Earthworms as a Potential Carrier of Mycobacterium bovis in Bovine Tuberculosis TransmissionBy Nicola Wilton (11203806)

A report submitted in part fulfilment of the examination requirements for the award of a BSc (Hons) degree title awarded by the University of Lincoln, June 2014, supervised by Dr Subhajit Biswas.

This is to certify that I am responsible for the work submitted in this thesis, that the original work is my own, except as specified in the acknowledgements and in references, and that neither the thesis nor the original work contained therein has been previously submitted to any institution for a degree. Signature: Name: Date:

Abstract:Methods of Bovine Tuberculosis transmission in the UK are still relatively unknown with this study aiming to address one possible route of infection. The idea was to investigate whether Mycobacterium bovis could be transmitted from cattle to badgers via invertebrates important to badger diet. It was hypothesized that these invertebrates may become infected through exposure with infected cattle faeces. The presence of M. bovis was tested for in earthworm samples (n=29) collected from cattle-occupied fields in Lincolnshire that were known to be frequented by badgers. Nucleic acid extraction, M. bovis-specific semi-nested PCR and gel electrophoresis were used to ascertain a result as to whether identified earthworms harboured this pathogen. Despite positive PCR controls, no discernible bands were seen resulting in a negative outcome. However it may be beneficial to implement the use of a TB outbreak farm of which did not feature within this study. 1. Introduction 1.1 Implications of Bovine TuberculosisBovine Tuberculosis (bTB) remains to be one of the most problematic and challenging diseases faced by Britain today. It continues to be of great concern to governmental and farming bodies, both of which are implicated with substantial financial losses associated with the spread of bTB (Skuce, et al. 2012). The UK exhibits the highest incidence of bTB than any other country within the European Union (Smith, et al. 2011) illustrating the problematic incidence of this infectious disease. Throughout a period of 10 years, DEFRA have released statistics marking a 500 million spend on bTB, with an expectant estimate reaching 1 billion over the next decade without further action taking place. A recent statement by DEFRA also expressed an ambition to achieve a Bovine TB free status within a 25 year period in the UK (Gov, 2013). This makes it all the more important to address areas of uncertainty regarding this disease and methods involved in transmission.1.2 What is Mycobacterium bovis?Mycobacterium bovis, the causative agent of bTB and an ecotype of the M. paratuberculosis complex initiates this chronic and infectious disease. It is one of the many components that make up the Mycobacterium tuberculosis complex of which closely related ecotypes include M. microti, M. tuberculosis (a human bacterial pathogen) and M. africanum (Smith, et al. 2011; Moda, et al. 1996). M. bovis has a wide host range, not exclusively affecting maintenance hosts such as cattle and badgers but also spill-over hosts including dogs, llamas, goats, pigs and cats (Broughan, et al. 2013). bTB is potentially zoonotic, capable of transmission to humans who ingest milk from infected cattle although since the pasteurisation of milk, these once high figures are now largely diminished (Torgerson & Torgerson, 2010). Since the year 2000, cases of human M. bovis infection has remained to be around 0.5% (Stone, 2012) and is very rarely fatal. This contrasts to historical figures of an estimated 200,000 human deaths from 1900 to 1950 (Smith & Phillips, 2000). 1.3 EpidemiologyFrom the times when bTB was heavily encountered in cattle, the situation has not much changed as currently in Britain it is now classed as endemic in areas including the southwest, parts of central England and southwest Wales. Sporadic outbreaks also occur throughout the rest of the country (Gilbert, et al. 2005). It is not only problematic for the UK though, with bTB identified in every cattle-farming continent of the world (Smith, et al. 2011). Epidemiological factors of the disease are particularly complex, incorporating inter-species transmission spreading infective M. bovis bacilli from cattle to cattle as well as through wildlife reservoirs which differ depending on geographical location (Corner, et al. 2011; Drewe, et al. 2013). 1.4 bTB in the NewsRecent cases have recorded the first ever incidence of cat to human bTB transmission gaining exposure in the popular press, although the occurrence of this is still regarded as incredibly rare (BBC, 2014). Reports regarding bTB continue to capture public interest, with the topic of controversial badger culls dividing opinion throughout the UK (White & Whiting, 2000). With this awareness reaching the public domain, the importance of continued research is ever highlighted to reduce the incidence of bTB and its impact on British wildlife and farming.1.5 Transmission RoutesThe Eurasian badger (Meles meles) has been identified as being one of the most important routes of transmission within the UK (Corner, et al. 2011) however badgers are not the only British mammal responsible for the spread, with deer species (including Cervus, Capreolus and Dama sp.), red fox (Vulpes vulpes), mink (Mustela vison) and brown rat (Rattus norvegicus) amongst those implicated (Delahay, et al. 2001). Methods of transmission for this respiratory disease comprise of direct and indirect routes, with direct being contact between badgers and cattle themselves on a site such as pasture or indoor cattle housing. Indirect is through infective badger secretions namely urine and faeces (Skuce, et al. 2012; Wilson, et al. 2011) with aerosol transmission of airborne bacilli believed to be the main route of transfer (Mullen, et al. 2013). However the exact means of how cattle contract M. bovis from badgers and vice versa remains unclear (Olea-Popelka, et al. 2006; Wilson, et al. 2011). Woodroffe, et al (2006) highlighted the relationship between cattle to badger transmission, suggesting that better control of the disease occurring in cattle would help to lower the presentation seen in badgers. This was observed during a time when TB testing in cattle was reduced. The removal of TB infected cattle was delayed during a FMD outbreak and as a consequence, the prevalence of bTB in badgers was seen to rise. It was only when it began to be addressed again in cattle that it started to fall in badger