PROTEIN EXPRESSION AND CHARACTERIZATION OF THE MAJOR
AUTOANTIGEN (TITIN DOMAIN) ASSOCIATED WITH AUTOIMMUNE
RIPPLING MUSCLE DISEASE
A dissertation submitted
to Kent State University in partial
fulfillment of the requirements for the
degree Doctor of Philosophy
by
Lisa M. Zelinka
May, 2015
Dissertation written by
Lisa M. Zelinka
B.S., Youngstown State University, 1995
M.S., Youngstown State University, 2002
Ph.D., Kent State University, 2015
Approved by
Dr. Gary R. Walker, Chair, Doctoral Dissertation Committee
Dr. Fayez Safadi, Doctoral Dissertation Committee
Dr. Eric M. Mintz, Doctoral Dissertation Committee
Dr. Wen- Hai Chou, Doctoral Dissertation Committee
Dr. Robert Clements, Graduate Faculty Representative
Accepted by
Dr. Eric M. Mintz, Director, School of Biomedical Sciences
Dr. James L. Blank, Dean, College of Arts and Science
iii
TABLE OF CONTENTS
TABLE OF CONTENTS ................................................................................................ iii
LIST OF FIGURES ........................................................................................................ vi
LIST OF DIAGRAMS ................................................................................................... vii
LIST OF TABLES ........................................................................................................ viii
ACKNOWLEDGEMENTS ............................................................................................ ix
I. INTRODUCTION ................................................................................................1
Anatomy and Physiology of Skeletal Muscle .......................................................1
Regulation of Muscle Contraction ........................................................................5
Rippling Muscle Disease (Genetic) ....................................................................10
Autoimmune Rippling Muscle Disease (Acquired) ............................................19
Skeletal Muscle Connectin/Titin.........................................................................27
Gene Cloning and Regulation .............................................................................37
Aims and Scope of Dissertation Research ..........................................................40
II. MATERIALS AND METHODS ........................................................................42
Strains .................................................................................................................42
RMMG#6 pBluescript II KS/SK(+)........................................................43
Cloning and Transformation ...............................................................................44
RMMG#6 DNA Insert Cloning ..............................................................44
pGEX and RMMG#6 Ligation ...............................................................46
iv
Transformation ........................................................................................48
Plasmid Preparation ................................................................................ 50
DNA Sequencing .................................................................................... 50
Protein Expression .................................................................................. 51
Glutathione-S-transferase affinity chromatography purification ............ 52
SDS PAGE .............................................................................................. 53
Western Blot ........................................................................................... 53
Olmsted Affinity Purification of Antibodies .......................................... 54
Immunofluorescent Microscopy ............................................................. 55
Titin Gels ................................................................................................ 56
Two Dimensional Gel Electrophoresis (2DGE) ..................................... 57
Protein Excision and Analysis ............................................................................61
In Gel Digestion ......................................................................................61
MASS Spectrophotometer ......................................................................62
III. RESULTS ...........................................................................................................65
Specimen Integrity ..............................................................................................65
Cloning and Transformation ...............................................................................66
Ligation ...............................................................................................................67
Confirmation of Ligation ....................................................................................67
Plasmid Construction ..........................................................................................75
Protein Expression and Purification....................................................................78
Polyacrylamide Gel Electrophoresis ...................................................................81
v
Confirmation of Antibody Reactivity .................................................................83
Cellular Localization ...........................................................................................85
Blast X Search.....................................................................................................87
MS/MS Protein Sequence Analysis ....................................................................99
IV. DISCUSSION .....................................................................................................90
REFERENCES .............................................................................................................110
APPENDICES ..............................................................................................................126
A. List of Abbreviations ..................................................................................127
B. List of Solutions and Reagents ...................................................................128
C. Muscle Protein Reference Table .................................................................132
D. Miscellaneous Solutions .............................................................................134
E. Vertical Agarose Gel Electrophoresis .........................................................137
F. Vertical Agarose Titin Gel Electrophoresis Gel Casting ............................138
vi
LIST OF FIGURES
Figure Page
1. PCR DNA Gel of pBluescript RMMG#677 .......................................................69
2. DNA Gel of pCR®4-TOPO RMMG#678 ..........................................................70
3. DNA Gel of pGEX and pCR®-TOPO RMMG#679 ..........................................71
4. DNA Gel of pGEX3RMMG#6 ...........................................................................72
5. DNA Sequence of ARMD Immune-Reactive Titin N2-A ..................................73
6. PCR and Restriction Endonuclease Analysis of pGEX Titin N2-A ...................74
7. Virtual Amino Acid Sequence Analysis .............................................................76
8. pG3RMMG6 Map ...............................................................................................77
9. SDS-PAGE of Expression and Purification ........................................................80
10. Vertical Agarose Gel Electrophoresis of Glutathione Affinity Purified
GST-titin N2-A Domain Fusion Protein .............................................................82
11. Western Blot .......................................................................................................84
12. Olmsted Affinity Purified Autoantibody from ARMD Antisera ........................86
13. Sequence Alignment of EU428487 ....................................................................87
14. Nano LC/MS/MS Analysis of gst-RMMG6 Fusion Protein...............................89
vii
LIST OF DIAGRAMS
Diagram Page
1. Sarcomere ..........................................................................................................2
2. Molecular Structures of the Sarcomere..............................................................9
3. Immunogenic Domains of Titin .......................................................................21
4. Domain structure of Titin Isoforms in Human ................................................29
5. Ion Channels of Skeletal Muscle Triad ............................................................36
6. Diagram of the Position of ARMD Autoantibody Binding on
Skeletal Muscle Titin .....................................................................................108
viii
LIST OF TABLES
Table Page
1. Events of Normal Skeletal Muscle Contraction..................................................10
2. Proteins Subject to Autoantibody Attack ............................................................20
ix
ACKNOWLEDGMENTS
I would have never been able to fulfill the requirements of my dissertation
without the constant guidance of my advisor, committee members, family, and friends.
My deepest gratitude goes to my advisor, Dr. Gary Walker. Dr. Walker generously
shared his expertise, patience, concern, care, and his passion for science and life. Dr.
Walker also provided me with an excellent research atmosphere where he was not only
my advisor but my colleague. His excellent guidance extended even to the point of
understanding that I needed to learn on my own, but he also had experience enough to
know to throw me a lifeline when I was in over my head. (This is something you
cannot comprehend until you have students of your own). Perhaps the most valuable
lesson that Dr. Walker taught me is that even negative data yields positive results in
terms of contributing to knowledge and understanding. I would also like to thank Dr.
Asch and Dr. Dorman for suggesting new ideas to resolve my experimental issues. Dr.
Asch always found time to answer my endless questions. I would like to thank Dr.
Cagiut, Dr. Cooper, Dr. Lorimer, and Dr. Fagan for their constant kindness,
consideration, compassion, support, and knowledge and also for the use of their
laboratories and reagents.
I would never have been able to make it through these days without my YSU
family. I want to thank Sumedha Sethi, who was an excellent friend (and cook!). She
was always eager to listen and willing to help with her best suggestions, not only in
terms of research, but also in the realm of encouragement and emotional support. I
would also like to thank Tom Watkins, an excellent friend, who answered my
x
innumerable questions and provided me with research suggestions as well as
encouragement and emotional support. I want to express special gratitude to my
student, Robert Giles, whose contagious enthusiasm inspired me during days where
enthusiasm was in short supply. He was my right hand, and without his continual thirst
for scientific knowledge and his eager preparation of my experiments, I never would
have stayed the course. It would have been a lonely lab without these people. Many
thanks to Julie, Heather, Stephanie, Angela, Dan, and Christine.
I would like to thank all the people at Sharon Regional Health System for all of
their encouragement, support and schedule changes.
I also learned throughout my journey that the secretary of the department knows
where everything is located and how to do things so I would like to thank Pat and Judy
for being so awesome at their jobs and keeping in check with my timeline.
Finally, I would like to thank my fiancé, Scott Suchora. He was on call for
cheering me up and he unfalteringly stood by me through the good, the bad, and the
ugly. He was my emotional support, my sounding-board, and my personal complaint
committee. I also want to thank my children, Alexandria Ann and Victoria Elizabeth,
for inspiring me not only to love and to laugh, but for reminding me that the influence
of a vital person vitalizes, and that girls need good female role models, especially in the
fields of math and science.
A simple thank you just does not seem adequate compensation for all of you!
1
CHAPTER I
INTRODUCTION
Anatomy and Physiology of Skeletal Muscle
The ultra structure of a skeletal muscle sarcomere is composed of distinct
contractile components to stabilize and control the sarcomeric structure and function
during contraction and relaxation. One muscle fiber is composed of thousands of long,
cylindrical cells. The sarcoplasm has light and dark bands or cross-striations.
Skeletal muscle has a striated appearance due to discontinuous position of the
A-band and then the I-band. The A-band is darker and denser then the I-band which is
lighter. The darker regions are called anisotropic or more commonly, A-band and the
light bands are named isotropic or more commonly, I-band. Contractile elements in the
skeletal muscle are named myofibrils. Diagram 1 is a one dimension schematic
representation of a muscle cell showing the cellular components.
2
Diagram 1: This is a schematic representation of the sarcomere.
This picture shows where the sarcomere cellular components are located
within the sarcomere. The titin molecule is red and located in the in the
Z-line of the I-band to the myosin of the A-band. Source: Kravitz L.
Web page. [Internet]. Albuquerque (NM): University of New Mexico;
[date unknown]. One screen from listing of media pages. Available
from: http://www.unm.edu/~lkravitz/MEDIA2/Sarcomere.jpg.
Myofibrils consist of three different myofilaments referred to as thick, thin, and
elastic filaments. A sarcomere is a uniquely specialized arrangement of myofilaments
in the myofibril. The I-band consists of actin thin filaments and the A-band consists of
myosin thick filaments. The I-band is directly attached to the Z-disk or Z-line. The Z-
disks are plate shaped areas containing the greatest density of sarcomeric proteins to
separate each sarcomere. It functions as a scaffold to support the contractile apparatus
3
formed by actin and myosin as well as their associated proteins (Sanger et al., 2008).
The A-bands in the sarcomere stretch the entire length of the thick filament and are
vicariously linked to the Z-disk by connectin or titin. Elastic filaments consist of the
large protein referred to as connectin or titin. Connectin or titin functions to stabilize
the thick filaments to the Z-disks. Not only does titin/ connectin have elastic properties
it also has regulatory properties (Barinaga 1995) as well. Titin will be discussed later
in detail due to its essential role in the sarcomere. Z-disks are located in the middle of
the I-bands and the H-zones are located in the middle of the A-bands. The H-zones
only contain thick filaments and are separated by the M-line. The function of the H-
zone is to attach the myosin thick filaments to the middle of the M-line.
Myosin is a contractile protein. The tail of the myosin points towards the M-
line which is located in the center of the sarcomere. Thick filaments contain the
myosin head or another name for them is cross bridges. The thin filaments contain
actin. Actin is a contractile protein. Actin’s purpose is to serve as the myosin binding
site. Each actin molecule on the thin filament holds a myosin binding site to adhere to
the myosin head of the thick filament.
Thin filaments are comprised of troponin and tropomyosin. These constituents
are regulatory proteins. The key role of tropomyosin is to sequester the myosin binding
sites on the actin molecule to facilitate relaxation of the muscle fiber. The muscle is
activated to contract by release of free calcium. Free calcium is released from the free
calcium release channels in the sarcoplasmic reticulum. Then the free calcium couples
to the troponin on the thin filament. This results in a conformational alteration of
4
tropomyosin to reveal the myosin-binding site on the actin molecules. Actin, located
on the thin filaments, couples to the myosin head located on the thick filaments
allowing the thick filament to slide over the thin filament by the activation of the
ATPase cycle leading to a decrease in sarcomere length. When the contraction is
finished, the membrane potential returns to a resting potential, which triggers the
calcium release channels in the sarcoplasmic reticulum to seal. Free calcium is pumped
from the sarcoplasm back to the sarcoplasmic reticulum by active transport from an
ATP powered calcium pump. This allows the troponin-tropomyosin complex to return
to normal and conceal the myosin binding sites on the actin. Now the muscle is in a
relaxed state.
In addition to thin and thick filaments, there are three more very large,
filamentous proteins that have essential support roles in muscle contraction. These
giant filamentous muscle proteins are titin, nebulin, and obscurin. Obscurin is a
multidomain, linear protein consisting of adhesion modules and signaling domains. It
is not included in the sarcomere proper; however, it exists on the peripheries. Nebulin
binds actin in striated muscle. Nebulin produces muscle contraction by associating
with the alpha-actin that makes the I-band, and nebulin. It extends along with actin,
with its N-terminus aligned with the ends of the titin filaments, and its C-terminus is
anchored to the Z-disk. Of course, titin is the most abundant of these three, and the
third most common protein in the muscle, behind only myosin and actin. Titin is the
largest sarcomeric protein; it spans half the muscle length. The N-terminus is attached
to the Z-disk and the C- terminus in the M-band. Due to this arrangement titin is
5
considered as the sarcomere’s third filamentous system, along with myosin and actin
(Kontrogianni- Konstantopoulos et al. 2009).
Regulation of Muscle Contraction
Muscle contraction occurs in conjunction with motor neurons. In 1954 Hanson
and Huxley proposed the sliding filament model describing contractile filaments and
properties of the sarcomere and motor neurons during contraction. An elaborate
sequence of events must occur for a normal skeletal muscle fiber to contract. The very
first event that must occur is a nerve impulse received at the axon terminal end of the
motor neuron. It is in fact the nerve impulse that activates the release of acetylcholine
into the synaptic cleft. When the acetylcholine (ACh) is released from the motor
neuron it complexes to the alpha subunits of the acetylcholine receptor (AChR) on the
motor end plate of the muscle sarcolemma located at the neuromuscular junction. The
coupling of acetylcholine (ACh) to the acetylcholine receptor (AChR) causes a
conformational alteration, responsible for releasing the free sodium ions to flow in the
sarcomere. The sodium release creates an action potential across the sarcolemma
surface and into the middle of the sarcomere via the T-tubule invagination.
It is actually the sarcolemma depolarization that distributes over the entire
sarcolemma into the T-tubule that stimulates the opening of the L-type voltage-gated
calcium channel located in the T-tubule to release free calcium ions (Bers et al. 1998;
Tanabe et al. 1990). This voltage dependent calcium channel positioned in the T-tubule
6
membrane of the sarcolemma is referred to as the dihydropyridine receptor (DHPR)
(Tortora et al. 1993).
The dihydropyridine receptor (DHPR) consists of multimeric proteins weighing
170, 150, 52, and 32 KDa with a grand total of 404 Kda (Mygland et al. 1994). DHPR
activates the calcium channel in the sarcoplasmic reticulum called the ryanodine
receptor to open and release free calcium into the sarcomere (Tanabe et al. 1990;
Mygland et al. 1992; Bers et al. 1998; Mouton et al. 2001; Lamb et al. 2000) at the I-
band. The ryanodine receptor (RyR) is a large muscle protein calcium release channel
located in the sarcoplasmic reticulum. RyR is a transmembrane ion channel protein
weighing 305 KDa residing in close contact to the T-tubular sarcolemma invaginations.
The exact mechanism for linking the excitation-contraction (E-C) coupling
between DHPR and RyR is not completely understood it is speculated that it is
electromechanical (Marx et al. 1998). DHPR/RyR channels are so closely associated to
each other in vivo that they have been coimmunoprecipitated in experiments (Marty et
al. 1994). Calcium passage is coordinated by DHPR and RyR in an orthograde
direction which DHPR activates the opening of the RyR and in a retrograde direction
which the RyR quells the closing of the DHPR (Nakai et al. 1996). It has been
demonstrated that the II-III loop domains of the DHPR are implicated in the association
between the RyR and the DHPR (Grabner et al. 1998).
The contraction is triggered by the influx of free calcium ions released from the
RyR, into the sarcoplasm. The calcium ions couple to the troponin C (TnC) molecule.
This results in a conformational alteration in the tropomyosin. This confirmational
7
change exposes myosin-binding sites attached to the actin thin filaments positioned in
the I-band. Next the myosin binds to ATP and hydrolyzes the ATP into ADP+ Pi
allowing the myosin to become “cocked.” When the myosin releases Pi it synthesizes a
“power stroke” that will eject the ADP molecule. The power stroke allows the myosin
molecules to pull the Z-disks to the M-line. Then the calcium is driven out of the
sarcomere back into the sarcoplasmic reticulum via the calcium ATPase pump. Myosin
complexes ATP and the actin filaments are released (Tortora and Grabowski 1995).
The skeletal muscle triad is an essential contributor to excitation-contraction.
The skeletal muscle triad (SMT) is composed of three membranous areas; two cisternae
of the sarcoplasmic reticulum and the indentation of the sarcolemma named the
transverse tubule or T-tubule. The skeletal muscle triad (SMT) is located over the Z-
disk right in the middle of the I-band. An important function of the skeletal muscle
triad (SMT) is the opening of the acetylcholine receptor’s sodium channel to begin the
propagation of E-C by stimulating DHPR to open the RyR to release the calcium at the
I-band. It has been demonstrated that a protein called triadin affects E-C coupling
between DHPR and RyR (Brandt et al., 1992). According to Brandt, triadin is a 95 kDa
protein of the sarcoplasmic reticulum and an essential component of the triad junction
involved in the functional coupling between DHPR and RyR or the juctional foot
protein of the SR (Brandt et al. 1990; Kim et al. 1990). This study confirmed that
depolarization-induced calcium release from the SR is regulated by the anchored T-
tubule membrane (Ikemoto et al. 1984) as previously postulated.
8
Another skeletal muscle protein, dystrophin, is thought to have a role in
associating DHPR and RyR with the cytoskeleton (Brown 1993) due to its cellular
localization adjacent to SMT (Watkins 1998; Hoffman 1987) it is near DHPR and RyR
(Hoffman 1987). It is suggested that the depolarization of the DHPR T-tubular
membrane activates the release of calcium ions from the RyR into the sarcoplasm
resulting in the rippling phenomena (Mygland et al. 1994). Diagram 2 is a picture of
the sarcomere molecular structure including the cellular location of the skeletal muscle
triad. Table 1 is a summary of the sequence of events required to synthesize a normal
skeletal muscle contraction.
9
Diagram 2: Picture of the molecular structures of the skeletal muscle sarcomere.
The orientation of the actin thin filaments and the myosin thick filaments
is overlaid on top of the Z-disk and the M-line. The triad is also shown in
a box illustrating its position over the I-band. A second box illustrates the
molecular structures of the regulatory proteins tropomyosin and troponin.
The titin molecule is also illustrated showing that it spans half of the
sarcomere and anchors the thick filaments to the Z-disk. Reprinted from:
Barinaga M. Titanic protein gives muscles structure and bounce. Science.
1995; 270(5234): 23.
10
Table 1: Sequence of events coordinating normal skeletal muscle contraction
Events of Skeletal Muscle Contraction
1. Acetylcholine (ACh) release from motor neuron
2. ACh binds -subunits of acetylcholine receptor (AChR)
3. The AChR opens to Na+
flow
4. Depolarization spreads over the muscle cell into T-tubule
5. Depolarization opens the L-type voltage gated Ca 2+
channel
dihydropyridine receptor (DHPR)
6. DHPR channel opening electromechanically opens the ryanodine
receptor (RyR) Ca 2+
channel of the SR
7. Ca 2+
entry into the sarcomere binds TnC leading to a
conformational change in tropomyosin, exposing the myosin
binding sites on the actin thin filaments
8. Myosin binds ATP
9. Myosin hydrolyzes ATP to ADP+ Pi and becomes “cocked”
10. Myosin releases Pi and generates a power stroke, later ejecting
ADP
11. Ca 2+
is pumped back out of the sarcomere into the SR by the Ca 2+
ATPase
12. Myosin binds ATP and releases the actin filaments
Rippling Muscle Disease (Genetic)
This rippling phenomenon was first described by Torbergsen in 1975 as a
genetic skeletal muscle disorder. Rippling muscle disease (RMD) is a rare, usually
11
benign, myotonia-like myopathy presenting with rapid rolling contractions and
percussion-induced contractions. This abnormal myotonia-like myopathy is electrically
silent during electromyographic analysis. Electrical silence during the
electromyography testing confirms that action potentials are not required for the rolling,
wave-like contractions to occur (Jusic 1989; Torbergsen 2002: Ricker et al. 1989).
Electrically silent muscle rippling seems to be exclusive to RMD (Yuen et al. 2001).
Due to this evidence, the muscular abnormality occurs in the contractile apparatus and
the contractions are not activated by depolarization of the sarcolemma (Torbergsen,
2002). As a matter of fact, a concentric needle electrode analysis demonstrated
ordinary motor unit potentials with a normal interference blueprint without myotonic
discharges (Torbergsen 2002; Yuen et al. 2001). Myotonia is a characteristic type of
spontaneous muscle electrical activity.
Since electrophysiological evidence supports that these contractions occur with
no motor unit action potentials (MUAPs) or electrically silent (Jusic 1989; Ricker et al.
1989; So et al. 2001) where does the muscle contraction originate? Many theories exist
about where these muscle contractions originate. One theory was proposed by Bretag
in 1988. His research suggested that the continuation of the electrically silent
contractions may possibly occur due to a conceivable role for stretch activated calcium
channels (Bretag 1988; Graham 2005). Stretch activated channels (SACs) or
mechanosensitive calcium channels (MSCs) play a role by the rippling muscle fibers
displaying calcium dependent, membrane depolarization-independent muscle
contractions (Bretag et al. 1988; Burns et al. 1994; Graham 2005).
12
The signs and symptoms of rippling muscle disease (RMD) encompass muscle
stiffness, muscle hypertrophy (Roberts et al. 2006), muscular hyperexcitability
(Torbergsen 2002) and after rest slowness in muscle movement. RMD patients often
report symptoms get worse with inactivity. Many RMD patients have to walk on their
toes upon awakening in the morning for about five minutes (Yuen et al. 2001). The
symptoms seemed to improve after exercise or simple stretching (Yeun et al. 2001).
The clinical hallmark symptom of RMD is the exclusive irritability of the
muscle to mechanical stimulation involuntarily producing rapid rolling muscle
contractions that revolve diagonally from one end of the muscle to the other end of the
muscle when provoked by mechanical stimuli like tapping and stretching of the muscle
(Torbergsen 2002; Ricker et al. 1989; Yuen et al. 2001). These self-propagating waves
are stimulated by mechanical stretch (Ricker et al. 1989). The contractions can be
induced voluntarily by a forceful muscle contraction pursued by sudden stretch (Ricker
et al. 1989; Burns et al. 1994). The spread of the contraction seems to be ten times
slower verses a normal muscle fiber action potential. The contractions extend not only
along the entire length of the muscle, but also progress to laterally adjacent muscle
fibers. Ricker found that the local contraction of a small number of sarcomeres could
stimulate the contraction of surrounding sarcomeres (Ricker et al. 1989).
Other symptoms often reported in RMD patients are myoedema and muscle
cramps, usually occurring in the proximal muscles of the lower extremities like the
quadriceps or the pectoralis and during forced physical activity muscle stiffness and
myalgia (Torbergsen 1975; Ricker et al. 1989; Torbergsen 2002). Myoedema is
13
percussion induced local mounding of muscles with duration of several seconds. The
myoedema experienced by RMD patients is painful (Torbergsen 2002; Lamb 2005). If
a RMD patient voluntarily contracts the muscle after a local mounding of muscle a
serration stays at the origin of the percussion site (Ricker et al. 1989). A percussion
induced rapid muscle contraction (PIRC) initiated by tapping the muscle with a reflex
hammer can also stimulate transitory local mounding or myoedema (Vorgerd et al.
1999; Torbergsen 2002) or sometimes it is referred to as percussion contracture (Yuen
et al. 2001). Percussion contracture is a percussion-initiated contraction that is
electrically silent. Also RMD patients have relatively normal laboratory findings
except for the creatine kinase (CK) levels. The CK levels in these patient’s sera is
moderately elevated.
