DMD 29637
1
Evaluation of Cynomolgus Monkey PXR, Primary Hepatocyte and In Vivo
Pharmacokinetic Changes in Predicting Human CYP3A4 Induction
Sean Kim, Joseph E. Dinchuk, Monique N. Anthony, Tami Orcutt, Mary E. Zoeckler, Mary
B. Sauer, Kathleen W. Mosure, Ragini Vuppugalla, James E. Grace Jr., Jean
Simmermacher, Heidi A. Dulac, Jennifer Pizzano and Michael Sinz
Metabolism and Pharmacokinetics (S.K., M.E.Z., K.W.M., J.E.G., J.S. and M.S.), Lead
Discovery (M.N.A.), Discovery Toxicology (T.O. and J.P.) and Veterinary Science (M.B.S.
and H.A.D.), Bristol-Myers Squibb Company, Wallingford, CT; Discovery Biology-
Oncology (J.E.D.) and Metabolism and Pharmacokinetics (R.V.), Bristol-Myers Squibb
Company, Lawrenceville, NJ
DMD Fast Forward. Published on October 15, 2009 as doi:10.1124/dmd.109.029637
Copyright 2009 by the American Society for Pharmacology and Experimental Therapeutics.
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
2
RUNNING TITLE:
Characterization of CYP3A induction in cynomolgus monkey
Corresponding author:
Sean Kim, Ph.D.
Metabolism and Pharmacokinetics
Bristol-Myers Squibb
5 Research Parkway
Wallingford, CT 06492
Email: [email protected]
Telephone: (203) 677-6147
Fax: (203) 677-6193
The number of text pages: 25
The number of tables: 3
The number of figures: 5
The number of references: 26
The number of words in abstract: 242
The number of words in introduction: 723
The number of words in discussion: 1432
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
3
ABBREVIATIONS:
AUC, area under the plasma concentration-time curve; cynoPXR, cynomolgus monkey
PXR; CYP, cytochrome P450; DMSO, dimethylsulfoxide; PXR, pregnane X receptor;
ADME, absorption, distribution, metabolism and elimination; MDZ, midazolam; LBD,
ligand-binding domain; DMEM, Dulbecco’s Modified Eagle’s Media; CAR, constitutive
androstane receptor; SJW, St. John’s Wort; CITCO, 6-(4-chlorophenyl)imidazo;
[1,3]thiazole-5-carbaldehyde O-3,4-dichlorobenzyl) oxime; TCPOBOP, 1,4-bis[2-(3,5-
dichloropyridyloxy)]benzene; PCN, pregnenolone 16α-carbonitrile; Cmax, maximum plasma
concentration
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
4
ABSTRACT
Monkeys have been proposed as an animal model to predict the magnitude of human
clinical drug-drug interactions caused by CYP3A4 enzyme induction. To evaluate whether
the cynomolgus monkey can be an effective in vivo model, human CYP3A4 inducers were
evaluated both in vitro and in vivo. First, a full-length PXR was cloned from the cynomolgus
monkey and the sequence compared to those of rhesus monkey and human PXR.
Cynomolgus and rhesus monkey PXR differed by only one amino acid (Ala68Val) and both
were highly homologous to human PXR (~ 96 %). When the transactivation profiles of 30
compounds including known inducers of CYP3A4 were compared between cynomolgus and
human PXR, a high degree of correlation with EC50 values was observed. These results
suggest that cynomolgus and human PXR respond in a similar fashion to these ligands.
Second, two known human CYP3A4 inducers, rifampicin and hyperforin, were tested in
monkey and human primary hepatocytes for induction of CYP3A enzymes. Both monkey
and human hepatocytes responded similarly to the inducers and resulted in increased RNA
and enzyme activity changes of CYP3A8 and CYP3A4, respectively. Lastly, in vivo
induction of CYP3A8 by rifampicin and hyperforin was demonstrated by significant
reductions of midazolam exposure which were comparable to those in humans. These results
demonstrate that the cynomolgus monkey can be a predictive in vivo animal model of PXR-
mediated induction of human CYP3A4 and can provide a useful assessment of the resulting
pharmacokinetic changes of affected drugs.
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
5
INTRODUCTION
Induction of cytochrome P450 (CYP) enzymes can result in serious drug-drug
interactions through loss of therapeutic efficacy or increased toxicity and is considered one
of the major liabilities during the treatment of disease states involving multiple drug
regimens (Lin, 2006). Drug-drug interactions involving CYP3A4 are of particular
importance because of its significant involvement in metabolizing over 50% of marketed
drugs. Thus, the elimination of this liability through proper screening as well as accurately
predicting the magnitude of CYP3A4 induction in patients has been a long standing pursuit
in preclinical development.
Non-human primates, including cynomolgus (Macaca fascicularis) and rhesus
monkeys (Macaca mulatta), have been used in pharmaceutical development as preclinical
models of drug safety, drug metabolism and pharmacokinetics as their absorption,
distribution, metabolism and elimination (ADME) properties are closely related to humans
(Akahori et al., 2005). For example, it has been shown that both cynomolgus and rhesus
monkey CYP2E1 and CYP2C activities are similar to the human isoforms (Sharer et al.,
1995; Zuber et al., 2002). The recently cloned rhesus CYP3A64 was also characterized and
found to be similar to human CYP3A4 in its amino acid sequence (93% homology) and
enzyme kinetics (Carr et al., 2006). Monkey and human intestinal microsomes also show
similar enzyme kinetic profiles for testosterone 6β-hydroxylation, suggesting a comparable
intestinal first pass metabolism by CYP3A substrates (Komura and Iwaki, 2007).
Collectively, these findings have led to the use of monkeys as an in vivo model to estimate
the absorption and first-pass hepatic or intestinal extraction of xenobiotics (Ward et al.,
2004; Ogasawara et al., 2007). Monkeys have also been used to study CYP3A enzyme
inhibition and the resulting drug-drug interactions in vivo between midazolam and CYP3A
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
6
inhibitors such as ketoconazole, erythromycin, diltiazem as well as several preclinical
development candidates (Kanazu et al., 2004; Prueksaritanont et al., 2006; Zhang et al.,
2007).
