 469
diluted across a 96-well plate in MHB with a final volume of 100 µL with an antibiotic 470
range of 256 to 0.25 μg/mL. Following bacterial incubation, 100 µL of each strain was 471
added to antibiotic containing media in a 96 well plate and incubated statically at 37°C 472
for 24 hours. Optical density of plates was read at an optical density of 590 nm using a 473
spectrophotometer (BioRad Xmark). The Minimum Inhibitory Concentration (MIC) was 474
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
23
called as the minimum antibiotic concentration needed to keep overnight growth to 475
under 20% of the unexposed bacterial growth control. 476
477
Motility assay. Assessment of motility was performed as described in (64). Briefly, B. 478
pseudomallei strains were incubated at 37°C overnight with agitation. One microliter of 479
overnight culture was stabbed into the middle of a 0.3 % motility agar using a sterile 480
inoculation loop and plates were incubated upright for 24 hours upon which the distance 481
of bacterial spread was measured. 482
483
Biofilm Forming Capacity Assay. Biofilm assays were performed according following 484
the methodology in (65) but with the following modifications. B. pseudomallei strains 485
were incubated overnight at 37°C with agitation. The following day 2% of overnight 486
culture (v/v) was inoculated into fresh media and incubated for a further 24 hours at 487
37°C with agitation. Overnight cultures (200µL) were added to a 96-well plate and 488
incubated for 3 hours at 37°C to allow for adhesion. Supernatant was gently aspirated to 489
avoid disturbing the adhered cells and fresh Luria Bertani Broth was added and 490
incubated at 37°C for a further 24 hours. Supernatant was aspirated and biofilms were 491
washed once with PBS and fresh LBB media added and incubated for a further 24 492
hours. On the final day supernatant was removed and biofilms were washed three times 493
with PBS before being fixed with methanol and allowed to air dry. Cells were stained 494
with 2 % crystal violet, with excess stain removed with running ddH2O and plates were 495
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
24
allowed to air dry. Dye bound to cells was solubilised with 33 % Glacial acetic acid and 496
the optical density was read at 590 nm on a spectrophotometer (BioRad X-Mark). 497
498
BALB/c murine infection model 499
Investigations involving animals were carried out according to the requirements of the 500
United Kingdom Animal (Scientific Procedures) Act 1986 under project licence PPL 501
30/3026. This project licence was approved following an ethical review by Dstl's Animal 502
Welfare and Ethical Review Body. Studies were performed using female BALB/cAnNCrl 503
mice (BALB/c; Charles River, UK) implanted with a subcutaneous Pico transponder 504
(Uno BV, Netherlands) to allow individual mice to be tracked through the study. On 505
arrival into containment level 3 animal facilities, mice were randomly allocated into 506
cages of five animals and acclimatised to their new surroundings for 5 days before any 507
procedures were performed. Animal husbandry practices and environmental conditions 508
during study were as described previously Scott et al (66). Challenges were performed 509
with B. pseudomallei K96243 prepared as described previously by Scott et al (66) and 510
delivered via the intraperitoneal route. Mice received 1.1 x 104 CFU B. pseudomallei 511
K96243 and 1.86 104 CFU Bps∆ppiB, 6 in each group. Mice were checked at least twice 512
daily following challenge and clinical signs for each mouse recorded for five weeks post‐513
infection. Humane end‐points were used throughout these studies to minimise suffering, 514
with culls performed via cervical dislocation at the end‐point. At the end of the study, 515
animals were culled and organs removed for enumeration of bacterial burden (lungs, 516
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
25
liver, spleen). These were homogenised through 40 μm sieves into PBS, serially diluted 517
and plated onto LB agar. 518
519
Complementation studies. 520
The open reading frame of BPSL2246 (ppiB) was amplified from genomic DNA of B. 521
pseudomallei K96243 using the primers ppiB_For/ppiB_Rev 522
(CTGCAGATGGTCGAACTGCATACG/CTGCAGGGACCACGACGGCCTTCT) and the 523
resulting product was ligated into pJR3XFLAG that incorporated a 3XFLAG tag on the 524
C-terminal end of the gene. This was then amplified with the primers 525
ppiB_pET_For/BamHI_stop_FLAG_Rev 526
(CATATGGTCGAACTGCATACGAAC/GGATCCTTACTTGTCATCGTCATCCTTAT). 527
The PCR product was inserted into the SmaI/BamHI restriction sites of pBBR1-MCS1. 528
The complementation construct was transformed into E. coli ST18 and conjugated into 529
Bps∆ppiB. Conjugates were selected on LB agar containing 30 μg/mL chloramphenicol. 530