RMD is an inherited heterogeneous autosomal dominant skeletal muscle
disorder associated with several genetic loci (Lamb 2005; Stephan et al. 1999; Stephan
et al. 1994; Yeun et al. 2001). A family in Oregon with RMD displayed genomic
mapping to a localized defect on the distal end of the long arm on chromosome one
location 1q41-1q42 (Stephan et al. 1999) as well as a second locus on chromosome 3
location 3p25 (Betz et al. 2001; Vorgerd et al. 2001). On the other hand, this 1q41-
1q42 locus was nonexistent in three Northern European families with RMD (So et al.
2001). A unique interest with location 3p25 is that this location is the identical location
for the caveolin-3 gene (Minetti et al., 1998). Caveolin-3 (CAV3) may participate in
muscle hyperexcitability in families with RMD from Germany and Scandinavia
(Vorgerd et al. 2001).
14
Caveolin-3 (CAV3) is an integral membrane protein that interacts with the
dystrophin-glycoprotein and is localized at the sarcolemma as well as the T-tubular
system in skeletal muscle (Nishino et al. 2002). It is responsible for the formation of
caveolae (Minetti et al. 2002; Galbiati et al. 2001; Woodman et al. 2004). Caveolae are
small invaginations of the sarcolemma. CAV3 has an essential function in the
formation of the T-tubule system (Parton et al. 1997). It was demonstrated that a
missense mutation and a micro-deletion obstruct caveolae localization to the
sarcolemma (Minetti et al. 1998).
A CAV3 mutation has been associated with autosomal limb girdle muscular
dystrophy (LGMD1C) (Minetti et al. 1998; Galbiati et al. 1999; Carbone et al. 2000)
and rippling muscle (Vorgerd et al. 2001; Ulrich et al. 2010). This caveolin-3 missense
mutation becomes trapped in the Golgi complex decreasing expression in the
sarcolemma (Betz et al., 2001). Normal caveolin-3 is targeted to the sarcolemma
(Galbiati et al. 1999; Carbone et al. 2000; Minetti et al. 1998). There are nine point
mutations and one deletion mutation existing in CAV3 gene leading to four different
phenotypes resulting in LGMD1C, RMD, distal myopathy and idiopathic
hyperCKaemia. All four of these caveolinopathies are autosomal dominant muscle
diseases. Muscle biopsies on these patients showed decreased CAV3 at the
sarcolemma as well as an absence of CAV3 in immunoblotting tests (Roberts et al.,
2006). It has been recently reported that CAV3 mutations are in fact the actual cause of
autosomal dominant RMD (Betz et al. 2001). These patients exhibit subsarcolemmal
15
vacuoles (Kubisch et al., 2003) resulting in structural abnormalities of the T-tubular
system that could possibly lead to the rapid rolling wave-like contractions.
In 2006 Dotti discovered another mutation in the CAV-3 gene that causes RMD.
This study found a decreased concentration of CAV-3 protein in the muscles of an
Italian family. Since CAV-3 is located in skeletal sarcolemma and functions as cellular
scaffolding and signaling. Genetic analysis identified an undocumented genetic
mutation within the scaffolding domain of the CAV-3 gene in the affected family
members. It was discovered that this particular area has an essential role in homo-
oligomerization and several signaling molecule connections (Dotti et al. 2006).
Another genetic mutation in the nucleotide position 140 in the CAV-3 gene was
discovered (Lorenzoni et al. 2007). This is a missense mutation within the same
scaffolding domain, 14 nucleotides from the missense mutation discovered by Dotti et
al., 2006. The missense mutation identified by Lorenzoni is a highly conserved
negatively charged glutamine residue exchanged by a neutral alanine residue. Since
other mutations are contained inside this area in patients with RMD, it is suggested that
this missense mutation also severely compromises normal structure formation resulting
in improper function of the protein. The missense alanine mutation was found in
several patients with RMD resulting in the significance of impaired function and RMD
in this CAV-3 protein (Lorenzoni 2007).
It has been demonstrated that CAV3 impedes nitric oxide synthase in skeletal
muscle (Stamler et al. 2001). Nitric oxide is controlled by cGMP. Nitric oxide affects
glucose metabolism, signal transduction, ion-channel dynamics and excitation-
16
contraction coupling (Stamler et al. 2001). Nitric oxide (NO) is a free radical with a
rapid half-life; it is a nonadrenergic-noncholinergic neurotransmitter. Nitric oxide
synthase (NOS) is a calcium dependent enzyme that produces NO from L-arginine.
Skeletal muscle synthesizes NO via neuronal type nitric oxide synthase (nNOS) located
in the sarcolemma. The N-terminal domain of nNOS consists of a GLGF motif that
associates with dystrophin. Dystrophin is responsible for the signaling enzyme in the
muscle plasma membrane. A dysfunction in the signaling enzyme is thought to result
in Duchenne muscular dystrophy (Brenman et al. 1995). A missense mutation called
A45T or de novo missense mutation Arg26Glu on chromosome 3p25 (Vorgerd et al.,
2001; Roberts et al., 2006) in the CAV3 gene was found in an autosomal dominant
RMD family (Betz et al. 2001; Roberts et al. 2006). The de novo CAV-3 patients have
a decreased expression of alpha-dystroglycan and a reduced CAV-3 sarcolemma
distribution in the muscle fibers (Roberts et al. 2006). The de novo CAV-3 or A45T
allows a 30-40 % elevation in nitric oxide formation and results in a mislocaliztion of
caveolin-3 (Betz et al. 2001) that could possibly affect the inducibility of nitric oxide
synthase by elevating it (Betz et al. 2001; Vorgerd et al. 2001). It has been
demonstrated that an increase in the calcium concentration in the cell can cause an
increase in nitric oxide synthase (Stamler et al. 2001).
A major constituent of the dystroglycan complex in skeletal muscle is caveolin-
3. Recent experiments demonstrated a number of proteins associated with the
dystroglycan complex resulting in muscle cell damage. The dystroglycan complex is
composed of the following: alpha and beta dystroglycans, cytosolic syntrophins,
17
transmembrane sarcoglycans, dystrophin, CAV3 and nitric oxide synthase (Cohn et al.
2000; Vorgerd et al. 1999). Dystrophin is a cytoskeletal membrane protein that
interacts with extracellular and transmembrane glycoproteins, dystroglycan, laminin,
and actin. These proteins are dystrophin-associated proteins. Dystrophin has an
important function in the dystroglycan complex; it is responsible for linking up with the
F-actin and the transverse tubular membrane (Knudson et al. 1988). Quite possibly
dystrophin may have a purpose for stabilizing the location of the transverse tubules to
the A-I junction of the muscle cell by cytoskeletal and myofibril linkage (Knudson et
al. 1988). A dystrophin deficiency leads to a loss of function in all the dystrophin
associated proteins leading to necrosis in Duchenne muscular dystrophy (Ohlendieck et
al. 1993).
Another dystrophin-associated muscle difficulty is related to caveolin 3. This
muscle specific gene in conjunction with beta-dystroglycan can control the dystrophin
localization to the muscle cell plasma membrane. Laminin-2 is anchored to dystrophin
by alpha-dystroglycan. Beta-dystroglycan binds to dystrophin. If there is any
interruption in the dystrophin-glycoprotein complex it can cause muscular damage
(Sotgia et al. 2000). The deterioration of the dystrophin complex causes DMD
(Ohledieck et al. 1993). Impedement of the dystrophin/beta-dystroglycan association
interferes with the dystrophin complex. Caveolin-3 interferes with the beta-
dystroglycan association to dystrophin resulting in DMD (Sotgia et al. 2000).
There are other muscle disorders linked to the diverse constituents that comprise
the dystroglycan complex (Cohn et al. 2000; Carbone et al. 2000). HyperCKemia,
18
Limb girdle muscular dystrophy, Fukuyama muscular dystrophy are all myopathies
associated with the dystroglycan complex of the skeletal muscle (Carbone et al. 2000;
Cohn et al. 2000).
As a result of the rarity, the inconsistent phenotypic penetrance, and vague
symptoms of RMD it is suggested that this disease is not recognized and maybe
misdiagnosed (Yuen et al. 2001). Although previously reported cases of RMD were
labeled as benign, a severe case of genetic rippling muscles has been identified. This
form of RMD is recessive and presents with classic RMD symptoms with an increase in
severity (Koul et al. 2001). This severe form is associated with arrhythmic
cardiomyopathy, a thickened intraventricular septum and premature ventricular
contraction in addition to the classical RMD symptoms (Koul et al. 2001). During
research on two RMD patients that had cardiac arrhythmias leading to their death it was
suggested that the RMD resulted in the cardiac problems of these two patients (Ricker
et al. 1989). It was speculated that an abnormality in the excitation-contraction
coupling connected to ryanodine receptor cardiac isoform was the cause. This mapped
to the infamous locus 1q42 (Tiso et al. 2001). The one thing that these contractions
have in common is a suggestion of an aberrant release of calcium in the sarcomere.
It has been speculated that an elevation of calcium levels in the sarcomere
induced by mechanical deformation of the muscle fiber may produce muscle
hyperexcitability (Yuen et al. 2001) seen in RMD patients. At present, scientific
research of the skeletal muscle proteins linked in the mechanosensitive control of
contraction have not been identified thus, we are left to speculate.
19
Autoimmune Rippling Muscle Disease (Acquired)
Our laboratory started Autoimmune Rippling Muscle Disease (ARMD) research
in 1999 by examining the antisera of patients with MG and ARMD to identify the
components of a skeletal muscle cell that are attacked by autoantibodies. Our
laboratory identified autoantidodies in these patients’ antisera which were
immunoreactive with larger skeletal muscle polypeptides. Since the rippling
occurrence is electrically silent and the large proteins of the skeletal muscle cells are
under attack, it was recommended that there is an initiation of mechanosensitivity of
calcium channels. Two calcium channels, Ryanodine Receptor (RyR) and
Dihydropyridine Receptor (DHPR), are high molecular weight proteins and therefore,
suggested to have an involvement in the mechanosensitive nature of the rippling muscle
contractions (Walker et al. 1999).
In 2006, Dr. Watkins continued this research by experimenting with antisera
from ARMD patients to identify which large proteins of the muscle cell may participate
in the origin of rippling muscle contractions. Dr. Watkins discovered five proteins:
(Table 1) enolase, aldolase, ATP synthase 6, Protein Phosphatase 1 Regulatory Subunit
1 (PPP1R3) and the titin Isoform N2-A. The enzymes had nothing to do with muscle
cell contractions and were not processed. There were a total 10 immunoreactive clones,
6 react with titin Isoform N2-A (Watkins et al. 2006). Since titin is a very large muscle
protein, it was concluded to have an essential task in the Anatomy and Physiology to
the location of the muscle responsible for the rippling muscle contractions.
20
Table 2. List of proteins subject to autoantibody attachk within RMD/MG
diagnosed patients and their respective immunoreactive clones.
Source: Watkins TC, Zelinka L, Kesic M, Ansevin CF, Walker GR. Identification of
skeletal muscle autoantigens by expression library screening using sera from
autoimmune rippling muscle disease (ARMD) patients. J Cell Biochem.
2006; 99(1):79-87
Bioinformatic research analysis of the titin immunoreactive clones continued in
our laboratory until the location of each clone was discovered on the titin polypeptide.
There are two different immunogenic locations of titin that have immunoreactivity to
autoantibodies of ARMD. The Main Immunogenic Region (MIR) of titin is located by
the A- band to I- band transition, was the first location of autoantibody
immunoreactivity in MG/T patients. The other location is in the A- band near the M-
line. This is the location that titin interacts with myosin. This location and the
pRRMG6 sequence are exclusive to ARMD (Watkins et al. 2006).
21
Diagram 3. Two distinct immunogenic domains within the A-band and I-band
regions of titin. Six clones within the study completed by Watkins
show identification with the titinprotein. Four recognize a region
mapped to the I band while 2 map to a position within the Abandregion
Source: Watkins TC, Zelinka L, Kesic M, Ansevin CF, Walker GR.
Identification of skeletal muscle autoantigens by expression library
screening using sera from autoimmune rippling muscle disease (ARMD)
patients. J Cell Biochem. 2006; 99(1):79-87.
My dissertation research continued Dr. Watkins’ research of the clones by
characterization of pRMMG6. The cDNA sequence (GenBank ID: EU428784)
(Zelinka et al. 2011) matches with the titin N2-A isoform (GenBank ID: 133378)
(Watkins et al. 2006). The pRMMG6 clone sequence encompasses exons 248 (90%
coverage), 249 (100% coverage) and a piece of 250 (24.3% coverage). The DNA
sequence translates to an amino acid sequence that consists of two Fibronectin III
domains (FN3) and a portion of an Immunoglobulin domain (Ig). BLAST analysis
established a 93.9% homology to titin from a mouse. The similarity between the
22
human and mouse titin isoform N2-A is vital for future experiments in our laboratory
using C2C12 cells.
Another form of rippling muscle was found by Dr. Ansevin in 1990. At that
time the patient displayed electrically silent rippling muscles without any other
problems or complaints. In 1995 the same patient returned for treatment again. During
this evaluation the patient presented with atypical wave like contractions stimulated by
percussion and stretch as well as myasthenia gravis. These contractions were
indistinguishable from the inherited RMD identified by Ricker et al. (1989) and
Torbergsen (1975). Concluding the investigation into the patient’s medical history and
the absence of an inherited pathway it was clear that this patient was suffering from
something similar to RMD. In the genetic RMD there is a family history of the disease
however, this patient did not have a family history of RMD or any other myopathies
(Ansevin et al. 1996). The patient had nine siblings without any type of neuromuscular
diseases. Later this patient was diagnosed with a thymoma and myasthenia gravis.
Since myasthenia gravis is an autoimmune neuromuscular disease the selected
treatment was immunosuppressive drugs such as a steroid, pyridostigmine (mestinon)
also known as acetylcholinesterase to degrade the acetylcholine, a thymectomy and a
plasmaphoresis. A plasmaphoresis is designed to remove all the present autoantibodies
and the immunosuppressive drugs are designed to decrease the production of
autoantibodies to decrease the symptoms of myasthenia gravis (MG). Not only did this
treatment plan reduce the symptoms of the autoimmune MG it also decreased the
rippling muscle symptoms as well (Ansevin et al. 1996).
23
A thymoma is present in about 15 % of the patients with MG (Williams et al.
1986; Skeie et al. 1996). Usually the presence of the thymoma in conjunction with MG
is a good indicator of more severe MG symptoms. A thymoma or hyperplasia is a
lymphoepithelial tumor of the thymus gland that proliferates at a very slow rate. The
thymoma causes a B-cell proliferation and autoantibody synthesis to increase. Roughly
half of the MG/thymoma patients have IgG autoantibodies to the ryanodine receptor
(Skeie et al. 2001; Mygland et al. 1994). The titre of the ryanodine receptor antibodies
is directly proportional to the severity of the MG disease (Mygland et al. 1994; Skeie et
al. 1996). MG/thymoma patients have autoantibodies recognizing different
intracellular muscle fiber proteins in the striations of the skeletal muscle myofibrils or
A-band, I-band and A and I-bands located in the Z-line (Vetters 1967; Williams et al.
1986). Striational autoantibodies are detected in 80-90 % of patients with
MG/thymoma. Other antibodies detected in MG/thymoma patients are to the skeletal
muscle fiber proteins like myosin, actin, titin, alpha-actinin, tropomyosin (Skeie et al.,
1996; Ohta et al. 1990; Pagala et al. 1990) and IgG autoantibodies to myosin and actin
(Ohta et al. 1990). Of course the more autoantibodies produced to the sarcomere the
worse the symptoms of the disease.
Two more patients with rippling muscles linked to MG were diagnosed
(Mueller-Felber et al. 1999). These two patients were treated with immunosuppressive
therapy to treat the MG and a reduction in the symptoms of the MG as well as the
rippling muscles was documented. Due to the clinical findings and the response to
treatment of these three patients an autoimmune etiology was suggested for the rippling
24
muscles linked with MG (Ansevin et al. 1996; Ansevin 1996; Mueller-Felber et al.
1999). The new type of RMD was named autoimmune rippling muscle disease
(ARMD).
ARMD like RMD displayed electrical silence during an electromyography
examination clearly demonstrated these patients had no motor unit action potentials
(MUAPs) or myotonia. The onset of symptoms for ARMD and RMD differed and the
improvement with immunosuppressive therapy differed as well. A theory involving
autoantibodies to mechanosensitive channels (MSCs) exists for ARMD (Ansevin et al.
1996; Walker et al. 1999) because both demonstrate stretch and percussion stimulation
and MUAP is not required for the stimulation of either one. Muscle responses are not
propagated by neural sources and the ripple phenomena are electrically silent. It is
suggested that the stretch activated wave-like contraction of skeletal muscle is a
product of MSCs (Mygland et al. 1992). Another suggestion is autoantibodies to MSCs
bind causing a conformation transformation elevating the sensitivity to these channels
to stimulate contraction upon stretch or percussion (Watkins 2004). Watkins also
suggested autoantibodies to unidentified non-MSC calcium channels or muscle cellular
proteins elevating their sensitivity to stretch or percussion triggering the activation of
the actomyosin contractile apparatus. Due to these similarities between MSCs and RM,
it is hypothesized that autoimmune rippling muscle patients generate autoantibodies to
MSCs or stretch activated channels (SACs) causing a voltage alteration across the
sarcolemma. It is this depolarization that stimulates DHPR to discharge calcium to
stimulate the RyR to release calcium.
25
MSCs discovered in chick skeletal muscle by Guchray (Guchray et al. 1984).
There are two different forms of MSCs. One is stretch inactivated channels (SICs) and
the other variety is stretch activated channels (SACs). During stretch or percussion
SACs open allowing calcium to surge into the cell. Usually SACs are closed to ion
flow. SICs are the opposite of the SACs. SICs are normally open to calcium flow and
then close in response to stretch or percussion.
Mechanical stimulation and amphipaths open SACs more rapidly (Sokabe et al.
1993). An amphipath is a compound comprised of a strongly polar group and a
strongly nonpolar group such as a phospholipid or other chemicals for example
trinitrophenol or chlorpromazine. It is suggested that SACs activate by cytoskeletal
structures and lipids (Sokabe et al. 1993). Activation and inactivation may possibly
cause injury to the neighboring tissues as indicated in another experiment performed on
mdx mice. This experiment suggested MSCs regulation might result in
pathophysiological calcium release (Franco-Obregon Jr. et al. 1994) due to
neuromuscular diseases and muscular dystrophy. Integrins are proteins that anchor
extracellular matrix molecules to cytoskeletal proteins. Proteins in the dystrophin-
spectrin family are located underneath the membrane. Dystrophin contains actin-
binding domains. These actin-binding domains are responsible for causing tension in
the cytoskeleton resulting in the stimulation required to activate MSCs (Hamill et al.
1995).
As previously mentioned, ARMD is sometimes diagnosed with myasthenia
gravis. When a patient exhibits these two diseases an exacerbation of autoantibody
26
production is demonstrated. Myasthenia gravis (MG) is an autoimmune neuromuscular
disease distinguished by fluctuating weakness or complete exhaustion of skeletal
muscle (Bartoccioni et al. 1980) because muscle contraction is partially obstructed,
although muscle contraction appears normal (Pagala et al. 1989). The muscles that are
usually affected are the throat and face muscles, more specifically the extraocular
muscles surrounding the eye. The neck, arm and leg muscles can also be affected.
Following muscle fatigue, slurred speech, problems with chewing and swallowing can
occur.
MG results from an accumulation of autoantibodies to acetlycholine receptors
that bind to the post-synaptic acetylcholine receptors (AChR) on the motor end plate
(Kimball et al. 1990; Drachman 1994) hampering the response of the muscle or
neuromuscular transmission to acetylcholine (Ach). This actually causes an incomplete
coupling because of reduced neurotransmitter or ACh and AChR complexing
(Bartoccioni et al. 1980). Muscle contraction is also impaired by the decreased number
of normal AChRs (Bartoccioni et al. 1980). This autoimmune assault on the receptor
actually is responsible for the muscle weakness and fatigueability (Drachman 1994).
One of the most interesting antibodies MG patients can synthesize is to the titin MIR
epitope. Around 95% of thymoma/MG patients produce the titin MIR epitope
antibody. The presence of the titin MIR epitope antibody is directly related to the
severity of the autoimmune state (Skeie et al. 1995).
Two other clinical syndromes present like MG symptoms but are extremely
dissimilar in their etiology. Seronegative myasthenia gravis patients have a
27
proliferation of autoantibodies to muscle specific kinase (MuSK) inhibit neuromuscular
transmission. Autoantibodies to MuSK are thought to obstruct the physiology of
MuSK in the clustering of AChR at the neuromuscular junction resulting in myasthenic
symptoms (Abicht et al. 2002; Vincent 2003). The other myasthenic like syndrome is
Lambert-Eaton myasthenic syndrome (LEMS). Patients with LEMS synthesize
autoantibodies to voltage gated calcium channels (VGCCs) of motor neurons. The
autoantibodies complex to the VGCCs impeding the release of ACh resulting in
inefficient neuromuscular transmission leading too myasthenic like symptoms (Lennon
et al. 1995; Takamori et al. 2000). Also, congenital myasthenic syndromes exist.
Mutations in the genes coding for the ion channel subunits of AChR interfere with
neuromuscular transmission (Ohno et al. 1997). Due to all of these disorders affecting
the contractile units of the skeletal muscle it has been possible to characterize these
units for their structure and function. It appears that the most important component is
the connectin or titin molecule.
Skeletal Muscle Connectin/Titin
Connectin and titin are the same exact protein discovered and characterized by
two separate research groups (Maruyama et al. 1977; Wang et al. 1979). Both terms
are used interchangeably. For simplicity, the term titin will be used because that is the
term previously used in our laboratory. Titin has multiple functions in the sarcomere
such as elasticity, stabilization, assembly, a molecular ruler and titin has been reported
a being a condensed mitotic chromosomal protein (Machado et al. 1998; Trinick et al.
28
1999). Chromosomal titin has not been accepted amongst the scientific community as a
fact, more experiments need to be done to confirm chromosomal titin.
Titin is the largest single-chain molecule known with isoforms ranging between
2,970 kDa found in cardiac muscle and 3,700 kDa located in skeletal muscle. Although
there is a size variation between titin isoforms, the same basic structural functions
occur. It is the third most abundant filamentous muscle protein found in both cardiac
and skeletal muscles. Titin constitutes 10% of the myofibrillar mass of the sarcomere.
Titin has multiple splice variants translated by diverse forms of skeletal muscles
(Maruyama 2002). The titin molecule is so diverse that it has been the debate by the
medical community, biologists, physiologists and biophysicists for its size, length,
structure and function as well as abnormalities.
Titin measures half of the length of the sarcomere. Titin stretches 1m from the
Z-disc to the M-line in humans (Skeie 2000), however it spans up to 3.5 m in the huge
sarcomeres of the crayfish claw muscle (Maruyama et al. 2002; Barinaga et al. 1995).
Oddly enough there is a high degree of homology between titin molecules of
distinguishing species (Kolmerer et al. 1996). The titin molecule is attached at the Z-
line by anchoring to the C-terminal end of alpha-actinin (Young et al. 1998). Diagram
4 is a picture of the domain structure of human titin isoforms. It shows the
conformational arrangement of the titin isoforms in the sarcomere.
29
Diagram 4: Domain Structure of Titin Isoforms in human. This diagram
demonstrates the correct location and special orientation of titin in the
sarcomere. It also shows a comparison between cardiac and skeletal
muscle. Shown in red is two titin molecules, running length wise, span the
sarcomere in a mirror isomer manner. Each titin contains a carboxy-
terminus found in the center M-line and an amino-terminus positioned in
its respective Z-disc bordering the sarcomere. Source: Freiburg A,
Trombitas K, Hell W, Cazorla O,Fougerousee F, Centner T, Komerer B,
Witt C, Beckmann JS, Gregorio CC, et al. Series of exon-skipping events
in the events in the elastic spring region of titin as the structural basis for
myofibrillar elastic diversity. Circulation. (2000); 86(11):1114-1121.
30
About 90% of titin’s mass is repeating structures. These repeating structures
range from 244-297 copies of two distinguishing forms of 100 residue replicates. The
residue replicates are known as immunoglobulin like domains consisting of 112-165
motifs and 132 fibronectin like repeats (Labeit et al. 1995). Titin’s N-terminal domain
attaches to actin (Young et al. 1998) at the M-band via Myomesin (Obermann et al.
