Eamcet Botany Model Paper

8/6/2019 Eamcet Botany Model Paper

1/16

EAMCET Botany Model Test

1. [A]: Fungi have nitrogen containing cell wall material

[R]: Cell wall of heterotrophic thallophytes has polymer made of nucleosides

1) Both A and R are true and R is the correct explanation of A

2) Both A and R are true but R is not the correct explanation of A

*3) A is true but R is false 4) A is false but R is true

2. Study the following table and choose the correct combination

Plant group Feature 1 Feature 2

I) Cryptogams Gametophytes can form asexualspores

Sporophyte can also producespores

II) Algae Gametophyte cannot form spores Sporophyte can form spores

III) Fungi Cannot trap light energy Do not have vacuoles.

IV) Bryophytes Have sporophyte parasite ongametophyte

Gametophyte is independent

*1) I and IV 2) II and IV 3) I and III 4) I and II

3. Study the following lists and match correctly

List I List II A B C D

A) LAB I) Kills caterpillars 1) II IV I III

B) Flemming II) Vit.B12 2) IV V II I

C) Waksman III) Uranium extraction 3) II IV V III

D) Bt. IV) Penicillin *4) II IV V I

V) Streptomyces grieseus

4. [A]: Iodine used during Grams staining

[R]: It stains Gram negative but not gram positive bacteria




5. Choose the incorrect statement.

1) Thickness of glycocalyx varies from species to species

*2) In a given species of bacterium all bacteria cells either possess glycocalyx or lack glycocalyx

3) All bacteria have nucleoid 4) Cocci do not have flagella

6. [A]: Cells of E.coli do not divide

[R]: The symbiotic bacterium of human intestine has no mesosomes



3) A is true but R is false *4) A is false but R is true7. The amino acid and Micronutrient required for auxin synthesis are

1) Phenyl Alanine, Mn 2) Tryptophan, Mo *3) Tryptophan, Zn 4) Tyrosine, Mg

8. Arrange the following events of Gibberellin influenced seed germination in a sequence.

I. Formation of Sugars II.-amylase synthesis III. Energy liberation IV. Gibberellin synthesis

1) II, IV, I, III 2) IV, I, II, III *3) IV, II, I, III 4) I, II, IV, III

9. [A]: ABA is a growth inhibitor[R]: It inhibits the formation of seedlings from seeds

*1) Both A and R are true and R is the correct explanation of A


3) A is true but R is false 4) A is false but R is true

10. Choose the incorrect pair

1) Potato crop Stress hormone 2) Pine Apple - Ethephon

*3) Ethylene - Skoog 4) Dormancy hormone - Waring

11. C40H56O2 is involved in the synthesis of

*1) Senescence hormone 2) Fruit ripening hormone

www.way2freshers.com
http://www.cvisiontech.com/


2/16

3) Richmond-Lang effect hormone 4) Bolting hormone

12. Read the following lists and choose the correct match


A) Virus with ssDNA I)Parasitic in cells havingpeptidoglycan cell wall

1) II III IV V

B) Plant virus with dsDNA II)

Forms irregularly shape and sized

chloretic areas on leaf of plant with2n = 48

2) I II IV V

C) Plant virus with dsRNA III)Causes disease in plant withcompound corymb and parietalplacentation

*3) I III IV II

D) Plant virus with ssRNA IV)Causes stunting in plants with

caryopsis fruit.4) I V IV II

V)Forms malformation in plants withhesperidium fruit

13. [A]: Triticum aestivum is naturally formed polyploid

[R]: Polyploids are common in Poaceae



3) A is true but R is false *4) A is false but R is true

14. Crop variety that shows anti-ethylene influence is

1) Roundup ready *2) Flavr-Savr 3) Taipei 4) Transgenic papaya

15. Study the following lists and choose the correct match


A) Pusa Moti I) Pure line selection 1) IV III V I

B) Kufri safed II) Polyploidy breeding 2) V III IV I

C) Aruna III) Clonal selection 3) III IV V II

D) Bread wheat IV) Mutational breeding *4) V III IV II

V) Mass selection

16. During stomatal opening of Photoactive plants, the decrease in water potential of guard cells is

due to

1) Passive movement of H+

into guard cells 2) Active movement of Cl-into guard cells

3) Active movement of K+

into guard cells *4) Active movement of H+

into subsidiary cells

17. If the number of ATP used for the production of 6 hexoses in dark reaction of Maize is equal to

the number of ATP used during carbon assimilation in the dark reaction of Chlorella for the

production of n number of hexoses, then n is

1) 12 *2) 10 3) 6 4) 18

18. The following reaction is catalyzed by a protein in mitochondrial matrix but the reaction is not an

integral part of Tricarboxylic acid cycle.

1) Conversion of Phosphoenol pyruvic acid to Pyruvic acid

*2) Oxidative decarboxylation of Pyruvic acid

3) Oxidative decarboxylation of Oxalo Succinic acid

4) Oxidation of Succinic acid.