In experiments the complemented mutant strain (Bps∆ppiB/ppiB) was grown in LB broth 531
containing 30 μg/mL chloramphenicol. 532
533
Immunofluorescence. J774A.1 macrophages (seeded at approximately 4 x 105 534
cells/well) were grown overnight on 13 mm round coverslips in a 24 well plate at 37°C 535
with 5% CO2. Macrophages were infected with B. pseudomallei strains at an MOI of 10 536
as described above in the J774.A1 murine macrophage infection assay. At 12 hours 537
post infection monolayers were washed 3 times with PBS for 5 minutes and fixed with 538
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
26
100 % methanol for 30 minutes, then washed 3 times with PBS for 5 minutes. 539
Monolayers were stained at room temperature using the following protocol. Monolayers 540
were blocked with 5 % (v/v) FCS/PBS for 2 hours to block non-specific binding and then 541
washed 3 times for 2 minutes each. Cells were incubated with anti-B. pseudomallei-LPS 542
at 1 µg/mL (1:100; Mab4VIH12) for 1 hour, after which they underwent 3 times 2 543
minutes washes. Monolayers were incubated with a secondary Anti-mouse-whole IgG-544
FITC (1:64; Sigma Aldrich) for 1 hour followed by three times 2-minute washes. Nuclei 545
were stained using Hoescht33258 (1:10,000; ThermoFisher Scientific) for 15 minutes 546
followed by 2 x 2 minute washes. Coverslips were mounted onto glass slides using 547
Prolong Gold Anti-Fade reagent (Invitrogen). Fluorescence microscopy was performed 548
using a Nikon Eclipse Ts2R microscope and images were acquired using the NIS-549
Elements software (Nikon). 550
551
Multinucleated Giant Cell enumeration (MNGC). Evaluation of MNCG formation was 552
conducted using fluorescently stained cell monolayers described above. Using 553
previously published metrics (67); 1000 nuclei per coverslip were counted and the 554
percentage of MNGC formation was calculated using the following equation; 555
MNGC (%)=number of nuclei within multinucleated cells
total nuclei counted X 100
556
Protein clean up and In-solution digestion. Cell preparations were solubilized in lysis 557
buffer (4 % SDS, 10 mM DTT, 100 mM Tris pH 8.5) by boiling for 10 minutes and the 558
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
27
protein content assess by BCA protein assay according to the manufacturer's 559
instruction. 100 ug of protein from each sample was acetone precipitated by mixing 4 560
volumes of ice-cold acetone with one volume of sample. Samples were precipitated 561
overnight at -20°C and then spun down at 4000 x g for 10 minutes at 4°C. The 562
precipitated protein pellets were resuspended with 80 % ice-cold acetone and 563
precipitated for an additional 4 hours at -20°C. Samples were spun down at 17000 x g 564
for 10 minutes at 4°C to collect precipitated protein, the supernatant was discarded and 565
excess acetone driven off at 65°C for 5 minutes. Dried protein pellets were resuspended 566
in 6 M urea, 2 M thiourea, 40 mM NH4HCO3 and reduced / alkylated prior to digestion 567
with Lys-C (1/200 w/w) then trypsin (1/50 w/w) overnight as previously described (68). 568
Digested samples were acidified to a final concentration of 0.5 % formic acid, desalted 569
with homemade C18 stage tips (69, 70), eluted with buffer B (80 % ACN, 0.1 % formic 570
acid) and bound peptides eluted with buffer B then dried. 571
572
LFQ based quantitative proteome LC-MS. Purified peptides were resuspended in 573
Buffer A* and separated using a two-column chromatography set up comprising a 574
PepMap100 C18 20 mm x 75 μm trap and a PepMap C18 500 mm x 75 μm analytical 575
column (ThermoFisher Scientific). Samples were concentrated onto the trap column at 5 576
μl/min for 5 mins and infused into an Orbitrap Elite™ Mass Spectrometer (ThermoFisher 577
Scientific) at 300 nl/min via the analytical column using a Dionex Ultimate 3000 UPLC 578
(ThermoFisher Scientific). 90 min gradients were run altering the buffer composition 579
from 1 % buffer B to 28 % B over 60 mins, then from 28 % B to 40 % B over 10 mins, 580
then from 40 % B to 100 % B over 2 mins, the composition was held at 100 % B for 3 581
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
28
mins, and then dropped to 3 % B over 5 mins and held at 3 % B for another 10 mins. 582
The Elite™ Mass Spectrometer was operated in a data-dependent mode automatically 583
switching between the acquisition of a single Orbitrap MS scan (120,000 resolution) 584
followed by 20 data-dependent CID MS-MS events (NCE 35) were allowed with 30 585
seconds dynamic exclusion enabled. 586
587
Mass spectrometry data analysis. Identification of proteins was accomplished using 588
MaxQuant (v1.5.3.1) (71). Searches were performed against the Burkholderia 589
pseudomallei strain K96243 (Uniprot proteome id UP000000605, downloaded 10-07-590