1997). Titin adheres to the thick filament via Myosin-binding protein-C. Titin’s N-
terminal domain and the PEVK area bind to actin. Titin is described as having two
divided regions: One portion that spans the I-band (the end attached to the Z-disk) the
other portion spans the A-band (which runs parallel with actin). Titin is divided like
this due to drastic changes at the I/A boundary (Kruger et al. 2011; Scott et al. 2002).
The A-band region of titin associates with M-line proteins and the myosin thick
filaments and is considered to be the outline for synthesis of the thick filament (Scott et
al. 2002; Trinick et al. 1999). A-band titin consists of ordinary preparations of a
succession of 7 and 11 domain superrepeats of Ig and FN3 sequences that makes a
lengthy repeating pattern of about 300 of the same two protein domains, (Skeie 2000)
and a kinase domain by the C-terminus in the part spanning the M-band. Titin’s super-
repeat sequence is conserved like actin and the periodicity of the FN3 and Ig domains
complements closely actin. This is suggested to allow for titin’s binding to the thick
filament (Tskhovrebova et al. 2010). Each one of these repeats is 43 nm in length
corresponding exactly to the 43 nm distances matching the myosin binding protein C
attached to titin (Skeie 2000; Labeit et al. 1997).
31
The I-band region of titin is the elastic segment that connects the myosin thick
filament of the A-band to the Z-disc (Scott 2002), this portion of titin centers the I- and
A-bands within the sarcomere (Trinick et al. 1992). Z-disc titin consists of the Z-
repeats or 45-residue motifs, immunoglobulin (Ig) domains and nonrepetitive
sequences (Trinick et al. 1999; Skeie 2002). The terminal part of alpha-actinin is
attached to the Z-repeats (Skeie 2002) and there is a free elastic portion in the I-band.
The Z-disc thickness depends on the quantity of the Z-repeats. Differential splicing of
the I-band titin gives rise to special peptide sequences. Variances in the electrophoretic
mobility of titin found in samples from different tissue types led to titin isoforms.
Different titin samples showed three variant electrophoretic bands (Vikhlyantsev et al.
2006). There are three major splice deviations: one for cardiac muscle (N2-B) and one
for skeletal muscle (N2-A) (Kolmerer et al. 1996) and N2BA. N2BA shares structural
components of both N2A and N2B and is also found only in cardiac muscle
(Kontrogianni-Konstantopoulos et al. 2009). N2BA is suggested to involve an
association between sarcomere length and its contractile properties (Greaser et al.
2002). The splice factors that create the different isoforms are not known, but a recent
experiment found the cardiomyopathy gene RBM20 as a regulator of titin’s spicing
(Guo et al. 2012).
The PEVK domain consists of areas rich in Proline, Glutamic acid, Valine and
Lysine. The I-band titin consists of Ig and the PEVK domains (Skeie 2002; Trinick et
al. 1999; Scott et al. 2002; Kontrogianni-Konstantopoulos et al. 2009). The PEVK
domains role is muscle stiffness and muscle elasticity, it is suggested that the PEVK
32
extends by unfolding during muscle stretches (Skeie 2002; Scott et al. 2002; Trinick et
al. 1999). The actual length of the PEVK domain is directly proportional to the muscle
stiffness, elasticity (Guittierez-Cruz et al. 2001) and the type of muscle tissue (Skeie
2000). A good example of the varying length of titin’s PEVK region is in cardiac
muscle it is 163 residues, a drastic difference compared to skeletal muscle, which are
1000-2000 residues (Skeie 2000). An explanation for the difference could possibly be
that the skeletal muscle does a lot more stretching than the cardiac muscle so it needs to
be longer to compensate for the stretching. As a matter of fact, longer titin isoforms
located in skeletal muscle isoforms are more elastic compared to shorter titin isoforms
identified in cardiac muscle isoforms are stiffer (Trinick et al. 1999; Granzier et al.
2003). The degree of tension is changed by altering the titin isoform that is being
expressed. For example, in cardiac muscle the N2BA/N2B ratio decreases during
development effecting tension thus, during chronic heart failure the N2BA/N2B ratio
increases to decrease tension (Kruger et al. 2011). The PEVK region is considered a
linker sequence that acts like an elastic spring (Trinick et al. 1999; Trombitas et al.
1998; Tskhovrebova et al. 2000) however at greater forces elasticity is thought to be
due to unfolding of the Ig domains (Tskhovrebova et al. 1996; Rief et al. 1997). A
study involving elasticity of I-band titin claims that unfolding of only a few Ig domains
occurs in the I-band area. Perhaps this stretch induced unfolding located adjacent to the
T-tubules may stimulate DHPR/RyR to release free calcium ultimately leading to the
rippling muscle.
33
The tertiary structure of the Ig domains and the fibronectin (FN3) domains are
comprised of two beta pleated sheets adjacent to each other. Each sheet consists of four
beta strands. These sheets are thought to function as spacers to place an interacting
component in a specific position to perform a specific function (Williams et al. 1988).
An interesting note about the N and C-terminals of the Ig and FN3 is that they
are positioned at opposite ends. It is believed that this assists in linking multiple
sequential independently folded domains (Skeie 2000).
Titin contains kinase domains responsible for monitoring sarcomere synthesis
(Trinick et al. 1999). The serine/thyrosine kinase domains are located at the Z-disc N-
terminus and the M-line at the C-terminus (Trinick et al. 2002; Skeie 2002; Young et al.
1998). Titin C-terminus and telethonin, a recently identified muscle protein located at
the Z-disc, colocalize in the precursors of myofibrils. This new information leads
researchers to discount the kinase activity as an aid in contractility (Skeie 2000). It has
been reported the kinase domain activity requires dual activation: phosphorylation of
the tyrosine stimulates the substrate binding site and binding of calcium calmodulin to
unblock the phosphate binding site (Mayans et al. 1998; Means et al. 1998).
Titin’s 400kDa segment, close to the PEVK domain that constitutes the N-
terminal elastic portion (Tatsumi et al. 2001), binds free calcium ions (Wang et al.
1985). Calcium binding to this area alters the secondary structure of titin. It was
reported that functions of titin filaments are monitored by the binding of calcium ions
(Kolmerer et al. 1996). This could possibly mean that the elasticity of the titin
molecule could alter during the contraction and relaxation phase (Tatsumi et al. 2001).
34
Sequences of titin independently experimented develop alterations in their properties
during experiments in the presence of adjacent areas (Scott et al. 2002). For this
reason, the function of titin is considered a result of the sum of its parts.
Most of the mutations in the titin leading to functional changes are incompatible
with life (Hein et al. 2002; Skeie 2000) causing myofibrillogenesis and entropy upon
sarcomere synthesis (Skeie 2000). However, mutations that result in minor alterations
will not change the overall structure ultimately not affecting function of titin. An
example of this is Hypertrophic cardiomyopathy (HCM). HCM results in ventricular
hypertrophy with myofibrillar disorder (Skeie 2000). HCM causes persistent pressure
overload resulting in cardiac hypertrophy and cardiac failure leading to decrease
regulation of titin resulting in an increase regulation of the desmin and microtubules.
This results in myocyte length increases and ultimately a malfunction. The location of
the titin gene is on the long arm of chromosome 2 at 2q31 (Kontrogianni-
Konstantopoulos et al. 2009). HCM locus is also chromosome 2q31 clearly implicating
the importance of titin in this disease. Since consistent pressure overload results in
cardiac hypertrophy, it may also result in skeletal muscle hypertrophy even though it
has not been documented.
Titin can affect cardiac physiology by an alteration in its stiffness or a change of
the membrane channel activity (Granzier et al. 2003). It has been observed that the
PEVK domain of cardiac titin complexes with actin under certain physiological
conditions differentiates it from the skeletal muscle titin isoform (Yamasaki et al.
2001). It has been speculated that this decreases the mobility of the thin filament; this
35
influences the function of the cardiac muscle (Granzier et al. 2003). The length of the
FN3 fragment of cardiac titin regulates sarcomeric calcium sensitivity by modifying the
actomyosin association. This may actually adjust the cardiac muscle contraction
(Muhle-Goll et al. 2001). Muscle stiffness in a single contraction cycle has been linked
to an elevation of calcium sensitivity during calcium influx in muscles with short
sarcomere length (Muhle-Goll et al. 2001; Granzier et al. 2003; Greaser et al. 2002).
Diagram 5 shows the cellular location of the ion channels in spatial relation to the Z-
line in the I-band and how it encompasses the skeletal triad.
36
Diagram 5: Diagram of the ion channels of the skeletal muscle triad. DHPR a
voltage gated Ca2+
channel (VGCC) of the T-tubule is linked to the RyR
a Ca2+
channel of the SR. It is postulated that the link is
electromechanical in origin and conformational changes in DHPR open
RyR (Marx et al., 1998). The result is a coordinated release of the
sarcoplasmic stores of Ca2+
directly into the Ca2+
regulated I-band of
skeletal muscle. Source: Marx S, Ondrias K, Marks A. Coupled gating
between individual skeletal muscle Ca2+
release channels (ryanodine
receptors). Science. 1998; 281(5378):818-822.
37
Ion channels may possibly be monitored by cardiac titin binding proteins.
Titin’s N-terminus associates with T-cap. T-cap has been observed to relate with mink
-subunit of the stretch-sensitive IsK potassium channel (Furukawa et al. 2001). This
association proposes a relationship involving the passive force of titin influencing
control of ion channels. There is a possibility that titin may affect the contractile
proteins by controlling the distance between the myosin heads and the actin thin
filaments (Granzier et al. 2003). Titin’s physiology could possibly change with
distance and pressure, which could explain the rippling phenomena observed in
autoimmune rippling muscle disease.
Gene Cloning and Regulation
Titin plays an essential role in the autoimmune response in patients with
ARMD. The titin sequence identified by our laboratory required sub cloning for the
immunoreactive protein expression. This involves a plasmid or vector consisting of
DNA that contains an active, easily controlled promoter located downstream from
where our titin fragment is inserted. The vector used in our laboratory was pGEX 3X.
pGEX 3X maintains tight control over protein expression by utilizing a lac promoter
and an internal lac Iq gene. The lac promoter is induced by the lactose analog
Isopropyl -D thiogalactoside (IPTG). After induction of the promoter the titin
fragment can be synthesized in mass quantities for further investigation.
Gene cloning is the process of obtaining several reproductions of a small
specific sequence of DNA by reproduction of a microorganism including the specific
38
sequence of DNA. A PCR from pBluescript containing the titin sequence was
performed and inserted into TOPO TA vector and propagated. An EcoR1 restriction
enzyme digest was performed to obtain pure titin DNA fragments and ligated into
pGEX 3X for protein expression.
Sometimes choosing the correct vector is harder than it sounds. Sometimes the
DNA fragment that needs to be cloned does not insert properly into the vector or the
DNA fragment produces proteins that are toxic to the host cell leading to the demise of
the host cell. A commonly used host cell is Escherichia coli (E. coli). The E. coli is
used for the transformation step. Transformation is the method that promotes the
bacterial cell, E. coli in this case, to take up the DNA sequence allowing the
information in the DNA sequence to become an everlasting part of the bacterial host
cell.
E. coli bacteria and the lac operon were first discovered by Dr. Jacob and Dr.
Monod to explain gene regulation. An operon is a set of simultaneously regulated
genes contiguous to each other in the genome so all the genes required to use lactose as
the carbon source are controlled as a complete unit. The lac operon contains a total of
three genes: a lac Z gene to encode -galactosidase an enzyme to split lactose into
galactose and glucose, a lac Y gene to encode the enzyme lactose permease its function
is to pump lactose into the cell, and a lac A gene to encode thiogalactosidase
transacetylase an enzyme that transfers an acetyl group from acetyl CoA to -
galactosidase. Lac genes are a regulatory circuit subject to negative control by a
repressor encoded by the lac I gene (Muller-Hill 1996).
39
X-gal is a colorless chemical compound hydrolyzed by -galactosidase to form
a blue colored product for identification purposes. Microorganisms struggle to be
metabolically competent to survive during unfavorable environmental conditions. If a
normally used carbon source like glucose is not available, a microorganism must be
prepared to produce enzymes required to metabolize different carbon sources or shut
down certain pathways when a certain carbon source is gone until a more favorable
carbon source is accessible. Thriving microorganisms must be able to use accessible
carbon or energy sources in order for survival.
E. coli grown in growth media containing glucose, which is an easily
metabolized carbon source, express decreased levels of lac Z and lac Y genes. When
these genes are repressed it is known as catabolite repression. E. coli changed to a
growth media containing lactose express increased levels of lac Z and lac Y genes.
When these genes are uninhibited lactose is considered to be the inducer of gene
expression this is termed induction.
E. coli constitutive mutants grown in media containing glucose or in the absence
of glucose always express elevated levels of lac Z and lac Y genes or these mutants do
not repress the lac operon. These mutations are located on the E. coli chromosome to
the left of the lac Z gene. The term used to describe these genes is lac I genes. The
protein encoded by the lac I gene is a repressor of gene expression so this protein is
known as the lac repressor. When an inducer or lactose is not present the lac I protein
adheres to an operator site hindering polymerase function at the promoter site. This
averts transcription of the rest of the lac genes. However if an inducer or lactose is
40
added to the E. coli culture it will decrease the attraction of the repressor protein for the
operator binding site and transcription at the promoter occurs (Beckwith 1967, Muller-
Hill 1996).
Aims and Scope of Dissertation Research
The purpose of this study is to characterize the Autoimmune rippling muscle
disease (ARMD) antigenic domain of titin recognized by an autoantibody to titin N2-A
contained in the antisera of a patient with ARMD. This will enable us to characterize
the major autoantigen connected with ARMD and allow us to understand its role in
ARMD.
This study will address the following specific aims:
1. Subclone RMMG6 into an expression vector and characterize the fusion gene
a. Characterize pG3RMMG6
i. PCR
ii. Sequence analysis
iii. Bioinformatic analysis
2. Biochemical analysis
a. Express the fusion protein pG3RMMG6
b. Characterization of the fusion protein by molecular weight and
purification by SDS-PAGE
c. Immunoreactivity to determine if the titin domain is recognized by
antisera from MG/T and ARMD by Western Blot analysis
d. pI determined by 2DGE
41
3. Structural characterization by MS (sent to OSU) and x-ray analysis (current
discussion at YSU)
42
CHAPTER II
MATERIALS AND METHODS
Strains
The strain of Escherichia coli, One Shot TOP 10, was purchased from
Invitrogen, as a kit, and was used for all transformations. These E. coli cells are
chemically competent and specific for transformation but very fragile and delicate.
When handling this strain great caution must be used to preserve cellular integrity. The
genotype is F- mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 Δ lacX74 recA1
araD139 Δ(ara-leu) 7697 galU galK rpsL (StrR) endA1 nupG. The vector used for all
cloning reactions was included in the kit.
The vector is pCR® 4-TOPO® supplied linearized with a single 3´ thymidine
(T) overhang specific for TA cloning and a covalently bound topoisomerase which
means it is an activated vector. Topoisomerase is from the vaccinia virus. The kit also
included T3, T7, M13 forward and reverse primers as well as sterile water, salt
solution, 10X PCR buffer, dNTP mix and controls. These primer sequences are listed
on the sequence of primers table.
43
RMMG#6 pBluescript II KS/SK(+)
RMMG#6 pBluescript II KS/SK(+) was obtained from a glycerol stock
prepared by Tom Watkins Ph.D. who screened the Lamba Zap II human skeletal
muscle cDNA library from Stratagene, INC. to obtain this clone (Watkins et. al. 2006).
Overnight cultures of pBluescript II KS/SK(+) containing the cDNA insert RMMG#6
(Watkins et. al. 2006) were propagated in LB Amp broth. The next morning plasmid
purification was performed (AMRESCO Cyclo-Prep). A spectrophotometer reading
was done by adding 10 µLs of the plasmid purification to 90 µLs of nuclease free
water.
This reading determined the dilution factor of the cyclo-prep for the PCR
reaction of RMMG#6. A 1/10 dilution was made of the cyclo-prep of pBluescript II
KS/SK (+) RMMG#6 to obtain a PCR product of RMMG#6. In a PCR tube 5 µLs of
10X PCR Buffer, 3 µLs of MgCl2, 1 µL of dNTP’s, 0.5 µL of Taq polymerase (Roche),
5 µLs of M13 forward and reverse primers (1.6 picomoles), 28.5 µLs nuclease free
water and 2 µLs of the 1/10 cyclo-prep dilution of pBluescript RMMG#6 were added
and then mixed. The tube was placed in a PTC-200TM
Peltier thermal cycler DNA
Engine Gadient cycler (MJ Research, Inc.) over a gradient of 50-62° C to determine the
optimal annealing temperature for the M13 forward and M13 reverse primers. The
optimum temperature was found to be 51° C. the first cycle was 95° C for 9 minutes
and 30 seconds, the second cycle was 95° C for 30 seconds, the third cycle was 52° C
for 30 seconds, the forth cycle was 72° C for 1 minute the fifth cycle was a repeat of
cycles 1-4 (35) times, the sixth cycle was 72° C for 7 minutes and the final cycle was a
44
hold forever cycle at 4° C. Approximately 300ng of plasmid DNA was used in a 50
µLs reaction.
If an agarose DNA gel electrophoresis detected a single band in the PCR
product, the PCR product was then ready to be cloned and transformed. If there were
multiple bands on the gel, the entire PCR sample was electrophoresed through a Sea
Plaque agarose gel (2 grams of Sea Plaque dissolved in 100 mLs of 1X TAE) to make a
2% gel. When the gel was finished running it was stained with ethidium bromide (EtBr)
for 5 minutes and viewed for adequate separation of bands. Next the band with the
desired molecular weight was cut out of the gel and weighed. A QIAquick Gel
Extraction was performed using a (Qiagen®) kit following the manufacturer’s protocol.
The final DNA elution was accomplished using 52 µLs of nuclease free water heated to
70° C. After centrifugation at 14,000 rpm for 1 minute the final quantity of eluted DNA
was 50 µLs.
Cloning and Transformation
RMMG#6 DNA insert cloning
RMMG#6 DNA insert was contained in a glycerol stock of pBluescript II
KS/SK(+). Glycerol stocks were made by Tom Watkins Ph. D. The viability, of these
glycerol stocks, was poor. In order to ensure the integrity of RMMG#6 pBluescript II
KS/SK(+) it required a vector transfer. The PCR product of RMMG#6, after proper
identification, was cloned into pCR® 4-TOPO® or TOPO TA.
45
Immediately after another PCR was finished (from the QIAquick Gel
Extraction) 4 µLs of RMMG#6 insert was added to 2 µLs of salt solution plus 4 µLs of
sterile water and 1 µL of TOPO TA vector. The cloning reaction was incubated at 22 °
C for 1 hour and 15 minutes. The One Shot Top 10 E. coli cryovial was thawed on ice
for 10 minutes.
Then 2 µLs of the cloning reaction was added to the One Shot Top 10 E. coli
cyrovial and gently mixed. The cryovial was incubated on ice for 1 hour and 15
minutes then heat shocked for 1 minute and transferred directly to the ice for 5 minutes.
Next 250 µLs of room temperature SOC medium was added to the cryovial. The
cryovial was placed in a 37 ° C incubator and horizontally rotated at 200 rpm for 2
hours. During the last hour of the incubation 2 LB/Amp selective plates were placed in
the 37 ° C incubator. When the incubation steps were completed 50 µLs and 200 µLs
of the cloning and transformation reaction was plated on the LB/Amp selective plates.
These plates were incubated at 37 ° C for 24 hours. The next day 4 colonies from each
plate were transferred to another prewarmed LB/Amp selective plate and incubated at
37 ° C for 18 hours. Each on of these colonies was grown overnight in LB Amp broth.
The following day an AMRESCO Cyclo-Prep plasmid purification was
completed per manufacturer’s directions. The final DNA elution was acquired using 52
µLs of nuclease free water warmed to 70° C. Following centrifugation at 14,000 rpm
for 1 minute the final amount of eluted DNA was 50 µLs. To ensure the validity of this
insert an EcoR1 restriction enzyme digest was executed on the purified plasmid DNA.
In an eppendorf tube 20 µLs of DNA was combined with 1 µL of nuclease free water,
46
2.5 µLs of H Buffer (SIGMA®) and 1.5 µLs of EcoR1 (SIGMA®). The eppendorf tube
was vortexed and incubated at 37 ° C for 30 minutes and then vortexed again and
incubated at 37 ° C for another 30 minutes. After incubation, 6 µLs of Stop Buffer
(AMESCO) was added. The specimen was frozen at -20 ° C overnight.
The next day an agarose gel (2%) was run at 120 volts for 3.5 hours. If the
agarose DNA gel identified a 748 bp DNA insert similar to RMMG#6 it was sent for
DNA sequencing.
Before the results of the sequence arrived, the RMMG#6 TOPO TA was
propagated overnight in 100mLs of LB Amp broth. Plasmid purification was achieved
using the Qiagen® Plasmid Midi Purification Kit following the manufacturer’s
procedure. The final purified DNA product was resuspended in 600 µLs of nuclease
free water heated to 70 ° C. The RMMG#6 TOPO TA was used to make glycerol
stocks for future testing and preservation. Also, RMMG#6 TOPO TA DNA is required
for a ligation reaction with pGEX.
pGEX and RMMG#6 Ligation
Overnight cultures of both the pGEX vector and the RMMG#6 TOPO TA DNA
insert were propagated in LB Amp broth simultaneously. Plasmid purification was
achieved using the Qiagen® Plasmid Midi Purification Kit following the
manufacturer’s procedure. The final purified DNA product was resuspended in 600 µLs
of nuclease free water heated to 70° C. After purification of both the pGEX vector and
RMMG#6 DNA insert was done an EcoR1 restriction enzyme digest was performed.
400 µLs of Qiagen® purified TOPO TA RMMG#6 DNA was placed in an eppendorf
47
tube. 20 µLs of sterile water, 50 µLs of H buffer (Sigma®) and 30 µLs of EcoR1
(SIGMA®) were pipetted into the eppendorf tube and then vortexed. The eppendorf
tube was incubated at 37° C for 30 minutes then vortexed and placed back in the
incubator for 30 minutes. After 1 hour 120 µLs of Stop Buffer (AMRESCO) was added
to inhibit the restriction enzyme. The digest was frozen at -20° C overnight. pGEX
was prepared by adding the following in an eppendorf tube: 100µLs of Qiagen®
purified pGEX, 5 µLs of sterile water, 12.5 µLs H Buffer (SIGMA®) and 7.5 µLs
EcoR1 (SIGMA®). Next the eppendorf tube was vortexed and placed in the incubator
for 30 minutes at 37° C then vortexed again and incubated another 30 minutes at 37° C.
After one hour 30 µLs of Stop Buffer (AMRESCO) was added to inactivate the
restriction enzyme. The digest was frozen overnight at -20° C.
The next day the samples were pulled out of the freezer and thawed at room
temperature while the DNA gel was assembled. 2 grams of Sea Plaque Agarose Low
gelling temperature agarose was added to 100 mLs of 1X TAE (2% agarose) and heated
in the microwave for 3 minutes. When the mixture was cool to touch the gel was
poured. After the gel solidified, 340 µLs of TOPO TA RMMG#6 was loaded and 130
µLs of pGEX was loaded as well as 7µLs of the 100bp DNA Ladder (AMRESCO®).
The gel was run at 120 volts for 3.5 hours. After the gel was finished a QIAquick Gel
Extraction was performed using a (Qiagen®) kit following the manufacturer’s protocol.
The final DNA elution was accomplished using 52 µLs of nuclease free water heated to
70° C. After centrifugation at 14,000 rpm for 1 minute the final quantity of eluted DNA
48
was 50 µLs. The concentration measured 13.5 ng/ µL for the pGEX and 7.0 ng/ µL for
the TOPO TA RMMG#6.
Ligation buffer was made by adding 1 µL of ATP (SIGMA®) and 1 µL of 10X
T4 ligase buffer (SIGMA®) in a small PCR tube on ice. Afterward in a separate small
PCR tube also on ice the following was added: 0.7 µL of nuclease free water, 1 µL of
previously made ligation buffer, 7.1 µLs of TOPO TA RMMG#6 DNA insert, 0.7 µL
pGEX vector and 0.5 µL of well mixed ligase (SIGMA®). The ligation reaction was
vortexed then placed in the PTC-200TM
Peltier thermal cycler DNA Engine Gadient
cycler (MJ Research, Inc). The ligation reaction contained two steps. The first step was
22.5 ° C for 30 minutes and the second step was to denature the ligase at 65 ° C for 10
minutes. The ligation reaction serves as a cloning step since pGEX is a vector. Thus
another cloning step is not required, and the transformation can be performed directly
after the ligation reaction.