The use of non-human primate as a surrogate animal model to study human CYP
induction has also been gradually increasing. In vivo studies with cynomolgus monkeys
revealed that hepatic CYP1A, CYP2B and CYP3A enzymes are inducible in response to
human CYP inducers (Bullock et al., 1995; Lee et al., 2006). In a recent study with rhesus
monkeys, rifampicin, a human CYP3A4 inducer, markedly induced CYP3A64 mRNA and
midazolam-1’-hydroxylase activity in primary hepatocytes and demonstrated a significant
reduction in midazolam exposure in vivo (Prueksaritanont et al., 2006). Also, the induction
profiles of CYP1A and CYP3A mRNA expression in primary cynomolgus monkey
hepatocytes were closer to those in primary human hepatocytes compared to rat hepatocytes
(Nishimura et al., 2007). The similarities in CYP induction responses, especially with
CYP3A between rhesus monkeys and humans, can be explained by the fact that their ligand-
binding domains (LBDs) of the pregnane X receptor (PXR, NR1a2) share relatively high
sequence homology (~96 %) (Moore et al., 2002). Therefore, monkey PXR is expected to
exhibit similar ligand-specificity to human PXR (hPXR). This is in contrast to the rodent
PXR where the relatively large differences in sequence homology and ligand binding
affinities between human and rodent PXR has complicated the extrapolation of rodent
induction responses to human drug-drug interactions (Gonzalez and Yu, 2006). Overall,
these similarities in ADME as well as induction properties favor the use of the monkey as an
in vivo animal model to assess the CYP3A4 induction potential of new chemical entities.
This study investigated whether the cynomolgus monkey can be an effective in vivo
surrogate animal model for predicting human CYP3A4 induction potential. The first step to
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
7
validate such animal model was to evaluate human CYP3A4 inducers in in vitro assays
derived from the cynomolgus monkey, namely PXR transactivation and primary
hepatocytes, to confirm that induction responses from these in vitro assays are comparable
to the corresponding assays of human origin. Our laboratory cloned the full-length cynoPXR
and incorporated it into a transactivation assay. Subsequently, thirty compounds including
known inducers of human CYP3A4 were evaluated in both human and monkey PXR
transactivation assays. In addition, the induction responses of two known CYP3A4 inducers,
rifampicin and hyperforin, were evaluated in freshly-isolated primary hepatocytes from
cynomolgus monkey and human donors. Lastly, in vivo drug-drug interactions between
CYP3A4/CYP3A8 substrate (midazolam) and inducers (rifampicin and hyperforin) were
assessed in cynomolgus monkeys to establish whether the induction of CYP3A8 in monkey
can result in midazolam pharmacokinetic changes comparable to those observed in humans
at therapeutic doses and/or plasma exposures.
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
8
MATERIALS AND METHODS
Chemicals and Reagents. Hyperforin-DHCA was purchased from Alexis Biochemicals
(Lausen, Switzerland). Celecoxib, rosiglitazone, and terbinafine were obtained from Sequoia
Research Products (Oxon, UK). Midazolam hydrochloride syrup (2 mg/ml) was obtained
from Roxanne Laboratories, Inc (Columbus, OH). 1’- and 4’-Hydroxymidazolam were
purchased from BD Gentest (Woburn, MA). All cell culture media and reagents were
obtained from Invitrogen (Rockville, MA) including LipofectamineTM 2000 and
charcoal/dextran-treated fetal bovine serum (FBS). Alamar-Blue reagent was purchased
from Trek Diagnostics (Cleveland, OH). All other chemicals including rifampicin were of
analytical or HPLC grade and were purchased from Sigma-Aldrich (St. Louis, MO). St.
John’s Wort (SJW, 300 mg containing 0.3 % hypericin) capsules were purchased from GNC
Corporation (Pittsburgh, PA). LC/MS-MS analysis of ethanolic extracts of SJW showed that
each 300 mg SJW capsule contained 0.29 ± 0.02 % (w/w) hyperforin or 0.87 mg per
capsule.
Molecular Cloning of Cynomolgus Monkey PXR. A cynomolgus monkey liver cDNA
panel was purchased from the Biochain Institute (Hayward, CA). Forward (nucleotide 1-27)
and reverse (1274-1305) primers were selected based upon a rhesus monkey PXR
(AF454671) sequence with the exception that CTG at the translation start site was
substituted with ATG. Using an Advantage2™ PCR kit (Beckton-Dickinson, San Jose, CA),
the primary cDNA sequences were amplified by reverse transcription and a total of nine
putative full-length (1.3 kb) cynomolgus PXR clones were selected for sequencing. Raw
sequence data was processed using an Applied Biosystems 3730 Sequencer (Foster City,
CA) and imported into the Sequencher program (Genecodes, Ann Arbor, MI) for alignment
and editing. The consensus cynomolgus PXR was then cloned into the CMV-based
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
9
mammalian expression vector pcDNA3.1 from Invitrogen Corporation (Carlsbad, CA).
Contigs were imported into the Vector NTI program (Invitrogen Corporation) where
sequences were compared, translated and aligned and displayed using the AlignX tool.
Cynomolgus Monkey and Human PXR Transactivation Assays. Human PXR (hPXR)
and cynomolgus monkey PXR (cynoPXR) transactivation assays were performed following
the protocol described previously (Zhu et al., 2007) with the exception that the cynoPXR
was expressed in African-Green Monkey kidney cells (CV-1) instead of HepG2 cells.
Briefly, cells were plated in T-175 flasks with DMEM containing 10% fetal bovine serum to
achieve ~80% confluency one day prior to transfection. On the day of transfection, 20 μg of
CYP3A-luciferase vector and 1 μg of either cyno- or hPXR vector were premixed with
LipofectamineTM 2000 reagent for each flask and incubated for 30 min at room temperature.
The transfection mixture was then added to the cells and incubated for 24 hr. Following the
removal of transfection mixture, HepG2 and CV-1 cells were resuspended to a final
concentration of 1.6 x 105 cells/ml in DMEM media supplemented with 5%
charcoal/dextran-stripped FBS, 200 mM L-glutamine, 100 mM sodium pyruvate, and 10
mM non-essential amino acids. The transfected HepG2 and CV-1 cells were plated into 384-
well plates at a density of 8,000 cells per well. The plates already contained test articles that
were serially diluted in DMSO at a ratio of 1:3 to achieve ten final concentrations ranging
from 2.5 nM to 50 μM (0.5% DMSO v/v) in triplicates. Rifampicin (10 μM final
concentration) was included in all assay plates as a positive control. After an overnight
incubation in a 5% CO2 incubator at 37oC, Alamar Blue reagent was added to each well.
Plates were then incubated for 2 hr at 37 °C and then 1 hr at room temperature after which
fluorescence was read at ex525/em598 to evaluate cytotoxicity of the test articles. The CC50
(concentration causing 50% cytotoxicity) was reported. The luciferase activities were then
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
10
measured on a ViewluxTM (Perkin Elmer, Boston, MA) following the addition of Steady-
GloTM reagent from Promega (Madison, WI). The raw data were normalized against the
signal from 10 μM rifampicin and were expressed as a percent activation (%Act) at each
concentration.