2018, 5,717 entries) proteomes with carbamidomethylation of cysteine set as a fixed 591
modification. Searches were performed with trypsin cleavage specificity allowing 2 592
miscleavage events and the variable modifications of oxidation of methionine and 593
acetylation of protein N-termini. The precursor mass tolerance was set to 20 parts-per-594
million (ppm) for the first search and 10 ppm for the main search, with a maximum false 595
discovery rate (FDR) of 1.0 % set for protein and peptide identifications. To enhance the 596
identification of peptides between samples the Match Between Runs option was 597
enabled with a precursor match window set to 2 minutes and an alignment window of 10 598
minutes. For label-free quantitation, the MaxLFQ option within Maxquant (72) was 599
enabled in addition to the re-quantification module. The resulting protein group output 600
was processed within the Perseus (v1.4.0.6) (73) analysis environment to remove 601
reverse matches and common protein contaminates prior. GO terms and associated 602
annotation was downloaded from Uniprot (Uniprot proteome id UP000000605, 603
downloaded 10-07-2018). For LFQ comparisons missing values were imputed using 604
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
29
Perseus and Pearson correlations visualized using Perseus and R. Determination of 605
significant changes was undertaken using a two-sample t-test within Perseus where 606
proteins were considered significant if the mean difference between groups was great 607
then or less than one-fold change and satisfied a Benjamini-Hochberg multiple 608
hypothesis corrected FDR of below 0.05 which corresponds to a -log10(P-value) of 1.73 609
or p-value of 0.018. The mass spectrometry proteomics data have been deposited to 610
the ProteomeXchange Consortium via the PRIDE (74) partner repository with the 611
dataset identifier PXD012956. 612
613
Statistical Analysis. All numerical results were analysed using Microsoft Excel 2010. 614
Statistical analyses performed using GraphPad Prism version 8.0. For growth curves, 615
motility, biofilm, MIC, intracellular infection and cell cytotoxicity assays, a Mann-Whitney 616
U-test was used to determine the difference between strains. The Log-rank (Mantel-617
Cox) test was used for the animal studies. A Student’s t-test was used for MNGC 618
formation. Significance is indicated as follows: *, P-value <0.05; **, P-value <0.01; ****, 619
P-value <0.0001. 620
621
Acknowledgements 622
NB was supported by an Australian Government Research Training Program 623
Scholarship. MST and TJJI were funded by NATO (SPF984835). This work was 624
partially supported by National Health and Medical Research Council of Australia 625
(NHMRC) project grants awarded to NES (APP1100164). We would like to thank the 626
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
30
Melbourne Mass Spectrometry and Proteomics Facility of The Bio21 Molecular Science 627
and Biotechnology Institute at The University of Melbourne for support, maintenance 628
and access to mass spectrometry infrastructure for proteomic analysis. We would like to 629
thank Dr Nathan Pavlos for providing an aliquot of Hoecsht33258 to use for the 630
immunofluorescence studies. We would also like to thank Dr Joshua Ramsay for 631
providing ST18 strain of E. coli used in conjugation as well as the plasmid pJR3XFLAG 632
to help with the construction of the complementation strain. 633
634
References 635
1. Dance DA. 2000. Ecology of Burkholderia pseudomallei and the interactions 636
between environmental Burkholderia spp. and human-animal hosts. Acta Trop 637
74:159-68. 638
2. Dance DA. 2000. Melioidosis as an emerging global problem. Acta Trop 74:115-639
9. 640
3. Currie BJ. 2008. Advances and remaining uncertainties in the epidemiology of 641
Burkholderia pseudomallei and melioidosis. Trans R Soc Trop Med Hyg 102:225-642
7. 643
4. Limmathurotsakul D, Golding N, Dance DA, Messina JP, Pigott DM, Moyes CL, 644
Rolim DB, Bertherat E, Day NP, Peacock SJ, Hay SI. 2016. Predicted global 645
distribution of Burkholderia pseudomallei and burden of melioidosis. Nat 646
Microbiol 1:15008. 647
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
31
5. Currie BJ, Ward L, Cheng AC. 2010. The epidemiology and clinical spectrum of 648
melioidosis: 540 cases from the 20 year Darwin prospective study. PLoS Negl 649
Trop Dis 4:e900. 650
6. Limmathurotsakul D, Chaowagul W, Chierakul W, Stepniewska K, Maharjan B, 651
Wuthiekanun V, White NJ, Day NP, Peacock SJ. 2006. Risk factors for recurrent 652
melioidosis in northeast Thailand. Clin Infect Dis 43:979-86. 653
7. Pitman MC, Luck T, Marshall CS, Anstey NM, Ward L, Currie BJ. 2015. 654
Intravenous therapy duration and outcomes in melioidosis: a new treatment 655