Transformation
The E. coli One Shot TOP 10 (Invitrogen) cells were thawed on ice the last 10
minutes of the ligation reaction. The transformation has to follow immediately after the
ligation reaction. The ligation reaction (2 µLs) was added directly to the E. coli One
Shot TOP 10 cryovial and then placed on ice for 45 minutes. Next the cryovial is
transferred to a 42 ° C water bath for 1 minute to heat shock the cells and then
transferred back to ice for 5 minutes. Room temperature SOC medium (250 µLs) was
added to the cryovial and incubated at 37 ° C shaking horizontally at 200 rpm for 1
hour and 15 minutes. During this incubation 2 LB Amp plates were placed in a 37 ° C
49
incubator to warm up. Finally, 50 µLs and 200 µLs of the ligation reaction/
transformation mixture were plated on the LB Amp plates and incubated overnight at
37 ° C.
The next day 4 colonies from each plate were transferred to another LB Amp
plate. The plate is incubated at 37 ° C overnight. A sterile toothpick was used to
transfer the 8 colonies in 5mLs of LB Amp broth. The broth was incubated overnight
at 37 ° C. The next day a (AMRESCO) Cyclo-Prep plasmid purification was performed
according to the manufacturer’s protocol. The final DNA elution was obtained using
52 µLs of nuclease free water heated to 70 ° C. After centrifugation at 14,000 rpm for
1 minute the final amount of eluted DNA was 50 µLs.
An EcoR1 restriction enzyme digest was performed on the purified plasmid
DNA. In an eppendorf tube 20 µLs of DNA was combined with 1 µL of nuclease free
water, 2.5 µLs of H Buffer (SIGMA®) and 1.5 µLs of EcoR1 (SIGMA®). The
eppendorf tube was vortexed and incubated at 37 ° C for 30 minutes and then vortexed
again and incubated at 37 ° C for another 30 minutes. After incubation, 6 µLs of Stop
Buffer (AMESCO) was added.
When the restriction enzyme digest was done a DNA agarose gel (2%) was run
at 120 volts for 3.5 hours. Clones that did not contain the RMMG#6 DNA insert were
discarded. Clones that contained the RMMG#6 DNA insert were grown overnight in
LB Amp broth. Glycerol stocks were made for latter analysis and long term storage of
these clones as well as DNA sequencing from the purified plasmid.
50
Plasmid Preparation
The AMRESCO Cyclo-Prep K179 Miniprep Plasmid DNA Purification Kit did
not use an RNase. DNA gels had an enormous amount of RNA where the RMMG#6
DNA insert should appear. After determining the presence of a band, another plasmid
purification was performed on the same culture using the QIAprep Spin Miniprep Kit
(Qiagen®) according to the manufacturer’s directions. This plasmid purification kit
contained a RNase in Buffer P1 and eliminated the huge RNA cloud that obscured our
band. Also, DNA sequencing worked better when the (Qiagen®) plasmid purification
kit was used. When the AMRESCO Cyclo-Prep kit was used the DNA sequencing did
not work at all. Our lab speculated this contradiction in results due to the RNA in the
sample interfering with the DNA sequencing.
After determination of RMMG#6 DNA fragment presence, a large scale
plasmid preparation was performed using the (Qiagen®) Plasmid Midi Purification Kit
following the manufacturer’s procedure. The final purified DNA product was
resuspended in 600 µLs of nuclease free water heated to 70° C and sequenced.
DNA Sequencing
Sequencing was performed using the Beckman-Coulter CEQTM
Quick Start Kit.
Plasmid purified samples were sequenced according to the manufacturer’s suggested
procedure. Roughly 1.5 µgs of pure plasmid DNA (dilutions were made and
approximately 2µLs) was added to 2µLs of (1.6 picomole) primer, 8 µLs of nuclease
free water and 8 µLs of DTCS Quick Start Master Mix and then gently mixed. The
samples were run according to the manufacturer’s directions.
51
Next, samples were ethanol precipitated and washed following the
manufacturer’s procedure. Then the samples were dried thoroughly by vacuum
centrifugation and frozen upright overnight at -20° C. The next day the DNA pellet
was resuspended with 40 µLs of Sample Loading Solution from the Beckman-Coulter
CEQTM
Quick Start Kit. The samples were sequenced on the Beckman-Coulter CEQTM
2000XL automated sequencer. The technique used for sequence analysis was the LFR-
1+30 method to increase data collection an additional 30 minutes. When sequence data
was obtained the data was analyzed using BioEdit Sequence Alignment, 4 Peaks and
Genius software.
Protein Expression
An overnight culture of pGEX3RMMG#6 was grown for 20 hours at
approximately 22° C in 300 mLs of LB Amp broth. Then 300 μLs of Isopropyl-ß-D-
thio-galactoside (IPTG) was added to the culture (to 0.1mM) to induce the lac operon
to express our protein. The culture remained at 22° C for four hours after the IPTG
addition. After the IPTG induction the culture was poured into 50 mL conical Falcon
tubes and centrifuged at 4 ° C for 30 minutes at 3800 rpm.
52
Glutathione-S-Transferase Affinity Chromatography Purification
The bacterial cell pellet was washed by resuspending with 4 ° C TBS and then
centrifuged again at 4 ° C for 30 minutes at 3800 rpm. Supernatent was decanted and
the cells were resuspended in 5 mLs of 4 ° C TBS then 100 μLs of Sigma P-7626 FW
174.2 Phenylmethylsulfonyl Fluoride α-Toluenesulfonyl fluoride and point sonicated at
50% power for 10 seconds on and 10 seconds off for 4 cycles. Next, 0.65 mLs of 10%
Triton X-100 was added and sonicated for 3 more cycles. The Falcon tube remained in
ice the whole time. The cell suspension should be more translucent. Cellular debris
was removed by centrifugation at 4 ° C for 40 minutes at 3800 rpm. Supernatant is
aspirated of the cellular debris and placed in another 15 mL Falcon tube at 22 ° C.
Supernatant was applied to the glutathione conjugated agarose column and incubated at
room temperature on a rotator for 1 hour and then allowed to flow through the
immobilized glutathione agarose matrix by gravity. The column was washed with 10
mLs of room temperature TBS four times. Next, a 15mM glutathione/ 50 mM Tris pH
8.28 solution is applied to the column for 30 minutes at room temperature on the
rotator. This solution elutes the GST. The elutant was collected in 0.5 mL fractions in
an eppendorf tube. Eppendorf tubes were frozen until the next day to run a SDS-
PAGE.
SDS PAGE
Proteins and GST purified fusion proteins were separated on the base of
molecular size by a Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis
(SDS-PAGE) (Laemmli, 1970) using a mini-gel arrangement (Matsudiara and Burgess,
53
1978). The gels were made in a multi-casting fashion. A 12% gel solution was
assembled by adding the following to a 500 mL Fleaker: 54 mLs of water, 36 mLs of
40% acrylamide, 30 mLs of Resolving Gel Buffer (90.85 grams of Tris, 2 grams of
SDS, 350 mLs of double distilled water titrated to 8.8 with HCl more double distilled
water was added to a final volume of 500 mLs), 120 μLs of TEMED and 480 μLs of
10% APS (0.1 gram of Ammonium per sulfate dissolved in 1 mL of double distilled
water). The 12% gel solution is poured into the syringe after 20 mLs of water saturated
butanol is poured through the syringe to protect the gels from air as they polymerize.
After the gels are polymerized the stacking gel (6.250 mLs of ddwater, 1.250 mLs of
40% acrylamide, 2.500 mLs of stacking gel buffer (12.1 grams of Tris, 0.8 grams SDS,
180 mLs of ddwater, titrate to 6.8 with HCl more ddwater was added to a final volume
of 200 mLs) was made. Approximately 1-5 μgs of protein was loaded into each lane or
20 μLs of sample. Samples were prepared by adding 15 μLs of sample to 5μLs of 4X
SDS-Buffer. Gels were run at a constant current of 0.020 mAmps for about 1 hour and
15 minutes and then placed in Coomassie Brilliant Blue (Sigma) overnight on a shaker
at room temperature. The next morning the gels were placed in high destain for 1.5
hours and then low destain overnight on a shaker at room temperaure. The next
morning the gels were viewed for our protein at 52 kDa. The control fractions or the
GST was on another gel at about 25kDa.
Western Blot
An SDS-PAGE was performed as above but when it was finished running the
proteins were transferred onto a Polyvinylidene difluoride (PVDF) (BioRad Sequi-
54
Blot) membrane by electrophoretic transfer or a Western Blot or immunoblot (Towbin
et al., 1979). PVDF membrane was placed in 10% blocking buffer (10 grams of
powdered milk dissolved in 100 mLs of TBS-T) for 2 hours. Membranes were rinsed
with TBS-T 3 times for 15 minutes and then placed in 1% Blocking buffer (1 mL of
10% Blocking Buffer plus 9 mLs of TBS-T) and 10 μLs of serum (primary antibody)
for 1 hour at room temperature on a shaker. The membranes were placed in the
refrigerator overnight. The next morning they were placed on the shaker at room
temperature for 1 hour and then rinsed with TBS-T 4 times for 15 minutes. Secondary
antibody was labeled with horseradish per-oxidase (HRP) (Sigma, Inc). Five μLs of
secondary antibody was added to 1% Blocking Buffer for 1 hour at room temperature
on the shaker. Then the PVDF membranes were rinsed 4 times with TBS-T for 15
minutes then TBS for 15 minutes. Antigen-antibody complexes were identified by the
Luminol chemiluminescent substrate (BioRad, Inc) and exposed to X-ray film (Kodak,
Inc BioMax film) by autoradiography.
Olmsted Affinity Purification of Antibodies
The SDS-PAGE and Western Blot were performed as previously mentioned.
The PVDF membrane dried overnight. The next day the PVDF membrane was placed
in methanol for 5 seconds and then the proteins were identified on the PVDF membrane
by staining with 0.1 % Ponceau S. for 20 minutes and destained with several changes of
distilled water until detection of the protein band. The protein band was cut out using
scissors. Residual Ponceau S. was removed by several washes with PBS. Next the
55
PVDF membrane is blocked with 5% blocking buffer for 1 hour and then washed 3
times using 3-10 mLs PBS for 5 minutes on a shaker. Place the PVDF membrane strip
in 200 µLs of crude serum in a 1.5 mL eppendorf microcentrifuge tube on a shaker for
3 hours. Remove the PVDF membrane from the “depleted fraction” and wash the
membrane 3 times with 3-10 mLs PBS for 10 min on a shaker. Take the PVDF
membrane out of PBS and place in another eppendorf tube containing 200 µLs of low
pH buffer on a shaker for 15 minutes and then added 200 µLs of ice cold 100mM Tris
base to increase the pH to 7.0. The purified and neutralized antibody was stored at -22 °
C.
Immunofluorescent Microscopy
The human skeletal muscle section microscope slides were placed in 10 mLs of
2% formaldehyde solution for 30 minutes. Next they were rinsed with TBS 3 times for
10 minutes on a shaker. The slides were placed in 5% blocking buffer solution and 250
µLs of Triton-X was added then the slides were put on the shaker for 1 hour. Slides
were rinsed with TBS 3 times for 10 minutes each. Rinsed slides were placed in 10
µLs of primary antibody in 10 mLs of 1% Blocking buffer solution on a shaker for 1
hour. The primary antibodies consisted of the following: Olmsted purified antibody
from patient #1, the depleted fraction control, reabsorbed affinity purified control and
the last slide was placed in 10 mLs of 1% blocking buffer for the secondary antibody
control. Next, rinsed slides with TBS 3 times for 10 minutes on a shaker and placed
them in 3 µLs of secondary antibody (goat anti human FITC) and 10 mLs of 1%
blocking buffer solution for 1 hour on a shaker. Slides were rinsed with TBS 3 times
56
for 10 minutes on a shaker. Slides dried for a few minutes and then 2 drops of 4% N-
propyl gallate in glycerol was put on the slide followed by a cover slip then they were
sealed with clear nail polish and viewed under the OLYMPUS manual/motorized
reflected fluorescence U-LH100HG system.
Titen Gels
An acrylamide plug is required otherwise the titin gel slips out of the glass
plates while it is running. Acrylamide plug consists of 1.5 mL of 40% acrylamide
solution, 0.5 mL of Glycerol, 1.25 mL of 2M Tris-Cl for polyacrylamide plug, 1.74 mL
of diH2O, 14 µL ammonium persulfate (APS), 7.6 µL TEMED. Place 900 µL of
acrylamide plug solution in between the glass plates. Use diH2O and pour over the
acrylamide plug solution to ensure the plug polymerizes as straight as possible. Wait 1
hour for polymerization then pour out the water, use a paper towel to get it all out.
Preheat oven to 65°C and weigh out 0.8 grams of agarose I powder and place in 250
mL beaker. In a graduated cylinder add 12 mL of Glycerol and 8 mL of 5X resolving
gel buffer and 20 mL of diH2O and mix until the solution looks homogenous. After the
acrylamide plug is polymerized place the entire gel casting apparatus into the 65°C
oven along with gel combs and pipette for 30 minutes. Take the graduated cylinder
containing glycerol, 5X resolving gel buffer and water and pour into 250 mL beaker
containing 0.8 gram of agarose I powder. Weigh the beaker to replace with diH2O after
heating. Heat the beaker in the microwave with another beaker of diH2O. Heat until the
agarose solution just begins to boil then swirl the beaker and reheat until the solution
has dissolved. Weigh the agarose beaker and replace significant evaporation loss with
57
the other beaker of hot diH2O. Remove all material from the oven, aspirate agarose
solution into the pipette and pour between glass plates of the gel casting device and
place comb in between glass plates. Avoid air bubbles while pouring gels. Let the gels
cool at room temperature for 30 minutes then place the entire gel casting device into the
refrigerator for 30 minutes at 4°C. Gels can be stored at 4°C with the comb in an air
tight container with paper towels moistened with water.
Two Dimensional Gel Electrophoresis (2DGE)
The GST-RMMG6 protein was obtained from the -20°C freezer. Passive
rehydration was performed using Bio-Rad® ReadyStrip™ IPG strips. The IPG strips
used in the passive rehydration process had a pH gradient of 5-8 and the strip size used
was 7 cm. GST-RMMG6 protein samples and rehydration buffer (8-9.8M Urea, 0.5%
CHAPS, 10mM DTT, 0-0.2% w/v Bio-Lytes, 0.001% Bromophenol Blue) were added
to the rehydration/equilibration tray. The 7 cm IPG strips, 125 µL of rehydration buffer
and protein sample was used to provide a final protein concentration of 0.667 ng/µl.
The Bio-Rad® ReadyStrip™ IPG strips were placed, gel side down, on top of the
rehydration buffer/protein sample in the rehydration/equilibration tray. Any bubbles
were removed if present under the IPG strips. The IPG strips were overlaid with
mineral oil and the rehydration/equilibration tray was placed on the orbital shaker at
room temperature overnight.
The next day (approximately 24 hours), the rehydration/equilibration tray with
the IPG strips soaking in the GST-RMMG6 protein rehydration buffer was obtained
from the orbital shaker and placed on the table in order to perform the first-dimension,
58
isoelectric focusing (IEF). The Bio-Rad® Electrode Wicks were immersed in de-
ionized H2O, and placed over the wire electrodes in the Protean® IEF focusing tray.
The IPG strips were obtained from the rehydration/equilibration tray and the mineral oil
was blotted off the tips of the strips before transferring to the Protean® IEF focusing
tray. IPG strips were placed on the wire electrodes of the IEF focusing tray with the gel
side down and the positive (+) end of the strip matching the positive (+) electrode of the
IEF focusing tray. The IPG strips were overlaid with mineral oil and the lid was placed
on the IEF focusing tray. The IEF focusing tray was placed in the Bio-Rad® Protean
IEF Cell. The Bio-Rad® Protean IEF Cell was turned on and programmed according to
the 7 cm IPG strip size. The program was set at the preset method, linear ramping
mode, 40,000 V-hr, and held at 500 V.
The same day as isoelectric focusing (IEF) was performed; 12% poly-
acrylamide gels were prepared in order to perform second dimension electrophoresis
the following day. Prepartion of the 12% poly-acrylamide gels was performed first by
cleaning the gel plates with 70% ethanol and then the poly-acrylamide solution was
prepared. For 100 mL of solution: 12% acrylamide, 0.375 M Tris, 0.1% SDS, and later
0.1% ammonium persulfate, and 0.04% TEMED was added to a beaker. After the poly-
acrylamide solution was prepared, it was added in between the long and short gel plates
and allowed to polymerize. Poly-acrylamide solution was added to each individual gel
plate by using a sterile pipette. After the gels were polymerized, they were transferred
to ½ X TGS buffer (For 1 x TGS buffer: 25mM tris, 192mM glycine, 0.1% SDS, H2O,
59
pH 8.6) and stored in the cooler until ready to perform second dimension
electrophoresis.
After completion of the isoelectric focusing (IEF), the IEF focusing tray was
obtained from the Bio-Rad® Protean IEF Cell and the IPG strips were removed from
the IEF focusing tray. The IPG strips were blotted off, to drain the excess mineral oil,
and placed in the rehydration/equilibration tray with the gel sides up. The IPG strips
were immersed in equilibration buffer I (6M urea, 2% SDS, 0.375M Tris-HCL, pH 8.8,
20% glycerol, 2% DTT) and placed on orbital shaker for 10 minutes at room
temperature. After 10 minutes, the IPG strips were transferred from equilibration buffer
I to equilibration buffer II (6M urea, 2% SDS, 0.375M Tris-HCL, pH 8.8, 20%
glycerol, 2.5% iodoacetamide) and were gently shaken on orbital shaker for 10 minutes
at room temperature. The IPG strips were then removed from equilibration buffer II and
were transferred to 1 x TGS buffer for 1-3 minutes. The 12% poly-acrylamide gels
were obtained from the ½ X TGS buffer (25mM tris, 192mM glycine, 0.1% SDS, H2O,
pH 8.6) in the cooler and were filled with overlay agarose (0.5g agarose, 100 mL 1 X
TGS buffer, 1 grain of bromophenol blue) to the top of the short plate. After the overlay
agarose was added, the IPG strips were quickly placed directly on top of the 12% poly-
acrylamide gels, with gel side up and positive (+) side on left, between the long and
short plates. The gels were placed on the table 10 minutes until the agarose solidified.
Then gels were placed into the electrophoresis cell chamber in order to perform second
dimension gel electrophoresis. The electrophoresis cell chamber was filled with 1 X
TGS buffer at room temperature and then electrophoresis was started. For 7 cm IPG
60
strips gels were placed in the Bio-Rad® Mini-Protean® 3 Cell and were run on manual,
constant milli-amps at 16 milli-amps per gel for approximately 21/2
hours. After
electrophoresis, the gels were removed from the electrophoresis cell chamber and
stained with Comassie (0.25% Comassie Brilliant Blue R-250 [Sigma], 45% methanol,
10% acetic acid).
To use Comassie stain, the gels were transferred to a staining container and
were immersed in Comassie stain. The gels were kept in the staining container
overnight, while being shaken on the orbital shaker at room temperature. After being
stained, the Comassie stain was removed from the staining container and the gels were
then immersed in high de-stain (40% methanol, 10% acetic acid) for 1 hour while on
the orbital shaker, in order to de-stain the gels. After 1 hour, the high de-stain was
removed from the staining container and the gels were re-immersed in low de-stain
(10% methanol, 6% acetic acid) for approximately two hours on the orbital shaker. The
low de-stain was removed from the staining container and the gels were placed in de-
ionized H2O in order for the gels to be scanned using the EPSON Scan Program and to
be stored on the table top for future use.
61
Protein Excision and Analysis
In order to perform mass spectrophotometry of GST-RMMG6 Coomassie Blue
stained gel bands were cut out the SDS-PAGE using a sterile pipette. . The excised
protein bands were then placed directly into a sterile eppendorf tube containing 5% v/v
acetic acid. The eppendorf tubes containing the excised protein bnds were then stored at
-20ºC until submitted to the Ohio State University Mass Spectrometry and Proteomics
Facility.
In Gel Digestion
At the Ohio State University Mass Spectrometry and Proteomics Facility, the
protein samples were processed by the following procedure. First, the gels were
digested with sequencing grade trypsin (Promega) or sequencing grade chymotrypsin
(Roche) using the Multiscreen Solvinert Filter Plates (Millipore). Briefly, samples were
then trimmed as close as possible to minimize background polyacrylamide material.
The gel samples were then washed in nanopure water for 5 minutes. The wash step was
then repeated twice before samples were washed with a 1:1 methanol/ammonium
bicarbonate solution (methanol: 50 mM ammonium bicarbonate; v/v) for 10 minutes.
The samples were then dehydrated with a 1:1 acetonitrile/ammonium bicarbonate
solution (acetonitrile: 50 mM ammonium bicarbonate; v/v). Subsequently, the protein
samples were rehydrated and incubated with a dithiothreitol solution (25 mM in 100
mM ammonium bicarbonate) for 30 minutes prior to the addition of iodoacetamide (55
mM iodoacetamide in 100 mM ammonium bicarbonate) solution. The protein samples
were then incubated with iodoacetamide in the dark for 30 minutes. The samples were
62
then washed again with two cycles of water and dehydrated using a 1:1
acetonitrile/ammonium bicarbonate solution (acetonitrile: 50 mM ammonium
bicarbonate; v/v). The protease was then driven into the protein samples by rehydrating
them in 12 ng/ml trypsin in 0.01% ProteaseMAX Surfactant for 5 minutes. After
rehydration, the samples were then overlaid with 40 ml of 0.01% ProteaseMAX
Surfactant: 50 mM ABC and gently mixed on a shaker for 1 hour. The in gel digestion
was finally stopped with the addition of 0.5% TFA.
Mass Spectrophotometry
Capillary-liquid chromatography-nanospray tandem mass spectrometry (Nano-
LC/MS/MS) was immediately performed on the digested samples to ensure high
quality tryptic peptides with minimal non-specific cleavage. The Nano-LC/MS/MS was
performed on a Thermo Finnigan LTQ mass spectrometer equipped with a nanospray
source operated in a positive ion mode and the LC system was an UltiMate™ 3000
system (Dionex). To each protein sample, 5 µl of solvent A, 50mM acetic acid, and
solvent B, acetonitrile, was first injected on to the μ-Precolumn Cartridge (Dionex) and
then washed with 50 mM acetic acid. The injector port was then switched to inject and
the peptides were eluted off of the trap onto the column. A 5 cm 75 μm ID ProteoPep II
C18 column (New Objective, Inc.) packed directly in the nanospray tip was then used
for chromatographic separations. The peptides were eluted directly off the column into
the LTQ system using a gradient of 2-80%B over 45 minutes, with a flow rate of
300nl/min. The total run time was 65 minutes and the MS/MS was acquired according
to standard conditions established in the laboratory. Briefly, a nanospray source
63
operated with a spray voltage of 3 KV and a capillary temperature of 200oC was used.
The scan sequence of the mass spectrometer was based on the TopTen™ method; the
analysis was programmed for a full scan recorded between 350 – 2000 Da, and a
MS/MS scan to generate product ion spectra to determine amino acid sequence in
consecutive instrument scans of the ten most abundant peak in the spectrum. The CID
fragmentation energy was set to 35%. Dynamic exclusion was enabled with a repeat
count of 2 within 10 seconds, a mass list size of 200, an exclusion duration of 350
seconds, a low mass width of 0.5 and a high mass width of 1.5.