19. Genetic code for serine is degenerate, because the codons for Serine are

I. UCG II. CGU III. GCU IV. AGU

1) II, III *2) I, IV 3) I, III 4) I, II, III

20. Study the following table showing the components of water potential during day time in linearlyarranged mesophyll cells P, Q, R, and S from xylem towards substomatal chamber. Arrange

them in a sequence of nearest to farthest to sub-stomatal chamber.

Cell Osmotic potential (MPa) Pressure potential (MPa)



3/16

P -0.31 0.031

Q -0.50 0.40

R -0.44 0.23

S -0.25 0.10

1) Q,P,R,S *2) P, R, S, Q 3) Q, R, P, S4) Q, S, R, P

21. [A]: Calcium is an essential element in Plant Nutrition

[R]: Calcium plays an important role in mitosis


2) Both A and R are true but R is not the correct explanation of A3) A is true but R is false 4) A is false but R is true

22. Choose the pair of physiological effects of two phytohormones that are synthesized from

connecting link of Glycolysis and Krebs cycle.

I. Promotion of seed germination II. Inhibition of seed germination

III. Promotion of Apical dominance IV. Promotion of Stomatal opening

*1) I, II 2) III, IV 3) I, III 4) II, IV

23. Arrange the following with respect to the correct order of formation of the following sugar

phosphates in Calvin cycle.

I. Glyceraldehyde phosphate II. Ribulose monophosphate

III. Xylulose monophosphate IV. Fructose monophosphate

1) I, IV, II, III 2) IV, I, III, II *3) I, IV, III, II 4) I, III, IV, II

2) Energy conservation site of respiratory electron transport chain is

I. Complex I II. Complex II III. Complex III IV. Complex IV

1) I, II 2) II, III, IV 3) III and IV *4) I, III, IV

24. [A]: Citric acid cycle is an oxidation pathway

[R]: C-C bonds are not formed during TCA cycle




25. This intermediate of Glycolysis, which is CO2 acceptor in C4 plants is formed by the catalyticactivity of

1) Mutase 2) Kinase *3) Enolase 4) Dehydrogenase

26. Study the following table with respect to C2 cycle and choose the correct combinations

Chloroplast Peroxisome Mitochondrion

I) O2 is utilized O2 is generated NH4+

is released

II) ATP are utilized O2 is utilized NADPH are generated

III) CO2 is utilized H2O2 is liberated CO2 is liberated

IV) NADPH are produced NADPH are used Glycine is formed

1) II, III 2) I, IV *3) I, II 4) III, IV

27. [A]: Calvin Benson cycle is also called as Reductive Pentose Phosphate cycle

[R]: In C3 cycle the oxidation state of Carbon of CO2 is reduced to zero or one or two.*1) Both A and R are true and R is the correct explanation of A



28. Xylulose-5-phosphate formed in C3 cycle has the carbon atoms directly obtained from

I. Glyceraldehyde-3-phosphate II. Fructose-6-phosphate

III. Sedohaptulose-7-phosphate IV. Dihydroxyacetone phosphate

1) I, II 2) II, III 3) II,III, IV *4) I, II, III

29. [A]: Light harvesting complex is involved in Photochemical reaction.

[R]: Light harvesting complex pigments transfer the absorbed light energy to reaction centre



4/16




30. [A]: Grana thylakoids have more PS II than PS I

[R]: Granum has more oppressed region than non-oppressed region




31. [A]: Q cycle helps in transport of more protons than electrons

[R]: During photosynthetic electron transport, out of two electrons accepted by PQ, one istransported linearly and the remaining one is carried in cyclic manner via Cytochrome b6.



3) A is true but R is false 4) A is false but R is true32. From the following explanations, identify the correct ones with respect to respiration of an obligate aerobe

which is provided one molecule of Glucose and one molecule of Oxygen.

I. The net gain of ATP is 6 II. Krebs cycle does not occur

III. Electron transport system is not operated

IV. Respiration comes to an end with the formation of Pyruvic acid

1) I, II 2) II, III, IV 3) I, II, IV 4) III, IV

33. Study the following with respect to inner membrane of Mitochondrion and choose the correct groups.

Component Function 1 Function 2

I) Complex I Transfers H+

from matrix to

perimitochondrial space

Reduces UQ

II) Complex II Involved in ETS and Krebs cycle Reduces Co.Q

III) Complex III Has Cytochrome C1 Can directly reduce O2

IV) Complex IV Has no Fe-S centers For each e-transfer removes

4 H+

from matrix

1) II, III *2) I, II 3) I, IV 4) II, IV

34. Arrange the following components of ETS in a sequence with respect to their first involvement during

aerobic breakdown of a molecule of Glucose.

A. Complex I B. Complex II C. UQ D. Complex III

E. Cytochrome C F. Complex IV

1) A, B, C, D, E, F 2) B, C, D, E, F, A *3) C, D, E, F, A, B 4) C, D, E, F, B, A

35. During Aerobic oxidation a molecule of Glucose, after removal of how many protons of the matrix of

mitochondrion, there is involvement of Complex II.