100X(DMSO)SignalBlankn)(rifampiciSignalTotal
(DMSO)SignalBlankSignalCompound%Act
−−=
Emax and EC50 were reported from non-linear regression of concentration-response (%Act)
curves using the 4-parameter Hill equation.
Cynomolgus Monkey and Human Primary Hepatocytes. Freshly isolated cynomolgus
monkey (3 donors) and human primary hepatocytes (3 donors) were obtained from either
CellzDirect (Durham, NC) or Celsis (Chicago, IL) in 24-well collagen-coated plates. Upon
receipt of the cells, the transport media was replaced with a serum-free William’s E media
containing supplements provided by CellzDirect. Following a 24-hr acclimation,
hepatocytes were treated for three consecutive days with either DMSO, rifampicin, or
hyperforin. The media was replaced daily with fresh media containing the test articles in
DMSO (0.1% v/v). The concentrations for rifampicin ranged from 0.78 to 50 μM and
hyperforin was tested at concentrations ranging from 0.01 to 6.25 μM. The hepatocytes were
then washed once with pre-warmed Krebs-Henseleit buffer and incubated with 25 μM
midazolam for 15 min (monkey hepatocytes) or 60 min (human hepatocytes). Metabolite
formation was linear at the midazolam concentration and incubation times used in the
assays. The media was collected in microcentrifuge tubes containing a half-volume of ice-
cold acetonitrile containing an internal standard (0.5 μM terfenadine) to stop the enzymatic
reaction. Protein was separated from the mixture by centrifugation at 10000 rpm for 10 min
and the supernatant was used to quantitate the formation of 1-hydroxymidazolam by
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
11
LC/MS-MS. The remaining monolayer of hepatocytes was incubated with lysis buffer from
a SV-96TM RNA purification kit (Promega, Madison, WI) and total RNA was purified from
the lysate following the manufacturer’s protocol.
TaqmanTM Real-Time RTPCR. TaqmanTM real-time RT-PCR was used to measure
expression levels of monkey CYP3A8 and human CYP3A4 mRNA using custom designed
primers and a FAM-MGB probe. The sequences used for monkey CYP3A8 were as follows:
Forward Primer: TGCAGGAGGAAATTGATACAGTTTT; Reverse Primer: TC-
GAGATACTCCATCTGTAGCACAGT; and Probe: CCCAATAAGGCACCACCCACCT-
ATGA. For human CYP3A4, the following sequences were used: Forward Primer: TGGT-
GAATGAA-ACGCTCAGATT; Reverse Primer: CATCTTTTTTGCAGACCCTCTCA; and
Probe: TTCCCAATTGCTATGAGAC. Ribosomal 18S RNA was used as an endogenous
control. Each RNA sample was analyzed in triplicate and ~10 ng/ul of RNA was used in a
one-step RT-PCR reaction. The RT reactions were performed for 30 min at 48°C. The PCR
reactions were then started at 95°C for 10 min followed by 40 amplification cycles of 15 sec
at 95°C and 1 min at 60°C. Relative quantification was determined via the ΔΔCT method
using the SDS 2.3 software (Applied Biosystems, Foster City, CA).
Pharmacokinetics Drug-Drug Interaction Studies in Cynomolgus Monkey. The in vivo
study, approved by Bristol-Myers Squibb Animal Care and Use Committee, was carried out
in three male cynomolgus monkeys (4-8 kg). On day 0 and day 7, each monkey received 2
mg/kg midazolam hydrochloride syrup by oral gavage followed by a sterile water rinse and
blood samples were collected at 0.25, 0.5, 0.75, 1, 2, 4, 6, 7, 8 and 24 hr post dose in K2-
EDTA containing tubes. Following the centrifugation of blood samples for 3 min at 13000
rpm, the resultant plasma was stored at -20°C until analysis. On days 1 thru 6, each monkey
received an oral dose of 15 mg/kg rifampicin (as a suspension in PEG-400) or a single
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
12
capsule of SJW (300 mg) daily. On day 3 and day 6, blood was withdrawn from each
monkey to determine plasma levels of hyperforin (1 hr post dose) or rifampicin (2 hr post
dose). Throughout the study, monkeys were fasted before each dose of midazolam, SJW or
rifampicin.
LC/MS-MS Analysis of Midazolam, 1’- and 4’-Hydroxymidazolam, Hyperforin and
Rifampicin. For the analysis of midazolam, 1’-hydroxymidazolam, 4-hydroxymidazolam
and rifampicin from monkey plasma, a 25 µL aliquot was extracted into 100 µL of quench
solution (90% acetonitrile:10% isopropyl alcohol containing 0.5 µM terfenadine as internal
standard) while a 50 µL aliquot of plasma was extracted into 200 µL of quench solution
(100% acetonitrile with 0.1% formic acid containing 0.5 µM of terfenadine) for the analysis
of hyperforin. Following protein precipitation using a strata impact protein precipitation
plate (Phenomenex®, Torrance, CA), the supernatants were injected into an API4000 Q-
Trap (Applied Biosystems, Foster City, CA) triple quadruple mass spectrometer. The HPLC
system consisted of two LC-20AD (Shimadzu, Norwell, MD) delivery pumps and a SIL-
HTc autosampler or an Agilent 1200 coupled with a HTS PAL autoinjecter system (Leap
Technologies, Carrboro, NC). The mobile phase, which consisted of 0.1% formic acid in
water (A) and 0.1% formic acid in acetonitrile (B) was delivered at a flow rate of 0.4 ml/min
with the gradient condition as follows: the proportions of mobile phases A and B at 0, 3, 3.5,
4.5, 4.6, and 6 min where 95/5, 50/50, 0/100, 0/100, 95/5, and 95/5, respectively.
LC/MS/MS analysis was carried out using multiple reaction monitoring transitions for each
test compound: midazolam (326 � 291), 1’-hydroxymidazolam (342 � 324), 4’-
hydroxymidazolam (342 � 297), rifampicin (823 � 791), hyperforin (535.2 � 313.2) and
terfenadine (472 � 436). Standard curves were fit with a linear regression weighted by
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
13
reciprocal concentration (1/x2) weighting. Calibration ranges were from 5 to 10000 nM for
all analytes except hyperforin which was 0.2 to 125 nM.
Pharmacokinetic and Statistical Analysis. Pharmacokinetic analysis of plasma
concentrations of midazolam and its metabolites vs. time profiles were performed by non-
compartmental analysis using Kinetica v4.4 software (Thermo Fisher Scientific, Waltham,
MA). Statistical analyses including linear and nonlinear-regression and calculation of
confidence interval were performed using GraphPad Prism v4.0 for Windows (GraphPad
Software, San Diego, CA).