populations. What is not explained though, is how badgers may contract the disease from cattle to begin with. 1.6 Earthworms and M. bovis?The potential impact that the environment may have in terms of the diseases transmission, especially in relation to ecology has not been extensively researched. As of yet, no research has been published in the UK regarding the possibility of invertebrates, such as earthworms, being able to harbour M. bovis, thus presenting a potential factor in the contraction of bTB within badgers. Earthworms are an important aspect to a cow pat, and may provide a potential explanation as to how badgers may become exposed to potentially infective M. bovis material. It is thought that earthworms migrate away from a cow pat site to be ingested by badgers; thus becoming an intermediary to the disease. Although Kruuk (1978) also recorded badgers digging up earthworms from cow pats directly. Earthworms make up a substantial amount of badger diet, with Mullen, et al. (2013) even stating that badgers may venture onto cattle-occupied pasture in order to forage, with preference to the shortly cropped grass regularly grazed by cattle (Kruuk, 1978). Within Great Britain, the most abundant earthworm and often preferred by badgers themselves is Lumbricus terrestris (Ward, et al. 2010). This type can be described as anecic and is one of the largest of its species, commonly found in regions throughout the UK (Griffith, et al. 2013). Earthworms such as this one may potentially come into contact with M. bovis infected material through cow pats produced from bovine TB positive cattle. As reported by Beynon, et al. (2012), earthworms contribute greatly to the later stages of decomposition of dung, normally after their invertebrate counterparts, such as the beetle, which work to break up the dung pat. To a temperate ecosystem, earthworms can be regarded as a vital component to dung removal through its transport into the soil (Svendsen, et al. 2003). Through this action however, earthworms may be exposed to the M. bovis pathogen, carrying it on the skin or internally and providing a further means to continue the spread. 1.7 Mycobacteria Isolates from EarthwormsPrevious research showed that Mycobacteria can be isolated from earthworms, reported by Fischer, et al. (2003), who found that earthworms may become passive vectors of these organisms. It was also stated that they are capable of protecting the bacteria from actions that would otherwise kill them such as disinfectants. Amongst the species of Mycobacteria isolated were: M. paratuberculosis, M. avium and M. gastri however M. bovis was not incorporated. It was however mentioned that it could be isolated from fly imagoes that had previously come into contact with tuberculosis lesions in cattle within a slaughterhouse. Moravkova, et al. (2011) also published a study on the findings of Mycobacterium species within earthworms and isolated M. diernhoferi, M. fortuitum and M. smegmatis amongst others showing Mycobacteriums capability to be found in earthworms.1.8 Current Study The current study aimed to investigate the presence of M. bovis within environmental earthworm samples, relating to the spread of bTB in badgers. It was hoped to isolate strains of M. bovis by implementing M. bovis-species specific semi-nested PCR as previously mentioned by Taylor, et al. (2007), to detect this pathogen within earthworm samples. 2. Materials and Methods2.1 Sampling Site Characteristics A farm within North Lincolnshire, England was selected for earthworm sampling with permission obtained from the owner prior to collection. This farm was situated in Bainton, near Brigg (53 32'34.46"N - 0 30'22.83"W) and had a previous history of TB cattle reactors with badger activity also observed within the farm. The pasture type selected for earthworm collection was permanent and ley pasture accommodating grazing cattle on a rotation basis, however at the time of collection no cattle were present. 2.1.1 Earthworm Collection Earthworms (n=29) were collected at random from 2 different ecological parameters. For the purposes of comparison, samples were recovered directly under the cow pat as well as within a 50cm margin. Two extraction methods were followed, the first with use of a 0.02% formalin solution, which worked as an irritant encouraging burrowed earthworms up to the surface. Once extracted from the soil, these samples were then washed with distilled water. The second of the 2 methods followed with hand sorting, manipulating the cow pat and teasing it apart to extract earthworms. At the margin, 25 - 30cm holes were dug to retrieve these samples, which were also washed with distilled water to remove soil debris. All earthworms used for study were humanely killed either on ice or with a 10% vodka/ethanol solution. Samples were placed into polythene bags and stored at 4C in preparation for identification and dissection. 2.2 Identification and Dissection After allowing specimens to warm to room temperature, they were washed in a beaker of water to remove any further debris. All of the samples were then categorically identified. An identification key was utilised for this, with supplementary confirmation using a UV light to highlight the fluorescent properties of setae as followed by McManus (2007). Dissection then proceeded, incorporating only the tail or gut for testing, with the exception of smaller earthworms (below 3cm) which were used whole. Small earthworms which were slightly larger in size were merged and the tail and gut samples were dissected and pooled. It was important to only fill a 1.5mleppendorf tube halfway with the sample, to allow an equal measurement of the lysis buffer later incorporated into the DNA extraction process. Tubes were then stored in a -80C freezer. 2.3 Selected SamplesA total of 5 earthworms were selected for further testing, including A. rosea (sample 10, tail), A. calignosa (sample 7, whole), L. terrestris (sample 14, gut), E. fetida (sample 25, whole) and a pooled sample of 3 specimens (A. rosea tails; samples 1-3). These were chosen to try and incorporate a range of species along with a variety of tissue types, with a representation of earthworm species found in table 1. Within the first part of this study (Study 1) DNA from the earthworms were pooled (EP1) but aliquots of individual sample DNAs were kept separate for further analysis in Study 2.Table 1 Identification of earthworm species recovered from both cow pat and margin sites. Sample Number(Cow Pat)Earthworm SpeciesSample Number(Margin)Earthworm Species