1) 72 2) 80 3) 104 *4) 88

36. Arrange the following respiratory substrates in an order of gradual increase in the number of Oxygen atoms

consumed during oxidation of each its molecules.

I. Oleic acid II. Tartaric acid III. Malic acid IV. Tripalmitin

1) II, III, IV, I 2) III, II, I, IV 3) III, II, IV, I *4) II, III, I, IV

37. The sequence of bases in the coding region of mRNA of E.coli is 5' AUGUGUAGCUUUUGA 3'. If its

translation is started with reading frame having GUG, the following events of translation do not occur for the

translation of the given mRNA.

I. Activation of amino acids II. Chain initiation

III. Involvement of Releasing factors IV. Chain elongation

1) II, IV 2) I, III, IV *3) Only IV 4) All

38. Arrange the involvement of following parts of initiator tRNA in correct sequence during translation.

I. Anticodon arm II. Acceptor arm

III. DHU arm IV. Ribosome recognition arm

1) II, I, III, IV 2) II, III, I, IV *3) III, II, I, IV 4) II, IV, III, I



5/16

39. Choose the correct statements with respect to biological nitrogen fixation.

I. Both component I and Component II of nitrogenase have Mo.

II. Nitrogenase accepts both e-and H

+from Ferredoxin.

III. Pyruvic acid supplies both e- and H+ for the reduction of N2.

IV. 2 ATP are utilized for the transfer of an electron from Pyruvic acid to N2.

1) I, III 2) II, III *3) III, IV 4) II, IV

40. The following stage of nitrogen cycle can not be completed with the involvement of only one species.

1) Nitrogen fixation 2) Ammonification *3) Nitrification 4) Denitrification

41. Match the following


A)Anoxygenic host associated

with oxygenic diazotrophI) Anthoceros 1) V I IV III

B)

Haploid oxygenic host

associated with oxygenic

diazotroph

II) Parasponia 2) II I IV V

C)

Diploid oxygenic host

associated with oxygenic

diazotroph

III) Solanum 3) V II IV I

D)

Diploid oxygenic host

associated with anoxygenicdiazotroph

IV) Azolla *4) V I IV II

V) Basidiomycete

42. Choose the incorrect statement

*1) All amino acids involved in protein synthesis are indicated by more than one codon.

2) 3 codons of genetic code do not indicate any amino acid

3) Initiating codons are sense codons. 4) Serine is indicated by six codons

43. Study the following with respect to nitrogen cycle and identify the correct math


A) N2 2NH3 I) Nitrosomonas *1) III V I II

B) RCHNH2COOH NH3 II) Micrococcus 2) III V IV II

C) NH3 NO2 III) Clostridium 3) IV III II VD) NO3 N2 IV) Nitrobacter 4) III II I IV

V) Bacillus

44. Study the following table with respect to structures of Symbiotic Biological nitrogen fixation and choose the

correct combinations

Microsymbiont Host character 1 Host character 2

I) Rhizobium Anterior odd petal Marginal placentation

II) Frankia Whorled phyllotaxy Sorosis

III) Nostoc Sporophyte parasitic on gametophyte Atracheate

IV) Anabaena Free f loating hydrophyte Sessile archegonia

1) All except IV 2) All *3) All except I 4) II and III only

45. If the coding region of mRNA has 600 nucleotides, the number of tRNA molecules that can bind to A-site ofribosome during translation is

1) 200 2) 199 *3) 198 4) 598

46. Codons that can not be recognized by tRNA are recognized by

1) rRNA 2) IF3 3) EFT *4) RF2

47. Arrange the involvement of the following in correct sequence during translation for the formation of a

polypeptide chain.

I. RF3 II. IF2 III. EFG IV. IF3

V. RF1 VI. IF1

http://www.cvisiontech.com/http://www.cvisiontech.com/


6/16

1) VI, II, IV, III, V, I *2) IV, VI, II, III, V, I 3) IV, II, VI, III, V, I 4) IV, VI, II, III, I, V

48. If a mRNA has information for the formation of protein as 5' AUGUUUUCAAGUUCGGGGUAA 3', the amino

acid with free COOH group in the formed protein must be

1) Serine 2) Phenyl Alanine 3) Methionine *4) Glycine

49. If the number of translocations during the formation of a polypeptide chain on a ribosome is 200, the total

number of GTP utilized during translation is

1) 399 2) 199 3) 201 *4) 401


Substrate/s Enzyme Product/s

I) Oxaloacetate, Aectyl

Co.A

Citrate synthetase Citric acid, Co.A

II) Succinyl Co.A, ADP Thiokinase Succinic acid, ATP, Co.A

III) Fumaric acid Fumarase Malic acid

IV) Citric acid Aconitase Cis-aconitic aicid

From the above identify the correct sets that utilize H2O in their respective reactions.