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
14
RESULTS
Molecular Cloning and Sequencing of Cynomolgus Monkey PXR. The full-length
cynomolgus monkey PXR sequence has been deposited to GenBank and was assigned the
accession number of GQ412289. The consensus cynoPXR sequence showed two amino-
acid residue differences at Cys182 and Glu189 in the ligand binding domain when it was
compared to the previously published partial cynoPXR sequence (EU153253) which has Tyr
and Arg at the same positions, respectively (Milnes et al., 2008). It also demonstrated two
wobble base pair changes relative to the rhesus PXR sequence at nucleotide positions 354
and 1158 of the open reading frame (not shown). One non-wobble base pair change in the
DNA binding domain was also noted in relation to the rhesus and human PXR and resulted
in a conservative amino acid substitution (Ala68Val) located within the DNA binding
domain as shown in Fig. 1. Except for this change, both rhesus and cynomolgus monkey
PXRs are identical in their amino acid sequences and are highly homologous to the human
orthologue (96%). Within the ligand binding domain, 11 amino acids were found to be
different between human and monkey PXR (consensus between cyno- and rhesus);
Leu184Met, Ser200Asn, Cys207Trp, Leu209Val, Leu213Val, Ser231Asn, Ser256Asn,
Ala280Thr, Thr311Pro, Leu357Val and Pro369Tyr.
Evaluation of Known CYP3A Inducers in Cynomolgus Monkey and Human PXR
Transactivation Assays. Among the thirty compounds tested in both hPXR and cynoPXR
transactivation assays, hyperforin was the most potent activator of human and monkey PXR
with EC50 values of 0.04 and 0.08 μM, respectively. SR-12813 was the second most potent
with EC50 values of 0.16 (hPXR) and 0.63 μM (cynoPXR). All other known activators of
hPXR such as clotrimzole, rosiglitazone, glimepride, ritonavir, pioglitazone, verapamil,
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
15
artemisinin, terbinafine, troleandomycin, troglitazone, mifepristone and carbamezepine
activated both cyno- and human PXR equally and their EC50 values are in good agreement
between two species. While all these compounds demonstrated similar affinities to PXR for
both species, rifampicin appeared to be the stronger activator of hPXR (EC50 = 0.84 μM)
than cynoPXR (EC50 = 5.1 μM) as shown in Fig. 2 and Table 1. Similar differences (less
affinity for cynoPXR) were observed with several other compounds including 1, 9-
dideoxyforkskolin, paclitaxel, nifedipine and celecoxib. However, the differences exhibited
by these compounds were less prominent (2-4 fold) than rifampicin (~6-fold). The most
noticeable differences in terms of maximum PXR activation were exhibited by reserpine and
sulfinpyrazone. The Emax values for reserpine and sulfinpyrzone were 103 and 73 % for
hPXR and 16 and 11 % for cynoPXR. Both compounds thus appear to be more potent
human PXR activators among the compounds tested. As shown in Table 1, negative control
compounds, methotrexate and probenecid, did not elicit any significant activation of PXR
up to 50 μM, regardless of the species tested. Pregnenolone 16α-carbonitrile (PCN), a
potent rodent CYP3A inducer, was shown to be a moderate PXR activator in both species
with an EC50 of approximately 25 μM. Dexamethasone, another potent rodent CYP3A
inducer, did not transactivate hPXR or cynoPXR. Phenytoin, meclizine, TCPOBOP and
CITCO are all known as preferential CAR activators, however, in our study all three
compounds activated PXR in both species. Phenobarbital, another CAR activator, did not
transactivate PXR up to 50 μM. In order to assess which parameter would yield the best
correlation of PXR transactivation between the two species, linear regression analyses were
performed with EC50, Emax and intrinsic induction activity (IIA, EC50/Emax) values obtained
from both assays. The initial estimates of correlation coefficients were 0.71, 0.49 and 0.99
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
16
for EC50, Emax and IIA, respectively. However, when both reserpine and sufinpyrazone were
excluded from the analyses due to their differential affinity for cyno- and human PXR, the
correlation coefficients for EC50 and Emax improved to 0.93 and 0.64, respectively (Fig. 3).
IIA values were found to be well correlated between hPXR and cynoPXR transactivation
assays (R2 = 0.99) regardless of the inclusion of reserpine and sufinpyrazone. As shown in
Fig. 3, most of the data points were plotted within the 95 % confidence interval lines,
suggesting that most of the compounds tested have a reasonably similar affinity for PXR in
both species. Most of the compounds tested in the assays were relatively non-cytotoxic up to
50 μM (Supplemental Table 1). Hyperforin was tested from 0.025 to 1 μM due to
cytotoxicity at concentrations above 1 μM.
CYP3A Induction in Cynomolgus Monkey and Human Primary Hepatocytes with
Rifampicin and Hyperforin. Both rifampicin and hyperforin, a known CYP3A4 inducers,
increased CYP3A RNA expression and activity (midazolam-1-hydroxylation) in primary
hepatocytes from cynomolgus monkey and human in a concentration-dependent manner
(Fig.4). The normalized rifampicin concentration-response curves for CYP3A8 RNA
expression and the activity in 3 preparations of monkey hepatocytes were almost super-
imposable to those of CYP3A4 RNA expression and activity in human hepatocytes from 3
individual donors. Non-linear regression analysis (Table 3) of the concentration-response
curves showed that the maximum induction of CYP3A8 (100-151.1 and 101.2-104.5 %RIF
for RNA and activity, respectively) was within the range shown by three human donors
(131-177.5 %RIF and 107.5-116.8 %RIF for RNA and activity, respectively). This result is
consistent with PXR transactivation profiles where the maximum transactivation by
rifampicin was similar between the species. While rifampicin appears to be a more potent
activator of human PXR, there were no significant differences in EC50 values between
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
17
human and monkey hepatocytes for the induction of CYP3A RNA or activity. EC50 value
for CYP3A8 RNA (3.38-12.18 μM) induction by rifampicin was within the range shown by
human donors (3.06-14.23 μM) and the EC50 for CYP3A8 activity (0.67-2.34 μM) was also
similar to EC50 values for human donors (0.76-1.94 μM). The comparison of concentration-
response curves for hyperforin between monkey and human hepatocytes was complicated by
the variable results at higher concentrations as shown in Fig. 4. This is probably due to the
combined effects of previously reported cytotoxicity at concentrations above 1 μM as well
as the inhibitory potential against CYP3A4 (IC50 = 2.3 μM) at high concentrations (Obach,
2000). Cynomolgus monkey hepatocytes appear to be more resistant to these combined
effects. Therefore, non-linear regression analysis was performed using only the data from
non-toxic concentrations of 0-1.65 μM. Human hepatocytes appeared to be more sensitive to
the inductive effects by hyperforin for CYP3A RNA expression than monkey hepatocytes.