paradigm. PLoS Negl Trop Dis 9:e0003586. 656
8. Wiersinga WJ, Currie BJ, Peacock SJ. 2012. Melioidosis. N Engl J Med 657
367:1035-44. 658
9. Schweizer HP. 2012. Mechanisms of antibiotic resistance in Burkholderia 659
pseudomallei: implications for treatment of melioidosis. Future Microbiol 7:1389-660
99. 661
10. Sarovich DS, Webb JR, Pitman MC, Viberg LT, Mayo M, Baird RW, Robson JM, 662
Currie BJ, Price EP. 2018. Raising the Stakes: Loss of Efflux Pump Regulation 663
Decreases Meropenem Susceptibility in Burkholderia pseudomallei. Clinical 664
Infectious Diseases 67:243-250. 665
11. Currie BJ, Fisher DA, Howard DM, Burrow JNC, Lo D, Selva-nayagam S, Anstey 666
NM, Huffam SE, Snelling PL, Marks PJ. 2000. Endemic melioidosis in tropical 667
northern Australia: a 10-year prospective study and review of the literature. 668
Clinical Infectious Diseases 31:981-986. 669
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
32
12. Kamjumphol W, Chareonsudjai S, Chareonsudjai P, Wongratanacheewin S, 670
Taweechaisupapong S. 2013. Environmental factors affecting Burkholderia 671
pseudomallei biofilm formation. Southeast Asian J Trop Med Public Health 44:72-672
81. 673
13. Kunyanee C, Kamjumphol W, Taweechaisupapong S, Kanthawong S, 674
Wongwajana S, Wongratanacheewin S, Hahnvajanawong C, Chareonsudjai S. 675
2016. Burkholderia pseudomallei Biofilm Promotes Adhesion, Internalization and 676
Stimulates Proinflammatory Cytokines in Human Epithelial A549 Cells. PLoS 677
One 11:e0160741. 678
14. Panomket P, Wongsana P, Wanram S, Wongratanacheewin S. 2017. 679
Burkholderia pseudomallei biofilm plays a key role in chronic inflammation in 680
C57BL/6 mice. Southeast Asian J Trop Med Public Health 48:73-82. 681
15. Chua KL, Chan YY, Gan YH. 2003. Flagella are virulence determinants of 682
Burkholderia pseudomallei. Infect Immun 71:1622-9. 683
16. Chuaygud T, Tungpradabkul S, Sirisinha S, Chua KL, Utaisincharoen P. 2008. A 684
role of Burkholderia pseudomallei flagella as a virulent factor. Trans R Soc Trop 685
Med Hyg 102 Suppl 1:S140-4. 686
17. Stevens MP, Wood MW, Taylor LA, Monaghan P, Hawes P, Jones PW, Wallis 687
TS, Galyov EE. 2002. An Inv/Mxi-Spa-like type III protein secretion system in 688
Burkholderia pseudomallei modulates intracellular behaviour of the pathogen. 689
Mol Microbiol 46:649-59. 690
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
33
18. Willcocks SJ, Denman CC, Atkins HS, Wren BW. 2016. Intracellular replication of 691
the well-armed pathogen Burkholderia pseudomallei. Curr Opin Microbiol 29:94-692
103. 693
19. Stevens MP, Haque A, Atkins T, Hill J, Wood MW, Easton A, Nelson M, 694
Underwood-Fowler C, Titball RW, Bancroft GJ, Galyov EE. 2004. Attenuated 695
virulence and protective efficacy of a Burkholderia pseudomallei bsa type III 696
secretion mutant in murine models of melioidosis. Microbiology 150:2669-76. 697
20. Sun GW, Gan YH. 2010. Unraveling type III secretion systems in the highly 698
versatile Burkholderia pseudomallei. Trends Microbiol 18:561-8. 699
21. Warawa J, Woods DE. 2005. Type III secretion system cluster 3 is required for 700
maximal virulence of Burkholderia pseudomallei in a hamster infection model. 701
FEMS Microbiol Lett 242:101-8. 702
22. Allwood EM, Devenish RJ, Prescott M, Adler B, Boyce JD. 2011. Strategies for 703
Intracellular Survival of Burkholderia pseudomallei. Front Microbiol 2:170. 704
23. Pilatz S, Breitbach K, Hein N, Fehlhaber B, Schulze J, Brenneke B, Eberl L, 705
Steinmetz I. 2006. Identification of Burkholderia pseudomallei genes required for 706
the intracellular life cycle and in vivo virulence. Infect Immun 74:3576-86. 707
24. Shalom G, Shaw JG, Thomas MS. 2007. In vivo expression technology identifies 708
a type VI secretion system locus in Burkholderia pseudomallei that is induced 709
upon invasion of macrophages. Microbiology 153:2689-99. 710
25. Lennings J, West TE, Schwarz S. 2018. The Burkholderia Type VI Secretion 711
System 5: Composition, Regulation and Role in Virulence. Front Microbiol 712
9:3339. 713
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
34
26. Schwarz S, Singh P, Robertson JD, LeRoux M, Skerrett SJ, Goodlett DR, West 714
TE, Mougous JD. 2014. VgrG-5 is a Burkholderia type VI secretion system-715
exported protein required for multinucleated giant cell formation and virulence. 716
Infect Immun 82:1445-52. 717
27. Burtnick MN, Brett PJ, Harding SV, Ngugi SA, Ribot WJ, Chantratita N, Scorpio 718
A, Milne TS, Dean RE, Fritz DL, Peacock SJ, Prior JL, Atkins TP, Deshazer D. 719
2011. The cluster 1 type VI secretion system is a major virulence determinant in 720
Burkholderia pseudomallei. Infect Immun 79:1512-25. 721
28. Schell MA, Ulrich RL, Ribot WJ, Brueggemann EE, Hines HB, Chen D, Lipscomb 722
L, Kim HS, Mrázek J, Nierman WC. 2007. Type VI secretion is a major virulence 723