1) I, II 2) III, IV 3) II, III, IV *4) I, II, III

51. Identify the respiratory substrates whose RQ in aerobic respiration is equivalent to Glucose

I. Pyruvic acid II. Glyceraldehyde-3-phosphate

III. Acetyl Co.A IV. 1,3 bisphospho glyceric acid

1) I, II *2) II, III 3) only II 4) III, IV

52. Morphologically similar Parenchyma cells A, B, C and D are kept respectively in solution P having 1%

Sucrose, Q with 2% sucrose solution, R with 3% sucrose solution and S with 4% sucrose solution. Cell D

has shown withdrawal of plasma membrane at the corners and the other cells have not shown any such

signs. Choose the correct statements among the following.

I. Cell A is isotonic to solution P II. Cell B is isotonic to solution Q

III. Cell C is isotonic to solution R IV. Cell D is hypotonic to solution S

1) All except IV 2) All except III

*3) All except I and II 4) All except III and IV

53. Match the followingList I List II A B C D

A) A virus is a virus I) Stanley 1) IV V II I

B)Disproved the theory of

spontaneous generationII) Gierer 2) IV III V I

C) Viruses as Nucleoproteins III) L. Pasteur 3) V IV I II

D)Nucleic acid as infectious

agentIV) A. Lwoff *4) IV III V II

V) Pierie

54. Match the following with respect to TMV particle


A) No. of capsomers I) 6,500 1) IV V II III

B) No. of nucleotides II) 300 2) V IV I II

C) No. of aminoacids in capsomere III) 3000 3) IV I V II

D) Length in Angstroms IV) 2130 *4) IV I V III

V) 158

55. Arrange the role of following structures of T4 bacteriophage during its replication

I. Lysozyme II. Tail fibres III. DNA IV. Tail sheath

1) II, IV, I, III *2) II, I, IV, III 3) I, II, IV, III 4) II, IV, III, I

56. If a Spirogyra free floating filament with 20 cells is broken into pieces with each fragment consisting of 5

cells, how many mitotic divisions have to occur to form daughter filaments with each filament having same

number of cells as that of parental filament



7/16

1) 76 *2) 60 3) 40 4) 80

57. A, B, C and D are the mycelia of a species of Rhizopus. Zygospore formation is seen when A is grown

along with D. Zygospore formation is noticed when B is grown along with C. When C is with D no such

zygospore formatin is noticed. With respect to this information choose the correct statements.

I. Zygospores can be formed when C is grown with A.

II. Zygophore formation can be noticed when B is grown with D.

III. Zygospores are not formed when B is grown with A.

IV. A and C belong to one type of strain and C and D belong to another type of strain.

*1) All except IV 2) All except III 3) only I and II are correct 4) II and IV are correct

58. Choose the wrong statements

1) A sporophyll of Pteris longifoliahas 50 sori. 2) A sporophyll of Pteris vittatahas 54 sori

3) Number of sori of Pterissporophyll is equivalent to number of false indusia

*4) A unipinnate sporophyll of Pterishas 52 sori.

59. [A]: Bulbils of Cycasare adventitious buds

[R]: Vegetatively propagating structures of Cycasare formed on woody portions of its stem.




60. Identify the pairs of cells formed simultaneously during the development of Cycasmale gametophyte

I. Tube cell Antheridial cell II. Body cell Male gamete

III. Stalk cell Body cell IV. Prothallial cell Antheridial cell

1) I and III 2) II and IV *3) I and IV 4) III and IV

61. Lock and Key model explains the following property of Enzymes

1) Activity in minute quantity *2) Specificity

3) Reversibility 4) Thermolability

62. Arrange the following events of Secondary active transport mediated by Symporter in correct sequence.

I. Neither H+

binding site nor the S binding sites of the symporter exposed towards the solution of outside

of plasma membrane.

II. S binding site of the Symporter neither exposed towards the solution of outside nor cytoplasmic side of

plasma membrane.

III. Both H+

binding site and the S binding site are exposed towards solution of outside of Plasma

membrane.

IV. Release of H+

and S into symplast.

1) I, II, III, IV 2) III, II, I, IV *3) II, III, I, IV 4) II, I, III, IV

63. If the Stomatal Index of lower surface of Solanum leaf with 960 epidermal cells in mm2

area is 1/25, how

many guard cells are present in that area.

1) 40 2) 20 *3) 80 4) 160

64. Study the following table and choose the correct combinations

Type of

Biofertiliser

Crop in which it is applied Significance

I) Azolla pinnata Paddy Reduces the heavy metal levels in the crop

plants

II) Glomus Potato Improves the pest tolerance of the crop

III) Azospirillum Wheat Provides Growth hormones to crop

IV) Rhizobium Soybean Improves tolerance to water stress in the

crop

1) I and II 2) III and IV *3) II and III 4) III and IV

65. If a C3 plant Rubisco enzyme is involved in adding 6 CO2 to RuBP and later 6 O2 to another 6 RuBP in the

same chloroplast, the ratio between the carbon atoms fixed to carbon atoms lost in the cell is



8/16

1) 1:1 2) 4:3 3) 3:2 *4) 2:1

66. [A]: In Photosynthesis, the absorbed VIBYO of visible spectrum is used in the form of red photons.