EC50 values for CYP3A4 were within 0.37-1.27 μM compared to 2.64-3.38 μM for
CYP3A8. On the contrary, there was no significant differences for the activity between the
two species (EC50 = 0.23-0.32 μM for CYP3A4 vs. 0.98-1.54 μM for CYP3A8).
In Vivo Pharmacokinetic Study of Midazolam with Rifampicin and Saint John’s Wort
(SJW). Drug-drug interaction studies were conducted in male cynomolgus monkeys using
rifampicin and SJW as the inducing agents and midazolam as the probe substrate. The
pharmacokinetic parameters of midazolam exposure were determined on day 0 and day 7
before and after six days of daily oral administration of either rifampicin (10 mg/kg) or SJW
(300 mg). The plasma concentrations of hyperforin and rifampicin were monitored on days
3 and 6 at 1 or 2 hr after oral administration of the inducers, respectively. On day 3 and 6,
the average plasma levels of rifampicin were 15.9 ± 2.4 and 4.2 ± 1.2 μM, respectively and
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
18
the hyperforin levels were 0.48 ± 0.14 and 0.96 ± 0.59 nM, respectively (the lower limit of
quantitation for hyperforin was 0.2 nM). As shown in Fig. 5, the plasma concentration-time
profiles of midazolam were significantly altered following 6 days of rifampicin or SJW
treatment. Oral administration of rifampicin lowered the Cmax and AUC of midazolam by
92.6 and 91.8 % respectively (Table 2). SJW also lowered these parameters but the
magnitude of change was less pronounced. The Cmax and AUC of midazolam were
decreased by 62.3 and 58.0 %, respectively with SJW treatment. In contrast, the half-life of
midazolam did not change significantly before or after treatment with rifampicin or SJW.
The exposure changes of two midazolam metabolites, 1’-hydroxy (1-OH) and 4’-hydroxy
(4-OH) midazolam, appear to closely follow the changes observed for the parent compound.
A similar extent of Cmax and AUC reduction in plasma for 1-OH-MDZ was observed in
animals treated with either rifampicin (91.9 and 96.8%) or SJW (66.1 and 53.4 %). In SJW-
treated monkeys, the reduction in Cmax and AUC of 4-OH-MDZ were again similar (62.6
and 56.1 %) to those of the parent compound. The plasma level of 4-OH-MDZ in
rifampicin-treated animals was below the lower limit of quantitation and the decreases in
pharmacokinetic parameters could not be determined. The metabolite:parent ratio of 1- and
4-OH-MDZ was not significantly altered by SJW while rifampicin increased the ratio from
1.3 to 2.1.
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
19
DISCUSSION
Monkeys have been widely used in drug development as a species for toxicological
evaluation as well as the characterization of ADME properties of new chemical entities.
Recent advancements in our understanding of PXR as a master regulator of CYP3A
expression as well as the high sequence homology between monkey and human PXR led us
to hypothesize that monkeys may be an effective surrogate in vivo animal model of human
CYP3A4 induction. Such a model is important, especially in late-stage drug development,
where the induction potential of a clinical candidate requires more extensive evaluation at
therapeutically-relevant in vivo concentrations in order to assess pharmacokinetic changes
that may result from an interaction.
Previously, the rhesus monkey PXR was cloned and shown to have a high sequence
homology (~96%) to the ligand binding domain of human PXR. We report here the cloning
of full-length cynoPXR and confirm that there are only minor differences in the nucleotide
(354 and 1158) as well as amino acid sequences (Ala68Val) between rhesus and cynoPXR.
This difference is not expected to affect the ligand-binding specificities of PXR between
cynomolgus- and rhesus monkey because the amino acid change is located in the DNA
binding domain, not in the ligand-binding domain (LBD) of PXR. This was further
confirmed in studies conducted in our laboratory where the PXR transactivation response of
selected compounds was nearly identical between cynomolgus and rhesus PXR reporter
assays (unpublished results). These results suggest that, in PXR transactivation and binding
assays, the PXR protein from both monkey strains may be used interchangeably. Within the
ligand-binding domain, our consensus sequence was different from the partial cynoPXR
reported by Milnes, et al, by two amino acid changes. These amino acid residues are
conserved between human, rhesus, Japanese macca and our cynoPXR sequences but not in
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
20
Milnes’ cynoPXR. Further studies are necessary to reconcile the difference between the two
cynoPXR sequences. Excluding that difference, there are 11 amino acids within the LBD
which are different between the monkey and the human PXR, which may result in
differential binding and transactivation profiles for certain PXR ligands between human and
monkey.
As there has been no comprehensive evaluation of monkey PXR reported in the
literature, we investigated how well cynoPXR transactivation correlates to the hPXR
activation response by testing 30 compounds in both cynomolgus monkey and human
systems. When parameters representing intrinsic induction were used to compare PXR
transactivation between cynomolgus monkey and human, Emax values between the two
species showed a poor correlation while EC50 and IIA (Emax/EC50) demonstrated good
correlations between the two species as shown in Figure 3. Often, the maximum
transactivation of PXR is obscured at high concentrations where cytotoxicity or poor
solubility can interfere with the accurate determination of Emax. Therefore, it is not
surprising that Emax values did not correlate well between the two assays. The most notable
exceptions in transactivation response between the two species were reserpine and
sulfinpyrazone where both compounds appear to be more potent activators of hPXR. When
these two compounds were excluded from the linear regression analysis, the correlation of
PXR transactivation between the two species was improved. Therefore, these results suggest
that, while the cynoPXR transactivation assay can be predictive of human CYP3A4
induction, there are exceptions that require further evaluation. Interestingly, the amino acid
change between human and monkey PXR at position 209 (Leu209Val) did not alter the
agonist properties of hyperforin despite the known interaction between Leu209 of PXR
ligand-binding domain and hyperforin (Teotico et al., 2008). Nonetheless, the close
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
21
agreement of monkey and human in vitro data for the induction potential of the majority of
these compounds gave us confidence that in vivo drug-drug interactions in monkeys would
be predictive of human CYP3A4 induction.