determinant in Burkholderia mallei. Molecular microbiology 64:1466-1485. 724
29. Dimou M, Venieraki A, Katinakis P. 2017. Microbial cyclophilins: specialized 725
functions in virulence and beyond. World Journal of Microbiology and 726
Biotechnology 33:164. 727
30. Lang K, Schmid FX, Fischer G. 1987. Catalysis of protein folding by prolyl 728
isomerase. Nature 329:268-70. 729
31. Zhu Y, Gong Y, Li A, Chen M, Kang D, Liu J, Yuan Y. 2018. Differential 730
Proteomic Analysis Reveals Protein Networks and Pathways that May Contribute 731
to Helicobacter pylori FKBP-Type PPIase-Associated Gastric Diseases. 732
Proteomics Clin Appl 12:e1700127. 733
32. Roset MS, Garcia Fernandez L, DelVecchio VG, Briones G. 2013. Intracellularly 734
induced cyclophilins play an important role in stress adaptation and virulence of 735
Brucella abortus. Infect Immun 81:521-30. 736
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
35
33. Schmidt B, Tradler T, Rahfeld JU, Ludwig B, Jain B, Mann K, Rucknagel KP, 737
Janowski B, Schierhorn A, Kullertz G, Hacker J, Fischer G. 1996. A cyclophilin-738
like peptidyl-prolyl cis/trans isomerase from Legionella pneumophila--739
characterization, molecular cloning and overexpression. Mol Microbiol 21:1147-740
60. 741
34. Skagia A, Zografou C, Vezyri E, Venieraki A, Katinakis P, Dimou M. 2016. 742
Cyclophilin PpiB is involved in motility and biofilm formation via its functional 743
association with certain proteins. Genes Cells 21:833-51. 744
35. Skagia A, Zografou C, Venieraki A, Fasseas C, Katinakis P, Dimou M. 2017. 745
Functional analysis of the cyclophilin PpiB role in bacterial cell division. Genes 746
Cells 22:810-824. 747
36. Walsh CT, Zydowsky LD, McKeon FD. 1992. Cyclosporin A, the cyclophilin class 748
of peptidylprolyl isomerases, and blockade of T cell signal transduction. Journal 749
of Biological Chemistry 267:13115-13118. 750
37. Logue CA, Peak IR, Beacham IR. 2009. Facile construction of unmarked deletion 751
mutants in Burkholderia pseudomallei using sacB counter-selection in sucrose-752
resistant and sucrose-sensitive isolates. J Microbiol Methods 76:320-3. 753
38. Rasch J, Unal CM, Klages A, Karsli U, Heinsohn N, Brouwer R, Richter M, 754
Dellmann A, Steinert M. 2019. Peptidyl-Prolyl-cis/trans-Isomerases Mip and PpiB 755
of Legionella pneumophila Contribute to Surface Translocation, Growth at 756
Suboptimal Temperature, and Infection. Infect Immun 87. 757
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
36
39. Dimou M, Venieraki A, Zografou C, Katinakis P. 2012. The cytoplasmic 758
cyclophilin from Azotobacter vinelandii interacts with phosphate acetyltransferase 759
isoforms enhancing their in vitro activity. Mol Biol Rep 39:4135-43. 760
40. Dimou M, Zografou C, Venieraki A, Katinakis P. 2012. Functional interaction of 761
Azotobacter vinelandii cytoplasmic cyclophilin with the biotin carboxylase subunit 762
of acetyl-CoA carboxylase. Biochem Biophys Res Commun 424:736-9. 763
41. Skagia A, Vezyri E, Sigala M, Kokkinou A, Karpusas M, Venieraki A, Katinakis P, 764
Dimou M. 2017. Structural and functional analysis of cyclophilin PpiB mutants 765
supports an in vivo function not limited to prolyl isomerization activity. Genes 766
Cells 22:32-44. 767
42. Jones AL, Beveridge TJ, Woods DE. 1996. Intracellular survival of Burkholderia 768
pseudomallei. Infect Immun 64:782-90. 769
43. Burtnick MN, Brett PJ, Nair V, Warawa JM, Woods DE, Gherardini FC. 2008. 770
Burkholderia pseudomallei type III secretion system mutants exhibit delayed 771
vacuolar escape phenotypes in RAW 264.7 murine macrophages. Infect Immun 772
76:2991-3000. 773
44. Burtnick MN, DeShazer D, Nair V, Gherardini FC, Brett PJ. 2010. Burkholderia 774
mallei cluster 1 type VI secretion mutants exhibit growth and actin polymerization 775
defects in RAW 264.7 murine macrophages. Infect Immun 78:88-99. 776
45. Gemmill TR, Wu X, Hanes SD. 2005. Vanishingly low levels of Ess1 prolyl-777
isomerase activity are sufficient for growth in Saccharomyces cerevisiae. J Biol 778
Chem 280:15510-7. 779
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
37
46. Toesca IJ, French CT, Miller JF. 2014. The Type VI secretion system spike 780
protein VgrG5 mediates membrane fusion during intercellular spread by 781
pseudomallei group Burkholderia species. Infect Immun 82:1436-44. 782
47. Bernard CS, Brunet YR, Gueguen E, Cascales E. 2010. Nooks and crannies in 783
type VI secretion regulation. J Bacteriol 192:3850-60. 784
48. Losada L, Shea AA, DeShazer D. 2018. A MarR family transcriptional regulator 785
and subinhibitory antibiotics regulate type VI secretion gene clusters in 786
Burkholderia pseudomallei. Microbiology 164:1196-1211. 787
49. Inglis TJJ, Rigby P, Robertson TA, Dutton NS, Henderson M, Chang BJ. 2000. 788