1Aporrectodea rosea14Lumbricus terrestris

2Aporrectodea rosea15Lumbricus terrestris

3Aporrectodea rosea16Aporrectodea rosea

4Aporrectodea rosea17Eisenia fetida

5Aporrectodea rosea18Aporrectodea longa

6Aporrectodea rosea19Aporrectodea longa

7Aporrectodea calignosa20Lumbricus terrestris

8Immature Aporrectodea longa21Octolasion cyneum

9Immature Aporrectodea longa22Aporrectodea longa

10Aporrectodea rosea23Aporrectodea rosea

11Aporrectodea rosea24Aporrectodea rosea

12Aporrectodea rosea25Eisenia fetida

13Aporrectodea rosea26Lumbricus rubellas

27Aporrectodea rosea

28Aporrectodea rosea

29Immature Aporrectodea longa

2.4 DNA Extraction from Processed Earthworm Samples using the NucliSENS miniMAG system NucliSENS miniMAG (bioMrieux) was used for the isolation of nucleic acids and followed in accordance to the manufacturers instructions in regards to the use of NucliSENS solutions. The study was run in parallel to a similar protocol set out by Taylor, et al. 2007 with some modifications to the original protocol adapted for suitable application. To initiate the lysis stage, 500l of NucliSENS lysis buffer (containing 5M Guanidinium) was added to each thawed sample. The next stage was in binding, with glass beads (Supelco) used to aid the release of DNA. These were vortexed (Genie 2, Mo-bio labs) for 15 minutes at mark 8 and then microfuged (Microfuge 3000) at 13,000 rpm for 5 minutes. The supernatant was isolated and centrifuged again at the same rate with 200l of vortexed silica solution then added to the samples. The samples were washed with 500l of wash buffer 1, 2 and 3; amended from the original manufacturers protocol. After addition of the elution buffer, the solution was incubated for 10 minutes at 70C in the thermoshaker at 1450rpm. All eluate (100l) of extracted samples were stored in -20C freezer. In order to obtain maximum yield and to see if any nucleic acids were attached to the silica, 200l of elute buffer was added and incubated again at 70 in the thermoshaker. This proved unnecessary however, as maximum yield was already seen to be obtained prior to this step. 2.5 Assessing Nucleic Acid Purity (NanoDrop)In order to quantify the amount of DNA obtained, Thermo Scientific NanoDrop 2000 spectrophotometer was utilised and used as per manufacturers instructions. 2.6 PCR methodsA semi-nested PCR protocol was run in accordance to Taylor, et al. (2007), with use of the same RD4 and IS1081 primers as seen in Table 2. High fidelity (HF) Taq (Roche) enzyme mix was used for this study and carried out per manufacturers instructions with recommended amounts applied routinely to all applicable samples. The first mix comprised of dNTP, primers, RNase free water and DNA template for each sample. Mix B, the enzyme mix was made up of RNase free water, buffer 2 and Taq enzyme used for both PCR processes. The first stage of PCR (PCR1), carried out by ThermoCycler PCR, commenced with the use of F1 and R1 (RD4) and F2 & R1 (IS1081) primers. The PCR process ran for 45 cycles of amplifications following this specified programme: the initial denaturation stage started with 95C for 8 minutes (1 cycle); then 45 cycles of denaturation at 95C for 15 seconds. Annealing was at 58C for 15 seconds (according to Taylor, et al. 2007) and extension at 72C for 30 seconds. Final extension occurred at 72C for 5 minutes (1 cycle). The second round PCR (PCR2) comprised 2l of the product produced from PCR1 used as a template for RD4 and IS1081. F2 and R1 primers for RD4 and F2 and R3 primers for IS1081 were used for this process. PCR2 conditions started at 95C for 8 minutes (1 cycle), followed by 95C for 15 seconds. Annealing temperature for PCR2 RD4 and IS1081 were 58.5C and 56.5C respectively for 15 seconds, with 72C for 40 seconds set to run for 45 cycles. This concluded with 72C at 5 minutes for 1 cycle. A positive control (237bp product) was also incorporated into PCR1 and PCR2 including DNA from norovirus attained from another study. The primers 443 and 444 in accordance with La Rosa, et al. (2012) were used for PCR1 and PCR2 respectively, as shown in table 3, with an annealing temperature of 46.5C. The negative control was made using water as a template. After completion, samples were frozen in a -20C freezer. Table 2 PCR primer sequences used within the PCR process. Shows annealing temperatures and amplicon sizing for IS1081 and RD4 primers. Reproduced from Taylor, et al. (2007). PCRPrimerSequenceAnneal. Temp (C)Amplicon Size (bp)

ISI081F2R2R35 -CTGCTCTCGACGTTCATCGCCG-35'-GGCACGGGTGTCGAAATCACG-3'5-TGGCGGTAGCCGTTGCGC-358135113

RD4F1F2R15-AATGGTTTGGTCATGACGCCTTC-35-TGTGAATTCATACAAGCCGTAGTC-35-CCCGTAGCGTTACTGAGAAATTGC-358176142

Table 3 NoV primers used for positive control during PCR, adapted from La Rosa, et al. (2012).PCRPrimer (fw or rev)PathogenSequence