The in vitro-in vivo correlation were further tested with rifampicin and hyperforin in
primary hepatocytes and in vivo. In primary hepatocytes isolated from both human and
cynomolgus monkeys, rifampicin and hyperforin induced both RNA expression and enzyme
activities of CYP3A as predicted by their PXR transactivation results. However, some
quantitative differences were also observed between PXR transactivation and CYP3A
induction in hepatocytes by both inducers. While rifampicin appeared to be a less potent
activator of PXR, it was an equally potent inducer of CYP3A in both cynomolgus monkey
and human hepatocytes. In contrast, hyperforin appears to be a less potent inducer of
CYP3A8 RNA expression compared to that of CYP3A4 RNA expression in primary
hepatocytes although the cytotoxicity and potential CYP3A inhibition complicated the
quantitative comparison between human and monkey induction responses. This species-
difference in the induction of CYP3A RNA expression did not significantly impact the
activity changes mediated by hyperforin. Midazolam-1-hydroxylase activities in hepatocytes
from both species were induced in a similar fashion (excluding the data from concentrations
above 1.65 μM). These quantitative differences in the prediction of CYP3A induction can
be attributed to the differences in either metabolic capacity or transporter functions between
the host cell lines in PXR assay (HepG2 and CV-1) and primary hepatocytes, which can
result in differential intracellular concentrations of the inducers.
Nonetheless, authors concluded that both compounds were still appropriate
candidates to be evaluated in a monkey in vivo model because the most important in vitro
parameter for CYP3A induction (activity changes in primary hepatocytes) is similar
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
22
between the two species and the differences are minimal considering the therapeutic
concentrations that these inducers reach during an established standard of care treatment
(i.e., EC50 << Cmax). When 15 mg/kg rifampicin was administered, the plasma
concentrations in monkeys were 15.9 and 4.2 μM, 2 hr post dose on days 2 and 6,
respectively. The decrease in C2h values after multiple days of dosing may be the reflection
of autoinduction by rifampicin as reported previously (Zhang et al., 1998; Wilkins et al.,
2008) but these levels are close to the reported Cmax values in patients (2.9 - 12.2 μM)
following a 600 mg oral dose of rifampicin (Israili et al., 1987). The results demonstrate that
the rifampicin dose chosen for the monkey study produced a similar plasma exposure to that
seen in patients. At these levels, rifampicin induction of CYP3A8 resulted in significant
changes in midazolam pharmacokinetics. Midazolam Cmax and AUC on day 7 decreased
from day 1 levels by 92.6 and 91.8 %, respectively, similar to the reported exposure changes
in human subjects following a 600 mg daily administration of rifampicin for 5 days (94 and
96 % respectively) (Backman et al., 1996). On the other hand, the plasma concentrations of
hyperforin 1 hr postdose were 0.48 and 0.96 nM in monkeys which are far lower than the
reported Cmax values (~51.5 nM) following a single dose of 900 mg SJW in human (Cui et
al., 2002). Unlike rifampicin where the Tmax value in monkeys is known (Prueksaritanont et
al., 2006), the Tmax for hyperforin in monkeys is not known. Assuming that hyperforin was
rapidly absorbed, a Tmax of 1 hr was chosen, however, it is not known if this is correct.
Therefore, a better estimation of hyperforin exposure (Cmax), is necessary with additional
sampling times to understand if there is an actual plasma exposure difference between
monkeys and humans at these doses. Despite the potentially lower exposure, oral
administration of 300 mg SJW (0.87 mg hyperforin) to monkeys resulted in Cmax and AUC
decreases in midazolam exposure of 62.3 and 58 %, respectively. The magnitude of
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
23
decreases in midazolam Cmax and AUC were similar to those in patients (42.5 and 52.3 %,
respectively) given daily administration of 900 mg (300 mg three times per day) SJW for 14
days (Wang et al., 2001). Interestingly, rifampicin and SJW treatment caused profound
decreases in both 1- and 4-OH midazolam plasma concentrations. A similar finding for the
midazolam metabolites was also reported in the rhesus monkey CYP3A64 induction study
(Prueksaritanont et al., 2006). Since PXR can also regulate the expression of Phase II
enzymes and transporters in addition to CYP3A, rifampicin and hyperforin may have
simultaneously induced pathways involved in the elimination of the MDZ metabolites, such
as glucuronidation and/or transporters. This secondary induction, in turn, may have
contributed to the rapid metabolism of 1- and 4-OH MDZ metabolites or enhanced
elimination via transporters.
In summary, the induction data from both in vitro (PXR transactivation and primary
hepatocytes) and in vivo (midazolam AUC reduction) experiments from cynomolgus
monkeys have been shown to be predictive of human CYP3A4 induction responses. Given
the positive qualitative and quantitative correlations between monkey and human, the
cynomolgus monkey may serve as an important animal model to more accurately assess
CYP3A4 induction potential and pharmacokinetic changes occurring due to drug-drug
interactions mediated by PXR during preclinical drug development.
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
24
ACKNOWLEDGEMENT
The authors greatly appreciate the critical review of the manuscript by Drs. A. David
Rodrigues and Kenneth Santone. We also acknowledge the significant contributions of Ms.
Sandra Matson and Dr. Tatyana Zvyaga with the hPXR transactivation assay.
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
25
REFERENCES
Akahori M, Takatori A, Kawamura S, Itagaki S and Yoshikawa Y (2005) No regional differences of cytochrome P450 expression in the liver of Cynomolgus monkeys (Macaca fascicularis). Exp Anim 54:131-136.
Backman JT, Olkkola KT and Neuvonen PJ (1996) Rifampin drastically reduces plasma concentrations and effects of oral midazolam. Clin Pharmacol Ther 59:7-13.
Bullock P, Pearce R, Draper A, Podval J, Bracken W, Veltman J, Thomas P and Parkinson A (1995) Induction of liver microsomal cytochrome P450 in cynomolgus monkeys. Drug Metab Dispos 23:736-748.
Carr B, Norcross R, Fang Y, Lu P, Rodrigues AD, Shou M, Rushmore T and Booth-Genthe C (2006) Characterization of the rhesus monkey CYP3A64 enzyme: species comparisons of CYP3A substrate specificity and kinetics using baculovirus-expressed recombinant enzymes. Drug Metab Dispos 34:1703-1712.
Cui Y, Gurley B, Ang CY and Leakey J (2002) Determination of hyperforin in human plasma using solid-phase extraction and high-performance liquid chromatography with ultraviolet detection. J Chromatogr B Analyt Technol Biomed Life Sci 780:129-135.
Gonzalez FJ and Yu AM (2006) Cytochrome P450 and xenobiotic receptor humanized mice. Annu Rev Pharmacol Toxicol 46:41-64.