[R]: The reaction centres of Photosytems II and I respectively have P680 and P700.




67. Choose the correct statement

1) Plantlets can not be produced in tissue culture without embryogenesis

*2) Plantlets can not be produced in tissue culture without organogenesis

3) Plantlets can not be produced in tissue culture without callus formation

4) Plantlets can not be produced in tissue culture without embryogenesis and callus formation

68. The principle of sterilization is applied during

I. Nutrient medium preparation II. Preparation of Explant

III. Inoculation of explant IV. Acclimatisation

1) I and III 2) II and IV 3) I and IV *4) II and III

69. [A]: Plants obtained through tissue culture should be acclimatized

[R]: Plants developed in tissue culture method fail to develop cuticle of required thickness to survive in

natural conditions

*1) Both A and R are true and R is the correct explanation of A2) Both A and R are true but R is not the correct explanation of A




A) Proteomics I) Parentage disputes *1) III II V I

B) Bioremediation II) Minimising pollutants 2) IV II V I

C) Genomics III)Application of information science

for the study of Polypeptides3) III IV II V

D) DNA finger printing IV) Usage of microbes as fertilizers 4) III V I II

V)Computer based study of single set

of chromosomes

71. Labeled single stranded DNA is called as

1) C-DNA 2) Satellite DNA *3) Probe DNA 4) Phasmid

72. [A]: Genetic engineering is based on the principle of crossing over

[R]: Endonucleases and ligases are used in rDNA technology




73. The sequence of nitrogen bases (Nucleotides) of a DNA strand at its restriction site is identified from 5' 3'

as 1G2C3T4A. With respect to this match the following and identify the correct match.


A) 1 I) A 1) III V II IV

B) 3 II) C 2) IV III II I

C) 2 III) T *3) III IV I II

D) 4 IV) G 4) III V II I

V) G

74. Match the following with respect to Mushroom cultivation


A)Inocubation for Spawn

productionI) 8 days 1) V III I II

B)Sterilisation of prepared

compostII) 20 days 2) IV V II I

C) Spawning III) 80 days *3) V IV II I

D) Interval between successive IV) 2 days 4) V IV III II

http://www.cvisiontech.com/http://www.cvisiontech.com/


9/16

flushes

V) 15 days

75. Arrange the following events in correct sequence during Mushroom production.

I. Harvesting Flushes II. Usage of Spawn III. Usage of Rice bran

IV. Maintainnace of 160C temperature in production room

*1) III, II, IV, I 2) III, IV, II, I 3) II, III, IV, I 4) I, IV, II, III


SCP organism Plant Group DemeritI) Scenedesmus Algae Low cell density

II) Paecilomyces Bacterium High RNA content

III) Chaetomium Fungus Slow growth rate

IV) Brevibacterium Bacterium Poor in Methionine

*1) I, III 2) II, IV 3) I, II 4) III, IV


SCP organism Plant Group Demerit

I) Scenedesmus Algae Low cell density

II) Paecilomyces Bacterium High RNA content

III) Chaetomium Fungus Slow growth rate

IV) Brevibacterium Bacterium Poor in Methionine

*1) I, III 2) II, IV 3) I, II 4) III, IV78. Varieties developed by the following methods are always heterozygous

I. Mass selection II. Pureline selection III. Clonal selection

1) I and II 2) II and III *3) I and III 4) I, II, III


Crop Method used for development Variety developed

I) Paddy Pureline selection IR-8

II) Bajra Mass selection Pusa Moti

III) Cotton Mass selection Dodahatti Local

IV) Mango Clonal selection Kufri Safed

1) I and II 2) III and IV *3) II and III 4) I and IV

80. Match the following with respect to Hybridisation


A) Selfing in Parent I) To select the desirable hybrids 1) III II I V

B) Emasculation II) To avoid self pollination 2) III II V IV

C) Bagging III) To develop homozygosity 3) II III IV I

D) Selfing in F1 plants IV) Artificial cross pollination *4) III II V I

V) To avoid unwanted cross pollination

81. [A]: Agar Agar is used in making semisolid media

[R]: It provides required carbohydrates to the explant in tissue culture.




82. One of the following is first to induce test tube fertilization in Plants.

1) M.O. P. Iyengar *2) P.C.Maheswari 3) Birbal Sahni 4) Nawaschin



A)Gametophyte parasitic onsporophyte of another species

I) Fire Moss 1) II V IV I

B)A gametophyte possesses

gametophyte of another species assymbiont

II) Pyricularia *2) II IV V I

C)Sporophyte of a species parasiticon sporophyte of another species

III) Chlorella 3) III IV V II



10/16

D)Sporophyte of a species parasiticon the gametophyte of the samespecies

IV) Anthoceros 4) II III I V

V) Orobanche

84. Modified aerial adventitious roots are seen in

I. Asparagus II. Tinospora III. Jussiaea IV. Striga

1) I and II 2) II and III 3) III and IV 4) I and IV

85. Functional modified roots eventually become functionless in

1) Taeniophyllum 2) Avicennia 3) Vanda *4) Santalum

86. Choose the correct statement

*1) Phylloclades have modified leaves

2) In Asparagus assimilatory branches arise in the axil of spines

3) A sucker has adventitious roots at every node

4) Offsets are horizontally growing axillary branches seen only in hydrophytes

87. Arrange the following plants in sequence of their modified stems showing positive geotropism to

negative geotropism.