443ReverseGITCATCATCACCATAGAAIGAG

ForwardGIATACCACTATGATGCAGAYTA

444ReverseG11AGCCAGTGGGCGATGGAATTC

2.7 Agarose Gel Electrophoresis (AGE)In order to ascertain the amount of product within the sample, gel electrophoresis was selected as recommended by Taylor, et al. (2007). To make a 1.5% agarose gel, 100ml of TBE buffer was made to 900ml of distilled water before mixing 2.25 g of agarose powder with ready-made buffer. This was then added to150ml of buffer and microwaved at 900w for 1 minute and then a further 1 minute and 30 seconds. 15l safeview nucleic acid stain (at 1ml/ 10ml gel NBS Biologicals) was added and emptied into the gel tray. After combe removal bromopherol blue (Bioline) and the DNA ladder of 100bp (Hyperladder IV, Bioline) were vortexed and 5l of loading dye was added to 10l of the sample. Ladders were positioned at either side of the samples along with positive and negative PCR controls to be used in aiding interpretation of the results. Finally, 75V was set for 60 minutes, further extended to 90 minutes and viewed under a UV transilluminator. 2.8 Further DNA PurificationUse of the DNeasy Blood & Tissue Kit (Qiagen) was incorporated into the first study; in order to further purify total DNA, with the process following the protocol as outlined by the manufacturer.2.9 Repeats (Study 2)This study was also repeated again, with the same 5 earthworm samples tested individually, with slight alterations made to some of the protocols. The main modification was the use of ISI081 only, ran in accordance to Taylor, et al. (2007). During gel electrophoresis, a 3% agarose gel was made as opposed to 1.5%, in the hope that it would be more sensitive, with changes made to original mixtures in order to accommodate a higher concentrated gel. 3. Results3.1 Species Identified After Collection.During identification, earthworms were separated into 2 groups: cow pat and margin. These represented the earthworms collected in separate ecological areas, with a higher number (n=16) retrieved from the margin in comparison to n=13 found within the cow pat. A surprising result observed was that the majority of earthworm isolates from the cow pat were predominantly A. rosea. A representation of the percentages found within the cow pat can be seen in figure 1. A wider variety of species can be seen within the margin extraction, with double the amount of identified species found within the cow pat. In comparison to the cow pat site, even though A. rosea was also found to be the most abundant, except the boundary was not as large. Diagrammatic representations of this can be seen in figure 2.

Figure 1 - Earthworm prevalence and species identified in collected samples from a cow pat.

Figure 2 -Earthworm prevalence and identified species collection from the margin of a cow pat.

3.2 Assessment of DNA PurityAfter nucleic acid isolation, the amount of DNA obtained was analysed in the pooled sample (study 1) along with the assessment of sample purity, the results of which can be seen in figure 3. A total of 66.7 ng/l of DNA was gathered and showed very little levels of contamination overall.

Figure 3- Results from the NanoDrop, 2000 of DNA quantification for the earthworm sample EP1.

3.3 Gel ElectrophoresisResults for both ISI801 and RD4 were negative (figure 4) which is further highlighted when compared to the positive control. With a comparison of primers, it was observed that IS1081 picked up more of a result reported in Taylor, et al. (2007) than its RD4 counterpart. With this in mind, a second experiment was run in order to clarify the result and determine if the ISI801 primer would produce more of a result due to its increased sensitivity (Taylor, et al. 2007). This was carried out with 5 individual earthworm samples as opposed to pooled. Due to the high percentage of gel (3%) upon the removal of the combes, it was noted that many of the wells were broken and unsuitable for use, meaning only 2 out of the 5 samples (E10 and E12) were tested for. The results of which can be observed in figure 5.

Figure 4 Results of the first gel electrophoresis after semi-nested PCR ran on a 1.5% agarose gel. Wells 1, 11: ladders (100bp), 2 and 4 shows EP1 pooled samples for RD4 and IS1081 respectively. Samples from another study were also run on the gel (well 3, 5). Well 6: negative control, 7: positive control (443 PCR, 237 bp, La Rosa, et al. 2012). Wells 8-10 contained samples from a different project.

Figure 5 Results from the second gel run on a 3% agarose gel. Not all of the samples seen on this gel are the subject of this study; other similar projects were also run in parallel. Wells 1,16,17 and 32: ladders (100bp) . 2-13: N/A. 14: Positive Control, 15: Negative Control. 18, 27 show the samples run in this study both with IS1081 primers using E10 and E12 samples. 19-26, 28-29: broken wells. 30, 31: N/A. Red pixilation observed on the gel is due to saturation of the camera and the bands being too bright.