Data processing was performed following recommended guidelines. Sequence
information from the MS/MS data was processed by converting the raw files into a
merged file (.mgf) using an in-house program, RAW2MZXML_n_MGF_batch
(merge.pl, a Perl script). The resulting mgf files were searched using Mascot Daemon
(version 2.2.2; Matrix Science) against the full SwissProt database (version 57.5;
471472 sequences; 167326533 residues) or the National Center for Biotechnology
Information (NCBI; http://www.ncbi.nlm.hih.gov) database (version 20091013;
9873339 sequences; 3367482728 residues). The mass accuracy of the precursor ions
were set to 2.0 Da given that the data was acquired on an ion trap mass analyzer and the
fragment mass accuracy was set to 0.5 Da. Considered modifications (variable) were
methionine oxidation and carbamidomethyl cysteine. Two missed cleavages for the
enzyme were permitted. A decoy database was searched to determine the false
discovery rate (FDR) and the peptides were filtered according to the FDR and proteins
identified required bold red peptides. Protein identifications were checked manually
64
and proteins with a Mascot score of 50 or higher with a minimum of two unique
peptides from one protein having a -b or -y ion sequence tag of five residues or better
were accepted.
65
CHAPTER III
RESULTS
Specimen Integrity
The original RMMG#6 DNA fragment was contained in the plasmid
pBluescript from Dr. Thomas C. Watkins. Then it was placed in the TOPO TA vector
(Figure 2) for long term storage and finally in pGEX-3X for protein synthesis. In order
to confirm specimen integrity of the original RMMG#6 DNA fragment specimen, a
DNA gel of the PCR product pBluescript RMMG#6 was performed. The pBluescript
RMMG#6 was grown overnight in LB Amp. The next morning a plasmid purification
by an Amresco cyclo-prep was performed and then a PCR. The sample was done in
duplicate. (Figure 1) is the DNA gel of the PCR product results of pBluescript
RMMG#6. Lane 1 was left blank and lane 2 contains the 100 bp DNA Molecular
Weight Ladder. Lanes 3, 5, 7, 8, 9, and 10 are all blank lanes. Lanes 4 and 6 are the
PCR products of pBluescript RMMG#6. In both lanes 4 and 6 a concise band is
present at the 800 bp area on the DNA gel. After confirmation of the PCR product
DNA sequence analysis was performed to verify the 748 bp RMMG#6 insert matched
the exact insert from Dr. Watkins (Figure 5). According to the sequence analysis, the
anticipated size is 831 bp and DNA gel analysis as well as PCR product estimated the
66
size around 810 bp. Once the RMMG#6 DNA fragment was confirmed it was cloned
into pCR®4-TO.
Cloning and Transformation
Several RMMG#6 TOPO TA clones were grown overnight in LB Amp. The
next morning plasmid purification was performed using the Amresco cyclo-prep and
then a Restriction enzyme digest was done using EcoRI. The EcoRI digested and
undigested RMMG#6 TOPO TA clones were run on DNA gels to find the clones with
the RMMG#6 DNA fragment (Figure 2). In lanes 1,4,7,10,13 of Figure 2 they are left
blank. Lanes 3, 6, 9, and 12 are the undigested RMMG#6 TOPO TA. Lanes 2, 5, and 8
are the EcoRI digested RMMG#6 TOPO TA; these lanes do not show a band indicating
that they do not have the RMMG#6 DNA insert. Lane 12 is the nondigested pCR®4-
TOPO RMMG#6 clone 4 showing that the pCR®4-TOPO vector is slightly higher than
the other vectors in lanes 3,6,9 without an insert. Lane 14 is the 100 bp DNA
Molecular Weight Ladder. Lane 11 is the EcoRI digested pCR®4-TOPO RMMG#6
with the insert at the 700 bp region and the pCR®4-TOPO vector at the 4490 bp region.
Clone 4 was confirmed with DNA sequence analysis. This DNA fragment is in fact the
exact RMMG#6 DNA fragment from pBluescript. These results were required to
continue with the ligation reaction.
67
Ligation
Next the ligation of the RMMG#6 DNA insert and pGEX-3X was performed
(Figure 3). This is a DNA gel of pGEX-3X and pCR®4-TOPO RMMG#6. Overnight
cultures of both were grown in LB Amp. The cultures were plasmid purified by a
Qiagen plasmid purifaction kit and then by a restriction enzyme digest using EcoR1.
Lanes 1 and 2 are the pGEX-3X vector containing a single band around 4490 bp for
pGEX-3X. Lane 3 contains the 100 bp DNA Molecular Weight Ladder. Lanes 4 and 5
are pCR®4-TOPO RMMG#6. These lanes contain a band around 4490 bp signifying
pCR®4-TOPO with another band around the 700 bp region indicative of RMMG#6
DNA insert. The pGEX-3X and RMMG#6 bands were cut out of the Sea Plaque
agarose low gelling temperature agarose gel and a QIAquick Gel Extraction was
performed. Once these bands were gel purified a ligation reaction and transformation
were completed.
Confirmation of Ligation
Colonies were selected and screened for the RMMG#6 DNA insert. Figure 4 is
a DNA gel of the pGEX RMMG#6 clones that were grown overnight in LB Amp and
plasmid purified by the Qiagen plasmid purification kit followed by an EcoRI
digestion. Lane 1 is the 100 bp DNA Molecular Weight Ladder. Lanes 3,5,7,9,11,13
are nondigested clones and Lanes 2,4,6,8,10,12 are the EcoRI digested clones. Lane 6
is the EcoRI digested pGEX3 RMMG#6 with the RMMG#6 DNA insert right between
the 700 and 800 bp bands corresponding to the DNA Molecular Weight Ladder and the
68
pGEX-3X plasmid at the 4490 bp area. Lane 7 is nondigested pGEX3 RMMG#6
demonstrating the pGEX plasmid is higher than the other vectors without an insert.
The gel measurement of the linearized plasmid are subject to a larger deviation from
the predicted size due to the bands being out of the range of the DNA ladder used
(AMERESCO, Inc., 100 bp ladder). The RMMG#6 DNA insert was confirmed by
DNA sequence analysis (Figure 5). This cDNA sequence of G3RMMG#6
demonstrates similarity to human skeletal muscle titin isoform N2-A. G3RMMG#6 is
748 bp area of this isoform of titin is immunoreactive to autoimmune rippling muscle
antisera. Figure 6 is a DNA gel of PCR analysis of all three subclones and
endonuclease analysis. G1RMMG6 contains a PCR product size of 200 b.p. and DNA
sequencing with this clone has never been effective. G2RMMG6 and G3RMMG6 both
contain the expected PCR product of 810 b.p. and correspond with the size based on
DNA sequence analysis which is 831 b. p. On the right side of figure 6 is the restriction
enzyme EcoRI analysis. It demonstrates the G3RMMG6 molecular size of the insert at
about 680 b. p. which matches the expected results. The linearized pGEX is above the
molecular weight ladder and is not accurate to determine the molecular size.
69
Figure 1: This is a PCR DNA gel of a pBluescript RMMG#6. This sample was
grown overnight in LB. An Amresco cyclo-prep was performed and then a
PCR. The sample was done in duplicate. Lane 2 is the 100bp DNA
Molecular Weight Ladder. Lanes 4 and 6 are the PCR product of
pBluescript RMMG#6. There is a clear and concise band at the 800bp
region on the DNA gel. DNA sequence analysis confirmed the 748bp
RMMG#6 insert.
70
Figure 2: DNA gel of pCR®4-TOPO RMMG#6. RMMG#6 was cut out of
pBluescript by the restriction enzyme EcoR1. RMMG#6 DNA insert was
cloned and transformed into pCR®4-TOPO. The colonies were grown in
LB overnight and a cyclo-prep was performed. Then an EcoR1 digest was
done and a DNA gel. Lane 14 is the 100bp DNA Molecular Weight
Ladder. Lane 12 is the nondigested pCR®4-TOPO RMMG#6 Clone 4
demonstrating the pCR®4-TOPO vector is slightly higher than the other
vectors without an insert. Lane 11 is the EcoR1 digested pCR®4-TOPO
RMMG#6 with the insert at the 700bp region and the pCR®4-TOPO
vector at the 4490bp region.
71
Figure 3: DNA Gel of pGEX and pCR®4-TOPO RMMG#6. Lanes 1 and 2 are
pGEX. Lane 3 is the 100bp Molecular Weight Ladder. Lanes 4 and 5 are
pCR®4-TOPO RMMG#6. Overnight cultures of pGEX and pCR®4-
TOPO RMMG#6 were grown in LB. The cultures were Qiagen plasmid
purified and EcoR1 digested. A Sea Plaque agarose low gelling
temperature agarose was made and the EcoR1 digestions were run. Lanes
1 and 2 have one single band around 4490bp for pGEX. Lanes 4 and 5
have a band around 4490bp signifying pCR®4-TOPO and another band
around the 700bp region indicative of RMMG#6. The pGEX band and the
RMMG#6 bands were cut out of the DNA gel and a QIAquick Gel
Extraction was performed. Once these bands were gel purified a ligation
and transformation were completed.
72
Figure 4: Demonstrates a DNA gel of pGEX3 RMMG#6. These samples are all
different colonies from a pGEX and pCR®4-TOPO RMMG#6 ligation
and transformation grown in LB overnight. A Qiagen plasmid purification
was performed and then an EcoR1 digestion. Lane 1 is the 100bp DNA
Molecular Weight Ladder. Lanes 3,5,7,9,11,13 are nondigested clones
and Lanes 2,4,6,8,10,12 are EcoR1 digested clones. Lane 6 is the EcoR1
digested pGEX3 RMMG#6 with the RMMG#6 insert between the 700 and
800bp region and the pGEX vector at the 4900bp region. Lane 7 is the
nondigested pGEX3 RMMG#6 representing the pGEX vector is fairly
higher than the other vectors without an insert.
73
Figure 5: Sequence of the ARMD immuno-reactive titin N2-A domain of
G3RMMG6 (GenBank # EU428784). This is the cDNA sequence of
G3RMMG6 showing identity to human skeletal muscle titin isoform N2-
A. G3RMMG6 is 748 b.p. region of this isoform of titin immunoreactive
to autoimmune rippling muscle antisera. This is the exact sequence that
confirmed the inserts from figures 1, 2, 3 and 4.
74
Figure 6: PCR and Restriction endonuclease analysis of pGEX-3X-
immunoreactive domain of titin N2-A fusion constructs (G1RMMG6,
G2RMMG6 and G3RMMG6). RMMG6 (pBluescript) cDNA
Subcloned into pGEX fusion vector (G3RMMG6) A.) PCR products using
pGEX-3X primers and three pGEX-3X/titin N2-A subclones. PCR of
G1RMMG6 yields about a 200 b.p. product, which is not consistent with
DNA sequencing results. G2RMMG6 and G3RMMG6 clones both yield
748 b.p products, consistent with DNA sequence results. B.) Restriction
endonuclease analysis of G3RMMG6 is also consistent with DNA
sequencing results. EcoR1 produces 748 b.p. fragment and 4900 b.p.
linearized pGEX-3X fragment. EcoRV, BamHI and Hind III produce only
a linearized plasmid.
75
Plasmid Construction
A plasmid map of pGEX-3X containing the 748 bp cDNA insert RMMG#6
(labeled EU 428784 the blue arrow) (Figure 8) demonstrates how the plasmid was
constructed. The location of the inserted RMMG6 immunoreactive domain is at the C-
terminal end of the glutathione-S-transferase. The pGEXRMMG6 map illustrates the area
where the LAC repressor protein is located (also labeled as a blue arrow). A LAC
repressor protein is required so the lactose deactivates the Lac I repressor then transcription
of the Lac Z, Lac Y, and Lac A can occur. The phosphorylated EIIA activates adenylate
cyclase to convert ATP to camp to bind the camp receptor protein (CRP) to stimulate
transcription of the Lac genes by binding to DNA near the lac promoter associated with
polymerase to stabilize polymerase binding to the promoter. A brown colored arrow is
used to designate the beta lactamase area in the plasmid. The beta lactamase is an enzyme
used to hydrolyze the beta lactam ring in the ampicillin rendering the antibiotic useless,
thus, allowing the selected organism to grow on the media containing ampicillin. It also
shows where the cDNA translates into the GST-titin fusion protein that was expressed and
glutathione affinity purified GST- titin N2-A domain weighing 50,747 kDa. Figure 7 is a
virtual amino acid sequence analysis constructed using the DNA sequence analysis to
create a conceptual translation of the fusion protein (gst-rmmg6) encoded by GST-
RMMG#6 gene. This computer-generated protein predicts a 51,023 kDa protein with a pI
of 5.95 which corresponds to experimental data. When the ligation of pGEX-3X and the
RMMG#6 insert was complete, protein expression was the next step in the process to study
the fusion protein directly by IPTG induced expression of pG3RMMG6 and affinity
purification was performed.
76
Figure 7: Virtual Amino Acid Sequence Analysis: This figure was constructed by
using the DNA sequence analysis to construct a conceptual translation of
the fusion protein (gst-rmmg6) encoded by GST-RMMG6 gene which
predicts a 51,023 protein with a pI of 5.95.
77
Figure 8: pG3RMMG6 map. This figure is a plasmid map of pGEX-3X
containing the 748 bp insert (labeled EU428784 the region is blue). The
Lac repressor protein (also labeled in blue) and the beta lactamase region
(colored brown) are also positioned on the map. The GST-Titin is shown
in yellow. The predicted PCR product (brown) of 221 bp using pGEX
forward and reverse primers is also included in the map. This size is in
concurrence to the size of the PCR fragment.
78
Protein Expression and Purification
Overnight cultures of pGEX3RMMG#6 were grown in LB Amp at 23 degrees
celcius for 24 hours and then IPTG was added to induce protein expression. After
expression the cells were centrifuged and the pellet was frozen overnight. The next
morning the pellet was washed with TBS and sonicated to release proteins from the
cell. Centrifugation was performed to separate the cellular debris (the pellet) from the
protein (the supernatant). The supernatant was applied to the Glutathione Affinity
purification column. The protein G3RMMG6 containing the glutathione affinity tag
would adhere to the glutathione beads, while the rest of the supernatant flows through
the column. TBS was used to wash the beads then the elution buffer was applied to
release the G3RMMG6 protein. The elution buffer with G3RMMG6 protein was
collected in eppendorf tubes and frozen until the next day to run a SDS-PAGE. (Figure
9) is the SDS-PAGE of the expressed and Glutathione Affinity purification of GST-titin
N2-A domain fusion protein. The first lane is the ProSieve® Color Protein Marker or
protein molecular weight standard from Lonza. The molecular weight of the bands
starting from the top of the SDS-PAGE and weighing the greatest to the least is 176,
119, 78, 51, 41, 27, 19, 12, 10 kDa. The second lane is the unpurified glutathione-S-
transferase fusion protein construct. Lane 2 has multiple protein bands at different
molecular weights. This clearly shows that the purification process has not occurred.
Lanes 3-10 are single glutathione affinity purified GST-titin N2-A domain fusion
protein fractions at 51,000 kDa according to the molecular weight standard based on
the SDS-PAGE mobility and Image J analysis as well as protein sequencing.
79
G3RMMG6 is 50,747 kDa indicating that the G3RMMG6 has been purified. This is
the expected result for experiment success. These fractions were also cut out of the
SDS-PAGE and sent to OSU for protein sequence and analysis, Figure 13). Testing on
the G3RMMG6 was the next step to find the pI, the electrophoretic mobility while
retaining the physical integrity for enhanced resolution of the large molecular weight
protein as well as checking for immunoreactivity with the ARMD antisera.
80
Figure 9: SDS-PAGE of Expression and Glutathione Affinity purification of
GST-titin N2-A domain fusion protein. Lane 1 is the ProSieve® Color
Protein Marker from LONZA as the protein molecular weight standard.
The first band starting at the top is 176, 119, 78, 51, 41, 27, 19, 12, 10
kDa. Lane 2 is the unpurified glutathione-S-transferase fusion protein
construct and it demonstrates multiple protein bands at several weights.
Lanes 3-10 are glutathione affinity purified GST-titin N2-A domain fusion
protein fractions corresponding to the 51,000 kDa. Molecular weight
standard G3RMMG6 is 50,747 kDa indicating that G3RMMG6 was
purified.
81
Polyacrylamide Gel Electrophoresis
After the expression and glutathione affinity purification of GST-titin N2-A
domain fusion protein was complete the protein was examined using vertical agarose
acrylamide gel electrophoresis and Two dimensional gel electrophoresis. Titin has
such a high molecular weight for separation by SDS-PAGE so a technique called
Vertical Agarose Gel Electrophoresis was used. These titin specific gels contain a
composite 2 % polyacrylamide to 0.5 % Agarose gel (Agarose is normally used to
separate DNA fragments), creating a larger pore size and retaining physical integrity
for enhanced resolution of the large molecular weight protein. Figure 10 is a titin gel
showing the glutathione affinity purified gst-rmmg6 titin N2-A domain fusion protein.
This gel shows a shaper resolution of the titin band as a doublet. This was a result we
were not expecting to see. Although the Vertical Agarose Gel Electrophoresis does
provide for a better resolution a doublet band should not appear unless there was a post
translational modification that occurred or due to sample age and repeated thawing and
freezing partial proteolysis occurred.
Next a two dimensional gel electrophoresis was performed using the glutathione
affinity purified GST-titin N2-A domain fusion protein to confirm the pI and use the
spots for future MSMS studies. Two dimensional gel electrophoresis is a technique
that separates and identifies proteins using two dimensions oriented at right angles to
each other. It uses two different physical properties. In the first dimension or
isoelectric focuses for separation of proteins on their net charge. The second dimension
or SDS-PAGE separates the protein by mass so it is rare that two different proteins will
82
resolve to the same place in both dimensions. The 2DGE was performed but the
protein quantity was not sufficient to run the test in triplicate to confirm results and a
clear distinct pattern was not observed. We were not expecting these results but due to
repeat freeze and thawing of the sample it must have degraded. Perhaps future studies
in our laboratory could perform more 2DGE analysis.
Figure 10: Vertical Agarose Gel Electrophoresis of the Glutathione Affinity
Purified GST-titin N2-A domain fusion protein. The first lane shown is
the glutathione affinity purified GST-rmmg6 titin N2-a domain fusion
protein. The red arrow indicates a sharper titin band resolution. The other
lane is homogenized human skeletal muscle sample that did not show the
clear concise band morphology of titin like the purified specimen. These
were the predicted results.
83
Confirmation of Antibody Reactivity
Western Blot studies were conducted on the ARMD antisera with the
G3RMMG6. Figure 11 is the result of Western Blot studies. On the left side of the
figure is the PVDF membrane stained with Coomassie Blue and the right side of the
figure is the autoradiograph of the Western Blot analysis. The PVDF membrane
demonstrates the ProSieve® Molecular Weight Standard and it does not show up on the
autoradiograph indicating there is not any immunoreactivity with the standard and the
ARMD antisera. The next lane was used as a control. The pGEX-3X is the next lane
on the PVDF membrane. It is not detected on the autoradiograph indicating that the
ARMD antisera is not immunoreactive to the pGEX-3X plasmid. The next lane on the
PVDF membrane is blank. The final lane on the PVDF membrane is the Titin N2-A or
the G3RMMG6. The PVDF membrane shows the immunoreactive Titin N2-A band
and the autoradiograph shows detection of chemiluminescence during the Western Blot
experiment. These results demonstrate that the ARMD antisera is immunoreactive with
the titin domain of the GST- titin N2-A fusion protein. The GST-titin N2-A fusion
protein needs to be used as a probe.
84
Figure 11: ARMD antisera is immunoreactive with the titin domain of the GST-
titin N2-A fusion protein. On the left side of this figure is the PVDF
membrane stained with Coomassie Blue and on the right is the
autoradiograph of the Western Blot analysis. The PVDF membrane shows
the ProSieve ® Molecular weight standard and it does not show up on the
autoradiograph. The next lane is the pGEX-3X control on the membrane
which is not detected on the autoradiograph. G3RMMG6 is right after the
blank lane. The PVDF membrane shows the immunoreactive Titin N2-A
band and the autoradiograph demonstrates the detection of
chemiluminescence during the western blot procedure. ARMD patient sera
is immunoreactive with the titin domain of the GST-titin N2-A fusion
protein.
85
Cellular Localization
Figure 12 is the Olmsted Affinity Purified Autoantibody from ARMD antisera
using immunofluorescent microscopy to tag the cellular localization of titin N2-A.
GST-titin N2-A fusion protein was run on an SDS-PAGE and blotted over to a PVDF
membrane to be used as a probe to purify the autoantibody out the serum of an ARMD
patient for immunofluorescent microscopy. This figure actually illustrates the
striational banding pattern in all three figures of the first lane. All three figures in lane
one are the same in lane two except that lane two figures were taken with the light
microscope. The striational banding pattern is seen with the light and fluorescent
microscope indicating that the GST- titin N2- A fusion protein cellular localization is in
the striational banding pattern. Lane 3 all 3 figures are immunofluorescent images of
controls. Lane 4 all 3 figures are the same as lane 3 except lane 4 is the light
microscope images. Lanes 3 does not illustrate the striational banding pattern that is
demonstrated in lane 1. In fact lane 3 controls do not demonstrate any pattern at all
only random immunofluorescence. This figure clearly demonstrates that the GST- titin
N2-A fusion protein’s cellular localization is a striational banding pattern.
86
LANE 1
IMMUNOFLUORESCENT
LANE 2
LIGHT MICROSCOPE
LANE 3 CONTROLS
IMMUNOFLUORESCENT
LANE 4 CONTROLS
LIGHT MICROSCOPE
Figure 12: Olmsted Affinity Purified Autoantibody from ARMD antisera using
immunofluorescent microscopy for cellular localization of titin N2-A:
The GST-titin N2-A fusion protein on a PVDF membrane was used as a
probe to purify the autoantibody from sera of an ARMD patient for
immunofluorescent microscopy demonstrating striational banding in the
first lane all 3 figures. Lane 2 all 3 figures are the same as lane 1 but using
a light microscope. Lane 3 all 3 figures are immunofluorescent images of
controls and lane 4 all 3 figures are the same as lane 3 only lane 4 using a
light microscope. Lane 3 and 4 images do not demonstrate any pattern at
all only random immunofluorescence.
87
Blast X Search
Figure 13 is a comparison figure of the cDNA region from exon 248 into exon
250 of the titin N2-A translated into protein. This is a figure of the Blast X search
showing that the ARMD immunogenic domain GenBank accession # EU428784 is
equivalent to the section spanning exon 248 – 250 of titin N2-A as designated by the
green color. The analogous residues are 50,093 – 50,747. This vicinity is composed of
fibronectin III domains. This is an area located inside of the A band section of the
sarcomere.
Figure 13: Sequence alignment of EU428487 indicates that the ARMD
immuunogenic domain corresponds to the region from exon 248 into
exon 250 of titin- N2-A. Blast X searches reveal that the ARMD
immunogenic domain (Gen Bank accession # EU428784) matches to the
area spanning exon 248 to exon 250 of titin N2-A as indicated by the
green color. The corresponding residues are 50,093-50,747. This region
consists of fibronectin III domains. This is a region located inside the A
band region of the sarcomere.
88
MS/MS Protein Sequence Analysis
Sequence analysis by MS/MS was performed on gel samples of the fusion
protein (GST-RMMG6) to confirm the titin domain RMMG6 of the recombinant GST
fusion protein is actually expressed. Figure 14 demonstrates the results from the OSU
MS analysis confirm the fusion protein contains peptide sequences that align with the
predicted human titin domain sequence that spans the exons 248 to 250 of the human
Titin gene. These protein sequences have alignment with the identical area of the titin
isoform N2-A. These peptide sequences cover 0.46 % of the total titin sequence and 74
% of the recombinant titin domain. This sequence has a Mascot numerical value of
772. Scores above 50 demonstrate a good quality sequence alignment determined by
the MS/MS. These peptide sequences matched an area of the glutathione –S-
Transferase with a Mascot score of 1053 and containing 52 % sequence coverage
indicating that the (GST-RMMG6) is in fact a portion of the human titin gene. These
results are the gold standard for protein identification.
89
Figure 14: Nano LC/Ms/MS analysis of gst-RMMG6 fusion protein. The top
portion of Figure 15 is the amino acid sequence of the fusion protein
fragments that show alignment with glutathione-S-transferase. The bottom
sequence is the amino acid sequence of the fusion protein fragments that
show alignment with the immunogenic region of the human titin N2-A
(numbers indicate amino acid position in the whole titin sequence).