Interaction between Burkholderia pseudomallei and Acanthamoeba species 789
results in coiling phagocytosis, endamebic bacterial survival, and escape. 790
Infection and immunity 68:1681-1686. 791
50. Ünal CM, Karagöz MS, Berges M, Priebe C, de Acuña JMB, Wissing J, Jänsch L, 792
Jahn D, Steinert M. 2019. Pleiotropic Clostridioides difficile cyclophilin PpiB 793
controls cysteine-tolerance, toxin production, the central metabolism and multiple 794
stress responses. Frontiers in Pharmacology 10. 795
51. Parkinson JS, Parker SR, Talbert PB, Houts SE. 1983. Interactions between 796
chemotaxis genes and flagellar genes in Escherichia coli. J Bacteriol 155:265-74. 797
52. Ravid S, Matsumura P, Eisenbach M. 1986. Restoration of flagellar clockwise 798
rotation in bacterial envelopes by insertion of the chemotaxis protein CheY. Proc 799
Natl Acad Sci U S A 83:7157-61. 800
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
38
53. Rowsell EH, Smith JM, Wolfe A, Taylor BL. 1995. CheA, CheW, and CheY are 801
required for chemotaxis to oxygen and sugars of the phosphotransferase system 802
in Escherichia coli. J Bacteriol 177:6011-4. 803
54. Stock A, Chen T, Welsh D, Stock J. 1988. CheA protein, a central regulator of 804
bacterial chemotaxis, belongs to a family of proteins that control gene expression 805
in response to changing environmental conditions. Proc Natl Acad Sci U S A 806
85:1403-7. 807
55. Tunpiboonsak S, Mongkolrob R, Kitudomsub K, Thanwatanaying P, 808
Kiettipirodom W, Tungboontina Y, Tungpradabkul S. 2010. Role of a 809
Burkholderia pseudomallei polyphosphate kinase in an oxidative stress 810
response, motilities, and biofilm formation. J Microbiol 48:63-70. 811
56. Chin CY, Hara Y, Ghazali AK, Yap SJ, Kong C, Wong YC, Rozali N, Koh SF, 812
Hoh CC, Puthucheary SD, Nathan S. 2015. Global transcriptional analysis of 813
Burkholderia pseudomallei high and low biofilm producers reveals insights into 814
biofilm production and virulence. BMC Genomics 16:471. 815
57. Babior BM. 2000. Phagocytes and oxidative stress. The American Journal of 816
Medicine 109:33-44. 817
58. Loprasert S, Whangsuk W, Sallabhan R, Mongkolsuk S. 2004. DpsA protects the 818
human pathogen Burkholderia pseudomallei against organic hydroperoxide. Arch 819
Microbiol 182:96-101. 820
59. Lumjiaktase P, Diggle SP, Loprasert S, Tungpradabkul S, Daykin M, Camara M, 821
Williams P, Kunakorn M. 2006. Quorum sensing regulates dpsA and the 822
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
39
oxidative stress response in Burkholderia pseudomallei. Microbiology 152:3651-823
9. 824
60. Viktorov DV, Zakharova IB, Podshivalova MV, Kalinkina EV, Merinova OA, 825
Ageeva NP, Antonov VA, Merinova LK, Alekseev VV. 2008. High-level resistance 826
to fluoroquinolones and cephalosporins in Burkholderia pseudomallei and closely 827
related species. Trans R Soc Trop Med Hyg 102 Suppl 1:S103-10. 828
61. Holden MT, Titball RW, Peacock SJ, Cerdeno-Tarraga AM, Atkins T, Crossman 829
LC, Pitt T, Churcher C, Mungall K, Bentley SD, Sebaihia M, Thomson NR, Bason 830
N, Beacham IR, Brooks K, Brown KA, Brown NF, Challis GL, Cherevach I, 831
Chillingworth T, Cronin A, Crossett B, Davis P, DeShazer D, Feltwell T, Fraser A, 832
Hance Z, Hauser H, Holroyd S, Jagels K, Keith KE, Maddison M, Moule S, Price 833
C, Quail MA, Rabbinowitsch E, Rutherford K, Sanders M, Simmonds M, 834
Songsivilai S, Stevens K, Tumapa S, Vesaratchavest M, Whitehead S, Yeats C, 835
Barrell BG, Oyston PC, Parkhill J. 2004. Genomic plasticity of the causative 836
agent of melioidosis, Burkholderia pseudomallei. Proc Natl Acad Sci U S A 837
101:14240-5. 838
62. Sarovich DS, Price EP. 2014. SPANDx: a genomics pipeline for comparative 839
analysis of large haploid whole genome re-sequencing datasets. BMC Research 840
Notes 7:618. 841
63. Heine HS, England MJ, Waag DM, Byrne WR. 2001. In vitro antibiotic 842
susceptibilities of Burkholderia mallei (causative agent of glanders) determined 843
by broth microdilution and E-test. Antimicrob Agents Chemother 45:2119-21. 844
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
40
64. Norville IH, Harmer NJ, Harding SV, Fischer G, Keith KE, Brown KA, Sarkar-845
Tyson M, Titball RW. 2011. A Burkholderia pseudomallei macrophage infectivity 846
potentiator-like protein has rapamycin-inhibitable peptidylprolyl isomerase activity 847
and pleiotropic effects on virulence. Infect Immun 79:4299-307. 848
65. Taweechaisupapong S, Kaewpa C, Arunyanart C, Kanla P, Homchampa P, 849
Sirisinha S, Proungvitaya T, Wongratanacheewin S. 2005. Virulence of 850
Burkholderia pseudomallei does not correlate with biofilm formation. Microb 851
Pathog 39:77-85. 852
66. Scott AE, Christ WJ, George AJ, Stokes MG, Lohman GJ, Guo Y, Jones M, 853
Titball RW, Atkins TP, Campbell AS. 2016. Protection against experimental 854