The 2 samples that were run presented a negative result, with the positive and negative controls displaying that the gel was run correctly. It also showed the occurrence of primer dimers similar to those seen in the first gel. If results within this study were to register positive, clear bands would have been present on the gel, as observed with the positive control. RD4 PCR 2 would have generated a band at 176 amplicon size (bp) with IS1081 PCR 2 at 113 bp. 4. DiscussionThere are many aspects about bTB that are not yet understood, especially in terms of transmission and mechanisms of occurrence. The question as to how badgers could come into contact with a potential source of infection was aimed to be addressed within this study. Earthworms can be questioned in their role of bTB contraction with the potential scenario of earthworms infecting UK badgers as their major dietary component. This therefore implicated them as a potential transmission route. The study endeavoured to discover whether earthworms were able to harbour or contract M. bovis through contact with infected material. 4.1 How Might Earthworms Become Infected?Earthworms may be exposed to M. bovis in the environment when they undertake the natural process of aiding decomposition of organic matter e.g. cow dung. Some farmers even partake in vermicomposting of organic wastes, using earthworms to break down this matter. This reduces the use of synthetic fertilisers (Wani, et al. 2013) but creates an abundance of earthworms making an attractive site for foraging badgers. With active M. bovis agents shed in the dung (Phillips, et al. 2003), earthworms may contract the pathogen either on the skin or ingest internally which may infect badgers through ingestion of this contaminated food source. 4.2 Sample ChoiceDuring dissection, the gut and tails of the earthworms were specifically chosen to test for the presence of M. bovis, justified due to the potential of finding these organisms within these particular isolates. The tails, along with coelomic fluid was hypothesized to be of importance. Within earthworms, they have developed a special adaptation of regenerating damaged caudal segments or replicating those that have been lost. Especially in the case of E. fetida who shed segments when insoluble waste is no longer able to be stored within the coelom (Sims & Gerard, 1985). This draws further inferences that M. bovis may be shed out in segments in an effort to rid itself of toxins. Attached to the end of caudal segments, coelomic fluid could be observed from the majority of the samples collected in this study. They are believed to have many properties, including: preventing desiccation, protection from predators and in the promotion of cutaneous respiration. It has also been found to be a good source of DNA as reported by Minamiya, et al. (2011). Earthworm guts were also of interest due to the presence of ingested bacteria able to live within the gut, as experimented by Adnan & Joshi, (2013), who stated that earthworms help in microbe distribution and therefore fulfilling their role as a vector. So if ingestions of M. bovis were a possibility, isolating gut samples would be the best mechanism to detect this. 4.3 PCR & Gel ElectrophoresisAn ample amount of DNA was extracted from earthworm samples (as shown by figure 3) however after the first study run on the agarose gel, these results came back negative for the presence of M. bovis in a pooled sample collection. Looking particularly at EP1, this was tested using 2 semi-nested PCRs, RD4 and ISI801. This was paralleled by a study from Taylor, et al. (2007), who found RD4 to be less efficient as shown by a weaker result. They reported RD4 to be ten times less sensitive than ISI801, with a 50% sensitivity value compared to 70% for ISI801. This influenced a modification made to the second study within this experiment; this time only using the ISI801 primer. Amongst the modifications it also featured the use of a 3% agarose gel solution as opposed to the 1.5% used in the first study for better resolution of PCR mixtures. Due to the thickness of the gel, some of the wells were broken upon extraction of the combe, meaning only some of the original individual samples were able to be run. These 2 samples also came back negative for the presence of M. bovis after electrophoresis and can be hypothesized that the 3 that were not run would also have attained a similar result. This would be consistent with the results observed from the first half of the study, as pooling all of the samples into 1 heralded no match with M. bovis. This therefore provides the basis for the assumption that the individual samples contained within this would also be negative. This can be inferred through analysing the average DNA concentration (ng/ml) of the samples as seen in table 4. The mean of these samples totals 69.65 ng/ml of which is comparably similar to the pooled sample of 66.7 ng/ml as seen in figure 3, suggesting little DNA was lost. Semi-nested PCR was a fitting technique to use and chosen due to its abilities to amplify small amounts of target DNA, applied to the scenario expected to be encountered within this study. Enhanced sensitivity and detecting potentially problematic DNA is also amongst the listed perks for use of this technique (Gupta, et al. 2013).Table 4 Figures of DNA quantification for individual non-pooled earthworm samples after Nanodrop analysis. SampleNg/ml260/280260/230