90
CHAPTER IV
DISCUSSION
The classification of antibodies in autoimmune disease is essential to the
detection of dysfunctional cellular apparatuses leading to the detected indications of
autoimmune diseases. The effects of an autoimmune disease can be devastating or
even deadly in some cases such as autoimmune hemolytic anemia. My research
pertains to autoimmune rippling muscle disease and the pathology it causes with
skeletal muscle. My data described and characterized the autoantigen titin N2-A and
laid down the foundation for future studies to pinpoint the location within the myocyte.
Stephanie McCann a researcher in the laboratory used the RMMG6 DNA fragment and
inserted in the Green Fluorescent Protein and then placed it in the C2C12 myocyte to
pinpoint the exact location in the myocyte. Although I was unable to identify the
mechanism involved in creating the rippling symptom I characterized and located the
position on the titin peptide associated with ARMD. For the present time we will need
to conjecture on the phenomenon of the muscle ripple recognized in both the
autoimmune and genetic rippling muscle disease. It is possible that a cascade of events
is required to occur to invoke the ripple phenomena.
A suggested mechanism for genetic rippling muscle is hyperexcitability of the
myocyte via a caveolin-3 gene mutation. This CAV3 genetic mutation causes a
decrease in the manifestation of caveolin-3 protein and a proliferation in the
91
inducibility of nNOS (Vorgerd et al. 2001; Betz et al. 2001). Another theory speculates
the chromosomal localization at 1q42 initiating a deficient RyR role (Stephan et al.
1999; Hoffman et al. 1999; Koul et al. 2001). The defect in this RyR was mapped to
chromosomal loci 1q42 to 1q43 in a ventricular tachycardia patient. This location
corresponds to the RyR2 or cardiac RyR type 2 which causes tachycardia via long-QT
interval. This leads to a delayed repolarization in contraction of the cardiac muscle
(Laitinen et al, 2001). It may be possible for the muscle rippling in RMD to originate
from a similar defect like the one occurring in the cardiac muscle contraction
imperfection developing in arrhythmia.
Although the exact mechanism required for the rippling phenomena is unknown
currently my ARMD research has lead me to suggest a post-synaptic imperfection in
the muscle contraction. However it has been speculated that the muscle ripple
phenomena is triggered by a pre-synaptic derivation via hyperexcitability of the motor
neuron. An example of a hyperexcitable motor neuron would be Acquired
neuromyotonia or Isaac’s syndrome (Vernino et al. 1999). During a personal
communication with a board certified neurologist, Dr. Carl Ansevin, proposed the
description of pre/post synaptic line is because of a clinical debate regarding the
electromyography or EMG results of ARMD. Our laboratory decided to pursue post-
synaptic effects with autoantibodies because of the “electrical silence” on early results
of EMG’s on ARMD patients. After antigenic spread created muscle inflammation and
then EMG’s that were done seemed to be pre-synaptic. This allows EMG noise and
thus decreases the statement of “electrical silence.”
92
Previous Experimental Data in Our Laboratory
Our laboratory has conducted several experiments on ARMD research each
piece of the puzzle will eventually create a picture. During the screening of patient
serum to identify particular autoantigens conducted by Dr. Tom Watkins several
experiments were conducted. First, biochemical isolation of serum autoantigen
>200kDa by sub-cellular fractionation recognized a sub-cellular fraction which
demonstrated immunoblot positive for probable ARMD autoantigen as well as DHPR
and negative in controls (ex. Autoimmunity due to thymoma or MG) as well as RyR.
ARMD patient serum immunoprecipitate exclusive autoantigens from whole muscle
when equated with controls. ARMD patient serum autoantibodies complex antigens
accompanying in biomolecular coupled with DHPR. Immunoblots of sub-cellular
fractions of T-tubules and coimmunoprecipitation of ARMD autoantigen with anti-
DHPR antibodies, demonstrate autoantibodies to T-tubule specific antigens. ARMD
patient serum complexes high molecular weight antigens in rat and human skeletal and
cardiac muscle which supports the preservation of arrangement of muscle peptides
between species. The cardiac muscle immunoblots demonstrated immunoreactivity at
high molecular weight suggesting autoantibodies to a cardiac isoform of autoantigen.
ARMD patients have autoantibodies to skeletal muscle titin. There is confirmation of
antigenic spread with ARMD. The anti-titin antibodies are located outside of the MG/T
main immunogenic area of titin and could have an affect on muscle functioning.
Immunofluorescent microscopy was used to exhibit localization of ARMD
autoantigens. Distribution of immunoreactive autoantigens using ARMD sera
93
demonstrated a striated pattern of immunofluorescense corresponding to the striational
banding pattern seen with dihydropyridine receptor and ryanodine receptor implying
the presence of autoantibodies to the cellular location of the dihydropyridine and
ryanodine receptors (Walker et al. 1999, Watkins et al. 2006, Zelinka et al. 2011).
Plasmid pRMMG-4 from Dr. Watkins’s research indicated antigen spread. A
BLASTx sequence analysis search of this plasmid revealed a high degree of similarity
with the mitochondrial ATP synthase (subunit 6) (Mava-Meyer et al. 2001).
Mitochondria are closely linked to the sarcomere and T-tubules of skeletal muscle
leading us to believe that antigenic spread may have occurred. This information
reinforced the sub-cellular localization of immunoreactivity in Dr. Watkin’s research
(Watkins et al., 2006) and was in agreement with immunofluorescent localizations of
ARMD autoimmunity found in the I-band of human skeletal muscle (Zelinka 2002,
Zelinka et al. 2011).
Other past studies used antisera from MG and ARMD patients as probes to
screen a human skeletal muscle expression cDNA library producing multiple
pBluescript clones with immunoreactive peptides or polypeptide fragments that were
identified by ARMD antibodies (Watkins et al. 2006). Established on nucleotide
sequence analysis three separate ARMD antigens were classified: ATP synthase 6,
PPP1 R3 (protein phosphatase 1 regulatory subunit 3 and titin isoform N2A (One of the
major auto-antigens identified as a sarcomere cytoskeletal protein) (Watkins et al.
2006). Classical MG antibodies identify an expressed sequence analogous to the main
immunogenic region of titin also known as MIR. However, the sequence of titin
94
recognized by ARMD antisera is different from the MIR in fact it is the titin isoform
N2-A region. Currently the contrivance for antibody penetration is unknown. Other
studies have shown that rippling muscle disease antibodies do disturb the contractile
equipment of the sarcomere developing mechanical sensitivity. Contractions can
stimulated by mechanical activation evading the actual action potential or electrically
silent. Our laboratory is working under a hypothesis that auto-immune antibodies
complex to constituents of the sarcomere’s contractile- regulatory system which react
to mechano-stimulation resulting in a changed response.
Titin’s function as a regulator of muscle contractility marks it as a target to
comprehend muscle mechanosensitive control. Titin plays an essential role in anatomy
and physiology of all living creatures. When autoimmune diseases produce antibodies
to titin, the effects can be anywhere from mild to detrimental. My research illustrates
the products of subcloning the titin isoform N2-A immunoreactive domain from
ARMD sera into glutathione- S-transferase (GST) fusion vector (pGEX-3X) and the
succeeding fusion protein (Zelinka et al. 2011). The reason glutathione-S-transferase
(GST) was selected for synthesizing a recombinant protein with GST was to allow the
fusion protein to be easily constructed, induced, purified and characterized for
additional analysis. The origin of the cDNA (GenBank #EU428784) pG3RMMG6 was
clone #6 from the novel pBluescript library, now we refer to this plasmid as
pG3RMMG6.
Preliminary studies that were performed were necessary to confirm that the
pBluescript RMMG#6 from Dr. Watkins in fact did contain the RMMG#6 DNA insert.
95
A PCR was performed on pBluescript using M13 forward and reverse primers then a
DNA gel was run (Figure 1). A clear and concise band was detected on the DNA gel at
the 800 bp region. This PCR was prepared for DNA sequence analysis and confirmed
the 748 bp RMMG#6 DNA insert. It took several attempts to get the pBluescript
RMMG#6 to grow. Since the fragile condition of pBluescript RMMG#6 delayed this
process it required a vector transfer for long term storage.
Next, RMMG#6 DNA fragment was cut out of pBluescript by the restriction
enzyme EcoRI. Then RMMG#6 DNA fragment was cloned and transformed into
pCR®4-TOPO for long term storage and viability. An EcoRI restriction enzyme digest
was performed then a DNA gel was run (Figure 2). A clear and concise band was
identified on the DNA gel at the 700 bp region. Next the PCR was prepared for DNA
sequence analysis and confirmed the presence of the RMMG#6 DNA insert. These
results were expected and required to continue the research. Then the RMMG#6 DNA
fragment needed to be ligated into the pGEX-3X vector. First overnight cultures were
grown separately of pGEX-3X and pCR®4-TOPO RMMG#6. Then a restriction
enzyme digest was performed using EcoRI (Figure 3). The pGEX-3X and RMMG#6
DNA fragment from pCR®4-TOPO RMMG#6 were cut out of the DNA gel then gel
purified, ligated and transformed into competent host cells. Figure 4 demonstrates that
after the EcoRI restriction enzyme digest and DNA gel were accomplished the pGEX-
3X ligation to RMMG#6 was a success. One clone was found to contain the RMMG#6
insert and it is the third one on the DNA gel. Screening continued and when a total of 3
clones were found, DNA sequence analysis (Figure 5) was done to confirm the DNA
96
gel results and make sure the spatial orientation of the RMMG#6 DNA fragment
inserted properly into the pGEX-3X vector. These three clones were named
pGEX1RMMG6, pGEX2RMMG6 and pGEX3RMMG6. Figure 6 A is a DNA gel of
the PCR products of all three clones. Unexpected results occurred with G1RMMG6.
G1RMMG6 PCR product size was about 200 b. p. and DNA sequence analysis with
this clone has never been effective. G2RMMG6 and G3RMMG6 both include the
expected PCR product of 810 b. p. and match with the size based on DNA sequence
analysis, which is 831 b. p. On the right side of the figure 6 B is the restriction
endonuclease analysis of pGEX3RMMG6 or G3RMMG6. G3RMMG6 is consistent
with DNA sequence results. EcoR1 restriction enzyme analysis demonstrates the
G3RMMG6 molecular size of the RMMG6 insert at about 748 b. p. fragment, which
correlates to the expected value. The linearized pGEX-3X fragment is above the
molecular weight ladder at about 4900 b.p. and therefore cannot be used to correctly
determine the molecular size. EcoRV, BamHI and Hind III produce only a linearized
plasmid which is the expected result for the restriction endonuclease analysis.
After all of the restriction enzyme studies, DNA sequence analysis, ligation,
transformation and confirmations were done, the DNA sequence analysis information
was programmed into the computer using Genious, BLASTX and NCBI and used to
construct a virtual translation of the polypeptide sequence (Figure 7) and a plasmid map
(Figure 8). The virtual amino acid sequence analysis (Figure 7) was constructed by
transforming the nucleic acid sequence into an amino acid sequence to construct the
fusion protein (gst-rmmg6) encoded by the GST-RMMG6 gene. The conceptual
97
translation predicts the molecular weight of the protein to be 51,023 kDa. This is an
expected molecular weight for the fusion protein because the GST portion of the fusion
protein weighs 26 kDa alone. The N- terminal end of the polypeptide along with the
immunogenic titin domain (rmmg6) encompasses the C-terminal end weighing about
25 kDa. The conceptual translation also predicts the pI to be 5.95. This numerical
value for the pI was confirmed on the two dimensional gel electrophoresis.
The plasmid map of pGEX-3X containing the 748 b. p. cDNA insert RMMG6
was constructed on the computer. A blue arrow labeled EU 428784 shows the position
of the inserted RMMG6 immunoreactive domain is at the C- terminal end of the
glutathione- S- transferase. Also indicated by a blue arrow is the location of the LAC
repressor polypeptide. The purpose of the LAC repressor protein is so the carbohydrate
lactose disables the LAC I repressor to stimulate transcription of the Lac Z, Lac Y and
Lac A. Then the phosphorylated EIIA stimulates adenylate cyclase to transform ATP
to camp to complex the camp receptor protein (CRP) to activate transcription of the Lac
genes by binding to DNA near the lac promoter connected with polymerase to stabilize
polymerase binding to the promoter. The brown arrow in the plasmid map represents
beta lactamase enzyme. Beta lactamase hydrolyzes the beta lactam ring in the
ampicillin antibiotic rendering the ampicillin as useless. This allows the organism to be
selected by allowing it to grow on selected media containing ampicillin. The cDNA
translates into the GST- titin fusion protein that was expressed and glutathione affinity
purified GST- titin N2- A domain estimated weight is 50,747 kDa.
98
Finally, everything was right where it needed to be to start the induction of
protein expression with IPTG. After protein expression, the next step was Glutathione
Affinity purification. G3RMMG6 protein, encompassing the glutathione affinity tag to
adhere to the glutathione beads, the beads were washed, then the elution buffer was
applied to the beads to release the G3RMMG6 protein. G3RMMG6 protein was
collected and a SDS-PAGE run. Figure 9 shows the expressed and glutathione affinity
purified GST- titin N2-A domain fusion protein. The second lane contains multiple
bands at different molecular weights. This is what the unpurified glutathione- S-
transferase fusion protein construct looks like on the SDS-PAGE before purification.
The other lanes with one single band are glutathione affinity purified GST- titin N2-A
domain fusion protein fractions at 51,000 kDa. These results were analyzed based on
the molecular weight standard based on the SDS-PAGE mobility and Image J analysis
as well as protein sequencing. Since G3RMMG6 is 50,747 kDa and there is a single
band, G3RMMG6 has been purified. These results were expected and required in order
to characterize the G3RMMG6 protein. Now that G3RMMG6 was glutathione affinity
purified the next step was to test the immunoreactivity of G3RMMG6 with ARMD
antisera by Western Blot analysis.
The results of the Western Blot analysis are shown in Figure 11. The PVDF
membrane stained with Coomassie Blue is on the left side of Figure 11 and the
autoradiograph of the Western Blot analysis is on the right side of Figure 11. The
ProSieve® Molecular Weight Standard is not detected on the PVDF membrane
indicating that there is not any immunoreactivity between the ProSieve® Molecular
99
Weight Standard and the ARMD antisera. Also pGEX-3X is on the PVDF membrane
as a control. pGEX-3X plasmid is not detected on the autoradiograph designating that
the pGEX-3X control is not immunoreactive with the ARMD antisera. We were
hoping for these results but were unsure if the ARMD antisera would be
immunoreactive with the pGEX-3X plasmid or the ProSieve® Molecular Weight
Standard. Now we know for sure the immunoreativity detected is specific for the titin
N2-A domain of the GST- titin N2-A fusion protein or G3RMMG6. Now the GST-
titin N2-A fusion protein can be used as a probe to identify the cellular location in the
sarcomere of ARMD patient.
The Olmsted Affinity Purification Process was used to affinity purify the
autoantibody from ARMD antisera for cellular localization within the sarcomere Figure
12. This process used immunofluorescent microscopy to tag the cellular location of
titin N2-A. A SDS-PAGE of the N2-A fusion protein was run then blotted onto the
PVDF membrane. The PVDF membrane was cut around the band and then the band
incubated in the ARMD antisera to absorb the antibody out of the ARMD antisera and
bind to the N2-A fusion protein band on the PVDF membrane. Figure 12 demonstrates
the striational banding pattern in the first lane with all three figures. The figures in lane
one and lane two are the same except that in lane two these figures were taken with the
light microscope and the striational banding pattern is observed with both the light and
fluorescent microscope designating that the GST- titin N2-A fusion protein cellular
localization is in the striational banding pattern. In lane three all three figures are
immunofluorescent pictures of controls and lane 4 all the pictures are the same as lane
100
3 except that they are light microscope figures. Lane 3 does not show the striational
banding pattern that is shown in the lane 1 figures. The figures in lane 3 only
demonstrate random immunofluorescence. As expected the figure clearly illustrates
that the GST – titin N2- A fusion protein’s cellular localization is a striational banding
pattern consistent with the striational banding pattern of skeletal muscle and confirms
the immunogenicity of the autoantibody in ARMD antisera to the target muscle protein
titin isoform N2-A.
A comparison of the cDNA fragment from exon 248 into exon 250 of the titin
N2- A translated into a polypeptide. Figure 13 is a figure of the Blast X search
demonstrating the ARMD immunogenic region GenBank accession # EU 428784 is
identical to the region spanning exon 248 -250 of titin N2- A as indicated by the green
color. The corresponding residues are 50,093 – 50,747. This location is constituted of
fibronectin III domains. This region is located inside of the A band section of the
muscle cell.
Polypeptide computational analysis required confirmation by MS analysis.
Figure 14 is the sequence analysis results by MS/MS performed on gel samples of the
fusion protein (GST – RMMG6) to compare the titin domain RMMG6 of the
recombinant GST fusion protein is essentially expressed. The Ohio State University
MS analysis established that the fusion protein encompasses polypeptide regions that
match with the predicted human titin domain region spanning 248 – 250 of the human
titin gene. These results showed that the polypeptide sequences have alignment with
the same region of the titin isoform N2 – A. The coverage of these protein sequences is
101
0.46 % of the total titin sequence and 74 % of the recombinant titin domain. The
Mascot numerical score is 772 for the protein sequence. Mascot numerical values
greater than 50 designate a good quality sequence alignment determined by the MS /
MS. Also these polypeptide sequences corresponded to a region of the glutathione – S
– Transferase with a Mascot numerical value of 1053 and comprised 52 % sequence
coverage designating that the (GST – RMMG6) is in fact a percentage of the human
titin gene. These results are the cutting edge technology for protein identification and
confirm the actual protein sequence of the immunoreactive domain.
A function for autoantibodies in patients suffering from ARMD occurs in the
mechanosensitive muscle contractions (Ansevin and Agmanolis 1996; Watkins 1998;
Walker et al. 1999). In striated muscle tissue the purpose of titin is to deliver support
and elasticity for the muscle cell (Wang et el. 1985). However it is now known that the
function of titin within the muscle cell is more vigorous than initially reported. Titin is
intertwined with minK and T – cap in the association of the T – tubules and the Z- disk
in cardiac sarcomeres. The cardiac sarcomeres have a stretch – sensitive responsibility
in the potassium channel movement (Furukawa et al. 2001). The elastic PEVK
sequence is a negatively charged section of titin at the A / I boundary that could be
involved in calcium binding in uM quantities according to a study by Tatsumi et al.
2000. Another proposition was made about physiological purposes of titin are actually
facilitated by the binding of calcium (Kolmerer et al. 1996). A realization of the
complexity of titin’s function has aided in the classification of the “titinopathies” in the
skeletal muscles as well as the cardiac myocytes.
102
The gene coding for human skeletal muscle titin is TTN. TTN has been
chromosomally mapped to chromosome locus 2q31 (Labeit and Kolmerer 1995). Thus
far multiple striated muscle tissue diseases have been linked to this same chromosomal
locus. Furthermore experiments describing tibial muscular dystrophy (Udd et al. 1998)
associated the M – line titin imperfection to a 11 b.p. deletion / insertion genetic
mutation to the 2q31 chromosomal locus (Hackman et al. 2002). Titin genetic
mutations have caused dynamic results in cardiac muscle tissue. For example dilated
cardiomyopathy (DCM) was associated with a truncation genetic mutation causing
tissue remodeling as well as hypertrophy (Gerull et al. 2002; Hein and Schaper 2002).
Another example is hypertrophic cardiomyopathy (HCM) was linked to a titin missense
genetic mutation Arg740Leu with an increase in the fusion attraction of titin
complexing to alpha – actinin that may result in a functional modification (Satoh et al.
1999). Genetic mutations of the sarcomeric protein troponin T have developed in
hypercontractility of the cardiac sarcomeres. This demonstrates an effect from
conformational mutations in the cardiac myocyte associated with contraction (Bonne et
al. 1998).
A drosophila cDNA library was screened using the sera from scleroderma
patients and the antibodies recognized a drosophila titin homologue that could be
involved in chromosome assembly (Machado et al. 1998). Also titin has been
designated as an autoantigen in patients with both scleroderma and MG / Thymoma. A
main immunogenic region (MIR) of the striated skeletal muscle titin was described
(Gautel t al. 1993). The MIR sequence actually is located at the A / I junction of
103
human skeletal muscle. Antigenic spread has been identified by the additional epitopes
that were recognized (Gautel et al. 1993). About 95 % of MG / Thymoma patients
produce autoantibodies to the MIR sequence, however, a pathogenic potential has not
been identified (Skeie 2000). Our laboratory data suggests a location of
immunoreactivity just outside titin’s MIR region in patients with ARMD.
There are exclusive modifications in genes that code for AChR subunits
developing in myasthenic syndromes (Engel et al. 1998). Neuromuscular
symptomology is correlated to modifications with indications triggered by an
autoimmune response. Similar symptoms are expressed in genetic RMD in comparison
with ARMD and are due to different origins. Genetic RMD demonstrates
heterogeneity (Vorgerd et al. 1999; So et al. 2001) which was genetically mapped to
loci 1q41-42 (Stephan and Hoffman 1999) and just recently it was also genetically
mapped to 3p25. The genetically mapped location to 3p25 is also correlated to a
modification in the caveolin- 3 and is suspected to have an association in rippling
(Vorgerd et al., 2001). The alteration in the caveolin – 3 is of interest because
observations that mutual mutations within caveolin – 3 are associated with RMD (Betz
et al., 2001; Vorgerd et al., 2001), hyperCK – emia (Carbone et al. 2000) and limb
girdle muscular dystrophy 1C (LGMD – 1C) (Herrmann et al. 2000), therefore
recommending further constituents or connections with caveolin – 3 developing in
these distinctive disorders due to their distinct symptoms.
The occurrence of autoantibodies to a portion of the fragments of titin in our
ARMD patients insinuates the prospect of a function for anti – titin antibodies in
104
patients with ARMD even though there is not a concise comprehension of the cellular
effects of anti-titin antibodies. Experiments have established that autoantibodies cross
the plasma cell membrane in different living cell types such as neurons, fibroblasts,
epithelial cells and other cells (Alarcon-Segovia et al. 1996). Other experiments
performed by (Ma et al. 1987) used a method called flow cytometry to tag antibodies
that can enter viable lymphocytes. This demonstrates that antibodies can enter viable
lymphocyte cells. Knowing this theory makes it possible that intracellular
autoantibodies to titin enter the skeletal muscle fiber and affect the contractility of
muscle cells. Therefore the determination of the presence and location of anti-titin
autoantibodies requires certain evidence for their possible pathogenesis in ARMD.
Also identification of titin as an autoantigen allowed me and other laboratory members
to diagnostically scrutinize all recommendations of titin with other sarcomeric and
cellular proteins.
Previous experimental data demonstrated an area of homology between two
immunoreactive cDNAs and obscurin (GenBank accession number CAC44768), a
member of a family of giant sarcomeric signaling molecules that show an association
with G- protein regulated pathways (Bang et al. 2001; Young et al. 2001). Additionally
the chromosomal position of obscurin is 1q42 (Young et al. 2001) is the exact site as a
known mutation that was found in families with the genetic form of RMD (Stephan and
Hoffman 1999). This might insinuate a fascinating association between autoantibody-
stimulated mechanosensitivity in ARMD as well as the genetic form of RMD. Another
giant sarcomeric protein is obscurin weighing in at about (800 kDa). Obscurin and titin
105
complex with each other in the muscle cell in order to aid in the collaboration of the
myofibril with other portions of the sarcomere. Another essential connection of
obscurin is with ankryin. Ankryin is a sarcoplasmic reticulum resident protein this
designates a function for obscurin linking the sarcomere with the sarcoplasmic
reticulum (Bagnato et al., 2003). Our previous laboratory experiments show BLASTx
analysis of cDNA sequences of ARMD patients with autoantibodies to titin and
conceivably to obscurin by cDNA sequence analysis. This gives rise to the thought that
autoantibodies could possibly affect the sarcoplasmic reticulum through this
association. Additional confirmation connecting a function for autoantibodies and
obscurin comes from characterization of its constituent domains. Like titin, obscurin is
assembled from repeating FN3 and Ig domains (Young et al. 2001). It is speculated
that the homology detected between immunoreactive “titin-like” sequences and
obscurin is a result of these combined domains. Keeping this in mind, an additional
suggestion that sharing of epitopes between obscurin and titin may lead to cross
reactivity of the autoantibodies. Coherent with this recommendation it was
demonstrated by our laboratory that two titin- like cDNAs have homology with the
FN3 domain.