melioidosis with a synthetic manno-heptopyranose hexasaccharide 855
glycoconjugate. Bioconjugate chemistry 27:1435-1446. 856
67. Kespichayawattana W, Rattanachetkul S, Wanun T, Utaisincharoen P, Sirisinha 857
S. 2000. Burkholderia pseudomallei induces cell fusion and actin-associated 858
membrane protrusion: a possible mechanism for cell-to-cell spreading. Infect 859
Immun 68:5377-84. 860
68. Scott NE, Parker BL, Connolly AM, Paulech J, Edwards AV, Crossett B, Falconer 861
L, Kolarich D, Djordjevic SP, Hojrup P, Packer NH, Larsen MR, Cordwell SJ. 862
2011. Simultaneous glycan-peptide characterization using hydrophilic interaction 863
chromatography and parallel fragmentation by CID, higher energy collisional 864
dissociation, and electron transfer dissociation MS applied to the N-linked 865
glycoproteome of Campylobacter jejuni. Mol Cell Proteomics 10:M000031-866
MCP201. 867
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
41
69. Ishihama Y, Rappsilber J, Mann M. 2006. Modular stop and go extraction tips 868
with stacked disks for parallel and multidimensional Peptide fractionation in 869
proteomics. J Proteome Res 5:988-94. 870
70. Rappsilber J, Mann M, Ishihama Y. 2007. Protocol for micro-purification, 871
enrichment, pre-fractionation and storage of peptides for proteomics using 872
StageTips. Nat Protoc 2:1896-906. 873
71. Cox J, Mann M. 2008. MaxQuant enables high peptide identification rates, 874
individualized p.p.b.-range mass accuracies and proteome-wide protein 875
quantification. Nat Biotechnol 26:1367-72. 876
72. Cox J, Hein MY, Luber CA, Paron I, Nagaraj N, Mann M. 2014. Accurate 877
proteome-wide label-free quantification by delayed normalization and maximal 878
peptide ratio extraction, termed MaxLFQ. Mol Cell Proteomics 13:2513-26. 879
73. Tyanova S, Temu T, Sinitcyn P, Carlson A, Hein MY, Geiger T, Mann M, Cox J. 880
2016. The Perseus computational platform for comprehensive analysis of 881
(prote)omics data. Nat Methods 13:731-40. 882
74. Perez-Riverol Y, Csordas A, Bai J, Bernal-Llinares M, Hewapathirana S, Kundu 883
DJ, Inuganti A, Griss J, Mayer G, Eisenacher M, Perez E, Uszkoreit J, Pfeuffer J, 884
Sachsenberg T, Yilmaz S, Tiwary S, Cox J, Audain E, Walzer M, Jarnuczak AF, 885
Ternent T, Brazma A, Vizcaino JA. 2019. The PRIDE database and related tools 886
and resources in 2019: improving support for quantification data. Nucleic Acids 887
Res 47:D442-D450. 888
75. Penfold RJ, Pemberton JM. 1992. An improved suicide vector for construction of 889
chromosomal insertion mutations in bacteria. Gene 118:145-146. 890
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
42
76. Thoma S, Schobert M. 2009. An improved Escherichia coli donor strain for 891
diparental mating. FEMS Microbiol Lett 294:127-32. 892
893
Figures 894
Figure 1. BpsΔppiB shows reduced intracellular survival in J774.A1 murine 895
macrophages. (A) Intracellular growth of BpsWT (●) and BpsΔppiB () in J774A.1 896
murine macrophages was infected at an MOI of 10 and intracellular counts taken at 0, 897
3, 6, 9 and 12. Graphs are the mean of five biological replicates with each having two 898
technical replicates. The error bars displaying the Standard Error of the Mean. * P-value 899
of 0.0159 by Mann-Whitney U-test. 900
901
Figure 2. BpsΔppiB is attenuated in the BALB/c mouse model of infection. (A) 902
BALB/c mice (n=6) were injected intraperitoneally with 1.1 x 104 CFU BpsWT (●) and 903
1.86 X 104 CFU of Bps∆ppiB (▲). * P-value 0.0183 by Log-rank test. Weight loss of 904
individual BALB/c mice (labelled 1 – 6) was monitored daily following intraperitoneal 905
infection as a measure of morbidity in (B) B.psWT and (C) B.psΔppiB. 906
907
Figure 3. BpsΔppiB demonstrates reduced formation of multinucleated giant cells 908
in J774 murine macrophages. Fluorescently stained monolayers infected with either 909
(A) BpsWT, (B) BpsΔppiB or (C) BpsΔppiB/ppiB. were stained with Anti-Bps-LPS-FITC 910
and nuclei are stained with Hoescht33258, bar indicates 14µM. (D) Percentage of nuclei 911
associated with a MNGC, BpsWT (●), BpsΔppiB () and BpsΔppiB/ppiB (■). Graphs 912
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
43
are the result of three biological repeats with each biological repeat containing two 913
technical repeats. 1000 nuclei were counted from each coverslip with them either being 914
part of a multinucleated cell or mononucleated and then the percentage of 915
multinucleated was calculated. * P-value 0.026 and ** P-value 0.0022 by Mann-Whitney 916
U-test. 917
918
Figure 4. Quantitative proteomic analysis of BpsWT vs BpsΔppiB. Label-free 919
quantification was undertaken to compare BpsΔppiB to BpsWT. A) Identified proteins 920
are presented as a volcano plot depicting mean label free quantitation (LFQ) intensity 921