E109.61.180.01

E711.31.290.02

E1381.31.760.5

E1-3176.41.540.06

4.4 Reasoning for Obtained Results The negative results observed in both study 1 and study 2 could be due to numerous reasons. It can be inferred that there was no presence of M. bovis to begin with within the samples, as the samples were not at fault due to the high presence of DNA obtained and observed after NanoDrop analysis. The farms included in this study were not outbreak farms, so no confirmed presence of bTB can be implied, thus this also applies to the presence of M. bovis. This gives a potential reason for the negative result as if there was no M. bovis to be contracted within the farm by the earthworms, that there would be no way for them to become infected in the first place. However, the study provides a basis for further investigation, to replicate and refine the methodology as created within this experiment, applied on an outbreak farm to rule out this method of transmission completely. High levels of DNA in EP1 (66.7 ng/l) compared nicely to levels expected to be seen in what is considered to be a good sample for testing. The DNA that was gathered showed very little contamination when compared to pure samples as set out by the manufacturers guidelines. Referring to the 260/280 reading which represents protein contamination, a value at 1.8 would normally be considered pure of which the result 1.98 is comparably similar. 260/230 representing other contaminants, saw a reading of 2.14 which can be compared to a 2-2.2 value considered to be pure and contamination free (Nanodrop, 2013). This then rules out any problem with the samples as there were both pure and clean, further demonstrated by extra cleaning by the DNeasy Blood & Tissue Kit as carried out in study 1. The positive and negative controls also showed up clearly in comparison, further suggesting no problem with the samples or the gel that was run.4. 5 Primer Dimerization after Gel ElectrophoresisResults obtained from the gel electrophoresis raised suggestions that primer dimers may have been present. These have an effect of the final yield of DNA produced (Das, et al. 1999) and can be found at high primer concentrations resulting in the occurrence of weak interactions (Brownie, et al. 1997). The likelihood of its occurrence has been likened to lengthy primers and insufficiency during small fragment removal, where sometimes this step fails to remove these dimers. The possibility of a high amount seen within this study could have interfered with their removal, resulting in their observation. Vandenbroucke, et al. (2011) reported primer dimer formation from hybridization of primer molecules combined with partial complementary sequences. These can be amplified during the stages of PCR, resulting in short amplicons being observed. These non-specific by-products are created through a duplex formation between 2 primers, which not only have the effect to decrease primer concentration but also create these non-specific products of DNA (Das, et al. 1999). For future reference, it is important to reduce the occurrence of primer dimerization, which can be achieved through a variety of methods. Following stringent conditions, careful primer design and the incorporation of enzymes, for example AmpliTaq GoldTM (Brownie, et al. 1997) are amongst a few of the methods that can be employed if this study was to be repeated.4. 6 Recommendations for the FutureIn order to gain clarity of these results, it would be highly beneficial to build on this study in terms of methodology and repeat in the future. There is room to improve upon this study, learning from mistakes and observations acquired throughout its duration. It would be justified to use ISI801 primers due to its increased sensitivity as well as increasing the time during gel electrophoresis in order to give it more time to develop. It is also reasonable to say that a 3% agarose gel may have been too high a percentage for this particular study, so in the future it must be preceded with a degree of caution, especially in the removal of combes to avoid leaking or broken wells. In regards to selecting the most appropriate gel percentage, generally speaking, a higher concentration of agarose helps to separate smaller fragments of DNA. Whereas a smaller percentage enables faster migration of DNA fragments, which works well when applied to the separation of larger DNA fragments (Barill & Nates, 2012). Smaller DNA fragments were aimed to be separated within this study, further justifying the use of a higher percentage agarose gel. For future investigation, running a 2% agarose may also be beneficial for consideration.Expanding the sample size and including differing farms from different areas of the country can be recommended upon repetition of the study, helping to better represent the possibility of the occurrence of M. bovis within collected samples. This study only incorporated the use of one, non TB outbreak farm so in using outbreak farms known and confirmed to have a spread of bTB, it may better signify a possibility to isolate M. bovis in earthworms. The time of year in which samples are collected may also provide a role in the detection of M. bovis, with all earthworms retrieved within this study collected over the winter period. During times of adverse weather, such as temperatures below freezing or extreme highs, earthworms demonstrate a decrease in activity and can be found in a state of diapause. Once conditions are no longer dry and have become favourable, they resume their normal activity (Edwards & Bohlen, 1996). It is therefore inferred that collection during summer or a period where they present more activity, are more likely to encounter M. bovis. Due to collection in the cold winter months, cows were only on rotation within the field, meaning cattle were not constantly present on the pasture and thus would have provided earthworms will less opportunity to interact with M. bovis if present. Due to a decrease in cattle on the field, cow pats used were not completely fresh however this could be observed as an advantageous occurrence. Sampled cow pats were between 9 and 22 days old, with still relatively raw faecal matter contained within the core areas. The effect of time upon a once fresh cow pat means the longer it has to deviate away from the stage, the more advanced stages of decomposition this organic material will be; becoming colonised, broken down and incorporated into the soil through earthworms (Lee & Wall, 2006). This is especially applicable to the margin areas. However in future studies, it may be deemed beneficial to test both fresh and old cow pats along with the earthworms distribution in and around these sites.4.7 Expanding the Area of StudyIn order to provide a controlled study within this area, it may be interesting to induce a population of earthworms to a cow pat known to be bTB-positive, thus exposing the earthworm to contaminated material. From here, it would be interesting to observe whether the earthworm fulfilling its normal ecological processes would be privy to M. bovis contraction. It could also be confirmed whether they are able to harbour the pathogen after contact with infected material. Testing soil samples along with earthworms may provide a positive addition to the study as earthworms are imperative to the health and quality of soil. They are also implicated in distributing the pathogen and bacteria into the soil as reported by Adnan & Joshi, (2013). This has been similarly demonstrated in a study by Moravkova, et al. (2011) who isolated several Mycobacterium species within soil samples in an enclosure housing a flock infected with M. avium. Isolated species included M. a. hominissuis, M. chelonae, M. fortuitum and M. scrofulaceum with some of the birds found to be cross infected with M.a.hominissuis also. Overall, there are several things that can be learnt after completion of this investigation and applied to similar areas testing field samples for M. bovis. The foundation for the methodology has already been set for further repetition if desired, to help further explore routes of bTB transmission. ConclusionWith the ever-expanding issues posed by bTB and the devastating effects it causes yearly, research into the disease and its processes has never been more important to pursue. This report has aimed to investigate one of the many mechanisms for transmission, addressing an area that has not yet been extensively researched. Earthworms as potential carriers of bTB composed the focus of the study, with the presence of M. bovis tested for within field-collected samples. Even though the samples registered as negative with the use of a non TB outbreak farm, it can be stressed that further research would be highly beneficial to address and overcome problems experienced throughout the study. Expanding the subject area to include other environmental samples such as soil and other invertebrates would also be a beneficial implementation. It is hoped that through research and further study, it will shed more light on bTB, helping to implement strategies to help tackle this increasing problem. In knowing more about how bTB spreads it may hold the key to understanding and therefore may provide important pieces of the puzzle to address this devastating disease. Hopefully, in the near future, through continued dedication in research and the development of vaccines, it will bring hope in the eradication of Bovine TB, striving for the Bovine TB free status that the UK is so hoping for.