Inferred immunoreactivity occurs outside the MG/T MIR region based on the
positional computation of alignments between the immunoreactive cDNAs and titin
isoform N2- A (GenBank accession numbers NP596869 and EU428784). Therefore
the implication of the presence of autoantibodies to titin may have an exclusive
pathogenic effect. Experiments conducted on a population of patients with MG/T years
106
ago identified autoantibodies to titin in the main immunogenic region (MIR) (Gautel et
al. 1993). It was previously demonstrated and confirmed by my results that our
sequences were outside of the conventional MIR. Alignments were performed
previously and confirmed by me by BLASTx between the published sequence of the
titin MIR (GenBank accession number AAB28119) and the N2- A titin sequence
(GenBank accession number NP596869 and EU428784). The alignment of the titin
MIR corresponding to titin isoform N2- A occurs between amino acids14257 through
14543. Previously in our laboratory the cDNA library was screened with MG/T patient
antisera (patient 10) and an immunoreactive cDNA clone was found that showed
homology with titin within the MIR sequence (Mathew Kesic personal
communication). This information allows for the possibility that there may be a
function for the autoantibodies that bind titin in the area outside the MIR in patients
with ARMD.
In general, ARMD autoantibodies happen to complex the skeletal muscle titin in
an area exterior to the MIR signifying a conceivable function for the titin
autoantibodies in ARMD. It may actually be the binding of titin autoantibodies to an
exclusive sequence of human skeletal muscle titin may actually be responsible for the
rippling muscle symptoms in ARMD by increasing the muscle’s capacity to contract in
response to mechanical stimuli. Presently several experiments demonstrate that cardiac
muscle tissue titin is sensitive to mechanical stress as a result of genetic mutations,
affecting arrhythmia and hypertrophy. Perhaps the autoantibodies to skeletal muscle
tissue may cause an abnormality such as a muscle ripple.
107
Different mutations in the same protein can cause diverse symptoms in
neuromuscular disorders. The CAV3 can be used as an example to demonstrate
mutations in different portions of caveolin- 3 result in either LGMD or genetic rippling
muscle disease. Our laboratory has a theory that the there is a possibility for
autoantibodies that can cross the cellular membrane to cause an affect on cellular
processes. In a study conducted by Alarcon-Segovia et al., (1996), some of the cellular
antibodies have been found intracellularly bound to their corresponding autoantigens.
In 2001 an experiment conducted by Skeie et al., (2001) discovered that autoantibodies
to RyR may inhibit the RyR channel dynamics in vivo and may even have a function in
severe MG. In Diagram 6 a probable mechanism for the in vivo effect of
autoantibodies to the skeletal muscle titin is proposed. Positional analysis performed
between immunogenic peptides encoded by cDNAs isolated from the cDNA library
and their positions of distinctiveness with skeletal muscle titin may be used to suggest
that there may be an effect on the extensible PEVK region of the polypeptide
(Guttierez-Cruz et al. 2001). This area is directly linked with passive stiffness and this
region is near a calcium binding segment in the I-band (Tatsumi et al. 2001). Calcium
is a crucial binding partner of titin. Recently the stiffness of the PEVK and other
extensible areas of titin were shown to be controlled by the calcium concentration
(Nocella et al. 2012). Calcium also controls titin’s placement during sarcomerogenesis
and if calcium transients are blocked, the sequence of actin and myosin is
compromised. Calcium activates the C-terminal kinase domain of titin.
108
Diagram 6: Diagram of the position of ARMD autoantibody binding on skeletal
muscle titin. The PEVK region and a 400-kDa Ca2+
binding sequence are
outside of the MIR. Boxed insert shows the region of autoimmunity.
Based on positional analysis of cDNA alignments with titin isoform N2-A
(GenBank accession number NP596869). Source: Watkins, TC. The
application of biochemical and genomic techniques to identify
autoimmune rippling muscle disease antigens [dissertation]. [Kent, (OH)]:
Kent State University; 2004. 140 p. Available from: Kent State
University, Special Collections.
This kinase domain initially subsides in the forming Z- band during sacomerogenesis,
thus, it has been suggested that titin’s connections with the thin filament are calcium
109
transient dependent (Harris et al. 2005). Telethonin or T- cap, a Z – band protein has
an extremely strong association with Z – band area of titin. A ligand of telethonin is
the transcriptional coactivator muscle LIM. In fact it is speculated that the Z-band titin,
Z- band T-cap and LIM make a sarcomeric mechanosensor complex, but the real nature
of this complex remains unknown (Kruger et al. 2011). Future research in our
laboratory may perhaps determine if autoantibodies to these areas have a function in
ARMD.
Recent experimental research in our laboratory conducted by Stephanie
McCann successfully constructed a fusion plasmid using the pGEXRMMG6. She
genetically engineered the RMMG6 immunogenic titin domain into pAcGFP1-C1. It is
now called RMMG#6/pAcGFP1-C1 fusion plasmid. The pAcGFP1-C1 attaches the
RMMG#6 immunogenic titin domain to a green fluorescent protein (McCann 2011).
Also Stephanie McCann has effectively transfected C2C12 mouse myoblasts
with the fusion plasmid RMMG#6/pAcGFP1-C1. Her work will lay down the
foundation for future research to track the immunogenic titin domain for localization
within the sarcomere in order to monitor alterations in cell differentiation, protein
expression, and cell development by over expression of the titin immunogenic domain.
Hopefully Stephanie McCann’s research will allow our laboratory to
quantitatively track specific immunogenic titin domain synthesis within the C2C12
mouse myoblasts in vitro during differentiation. Her hypothesis is that if the RMMG#6
titin immunogenic domain is over-expressed in developing C2C12 mouse myoblasts
then a distorted maturity of mytotubes should occur during myogenesis.
110
REFERENCES
Abicht A, Lochmuller H. What's in the serum of seronegative MG and LEMS? MuSK
et al. Neurology. 2002; 59(11):1672-1673.
Alarcon-Segovia D, Ruiz-Arguelles A, Lorente L. Broken dogma: penetration of
Autantibodies into living cells. Immunol Today. 1996; 17(4): 163-164.
Ansevin CF. Rippling muscles and myasthenia gravis: a stretch activated
channelopathy? Neuromuscul Disord. 1996; 6 (Suppl):S60.
Ansevin CF, Agamanolis DP. Rippling muscles and myasthenia gravis with rippling
muscles. Arch Neurol. 1996; 53(2):197-199.
Bagnato P, Barone V, Giacomello E, Rossi D, Sorrentino V. Binding of an ankyrin-1
isoform to obscurin suggests a molecular link between the sarcoplasmic
reticulum and myofibrils in striated muscles. J Cell Biol. 2003; 160(2):245-253.
Bang ML, Centner T, Fornoff F, Geach AJ, Gotthardt M, McNabb M, Witt CC, Labeit
D, Gregorio CC, Granzier H, Labeit S. The complete gene sequence of titin,
expression of an unusual approximately 700-kDa titin isoform, and its
interaction with obscurin identify a novel Z-line to I-band linking system. Circ
Res. 2001; 89(11):1065-72.
Barinaga M. Titanic protein gives muscles structure and bounce. Science. 1995;
270(5234): 23.
111
Bartoccioni E, Scuderi F, Scoppetta C, Evoli A, Tonali P, Guidi L, Bartoloni C,
Terranova T. Myasthenia gravis, thymectomy, and antiacetlycholine receptor
antibody. J Neurol. 1980; 224(1):9-15.
Beckman Coulter® Genome Lab™ Dye Terminator Cycle Sequencing with Quick Start
Kit. September 2004. p. 1-2
Bers DM, Fill M. Coordinated feet and the dance of ryanodine receptors. Science.
1998; 281(5378):790-791.
Betz R, Schoser, BGH, Kasper D, Ricker K, Ramirez A, Stein V, Torbergsen T, Lee,
YA, Nothen MM, Weinker TF, et. al. Mutations in CAV3 cause mechanical
hyperirritability of skeletal muscle in rippling muscle disease. Nat Genet. 2001;
28(3):218-219.
Bonne G, Carrier L, Richard P, Hainque B, Schwartz K. Familial hypertrophic
cardiomyopathy: from mutations to functional defects. Circ Res.1998;
83(6):580-93.
Brandt NR, Caswell AH, Brunschwig JP, Kang JJ, Antoniu B, Ikemoto N. Effects of
anti-triadin antibody on Ca2+
release from sarcoplasmic reticulum. FEBS Lett.
1992; 299(1):57-9.
Brenman JE, Chao DS, Xia H, Aldape K, Bredt DS. Nitric oxide synthase complexed
with dystrophin and absent from skeletal muscle sarcolemma in Duchenne
muscular dystrophy. Cell. 1995; 82(5):743-752.
112
Burns RJ, Bretag AH, Blumbergs PC, Harbord MG. Benign familial disease with
muscle mounding and rippling. J Neurol Neurosurg Psychiatry. 1994; 57(3):
344-347.
Carbone I, Bruno C, Sotgia F, Bado M, Broda P, Masetti E, Panella A, Zara F,
Bricarelli FD, Cordone G, Lisanti MP, Minetti C. Mutation in the CAV3 gene
causes partial caveolin-3 deficiency and hyperCKemia. Neurology. 2000;
54(6):1373-6.
Cohn RD, Campbell KP. Molecular basis of muscular dystrophies. Muscle Nerve. 2000;
23(10):1456-71.
De Paula F, Vainzof M, Bernardio ALF, McNally E, Kunkel LM, Zatz M. Mutations in
the caveolin-3 gene: when are they pathogenic? Am J Med Genet. 2001;
99(3):303-307.
Dotti MT, Malandrini A, Gambelli S, Salvadori C, De Stafano N, Federico A. A new
missense in caveolin-3 gene causes rippling muscle disease. J Neurol Sci. 2006;
243(1-2):61-64.
Drachman DB. Myasthenia gravis. N Engl J Med. 1994; 330: 1769-1797.
Engel AG, Ohno K, Sine SM. Congenital myasthenic syndromes: experiments of
nature. J Physiology Paris. 1998; 92(2):113-117.
Fisher D, Schroers A, Blumcke I, Urbach H, Zerres K, Mortier W, Vorgerd M,
Schroder R. (2003) Consequences of a novel caveolin-3 mutation in a large
German family. Ann Neurol. 2003; 53(2):233-241.
113
Franco-Obregon, Jr. A, Lansman JB. Mechanosensitive ion channels in skeletal muscle
from normal and dystrophic mice. J Physiol. 1994; 481(Pt 2):299-309.
Freiburg A, Trombitas K, Hell W, Cazorla O,Fougerousee F, Centner T, Komerer B, Witt
C, Beckmann JS, Gregorio CC, et al. Series of exon-skipping events in the events
in the elastic spring region of titin as the structural basis for myofibrillar elastic
diversity. Circulation. (2000); 86(11):1114-1121.
Furukawa T, Ono Y, Tsuchiya H, Katayama Y, Bang ML, Labeit D, Labeit S, Inagaki
N, Gregorio CC. Specific interaction of the potassium channel beta-subunit
minK with the sarcomeric protein T-cap suggests a T-tubule-myofibril linking
system. J Mol Biol. 2001; 313(4):775-84.
Galbiati F, Volonte D, Minetti C, Chu JB, Lisanti MP. Phenotypic behavior of
caveolin- 3 mutations that cause autosomal dominant limb girdle muscular
dystrohpy (LGMD-1C). J Biol Chem. 1999; 274:25632-25641.
Galbiati F, Engleman JA, Volonte D, Zhang XL, Minetti C, Li M, Hou, Jr. H, Kneitz B,
Edelmann W, Lisanti MP. Caveolin – 3 null mice show a loss of caveolae,
changes in the microdomain distribution of the dystrophin - glycoprotein
complex, and t- tubule abnormalities. J Biol Chem. 2001; 276:21425-21433.
Gautel M, Lakey A, Barlow DP, Holmes Z, Scales S, Leonard K, Labeit S, Mygland A,
Gilhus NE, Aarli JA. Titin antibodies in myasthenia gravis: identification of a
major immunogenic region of titin. Neurology. 1993; 43(8):1581-5.
114
Gerull B, Gramlich M, Atherton J, McNabb M, Trombitas K, Sasse-Klaassen S,
Seidman JG, Seidman C, Granzier H, Labeit S, Frenneaux M, Thierfelder L.
(2002) Mutations of TTN, encoding the giant muscle filament titin, cause
familial dilated cardiomyopathy. Nat Genet. 2002; 30(2):201-204.
Grabner M, Dirksen RT, Beam KG. Skeletal dihydropyridine receptor Ca2+
channel
activity is enhanced by the ryanodine receptor via the channel’s II-III loop.
Biophys J. 1998; 74(2 Pt 2):A165.
Granzier, HL, Wu Y, Trombitas K, Wit TC, Labeit S, Bell S, LeWinter M. Variable
titin-based stiffness adjustment in heart disease. Circulation 2003; 108(4): e23.
Greaser ML, Berri M, Warren CM, Mozdziak PE. Species variations in cDNA
sequence and exon splicing patterns in the extensible I-band region of cardiac
titin: relation to passive tension. J Muscle Res Cell Motil. 2002; 23(5-6): 473-
482.
Guharay F, Sachs F. Stretch activated single ion channel currents in tissue-cultured
embryonic chick skeletal muscle. J Physiol. 1984; 352(1):685-701.
Gutierrez-Cruz G, Van Heerden AH, Wang K. Modular motif, structural folds and
affinity profiles of PEVK segment of human fetal skeletal muscle titin. J Biol
Chem. 2001; 276(10):7442-7449.
Hackman P, Vihola A, Haravuori H, Marchand S, Sarparanta J, De Seze J, Labeit,
S,Witt C, Peltonen L, Richard I, Udd B. Tibial muscular dystrophy is a
titinopathy caused by mutations in TTN, the gene encoding the giant skeletal-
muscle protein titin. Am J Hum Genet. 2002; 71(3):492-500.
115
Hamill, OP, McBride Jr. Don W. Mechanoreceptive Membrane Channels. Am Sci.
1995; 83:30-37.
Harris BN, Li H, Terry M, Ferrari MB. "Calcium Transients regulate Titin Organization
during Myofibrillogenesis" Cell Motil Cytoskeleton. 2005; 60:129-139.
Hein S, Schaper J. Weakness of a giant: mutations of the sarcomeric protein titin.
Trends Mol Med. 2002; 8(7):311-3.
Herrmann R, Straub V, Blank M, Kutzick C, Franke N, Jacob EN, Lenard HG, Kroger
S, Voit T. (2000) Dissociation of the dystroglycan complex in caveolin-3-
deficient limb girdle muscular dystrophy. Hum Mol Genet. 2000; 9(15):2335-
2340.
Hoffman EP, Knudson CM, Campbell KP, Kunkel LM, Nature. 1987; 330(6150):754-
758.
Jusic A. Hereditary increased muscle mechanical irritability and progressive
contracture with stretch-induced electromyographic activity. Muscle Nerve.
1989; 12(2):103-107.
Kimball JW. Introduction to Immunology. 3rd
ed. New York: Macmillan; 1990.
Kolmerer B, Olivieri N, Witt CC, Herrmann BG, Labeit S. Genomic organization of M
line titin and its tissue-specific expression in two distinct isoforms. J Mol Biol.
1996; 256(3):556-563.
Koul RL, Chand RP, Chacko A, Ali M, Brown KM, Bushnarmuth SR, Escolar DM,
Stephan DA. Severe autosomal recessive rippling muscle disease. Muscle
Nerve. 2001; 24(11):1542-1547.
116
Knudson CM. Evidence for the association of dystrophin with the transverse tubular
system in skeletal muscle. J Biol Chem. 1988; 263(17):8480-8484.
Kravitz L. Web page. [Internet]. Albuquerque (NM): University of New Mexico; [date
unknown]. One screen from listing of media pages. Available from:
http://www.unm.edu/~lkravitz/MEDIA2/Sarcomere.jpg.
Kruger M; Linke WA. The giant protein titin: a regulatory node that integrates myocyte
signaling pathways” J Biol Chem. 2001; 276(13):9905-9912.
Kubisch C, Schoser BG, von During M, Betz RC, Goebel HH, Zahn S, Ehrbrecht A,
Aasly J, Schroers A, Popovic N, et al. Homozygous mutations in caveolin-3 cause
a severe form of rippling muscle disease. Ann Neurol. 2003;53(4):512–520.
Labeit S, Kolmerer B. The complete primary structure of human nebulin and its
correlation to muscle structure. J Mol Biol. 1995; 248(2):308-315.
Labeit, S, Kolmerer, B, Linke, WA. The giant protein titin. Emerging roles in physiology
and pathophysiology. Circ Res, 1997; 80(2):290-294.
Laitinen PJ, Brown KM, Piippo K, Swan H, Devaney JM, Brahmbhatt B, Donarum EA,
Marino M, Tiso N, Viitasalo M, Toivonen L, Stephan DA, Kontula K.
Mutations of the cardiac ryanodine receptor (RyR2) gene in familial
polymorphic ventricular tachycardia. Circulation 2001; 103(4):485-490.
Lamb GD. Excitation-contraction coupling in skeletal muscle: comparisons with
cardiac muscle. Clin Exp Pharmacol Physiol. 2000; 27(3):216-224.
Lamb GD. Rippling Muscle Disease may be caused by “silent” action potentials in the
tubular system of skeletal muscle fibers. Muscle Nerve 2005; 31(5):652-658.
117
Lennon VA, Kryzer TJ, Griesman GE, O’Suilleabhain PE, Windebank AJ, Woppmann
A, Miljanich GP, Lambert EH. (1995) Calcium channel antibodies in the
Lambert-Eaton myasthenic syndrome and other paraneoplastic disorders. N
Engl J Med. 1995; 332(22):1467-1471.
Ma JA, Chapman GV, Chen SL, Penny R, Breit SN. Flow cytometry with crystal violet
to detect intracytoplasmic fluorescence in viable human lymphocytes:
Demonstration of antibody entering living cells. J Immunol Methods. 1987;
104(1-2): 95-200.
Machado C, Sunkel CE, Andrew DJ. Human autoantibodies reveal titin as a
chromosomal protein. J Cell Biol. 1998; 141(2):321-333.
Marty I, Robert M, Villaz M. Biochemical evidence for a complex involving
dihydropyridine receptor and ryanodine receptor in triad junctions of skeletal
muscle. Proc Natl Acad Sci. 1994; 91(6):2270-2274.
Maruyama K, Murakami F, Ohashi K. Connectin, an elastic protein of muscle. J
Biochem. 1977; 82(2):339-45.
Maruyama K. beta-Actinin, Cap Z, connectin and titin: what’s in a name? Trends
Biochem Sci. 2002; 27(5):264-266.
Marx S, Ondrias K, Marks A. Coupled gating between individual skeletal muscle Ca2+
release channels (ryanodine receptors). Science. 1998; 281(5378):818-822.
Mayans O, van der Ven PFM, Wilm M, Mues A, Young P, Furst, DO, Wilmanns M,
Gautel M. (1998). Structural basis for activation of the titin kinase domain
during myofibrillogenesis. Nature. 1998; 395(6705):863-869.
118
McCann SM. 2011. Domain specific over-expression of a peptide encoded by an I-band
domain of the human TTN gene; the role of titin exons 248 – 250 in C2C12
myogenesis [master’s thesis]. Youngstown, Ohio: Youngstown State
University. Available from: Maag Library; Thesis no. 1302.
Minetti C, Sotgia F, Bruno C, Scartezzini P, Broda P, Bado M, Masetti E, Mazzocco M,
Egeo A, Donati MA, Volonte D, Galbiati F, Cordone G, Bricarelli FD, Lisanti
MP, Zara F. Mutations in the caveolin-3 gene cause autosomal dominant limb-
girdle muscular dystrophy. Nat Genet/ 1998; (18):365-368.
Minetti C, Baldo M, Broda P, Sotia F, Bruno C, Galbiati F, Volonte D, Lucania G,
Pavan A, Bonilla E, Lisanti MP, Cordone G. Impairment of caveolae formation
and T- system disorganization in human muscular dystrophy with caveolin- 3
deficiency. Am J Pathol. 2002; 160(1):265-270.
Mouton J, Ronjat M, Jona I, Villaz M, Feltz A, Maulet Y. Skeletal and cardiac
ryanodine receptors bind to the calcium sensor region of dihydropyridine
receptor alpha 1 c subunit. FEBS Lett. 2001; 505(3):441-444
Muhle-Goll C, Habeck M, Cazorla O, Nilges M, Labeit S, Granzier H. Structural and
functional studies of titin’s fn3 modules reveal conserved surface patterns and
binding to myosin S1--a possible role in the Frank-Starling mechanism of the
heart. J Mol Biol. 2001; 313(2):431-47.
Muller-Felber W, Ansevin, CF, Ricker K, Muller-Jenssen A, Topfer M, Goebel HH,
Pongratz DE. Immunosuppressive treatment of rippling muscles in patients with
myasthenia gravis. Neuromuscul Disord. 1999; 9(8):604-607.
119
Mygland A, Aarli JA, Hofstad H, Gilhus NE. Heart muscle antibodies in myasthenia
gravis. Autoimmunity 1991; 10(4):263-7.
Mygland A. Ryanodine Receptor autoantibodies in myasthenia gravis patients with a
thymoma. Ann Neurol. 1992; 32(4):589-591.
Mygland A, Aarli JA, Matre R, Gilhus NE. Ryanodine receptor antibodies related to
severity of thymoma associated myasthenia gravis. J Neurol Neurosurg
Psychiatry. 1994; 57(7):527-531.
Mygland A, Vincent A, Newsome-Davis J, Kaminski H, Zorzato F, Agius M, Gilhus N,
Aarli JA. Autoantibodies in thymoma associated myasthenia gravis with
myosistis or neuromyotonia. Arch Neurol. 2000; 57(4):527-531.
Nakai J, Dirksen R, Nguyen H, Pessah I, Beam K, Allen P. Enhanced dihydropyridine
receptor channel activity in the presence of ryanodine receptor. Nature. 1996;
380(6569):72-75.
Nocella M, Colombini B, Bagni MA, Bruton J; Cecchi G. (2012). Non-crossbridge
calcium dependent stiffness in slow and fast skeletal muscle fibres from mouse
muscle. J Muscle Res Cell Motil. 2012; 32(6):403-409.
Ohlendieck K, Matsumura K, Ionasescu VV, Towbin JA, Bosch EP, Weinstein SL,
Sernett SW, Campbell KP. Duchenne muscular dystrophy: deficiency of
dystrophin-associated proteins in the sarcolemma. Neurology. 1993; 43(4):795-
800.
120
Ohta M, Ohat K, Itoh N, Kurobe M, Hayashi K, Nishitani H. Anti-skeletal muscle
antibodies in the sera from myasthenic patients with thymoma: identification of
Anti-myosin, Actomyosin, Actin, alpha-actin antibodies by solid-phase
radioimmunoassay and Western Blot analysis. Clin Chim Acta. 1990;
187(3):255-264.
Pagala MKD, Nandakumar NV, Venkatachari SAT, Ravindran K, Namba T, Grob D.
Responses of intercostals muscle biopsies from Normal subjects and patients
with myasthenia gravis. Muscle Nerve. 1990; 13(11):1012-1022.
Parton RG, Way M, Zorzi N, Stang E. Caveolin – 3 associates with developing T-
tubules during muscle differentiation. J Cell Biol. 1997; 136(1):137-154.
QIAGEN® Plasmid Purification Handbook. [place unknown]: ; January 1997Protocol:
Plasmid or Cosmid DNA Purification Using QIAGEN Plasmid Mini and Maxi
Kits. January 1997; 14-17.
QIAprep® Miniprep handbook. Protocol: Plasmid DNA Purification Using the
QIAprep Spin Miniprep Kit and a Microcentrifuge. December 2006; 22-23.
Ricker K, Moxley RT, Rohkamm R. Rippling Muscle Disease. Arch Neurol. 1989;
46(4):405-408.
Rief M, Gautel M, Oesterhelt F, Fernandez JM, Gaub HE. Reversible unfolding of
individual titin immunoglobulin domains by AFM. Science. 1997;
276(5315):1109- 1112.