I. Amorphophallus II. Helianthus tuberosus III. Lippia nodiflora IV. Chrysanthemum

1) III, II, IV, I 2) II, III, I, IV *3) II, III, IV, I 4) III, IV, I, II

88. Primary rachis lacks leaflets in

1) Tamarindus 2) Moringa *3) Acacia 4) Coriandrum

89. Arrange the following plants with gradual increase in the number of leaflets per leaf.

I. Clematis II. Hardwickia III. Pisum IV. Aegle

*1) II, IV, I, III 2) II, I, IV, III 3) I, II, III, IV 4) II, III, I, IV

90. Opening of flowers is neither centripetal nor centrifugal in

1) Coriandrum 2) Chrysanthemum 3) Jasminum *4) Ficus

91. Study the following table and choose the correct combinationPlant Leaf character Inflorescence character

I) Yucca Spinous leaf Compound cyme

II) Gynandropsis Pentafoliate compoundleaf

Simple corymb

III) Coriandrum Decompound leaf Involucreated

IV) Acalypha Leaf mosaic Simple spike

1) I and II *2) II and III 3) III and IV 4) II and IV

92. [A]: Self pollination is absent in Vanda

[R]: Orchidaceae plants are self incompatible



3) A is true but R is false *4) A is false but R is true93. Choose the plants in which 5 margins of their perianth lobes of a cycle are overlapped in their

aestivation.

I. Calyx of Hibiscus II. Corolla of Datura

III. Corolla of Crotalaria IV. Calyx of Catheranthus

1) I, II 2) III, IV 3) I, III *4) II, IV

94. Unilocular ovary with axile placentation is seen in

*1) Capsicum 2) Dianthus 3) Brassica 4) Cucurbita



11/16

95. If complete megaspore mother cell transforms into an embryosac, the ratio between the number

of meiotic and mitotic spindles is

1) 3:7 2) 4:3 *3) 3:4 4) 2:7

96. Mesocotyl is

1) Region of tigellum where cotyledon is inserted

*2) Region of tigellum between insertion of cotyledon and point of origin of coleoptyle

3) Region of tigellum between the point of origin of coleoptyle and coleorhiza

4) Region between plumule and cotyledonary node

97. Flowers of Kigelia are pollinated by

1) Bird 2) Insect *3) Mammal 4) Snail

98. Vienna code 2006 was the outcome of

1) XVI International Botanical cogress *2) XVII International Botanical congress

3) XVIII International Botanical cogress 4) XIX International Botanical cogress



A) Charak I)Classified plants on the basis ofHabit *1) II V IV I

B) Susruta II)Classifed Plant kingdom into 50groups

2) II IV V I

C) Linnaeus III)Classified plants on the basis ofhabitat

3) III V IV II

D) Theopharstus IV)Classifed plant kingdom into 87orders

4) II V I IV

V)Classified medicinal plants into37 sections

100. Stellate epidermal hairs are seen in

1) Ruscus 2) Lycopersicon 3) Abrus *4) Gossypium

101. [A]: Alae have posterior margin outside and anterior margin inside

[R]: Wing petals are overlapped by Vexillum




102. The following plant has both tricyclic and tetracyclic flowers

1) Datura *2) Smilax 3) Tephrosia 4) Thespesia

103.Torus is a part of

1) Nuclear envelope *2) Middle lamellum 3) Primary wall 4) Secondary wall

104. Lipidless cell organelle is

1) Mitochondrion 2) Peroxisome 3) Glyoxysome *4) Ribosome

105. [A]: mRNA is devoid of intramolecular hydrogen bonding.

[R]: It does not form hydrogen bonds with other nucleic acids.




106. Collenchyma with intercellular spaces is seen in

1) Datura 2) Helianthus 3) Cucurbita *4) Leucas

107. Vessels with very high amount of Lignin show

1) Scalariform thickenings 2) Reticulate thickenings 3) Spiral thickenings *4) Pitted thic



12/16

108.Coenocytes are

1) Cells of epitherm 2) Epithelial cells of secretory tissue

*3) Latex cells 4) Cells of nectaries

109. A cross is made between F1 hybrid of Pisum sativum dihybrid cross and a plant with Yy rr

genotype. Match the following genotypes or phenotypes of the offspring of the resultant crosswith the respective probabilities.


A) Yy rr I) 3/8 1) IV I V IIB) Yellow wrinkled seeds II) 1/8 2) IV II V III

C) Green wrinkled seeds III) Zero *3) IV I II III

D) YY RR IV) 4) III I II V

V)


Scientist Contribution 1 Contribution 2

I) Linnaeus Proposed the taxon

order

Classification rules

II) Bauhin Binomialnomenclature

Description of 6000plants

III) De Candolle Natural system ofclassification

Symmetry of flower

IV) H.G. Khorana Artificial synthesisof gene

Deciphering Geneticcode

1) All except I 2) All except II *3) All except III 4) All

111. A phanerogam whose roots are externally in symbiotic association with a bacterium and

internally in symbiotic association with a fungus and maintains parasitic association with an

angiosperm shows the following features.