ACKNOWLEDGMENTSI would like to express a heartfelt appreciation to my supervisor, Dr Subhajit Biswas, who was always there to answer my endless questions and queries and without his helpful input, feedback and support would never have been able to finish this dissertation. His help and guidance within the lab were also something I am ever grateful for and thank him for his patience and infectious enthusiasm.I would also like to thank Professor Roy Brown, of which I benefited endlessly from his expertise, support and informative feedback. His assistance in field collection was greatly appreciated, along with collection and identification of field samples and dissections.For their help and company in the lab, I thank Ciorstaidh Macgillivry, Charlotte ONeill and Kimberly Braid. As well as to my friends who were always there to help.Finally I thank my family, for their love, unwavering support and advice who let me talk their ears off about Bovine TB even if they didnt understand it.Thank you all.ReferencesAdnan, M., Joshi, N. (2013) The Uniqueness of Microbial Diversity from the Gut of Earthworms and Its Importance. Journal of Microbiology and Biotechnology Research.Vol.3 (1) pg. 111-115. Barill, P., Nates, S. (2012) Gel Electrophoresis: Principles and Basics. Shanghai: Intech.BBC (2014) Pet Cats Infect Two People with TB. [online] Available from: http://www.bbc.co.uk/news/health-26766006 [Accessed: 29 March 2014]Beynon, S.A., Peck, M., Mann, D.J., Lewis, O.T. (2012) Consequences of Alternative and Conventional Endoparasite Control in Cattle for Dung-Associated Invertebrates and Ecosystem Functioning. Agriculture, Ecosystems and Environment. Vol. 162 (11) pg. 36-44.Broughan, J.M., Downs, S.H., Crawshaw, T.R., Upton, P.A., Brewer, J., Clifton-Hadley, R.S. (2013) Mycobacterium bovis Infections in Domesticated Non-Bovine Mammalian Species. Part 1: Review of Epidemiology and Laboratory Submissions in Great Britain 2004-2010. The Veterinary Journal. Vol. 198 (2) pg. 339-345. Brownie, J., Shawcross, S., Theaker, J., Whitcombe, D., Ferrie, R., Newton, C., Little, S. (1997) The Elimination of Primer-Dimer Accumulation in PCR. Nucleic Acids Research. Vol. 25 (16) pg. 3235-3241.Corner, L.A.L., Murphy, D., Gormley, E. (2011) Mycobacterium bovis Infection in the Eurasian Badger (Meles meles): the Disease, Pathogenesis, Epidemiology and Control. Journal of Comparative Physiology. Vol. 144 (1) pg. 1-24.Das, S., Mohapatra, S.C., Hsu, J.T. (1999) Studies on Primer-Dimer Formation in Polymerase Chain Reaction (PCR) Biotechnology Techniques. Vol. 13 (10) pg. 643-646. Delahay, R.J., Cheeseman, C.L., Clifton-Hadley, R.S. (2001) Wildlife Disease Reservoirs: The Epidemiology of Mycobacterium bovis Infection in the European Badger (Meles meles) and Other British Mammals. Tuberculosis. Vol. 81 (1-2) pg. 43-49.Drewe, J.A., OConnor, H.M., Weber, N., McDonald, R.A., Delahay, R.J. (2013) Patterns of Direct and Indirect Contact Between Cattle and Badgers Naturally Infected with Tuberculosis. Epidemiology and Infection. Vol. 141 (7) pg. 1467-1475.Edwards, C.A., Bohlen, E.P.J. (1996) Biology and Ecology of Earthworms. 3rd edition. London: Chapman & Hall. Fischer, O,A., Matlova, L., Bartl, J., Dvorska, L., Svastova, P., du Maine, R., Melicharek, I., Bartos, M., Pavlik, I. (2003) Earthworms (Oligochaeta, Lumbricidae) and Mycobacteria. Veterinary Microbiology. Vol. 91 (4) pg. 325-338. Gilbert, M., Mitchell, A., Bourn, D., Mawdsley, J., Clifton-Hadley, R., Wint, W. (2005) Cattle Movements and Bovine Tuberculosis in Britain. Nature. Vol. 435 (7041) pg. 491-496. Griffith, B., Turke, M., Weisser, W.W., Eisenhauer, N. (2013) Herbivore Behaviour in the Anecic Earthworm Species Lumbricus terrestris L. European Journal of Soil Biology. Vol. 55 (?) pg. 62-65. Gov (2013) Bovine TB Strategy Launched to Make England Disease Free within 25 Years. [online] Accessed from: https://www.gov.uk/government/organisations/department-for-environment-food-rural-affairs [Accessed: 28 January 2014].Gupta, V.K., Tuohy, M.G., Ayyachamy, M., ODonovan, A., Turner, K.M. (2013) Laboratory Protocols in Fungal Biology: Current Methods in Fungal Biology. New York: SpringerKruuk, H. (1978). Foraging and Spacial Organisation of the European Badger Meles meles. Behavioural Ecology and Sociobiology. Vol. 4 (1) pg. 75-89.La Rosa, G., Fratini, M., Vennarucci, S., Guercio, A., Purpari, G., Muscillo, M. (2012) GIV Noroviruses and Other Enteric Viruses in Bivalves: A Preliminary Study. New Microbiologica. Vol. 35 (1) pg. 27-34. Lee, C.M., Wall, R. (2006) Cow-dung Colonization and Decomposition Following Insect Exclusion. Bulletin of Entomological Research. Vol. 96 (3) pg. 315-322. McManus, S.A. (2007) Auto fluorescence in Earthworm Setae. Megadrilogica. Vol. 11(1) pg. 1-3. Minamaya, Y., Ohga, K., Hayakawa, H., Ito, K., Fukuda, T. (2011) Coelomic Fluid: A Noninvasive Source of DNA in Earthworms. Molecular Ecology Resources. Vol. 11 (4) pg. 