Israili ZH, Rogers CM and el-Attar H (1987) Pharmacokinetics of antituberculosis drugs in patients. J Clin Pharmacol 27:78-83.
Kanazu T, Yamaguchi Y, Okamura N, Baba T and Koike M (2004) Model for the drug-drug interaction responsible for CYP3A enzyme inhibition. I: evaluation of cynomolgus monkeys as surrogates for humans. Xenobiotica 34:391-402.
Komura H and Iwaki M (2007) Species differences in in vitro and in vivo small intestinal metabolism of CYP3A substrates. J Pharm Sci.
Lee AM, Miksys S and Tyndale RF (2006) Phenobarbital increases monkey in vivo nicotine disposition and induces liver and brain CYP2B6 protein. Br J Pharmacol 148:786-794.
Lin JH (2006) CYP induction-mediated drug interactions: in vitro assessment and clinical implications. Pharm Res 23:1089-1116.
Milnes MR, Garcia A, Grossman E, Grun F, Shiotsugu J, Tabb MM, Kawashima Y, Katsu Y, Watanabe H, Iguchi T and Blumberg B (2008) Activation of steroid and xenobiotic receptor (SXR, NR1I2) and its orthologs in laboratory, toxicologic, and genome model species. Environ Health Perspect 116:880-885.
Moore LB, Maglich JM, McKee DD, Wisely B, Willson TM, Kliewer SA, Lambert MH and Moore JT (2002) Pregnane X receptor (PXR), constitutive androstane receptor (CAR), and benzoate X receptor (BXR) define three pharmacologically distinct classes of nuclear receptors. Mol Endocrinol 16:977-986.
Nishimura M, Koeda A, Suganuma Y, Suzuki E, Shimizu T, Nakayama M, Satoh T, Narimatsu S and Naito S (2007) Comparison of inducibility of CYP1A and CYP3A mRNAs by prototypical inducers in primary cultures of human, cynomolgus monkey, and rat hepatocytes. Drug Metab Pharmacokinet 22:178-186.
Obach RS (2000) Inhibition of human cytochrome P450 enzymes by constituents of St. John's Wort, an herbal preparation used in the treatment of depression. J Pharmacol Exp Ther 294:88-95.
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
26
Ogasawara A, Kume T and Kazama E (2007) Effect of oral ketoconazole on intestinal first-pass effect of midazolam and fexofenadine in cynomolgus monkeys. Drug Metab Dispos 35:410-418.
Prueksaritanont T, Kuo Y, Tang C, Li C, Qiu Y, Lu B, Strong-Basalyga K, Richards K, Carr B and Lin JH (2006) In vitro and in vivo CYP3A64 induction and inhibition studies in rhesus monkeys: a preclinical approach for CYP3A-mediated drug interaction studies. Drug Metab Dispos 34:1546-1555.
Sharer JE, Shipley LA, Vandenbranden MR, Binkley SN and Wrighton SA (1995) Comparisons of phase I and phase II in vitro hepatic enzyme activities of human, dog, rhesus monkey, and cynomolgus monkey. Drug Metab Dispos 23:1231-1241.
Teotico DG, Bischof JJ, Peng L, Kliewer SA and Redinbo MR (2008) Structural basis of human pregnane X receptor activation by the hops constituent colupulone. Mol Pharmacol 74:1512-1520.
Wang Z, Gorski JC, Hamman MA, Huang SM, Lesko LJ and Hall SD (2001) The effects of St John's wort (Hypericum perforatum) on human cytochrome P450 activity. Clin Pharmacol Ther 70:317-326.
Ward KW, Stelman GJ, Morgan JA, Zeigler KS, Azzarano LM, Kehler JR, McSurdy-Freed JE, Proksch JW and Smith BR (2004) Development of an in vivo preclinical screen model to estimate absorption and first-pass hepatic extraction of xenobiotics. II. Use of ketoconazole to identify P-glycoprotein/CYP3A-limited bioavailability in the monkey. Drug Metab Dispos 32:172-177.
Wilkins JJ, Savic RM, Karlsson MO, Langdon G, McIlleron H, Pillai G, Smith PJ and Simonsson US (2008) Population pharmacokinetics of rifampin in pulmonary tuberculosis patients, including a semimechanistic model to describe variable absorption. Antimicrob Agents Chemother 52:2138-2148.
Zhang H, Zhang D, Li W, Yao M, D'Arienzo C, Li YX, Ewing WR, Gu Z, Zhu Y, Murugesan N, Shyu WC and Humphreys WG (2007) Reduction of site-specific CYP3A-mediated metabolism for dual angiotensin and endothelin receptor antagonists in various in vitro systems and in cynomolgus monkeys. Drug Metab Dispos 35:795-805.
Zhang JN, Liu XG, Zhu M, Chiu FC and Li RC (1998) Assessment of presystemic factors on the oral bioavailability of rifampicin following multiple dosing. J Chemother 10:354-359.
Zhu Z, Puglisi J, Connors D, Stewart J, Herbst J, Marino A, Sinz M, O'Connell J, Banks M, Dickinson K and Cacace A (2007) Use of cryopreserved transiently transfected cells in high-throughput pregnane X receptor transactivation assay. J Biomol Screen 12:248-254.
Zuber R, Anzenbacherova E and Anzenbacher P (2002) Cytochromes P450 and experimental models of drug metabolism. J Cell Mol Med 6:189-198.
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
27
LEGENDS FOR FIGURES
Figure 1. Open reading frame of cynomolgus monkey PXR; the protein sequence alignment
with rhesus (rhes) and human (huma) PXR sequences was performed as described in
Methods. The highlighted areas denote the difference between the sequences of
cynomolgus, rhesus or human PXR. The DNA binding domain spans amino acid residues
41-107 while the ligand binding domain spans amino acid residues 139 through 434.
Figure 2. Mean concentration-response profiles of rifampicin and hyperforin in both
cynomolgus (cynoPXR) and human PXR (hPXR) transactivation (A and C, respectively)
and Alamar-blue cytotoxicity assays (B and D, respectively). Each data point is expressed as
average ± SD.
Figure 3. Linear regression analysis between cynomolgus monkey (cynoPXR) and human
PXR (hPXR) transactivation profiles. (A) EC50 (excluding reserpine and sulfinpyrazone);
(B) Emax (excluding reserpine and sulfinpyrazone); (C) IIA (Emax/EC50) with all 30
compounds and (D) an enlarged view of inset square in C. The dashed lines denote 95 %
confidence intervals.