I. Diarch roots II. Dimorphic chloroplastsIII. Motor cells IV. Spikelets

1) All 2) I and II 3) II and IV *4) II, III, IV

112.Match the following


A)Inflorescence is involvedin vegetative and sexualreproduction

I) Stachys tubifera 1) II V III I

B)Stem and leaves are

vegetatively propagatedstructures

II) Globba *2) II V I III

C)Vegetatively propagatingbranch

III) Artabotrys 3) III IV V II

D)Peduncle modified intoHook

IV) Dioscorea 4) IV V I III

V) Scilla

113. Pinnately lobed simple leaves are present in

I. Ipomoea batatus II. Ipomoea quamoclit III. Brassica IV. Argemone

1) All *2) II, III, IV 3) III, IV 4) II, III

114. If the inflorescence of clerodendron has 4 generations of branches, the total number of flowers in

the inflorescence must be

1) 9 2) 15 *3) 31 4) 63

115. Floral leaves of the following plant show nether cohesion nor adhesion

1) Hibiscus *2) Magnolia 3) Malvaviscus 4) Martynia


Plant character Type of Ovule A B C D



13/16

A)Plant with aereoles onthe modified stem

I) Anatropous 1) IV III II V

B)Plant with tetradynamousandroecium

II) Amphitropous 2) IV III V I

C) Plant with Anthodium III) Campylotropous *3) IV III I V

D)Plant with heterophyllyand Homogamy

IV) Circinotropous 4) V I III IV

V) Hemitropous

117. Nucleus of following cell of embryosac is suspended like the nucleus of Spirogyra cell bycytoplasmic threads

1) Synergid *2) Central cell 3) Egg cell 4) Antipodal

118. Seeds are both perispermic and endospermic in

*1) Piper 2) Capsella 3) Datura 4) Nymphaea



A)Externally invisible truefruit

I) Caryopsis 1) V IV II III

B)Dry dehiscent fruit showsmore resemblance with

dry schizocarpic fruit

II) Cypsela 2) IV V II I

C) Fruit with persistent calyx III) Loculicidal capsule 3) V IV I II

D)Fruit formed from flowersof spikelet

IV) Septicidal capsule *4) V IV II I

V) Pome


Plant Character Family

I) Sida cordifolia Pentalocular ovary Malvaceae

II) Ulex Spinous leaflets Fabaceae

III) Hyoscyamus niger Obliquely placed ovary Solanaceae

IV) Lilium Polyembryony Liliaceae

1) III, IV 2) I, II *3) II, III 4) I, IV121. Study the following table and choose the correct combination

I) EndoplasmicReticulum

Extensive unit membranesystem

Forms Golgi

II) Golgi Complex Made of Dictyosomes Forms Lysosomes

III) Peroxisomes Synthesises Phospholipids Involved in Serineformation

IV) Lysosome Has enzymes of 2nd

class Formed from cisternae ofEndoplasmic Reticulum

*1) I and II 2) II and III 3) III and IV 4) II and IV

122. [A]: Nucleosome is not having H1 protein

[R]: Chromatin has nucleic acids and basic proteins


*2) Both A and R are true but R is not the correct explanation of A


123. Each chromosome has contact with spindle fibres of only one pole during

I. Diplotene II. Metaphase I III. Mitotic Metaphase IV. Mitotic Anaphase

1) I and II 2) II and III 3) II, III, IV *4) II and IV

124. Fruits grow in size due to the activity of

1) Apical meristem *2) Intercalary meristem 3) Lateral meristem 4) Secondary

meristem



14/16

125. Sclereids commonly seen in the leaves of Dicots are

I. Osteosclereids II. Brachy sclereids III. Malpighian cells IV. Astrosclereids.

1) I and II 2) III and IV *3) I and IV 4) II and III

126. Choose the correct statements

I. Vessels are seen in all cryptogams and Phanerogams

II. Sieve cells are anucleated living cells

III. Protoplasm of one sieve tube element is extended into another sieve element through sieve

pores.

IV. Companian cells are not seen in Archegoniates.

*1) Onle I is correct 2) II and III are correct 3) II, III, IV are correct 4) Only IV is correct.

127. Either externally or Internally xerophytic characters are not noticed in the following xerophyte.

1) Calotropis 2) Agave *3) Tribulus 4) Nerium

128. Choose the crosses of Pisum sativum varieties which do not form the plants with the genotypes

as YYRR.

I. Yy Rr X Yy Rr II. YY Rr X Yy rr III. YY rr X yy RR IV. Yy RR X YY Rr

1) I and II *2) II and III 3) III and IV 4) II and IV

129.During the following type of chromosomal mutations, one chromosome is subjected to deletion

and another chromosome is addition.