121
Satoh, M., Takahashi M, Sakamoto T, Hiroe M, Marumo F, Kimura A. Structural
analysis of the titin gene in hypertrophic cardiomyopathy: identification of a
novel disease gene. Biochem Biophys Res Commun. 1999; 262(2):411-7.
Scott KA, Steward A, Fowler SB, Clarke J. Titin; a multidomain protein that behaves
as the sum of its parts. J Mol Biol. 2002; 315(4):819-29.
Skeie GO, Bartoccioni E, Evoli A, Aarli JA, Gilhus NE. Ryanodine receptor antibodies
are associated with severe myasthenia gravis. Eur J Neurol. 1996; 3(2):136-140.
Skeie GO. Skeletal muscle titin: physiology and pathophysiology. Cell Mol Life Sci.
2000; 57(11):1570-1576.
Skeie GO, Lunde PK, Sejersted OM, Mygland A, Aarli JA, Gilhus NE. Autoimmunity
against the ryanodine receptor in myasthenia gravis. Acta Physiol Scand. 2001;
171(3):379-84.
So YT, Zu L, Barraza C, Figueroa KP, Pulst SM. Rippling muscle disease: evidence for
phenotypic and genetic heterogeneity. Muscle Nerve. 2001; 24(3):340-344.
Sokabe M, Hasegawa N, Yamamori K. Blockers and Activators for Stretch-Activated
Ion Channels of Chick Skeletal Muscle. Ann N Y Acad Sci. 1993; 707:417-420.
Sotgia F, Minetti C, Lisanti MP. Localization of the human caveolin-3 gene to the
D3S18/D3S4163/D3S4539 locus (3p25), in close proximity to the human
oxytocin receptor gene, Identification of the caveolin-3 gene as a candidate for
deletion in 3p-syndrome. FEBS Lett. 1999; 452(2):177-180.
122
Sotgia F, Lee JK, Das K, Bedford M, Petrucci TC, Macioce P, Sargiacomo M,
Bricarelli FD, Minetti C, Sudol M, Lisanti M.P. Caveolin-3 directly interacts
with the C-terminal tail of beta-dystroglycan. J Biol Chem. 2000;
275(48):38048-38058
Stamler JS, Meissner G. Physiology of nitric oxide in skeletal muscle. Physiol Rev.
2001; 81(1):209-231.
Stephan DA. A rippling muscle disease gene is localized to 1q41: evidence for multiple
genes. Neurology. 1994; 44(10):1915-1920.
Stephan DA, Hoffman EP. physical mapping of the rippling muscle disease locus.
Genomics. 1994; 55(3):268-274.
Takamori M, Komai K, Iwasa K. Antibodies to calcium channel and synaptotagmin in
Lambert-Eaton myasthenic syndrome. Am J Med Sci. 2000; 319(4):204-208.
Tanabe T, Beam K, Brett A, Niidome T, Numa S. Regions of the skeletal muscle
dihydropyridine receptor critical for excitation-contraction coupling. Nature.
1990; 346(6284):567-569.
Tatsumi R, Maeda K, Hattori A, Takahashi K. Calcium binding to an elastic portion of
connectin/titin filaments. J Muscle Res Cell Motil. 2001; 22(2):149-62.
Tiso N, Stephan DA, Nava A, Bagattin A, Devaney JM, Stanchi F, Larderet G,
Brahmbhatt B, Brown K, Bauce B, Muriago M, Basso C, Thiene G, Danieli
GA, Rampazzo A. Identification of mutations in the cardiac ryanodine receptor
gene in families affected with arrhythmogenic right ventricular cardiomyopathy
type 2 (ARVD2). Hum Mole Genet. 2001; 10(3):189-94.
123
Tortora GJ, Grabowski SR. Principles of anatomy and physiology. New York: Harper
Collins College Publishers; 1993. p. 241-250.
Torbergsen T. A family with dominant hereditary myotonia, muscular hypertrophy and
increased muscular irritability, distinct from myotonia congenital. Acta
Neurology Scand. 1975; 51(3):225-232.
Torbergsen T. Rippling muscle disease: a review. Muscle Nerve Suppl. 2002; (Supp
11):S103-107.
Trinick J. Understanding the functions of titin and nebulin. FEBS Lett. 1992; 307(1):44-
48.
Trinick J, Tskhovrebova L. Titin: a molecular control freak. Trends Cell Biol. 1999;
9(10):377-80.
Trombitas K, Greaser M, Labeit S. Titin extensibility in situ: entropic elasticity of
permanently folded and permanently unfolded molecular segments. J Cell Biol.
1998; 140(4):853-859.
Udd B, Haravuori H, Kalimo H, Partanen J, Pulkkinen L, Paetau A, Peltonen L, Somer
H. Tibial muscular dystrophy--from clinical description to linkage on
chromosome 2q31. Neuromuscul Disord. 1998; 8(5):327-32.
Vernino S, Auger RG, Emslie-Smith AM, Harper CM, Lennon VA. Myasthenia,
thymoma, presynaptic antibodies, and a continuum of neuromuscular
hyperexcitability. Neurology. 1999; 53(6):1233-1239.
124
Vincent A, Bowen J, Newsom-Davis J, McConville J. Seronegative generalised
myasthenia gravis: clinical features, antibodies, and their targets. Lancet Neurol.
2003; 2(2):99-106.
Vorgerd M, Bolz H, Patzold T, Kubisch C, Malin JP, Mortier W. Phenotypic variability
in rippling muscle disease. Neurology. 1999; 54(1):273-4.
Vorgerd M, Ricker K, Ziemssen F, Kress W, Goebel HH, Nix WA, Kubisch C, Schoser
BGH, Mortier W. A sporadic case of rippling muscle disease caused by a de
novo caveolin-3 mutation. Neurology. 2001; 57(12):2273-2277.
Walker GR, Watkins T, Ansevin CF. Identification of autoantibodies associated with
rippling muscles and myasthenia gravis that recognize skeletal muscle proteins:
Possible relationship of antigens and stretch-activated ion channels. Biochem
Biophys Res Comm. 1999; 264(2):430-435
Wang K, McClure J, Tu A. Titin: major myofibrillar components of striated muscle.
Proc Natl Acad Sci U S A. 1979; 76(8):3698-702.
Wang SM, Greaser ML. Immunocytochemical studies using a monoclonal antibody to
bovine cardiac titin on intact and extracted myofibrils. J Muscle Res Cell Motil.
1985; 6(3):293-312.
Watkins TC. Characterization of skeletal muscle antibodies in patients with
autoimmune rippling muscles and myasthenia gravis [master’s thesis].
[Youngstown, (OH)]: Youngstown State University; 1998. 79 p. Available
from: Maag Library, Thesis no.626.
125
Watkins, TC. The application of biochemical and genomic techniques to identify
autoimmune rippling muscle disease antigens [dissertation]. [Kent, (OH)]: Kent
State University; 2004. 140 p. Available from: Kent State University, Special
Collections.
Watkins TC, Zelinka L, Kesic M, Ansevin CF, Walker GR. Identification of skeletal
muscle autoantigens by expression library screening using sera from
autoimmune rippling muscle disease (ARMD) patients. J Cell Biochem. 2006;
99(1):79-87.
Williams C, Lennon V. Thymic B lymphocyte clones from patients with myasthenia
gravis secrete monoclonal striational autoantibodies reacting with myosin,
alpha-actinin, or actin. J Exp Med. 1986; 164(4):1043-1059.
Woodman SE, Sotia F, Galbiati F, Minetti C, Lisanti MP. Caveolinopathies: mutations
in caveolin – 3 cause four distinct autosomal dominant muscle diseases.
Neurology. 2004; 62(4):538- 543.
Yamasaki R, Berri M, Wu Y, Trombitas K, McNabb M, Kellermayer MS, Witt C,
Labeit D., Labeit S, Greaser M, Granzier H. Titin-actin interaction in mouse
myocardium: passive tension modulation and its regulation by calcium/S100A1.
Biophys J. 2001; 81(4):2297-2313.
Young P, Ehler E, Gautel M. Obscurin, a giant sarcomeric Rho guanine nucleotide
exchange factor protein involved in sarcomere assembly. J Cell Biol. 2001;
154(1):123-36.
126
Zelinka LM. The immunofluorescent localization of antigens associated with
autoimmune rippling muscles [master’s thesis]. [Youngstown, (OH)]:
Youngstown State University; 2002. 67 p. Available from: Maag Library,
Thesis no.759.
Zelinka L, McCann S, Budde J, Sethi S, Guidos M, Giles R, Walker GR.
Characterization of the in vitro expressed autoimmune rippling muscle disease
immunogenic domain of human titin encoded by TTN exons 248-250. Biochem
Biophys Res Commun. 2011; 411(3) 501-505.
APPENDICES
128
Appendix A: List of Abbreviations and Acronyms
Abbreviation Term Abbreviation Term
Ach
Acetylcholine MUAP Motor Unit Action Potential
AChR
Acetylcholine receptor MW Molecular Weight
ARMD Acquired Rippling Muscle
Disease MuSK
Muscle Specific Kinase
BLAST Basic Local Alignment Search
Tool MSC Mechanosensitive Channel
CAV3 Caveolin-3 NCBI National Center for
Biotechnology Information
CFA Carl F. Ansevin M.D. NO Nitric Oxide
DCM Dilated Cardiomyopathy nNOS Nitric Oxide Synthase
DHPR Dihydropyridine Receptor ORF Open Reading Frame
DMD Duchenne Muscular Dystrophy PCR Polymerase Chain Reaction
EAMG Experimental Autoimmune
Myasthenia Gravis PPP1R# Phosphoprotein Phosphatase 1
Regulatory subunit
E-C Excitation-Contraction pRMMG-# Plasmid isolated from
RM/MG patient 1 and # of
plasmid (nomenclature
system)
ES Epitope Spread PVDF Polyvinylidene Fluoride
E-value Expectation value RIPA Radio-immunoprecipitation
FASTA Fast Alignment Search Tools
Anything RM Rippling Muscles
FHC Familial Hypertrophic
Cardiomyopathy RMD Rippling Muscle Disease
FN3 Fibronectin three domain RyR Ryanodine Receptor
HCM Hypertrophic Cardiomyopathy SAC Stretch Activated Channel
HRP Horse Radish Peroxidase SDS-PAGE Sodium Dodecyl Sulfate
Polyacrylamide Gel
Electrophoresis
Ig Immunoglobulin (subtype) SR Sarcoplasmic Reticulum
IPTG Isopropyl - -D-
thiogalactopyranoside TBS Tris Buffered Saline
kDa Kilodalton VAGE Vertical Agarose Gel
Electrophoresis
LEMS Lambert Eaton Myasthenic
Syndrome VGCC Voltage Gated Calcium
Channels
LGMD Limb Girdle Muscular
Dystrophy TnC, TnI or
TnT
troponins I, T and C
MG Myasthenia Gravis Transverse
Tubular
System
T-tubule
MG/T Myasthenia Gravis/Thymoma YSU Youngstown State University
MIR Main Immunogenic Region Xg Times Gravity
(centrifugation)
MUAP Motor Unit Action Potential
129
Appendix B: List of solutions and reagents
Reagent Purpose Contents/Details
SDS-PAGE
7.5% Acrylamide
gel
Separation of
proteins: resolving
gel (larger peptides)
1.6g glycerol, 6.0 mL running gel buffer, 10mL
ddH2O, 6.0 mL 30% acrylamide gel stock, 80μL
10% ammonium persulfate, 24 μL TEMED (makes
5 minislab gels)
10% Acrylamide
gel
Separation of
proteins: resolving
gel (smaller
peptides)
1.6g glycerol, 6.0 mL running gel buffer, ddH2O,
8.0 mL 30% acrylamide gel stock, 80μL 10%
ammonium persulfate, 24 μL TEMED (makes 5
minislab gels)
5% Acrylamide
stacking gel
Stacking of proteins
entering
4.5 mL stacking gel buffer, 10.5 mL ddH2O, 3,0 mL
30% acrylamide gel stock, 60μL 10% ammonium
persulfate, 23 μL TEMED (makes 5 minislab gels)
Electrode buffer pH buffer for SDS-
PAGE
6.05g tris, 28.84g glycine, 2.00g SDS, ddH2O to
2000mL
Resolving gel
buffer
pH buffer for
resolving gel
18.17g tris, 8.20 mL 3M HCl, 0.4g SDS, ddH2O to
100mL
Stacking gel
buffer
pH buffer for
stacking gel
6.05g tris, 29.1mL 2M HCl, 0.4g SDS, ddH2O to
100mL, titrated to pH 6.8
SDS-sample
buffer (1x):
Solubilize protein
for SDS-PAGE
12.5% glycerol, 50 mM TRIS (pH 6.8), 5% 2-
mercaptoethanol and 2.3% SDS
SDS sample
buffer (4x)
Solubilize protein
for SDS-PAGE
50% glycerol, 200 mM TRIS (pH 6.8), 20% 2-
mercaptoethanol and 9.2% SDS
130
Reagent Purpose Contents/Details
Immunoblot
anti-titin
(1 antibody)
Antibody to titin Commercially available from Sigma, Inc.
Goat anti-human IgG
(Fc region specific)
(2antibody)
Antibody labeled
with HRP for
detection of
human
immunoglobulin
Commercially available from Sigma, Inc.
Chemiluminiscent
substrate
(Luminol)
Detection of
HRP labeled
immuno-
globulin(2
antibody)
Commercially available from Pierce, Inc
Colorimetric substrate Detection of
HRP labeled
immunoglobulin
Commercially available from Sigma, Inc.
PVDF membrane Binds proteins
transfered by
electroblot
Commercially available from Bio-Rad, Inc.
Low pH buffer
(Olmsted)
Decrease pH of
solution 0.2 M Glycine, 1 mM EGTA, pH 2.3-2.7
Transfer buffer Transfer of
proteins onto
PVDF 57.6g glycine, 12.1g tris, 800mL methanol, 3200
mL ddH2O
Tris buffered Saline
TBS
Buffer /pH
20mM tris, 0.5 M NaCl, titrate to pH 7.5 with
HCl
Tris buffered Saline w/
Tween-20
TBS-T
Buffer /pH
20mM tris, 0.5 M NaCl, titrate to pH 7.5 with
HCl with 0.2% Tween-20
Western (immuno)
blot
Blocking buffer (5%)
Membrane
blocking 5% powdered milk in TBS-T
Western (immuno)
blot
Blocking buffer (3%)
Membrane
blocking 3% powdered milk in TBS-T
Western (immuno)
blot Blocking buffer
(1%):
Membrane
blocking with
antibody 1% powdered milk in TBS-T
BioMax Autoradiography
film Commercially available from Kodak, Inc.
Used with Kodak, Inc. GBX processing chemicals
and procedures
131
Reagent Purpose Contents/Details
Growth Media
LB broth
LB Amp broth
Growth media
Selective growth
media
Broth: 10g NaCl, 10g tryptone, 5g yeast extract,
add ddH2O to 1L, pH 7.0 with NaOH, autoclaved
Add 1 mL Ampicillin stock to cool media
LB agar
LB Amp agar
*1000X amp
Growth media
for pBluescript
and pGEX and
TOPO
Selective media
Broth: 10g NaCl, 10g tryptone, 5g yeast extract,
add ddH2O to 1L, pH 7.0 with NaOH autoclaved
Agar: add an additional 20g agar
Add 1 mL Ampicillin stock to media
*5 grams amp dissolved in 100 mL DI water
Biologicals (Included in the Stratagene, Inc. Lambda Zap II library)
pBluescript Bacteria phage
containing
cDNA insert and
unique
restriction sites
Stratagene
132
Reagent Purpose Contents/Details
cDNA Manipulation
Agarose gel DNA electrophoresis 1% electrophoresis grade agarose in TAE
DCTS-Quick
Start
PCR kit for
sequencing
Beckman-Coulter commercial kit for amplifying
DNA for automated sequencing
EcoRI Restriction enzyme Commercially available from Sigma, Inc. for
cleaving cDNA insert from pBluescript (40
units/μL)
H-buffer Restriction
edonuclease digestion
buffer
Commercially available from Sigma, Inc
IPTG Promotes translation
of insert cDNA
Isopropyl - -D- thiogalactopyranoside a
fine chemical commercially available from Sigma,
Inc.
Plasmid mini-
prep kit
Separation of plasmid
DNA from genomic
E.Coli DNA
Kit commercially available from Eppendorf
Primer M13 PCR primer Primer sequence:
5´ GTAAAACGACGGCCAGT 3 ´
Reverse primer PCR primer Primer sequence:
5´ GGAAACAGCTATGACCATG 3´
Stop buffer(10x
loading buffer)
Stops restriction
digest and prepares
DNA for
electrophoresis
20 mL Ficoll 400, 1g SDS, 3.72g Na EDTA
dihydrate pH 8.0, 0.25g bromphenol blue
TAE Agarose gel
electrophoresis
running gel buffer
242g tris, 57.1 mL glacial acetic acid, 37.2g Na
EDTA dihydrate, ddH2O to 1L, titrated to pH 8.5
(makes 50X)
pGEX Reverse
primer
PCR primer Primer sequence: Reverse
5´ CCGGGAGCTGCATGTGTCAGAGG 3 ´
pGEX Forward
primer
PCR primer Primer sequence: Forward
5´ GGGCTGGCAAGCCACGTTTGGTG 3´
133
Appendix C: Muscle Protein Reference Table
134
135
Appendix D Miscellaneous Solutions
10X Running Buffer (TGS Buffer) (1 L)
30g Tris
144g Glycine
10 g SDS
Deionized water
Tris, Glycine, and SDS were dissolved in deionized water. The pH was titrated
to 8.3 and the final volume was adjusted to 1L with deionized water. The
running buffer was diluted to 1x before use and stored at room temperature.
2% Agarose gel
100 ml 1x TAE Buffer
2 g Agarose I
Agarose I was dissolved in 1x TAE buffer and microwaved on high for 1 – 2
minutes. When liquid cooled slightly it was poured into an electrophoresis gel
tray, a comb was inserted, and was allowed to solidify.
1% Agarose gel
100 ml 1x TAE Buffer
1 g Agarose I
Agarose I was dissolved in 1x TAE buffer and microwaved on high for 1 – 2
minutes. When liquid cooled slightly it was poured into an electrophoresis gel
tray, a comb was inserted, and was allowed to solidify.
10x Tris Buffered Saline (10x TBS Buffer) (1 L)
24.22 g Tris
87.66 g NaCl
800 ml Deionized water
Tris and NaCl were dissolved in 800 ml deionized water. The solution was
titrated to pH to 7.3 and then diluted to 1 L with deionized water. Buffer was
diluted to 1x prior to use and stored at room temperature.
136
10 mM Phosphate Buffered Solution (PBS) (pH 7.4 with TWEEN20)
0.26 g Potassium Phosphate Monobasic Crystal (KH2PO4)
2.17 g Sodium Phosphate Dibasic Anhydrous (Na2HPO4·7H2O)
8.71 g NaCl
Deionized water
0.5 ml TWEEN20
KH2PO4, Na2HPO4·7H2O, and NaCl were dissolved in 800 ml deionized water.
The solution was titrated to pH 7.4 and adjusted to a total volume of 1 L. 0.5 ml
TWEEN20 was added and stored at room temperature.
10% Ammonium Persulfate
1.0 g Ammonium persulfate
10 ml Deionized water
Ammonium persulfate was dissolved in 10 ml deionized water and stored at 4
°C.
Low De-stain Solution
100 ml Glacial Acetic Acid
150 ml Methanol
750 ml Deionized water
Glacial acetic acid, methanol and deionized water were combined and stored at
room temperature.
High De-stain Solution
100 ml Glacial Acetic Acid
400 ml Methanol
500 ml Deionized water
Glacial acetic acid, methanol and deionized water were combined and stored at
room temperature.
Coomassie Stain
2.5 g Coomassie Brilliant Blue R-250
100 ml Glacial Acetic Acid
450 Methanol
450 ml Deionized water
High Destain / Sypro Fixing Solution 100 ml glacial
Combined and stirred overnight and stored room temperature.
137
Elution Buffer
0.461 g Glutathione
0.788 g Tris-HCl
Dissolve in 90 mL DI water pH 9.0 then bring solution to 100 mL final volume.
Strong Elution Buffer
0.641 g Glutathione
1.576 g Tris-HCl
0.701 g NaCl
Dissolve in 90 mL DI water pH 8.0 then bring solution to 100 mL final volume.
Equilibration Buffer
10 mM PBS-T pH 7.4
150 mM NaCl
Cleansing Buffer 1
M borate buffer pH 8.5
0.5 M NaCl
Adjust pH with NaOH
Cleansing Buffer 2
M Acetate Buffer pH 4.5
0.5 NaCl
Adjust pH with acetic acid
Storage Buffer
Use 2 M NaCl
mM sodium azid
138
Appendix E Vertical Agarose Titin Gel Electrophoresis
Sample buffer - this mixture must be stirred sufficiently for a long time on the stir
plate
Urea 48.05 g
Thiourea 15.22 g
SDS 3.00 g
Bromophenol blue 0.03 g
Tris 0.6055 g
Dissolve in diH2O
Titrate with concentrated (12 M) HCl until pH 6.8________________________
Final volume 100 mL
2M Tris·Cl for polyacrylamide plug (In the 4°C fridge, labeled)
Tris 24.20 g
Dissolve in diH2O about 90 mL
Titrate with concentrated (12M) HCl until pH 9.3________________________
Final Volume 100 mL
5x Resolving Gel Buffer (In the 4°C fridge, labeled; also can dilute 10x TGS buffer
accordingly)
Tris 3.0275 g
Glycine 14.40 g
SDS 0.50 g
Dissolve in diH2O_________________________________________________
Final Volume 100 mL
Electrode buffer
Tris 12.10 g
Glycine 28.84 g
SDS 2.00 g
Dissolve in diH2O_________________________________________________
Final volume 2000 mL
0.04% Coomassie Stain
Coomassie 0.40 g
Methanol 500 mL
Glacial acetic acid 100 mL
diH2O ________
Final volume 1000 mL
139
Appendix F: Vertical Agarose Titin Gel Electrophoresis Gel Casting
Gel Casting- makes 4 mini-gels (8 cm x 7.3 cm)
1. Assemble Bio-rad Mini-PROTEAN 3 gel casting frames and stands as directed
in the equipment manual.
2. Acrylamide Plug- must be ready to pour when APS and/or TEMED is added.
Make sure APS is still good
40% acrylamide solution 1.5 mL
Glycerol 0.5 mL
2M Tris·Cl for polyacrylamide plug 1.25 mL
diH2O 1.74 mL
10% ammonium persulfate (APS) 14 μL
TEMED 7.6 μL
Final volume 5 mL
3. Add about 900 μL of solution to the gel casting apparatus to create a plug about
1 cm high. Overlay with a layer of diH2O to form a flat interface. Allow to
polymerize for about an hour. While waiting, preheat oven to 65°C and prepare
solutions for agarose gel.
4. Weigh out 0.8 g of agarose powder and place in a 250 mL beaker.
5. In a graduated cylinder combine 12 mL glycerol with 8 mL of 5x resolving gel
buffer. Bring solution to 40 mL. Parafilm the top of the cylinder and invert to
mix.
6. After polyacrylamide plug has polymerized drain water using a paper towel or
Kimwipe if necessary to absorb water. Place entire gel casting apparatus in
65°C incubator with serological pipette and enough gel combs. Allow to be in
oven for 30 minutes.
7. Near the end of the 30 minutes combine liquid agarose solutions with agarose
powder in the 250 mL beaker. Cover with plastic wrap and vent cover. Weigh
beaker and take note. Place beaker in microwave with another beaker with
about 40 mL of water. Heat until agarose solution just begins to boil. Stop the
microwave and with an insulated glove swirl the mixture around. Repeat two or
three times. Weigh beaker again and replace any significant evaporation loss
with water from microwave.
140
8. Remove gel casting apparatus, pipette, and combs from the oven. Using a bulb,
draw solution into pipette and slowly pour between plates on the gel casting
apparatus to avoid bubbles. Place comb when mixture has reached a sufficient
level but not so early as to produce gaps. If combs cause mixture to overflow,
wipe up. Allow gels to cool at room temperature for 30 minutes. After that,
place gel casting apparatus in 4°C refrigerator for another 30 minutes. Store
gels with plates and comb in 4°C refrigerator with moistened paper towel in gel
box to avoid drying out.