Figure 4. Mean concentration-response curves for RNA expressions and midazolam-1-
hydroxylase activities in cynomolgus monkey and human primary hepatocytes (A)
rifampicin - RNA (B) rifampicin - activity (C) hyperforin - RNA and (D) hyperforin -
activity.
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
28
Figure 5. Plasma-time profiles of midazolam, 1- (1-OH-MDZ) and 4-hydroxymidazolam (4-
OH-MDZ) on day 0 (before inducer treatment) and day 7 (after inducer dose) in
cynomolgus monkeys treated by either rifampicin (A, B and C, respectively) or SJW (D, E
and F, respectively).
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
29
Table 1. PXR transactivation results for thirty compounds tested in human and cynomolgus
monkey PXR transactivation assays
Substance1 PXR Transactivation (Human / Cyno)
Emax (%RIF)
EC50
(μM) IIA3
(Emax/EC50)
Hyperforin2 148 / 155 0.04 / 0.08 3610 / 2067 SR-12813 120 / 163 0.16/ 0.63 736/ 259
Clotrimazole 115 / 94 1.4 / 1.0 82 / 94 Rosiglitazone 109 / 94 ~ 25 / ~ 25 4.4 / 3.8
1,9-Dideoxy-forskolin 103 / 109 1.4 / 7.5 74 / 15 Reserpine 103 / 16 2.7 / 50 38 / 0.3 Rifampicin 101 / 137 0.84 / 5.1 121 / 27 Glimepride 98 / 96 7.5 / 19 13 / 5.1 Ritonavir 97 / 112 1.7 / 4.5 57 / 25
Piogiltazone 92 / 69 ~ 25 / ~ 25 3.7 / 2.8 CITCO 87 / 109 1.9 / 4.3 46 / 25
Sulfinpyrazone 73 / 11 ~ 25 / > 50 2.9 / 0.2 Verapamil 71 / 180 3.5 / 3.6 20 / 50 Nifedipine 70 / 69 1.7 / 4.5 41 / 15
Artemisinin 67 / 79 29 / 14 2.3 / 5.8 Terbinafine 63 / 40 4.8 / 5.0 13 / 8.0 Paclitaxel 60 / 40 0.55 / 2.2 109 / 18
Troleandomycin 60 / 116 4.1 / 10 15 / 12 Trogiltazone 55 / 65 4.1 / 4.1 13 / 16 Mifepristone 53 / 49 1.8 / 1.6 29 / 31
PCN 50 / 113 ~ 25 / ~ 25 2.0 / 4.5 Celecoxib 36 / 94 2.5 / 8.3 14 / 11 Phenytoin 33 / 23 28 / 16 1.2 / 1.4 Meclizine 25 / 29 8.3 / 6.2 3.0 / 4.7 TCPOBOP 22 / 44 4.3 / 5.9 5.1 / 7.5
Carbamezepine 21 / 21 > 50 / > 50 0.4 / 0.4 Probenecid 9 / 7 > 50 / > 50 0.2 / 0.1
Phenobarbital 3 / 1 > 50 / > 50 0.1 / 0.0 Dexamethasone 0 / 4 > 50 / > 50 0.0 / 0.1
Methotrexate 0 / 2 > 50 / > 50 0.0 / 0.0 1 in order of Emax values (highest-lowest) in the hPXR transactivation assay
2hyperforin was only tested up to 1.0 μM due to known cytotoxicity 3intrinsic induction activity
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
30
Table 2. Pharmacokinetic parameters of midazolam (MDZ), 1- and 4- hydroxymidazolam
(1’- and 4’-OH-MDZ) in cynomolgus monkey plasma following oral administration of
midazolam (2 mg/kg)
Analyte 1Parameter Rifampicin St. John’s Wort
Day 0 Day 7 %
Change Day 0 Day 7
% Change
MDZ
Cmax (nM) 110.7 8.2 -92.6 148.0 55.8 -62.3
AUC (nM*hr) 264.1 21.7 -91.8 435.2 182.7 -58.0
T1/2 (hr) 1.5 1.6 +6.7 1.1 1.2 +9.1
1’-OH-
MDZ
Cmax (nM) 266.1 21.5 -91.9 279.7 94.8 -66.1
AUC (nM*hr) 342.9 45.4 -86.8 453.0 211.0 -53.4
Ratio (M/P2) 1.3 2.1 1.0 1.2
4’-OH-
MDZ
Cmax (nM) 36.5 BLLQ3 32.1 12.0 -62.6
AUC (nM*hr) 39.6 BLLQ 60.1 26.4 -56.1
Ratio (M/P) 0.1 0.1 0.1
1The value is represented as the average of three animals 2Metabolite/parent 3Below lower limit of quantitation
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
DMD 29637
31
Table 3. Donor information and non-linear regression analysis of CYP3A4 induction in human and cynomolgus monkey hepatocytes
Species Donor Information
Endpoint Rifampicin Hyperforin2
Vendor/Lot Sex Age Ethnicity EC50
(μM) Emax
1
(%RIF) EC50
(μM) Emax
1
(%RIF)
Human
CellzDirect HU0693
M 41 Caucasian RNA 14.23 177.5 0.37 63.5
Activity 1.94 109.5 0.32 71.5
CellzDirect HU0694
F 54 Caucasian RNA 6.48 169.5 0.51 104.6
Activity 0.76 116.8 0.23 69.7
CellzDirect HU0965
F 27 Caucasian RNA 3.06 131.0 1.27 66.5
Activity 0.93 107.5 0.32 57.9
Cynomolgus Monkey
CellzDirect M - - RNA 12.18 151.1 3.28 118.2
Activity 0.67 104.5 1.54 66.0
CellzDirect M - - RNA 3.38 100.0 3.01 46.9
Activity 1.68 101.2 0.98 68.5
Celsis M - - RNA 6.16 131.0 2.64 28.1
Activity 2.34 101.5 1.50 74.1 1% of induction response compared to that of rifampicin at 12.5 μM 2Non-linear regression analysis for CYP3A induction in human hepatocytes was performed with the partial data set (0-1.56 μM) due to the observed cytotoxicity at higher concentrations of hyperforin
This article has not been copyedited and form
atted. The final version m
ay differ from this version.
DM
D Fast Forw
ard. Published on October 15, 2009 as D
OI: 10.1124/dm
d.109.029637 at ASPET Journals on June 1, 2020 dmd.aspetjournals.org Downloaded from
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from
This article has not been copyedited and formatted. The final version may differ from this version.DMD Fast Forward. Published on October 15, 2009 as DOI: 10.1124/dmd.109.029637
at ASPE
T Journals on June 1, 2020
dmd.aspetjournals.org
Dow
nloaded from