1) Inversion 2) Reciprocation 3) Duplication *4) Translocation



A) Digitalis I) Bio-diesel plant 1) IV V I II

B) Azolla II) SCP organism *2) IV V II I

C) Spirulina III) Biofertiliser 3) V IV II III

D) Jatropa IV) Medicinal plant 4) IV V III I

V) Bioremediation

131. Plnat X has Quincuncial aestivation in its calyx and tetralocular ovary in its gynoecium. Plant Y

has suppressed endosperm formation and dead multiple Rhizodermis. The modified roots in X

and Y are respectively

1) Storage root, Parasitic root 2) Epiphytic roots, Respiratory roots

*3) Storage root, Photosynthetic roots 4) Storage tap root, Root nodule

132. Modified stems and modified roots are seen in

I. Oxalis II. Asparagus III. Amorphophallus IV. Ruscus

1) All except I 2) All except II 3) All except III *4) All except IV

133. [A]: Leaves with convergent venation are unlobed

[R]: All unlobed leaves have convergent venation1) Both A and R are true and R is the correct explanation of A



134. Inflorescences with trimorphic flowers are seen in

I. Colocasia II. Tridax III. Mangifera IV. Euphorbia

1) I, II 2) II, III 3) III, IV *4) I, III



A) Dichlamydeous unisexual I) Ficus 1) V IV II III



15/16

flowers

B)Monochlamydeousbisexual flowers

II) Vernonia 2) IV V III II

C)Dichlamydeous bisexualflowers

III) Poinsettia *3) V IV II I

D)Monochlamydeous

unisexual flowersIV) Amaranthus 4) V IV III I

V) Mangifera

136. If a Brassica microsporangium has meiocytes equal to the number of meiocytes of Pterissporangium, the total number of male gametes produced by microspores of a Brassica flower is

1) 1152 *2) 2304 3) 576 4) 2204

137. Double fertilization was first discovered in plants with

I. Monosporic embryosac II. Bisporic embryosac III. Tetrasporic

embryosac IV. Trisporic embryosac

1) I, IV 2) II, III *3) only III 4) I, III

138. Series of Bentham and Hookers classification with superior ovary are

I. Disciflorae II. Heteromerae III. Coronariae IV. Bicarpellatae

*1) All 2) All except I 3) All except IV 4) All except II139. Root has medicinal value in

I. Withania II. Smilax III. Derris indica IV. Trigonella

1) III, IV *2) I, II 3) II, IV 4) I, III



A)Trimorphic unisexualflowers

I) Poinsettia *1) II IV V I

B)Trimorphic bisexual

flowersII) Ficus 2) II V IV I

C)Dimorphic bisexual

flowers

III) Mangifera 3) IV V II III

D)Dimorphic unisexualflowers

IV) Lythrum 4) II IV I V

V) Oldenlandia


Fruit Feature I Feature II

I) Syconus Edible peduncle Several achenes

II) Sorosis Developed from racemoseinflorescence

Always fleshy

III) Schizocarp Developed from multicarpellary ovary Splits vertically

IV) Hesperidium Developed from multicarpellary ovary Edible mesocarp

1) I and II 2) II and III 3) III and IV *4) I and III

142. The resolving power of human eye is

1) 1 mm *2) 0.1 mm 3) 10 4) 0.5 mm

143. A DNA molecule has 150 hydrogen bonds. 14% of them are present in the 1st

spiral, 16% in the

2nd

spiral, 18% in the 3rd

spiral, 20% in the 4th

spiral, 14% in the 5th

spiral and the remaining in the

6th

spiral. The percentage of Adenine in the DNA molecule is

1) 25% 2) 30% 3) 20% 4) 15%

144. [A]: All dicots show secondary growth.

[R]: Vascular bundles of Dicot stem are open type.



16/16




145. Tracheids containing special tissue is seen in

1) Pinus 2) Ficus 3) Eucalyptus *4) Pothos

146. [A]: Vascular bundles of roots are described as separate vascular bundles.

[R]: Xylem and Phloem of root bundles are in different radii


*2) Both A and R are true but R is not the correct explanation of A3) A is true but R is false 4) A is false but R is true

147. Photosynthetic secondary tissue is

1) Periderm *2) Phelloderm 3) Exodermis 4) Exothecium

148. [A]: Cuticle is absent in ceratophyllum

[R]: Ceratophyllum is submerged hydrophyte




149. Choose the genotypes that show Mendelian recombinations

I. TT yy II. Tt YY III. Tt Yy IV. tt Yy

1) I and III 2) II and IV 3) I and III *4) I and IV

150. Trichoblasts are absent in

I. Assimilatory roots II. Adventitious roots III. Haustorial roots IV. Ectomycorrhizae

*1) I, III, IV 2) II, III, IV 3) I, II, IV 4) I, II, III


Date post:	08-Apr-2018
Category:	Documents
Upload:	naresh-kosuri
View:	224 times
Download:	0 times

Eamcet Botany Model Paper

Documents