645-649. Moda, G., Daborn, C.J., Grange, J.M., Cosivi, O. (1996) The Zoonotic Importance of Mycobacterium bovis. Tubercle and Lung Disease. Vol. 77 (2) pg. 103-108. Moravkova, M., Lamka, J., Kriz, P., Pavlik, I. (2011) The Presence of Mycobacterium avium subsp. Avium in Common Pheasants (Phasianus colchicus) Living in Captivity and In Other Birds, Vertebrates, Non-Vertebrates and the Environment. Veterinarni Medicina. Vol. 56(7) pg. 333-343.Mullen, E.M., MacWhite, T., Maher, P.K., Kelly, D.J., Marples, N.M., Good, M. (2013) Foraging Eurasian Badgers Meles meles and the Presence of Cattle in Pastures. Do Badgers Avoid Cattle? Applied Animal Behaviour Science. Vol. 144 (3-4) pg. 130-137.Nanodrop. (2013) Assessment of Nucleic Acid Purity. [pdf] [online] Available from: http://www.nanodrop.com/Library/T042-NanoDrop-Spectrophotometers-Nucleic-Acid-Purity-Ratios.pdf [Accessed: March 1 2014].Olea-Popelka, F.J., Phelan, J., White, P.W., McGrath, G., Collins, J.D., OKeeffe, J., Duggan, M., Colins, D.M., Kelton, D.F., Berke, O., More, S.J., Martin, S.W. (2006) Quantifying Badger Exposure and the Risk of Bovine Tuberculosis for Cattle Herds in Kilkenny, Ireland. Preventative Veterinary Medicine. Vol.75 (1-2) pg. 34-46. Phillips, C.J.C., Foster, C.R.W., Morris, P.A., Teverson, R. (2003) The Transmission of Mycobacterium bovis Infection in Cattle. Research in Veterinary Science. Vol. 74 (1) pg. 1-15. Sims, R.W., Gerard, B.M. (1985) Earthworms. Bath: The Pitman Press.Skuce, R.A., Allen, A.R., McDowell, S.W.J. (2012) Herd-Level Risk Factors for Bovine Tuberculosis: A Literature Review. Veterinary Medicine International. Vol. 2012 (1) pg. 1-10. Smith, N.H., Berg, S., Dale, J., Allen, A., Rodriguez, S., Romero, B., Matos, F., Ghebremichael, S., Karoui, C., Donati, C., Machado, A.C., Mucavele, C., Kazwala, R.R., Hilty, M., Cadmus, S., Ngandolo, B.N.R., Habtamu, M., Oloya, J., Muller, A., Milian-Suazo, F., Andrievskaia, O., Projahn, M., Barandiaran, S., Macias, A., Muller, B., Zanini, M.S., Ikuta, C.Y., Rodriguez, C.A.R., Pinheiro, S.R., Figueroa, A., Cho, S.N., Mosavari, N., Chuang, P., Jou, R., Zinsstag, J., Soolingen, D.V., Costello, E., Aseffa, A., Proano-Perez, F., Portaels, F., Rigouts, L., Cataldi, A.A., Collins, D.M., Boschiroli, M.L., Hewinson, G.L., Neto, J.S.F., Surujballi, O., Tadyon, K., Botelho, A., Zarraga, A.M. (2011) European 1: A Globally Important Clonal Complex of Mycobacterium bovis. Infection, Genetics and Evolution. Vol. 11 (6) pg. 1340-1351. Smith, D.F., Phillips, J. (2000) Food, Science, Policy and Regulation in the Twentieth Century: International and Comparative Perspectives. London: RoutledgeStone, M.J., Brown, T.J., Drobniewski, F.A. (2012) Human Mycobacterium bovis Infection in London and Southeast England. Journal of Clinical Microbiology. Vol. 50 (1) pg. 164-165. Svendsen, T.S., Gronvold, J., Holter, P., Sommer, C. (2003) Field Effects of Ivermectin and Fenbendazole on Earthworm Populations and the Disappearance of Dung Pats From Bolus-Treated Cattle. Applied Soil Ecology. Vol. 24 (3) pg. 207-218.Taylor, G.M., Worth, D.R., Palmer, S., Jahans, K., Hewinson, R.G. (2007) Rapid Detection of Mycobacterium bovis DNA in Cattle Lymph Nodes with Visible Lesions using PCR. BMC Veterinary Research. Vol. 3 (12) pg. 1-11. Torgerson P.R., Torgerson, D.J.(2010) Public Health and Bovine Tuberculosis: Whats all the Fuss About? Trends In Microbiology Vol.18 (2) pg. 67-72.. Vandenbroucke, I., Van Marck, H., Verhasselt, P., Thys, K., Mostmans, W., Dumont, S, Van Eygen, V., Coen, K., Tuefferd, M., Aerssens, J. (2011) Minor Variant Detection in Amplicons Using 454 Massive Parallel Pyrosequencing: Experiences and Considerations for Successful Applications. BioTechniques. Vol. 51 (3) pg. 167-177.Wani, K.A., Mamta, S.K., Rao, R.J. (2013) Bioconversion of Garden Waste, Kitchen Waste and Cow Dung into Value-Added Products Using Earthworm Eisenia fetida. Saudi Journal of Biological Sciences. Vol. 20 (2) pg. 149-154. Ward, A.I., Judge, J., Delahay, R.J. (2010) Farm Husbandry and Badger Behaviour: Opportunities to Manage Badger to Cattle Transmission of Mycobacterium bovis. Preventative Veterinary Medicine. Vol. 93 (1) pg. 2-10.White, P.C.L., Whiting, S.J. (2000) Public Attitudes Towards Badger Culling to Control Bovine Tuberculosis in Cattle. Veterinary Record: Journal of the British Veterinary Association. Vol. 147 (7) pg. 179-183. Wilson, G.J., Carter. S.P., Delahay, R.J. (2011) Advances and Prospects for Management of TB Transmission Between Badgers and Cattle. Veterinary Microbiology. Vol. 151 (1-2) pg. 43-50.Woodroffe, R., Donnelly, C.A., Jenkins, H.E., Johnston, W.T., Cox, D.R., Bourne, F.J., Cheeseman, C.L., Delahay, R.J., Clifton-Hadley, R.S., Gettinby, G., Gilks, P., Hewinson, R.G., McInerney, J.P., Morrison, W.I. (2006) Culling and Cattle Controls Influence Tuberculosis Risk for Badgers. Proceedings of the National Academy of Sciences. Vol. 103 (40) pg. 14713-14717.

24