ratios of BpsΔppiB versus BpsWT plotted against logarithmic t test p values from four 922
biological experiments of each strain. B) GO terms assigned localization of the 42 out 923
the 213 proteins which undergo statistically significant changes with localization 924
assignment. Only GO localization terms for groups with greater than 3 entries are 925
shown. Complementation of PpiB lead to restoration of proteins observed to (C) 926
increase and (D) decrease to near BpsWT levels. 927
928
Figure 5. KEGG Pathway analysis of proteins differentially present in BpsWT vs 929
BpsΔppiB. Proteins that were differentially present by proteomics (Supplementary 930
Table 1) were manually curated using the Kyoto Encyclopaedia of Genes and Genomes 931
(KEGG) database against the Burkholderia pseudomallei K96243 genome (entry 932
number T00203) and assigned a KEGG Orthology (KO). Proteins in red were increased 933
in BpsΔppiB relative to BpsWT, while proteins in blue were decreased. Numerous 934
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
44
proteins were predicted to be in other functional groups but only the highest KO was 935
taken down. 936
937
Figure 6. BpsΔppiB has significantly reduced motility and biofilm formation. (A) 938
Swarming motility of BpsWT (●), BpsΔppiB () and BpsΔppiB/ppiB (■) through 0.3 % 939
agarose plates. Values are the diameter of spread with readings taken at 24 hours post-940
inoculation. Results are of three biological replicates. ** P-value 0.0022 by Mann 941
Whitney U-test. (B) Biofilm forming capacity of BpsWT (●), BpsΔppiB () and 942
BpsΔppiB/ppiB (■) in nutrient LB broth. Biofilms were allowed to form over a 48 hour 943
period before being fixed with methanol and stained with crystal violet to determine 944
bacterial biomass. Crystal violet was solubilised with 33 % glacial acetic acid and optical 945
density was read with a spectrophotometer (BioRad Xmark) at 590 nm. Bars are 946
representative of the mean optical density with individual values plotted. Six biological 947
replicates with 6 technical repeats were conducted. ** P-value by Mann-Whitney U-test. 948
949
Figure 7. BpsΔppiB demonstrates greater sensitivity towards oxidative stress. 950
Survival of BpsWT (●), BpsΔppiB () and BpsΔppiB/ppiB (■) in increasing 951
concentrations of hydrogen peroxide. Values are the mean MIC of three biological 952
replicates. Concentrations are in µL/mL of 30% Hydrogen Peroxide (BioVar) solution. 953
MIC was determined by measuring the optical density (OD 590 nm) at 24 hours post 954
hydrogen peroxide exposure and MIC was called as the lowest concentration which 955
resulted in less than 20 % growth (dotted line) of the unexposed control on that plate. 956
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
45
957
Antibiotic BpsWT BpsΔppiB BpsΔppiB/ppiB
Ceftriaxone 128 8 16
Meropenem 2 0.5 1
Tetracycline 2 0.5 1
Doxycycline 1 <0.25 0.5
958
Table 1. Minimum Inhibitory Concentration (MIC) as determined by broth 959
microdilutions. Values are the mean MIC of three biological replicates. Concentrations 960
are in µg/mL for antibiotics. MIC was determined by measuring the optical density (OD 961
590 nm) at 24 hours post antibiotic exposure and MIC was called as the lowest 962
concentration which resulted in less than 20 % growth of the unexposed control on that 963
plate. 964
965
966
967
968
969
970
971
972
973
Strain or plasmid Genotype or description Source or
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
46
974
Table 2. Bacterial strains and plasmids used in this study 975
reference
Escherichia coli
TOP10® Chemically competent cloning strain Invitrogen
S17-1 λpir S17-1 with a λ prophage carrying the pir gene,
conjugal strain for the movement of pDM4
(75)
ST18 S17-1 λpirΔhemA, conjugal strain for the
movement of pBBR1-MCS1
(76)
Burkholderia pseudomallei
K96243 (WT) Clinical isolate Dstl, (61)
∆ppiB K96243 derivative; unmarked deletion ∆ppiB This study
∆ppiB/ppiB K96243 derivative; unmarked deletion ∆ppiB;
ppiB_3XFLAG_pBBR1-MCS1
This study
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
*
-5 0 5 10 15 20 25 30 35
12
14
16
18
20
22
Days post challenge
We
igh
t (g
)
1
2
3
4
5
6
-5 0 5 10 15 20 25 30 35
12
14
16
18
20
22
Days post challenge
We
igh
t (g
)
1
2
3
4
5
6
C
B
A
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
0 50 100 150 200 250
Metabolism
Environmental Information Processing
Signalling and Cellular Processes
Genetic Information Processing
Human Disease
Cellular Processes
Not Included in Pathway
Unassigned
Hypothetical Protein
Number of proteins
Increased Decreased
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from
0.32 0.16 0.08 0.04 0.02 0.01 0.005 0.0025
0
20
40
60
80
100
Concentration (µL/mL)
% G
row
th
on Decem
ber 22, 2020 by guesthttp://iai.asm
.org/D
ownloaded from