+ All Categories
Home > Documents > Eastern Shore Real Estate Guide

Eastern Shore Real Estate Guide

Date post: 31-Mar-2016
Category:
Upload: lynch-printing-llc
View: 217 times
Download: 0 times
Share this document with a friend
Description:
Vol. 1 Issue 5
Popular Tags:
16
MARYLAND’S EASTERN SHORE Featuring: Kent, Queen Anne’s, Talbot, Caroline, Dorchester, Wicomico & Somerset Counties DETAILS ON THIS PROPERTY Sunshine Properties, Inc. Kelly Macomber 443-553-4984 Located on Page 15 FOR ADVERTISING INFORMATION Call Lynch Printing: 410/213-9200 Toll Free 877/213-9220 [email protected] Vol. 01 : No. 05 YOUR RESOURCE FOR BUYING AND SELLING ON THE SHORE REALESTATE guide eastern shore’s
Transcript
Page 1: Eastern Shore Real Estate Guide

MARYLAND’S EASTERN SHOREFeaturing: Kent, Queen Anne’s,

Talbot, Caroline, Dorchester, Wicomico & Somerset Counties

DETAILS ON THIS PROPERTY Sunshine Properties, Inc.Kelly Macomber 443-553-4984Located on Page 15

FOR ADVERTISING INFORMATIONCall Lynch Printing: 410/213-9200Toll Free 877/[email protected]

FOR ADVERTISING INFORMATION

Vol. 01 : No. 05

YOUR RESOURCE FOR BUYING AND SELL ING ON THE SHOREREALESTATE g

uid

e

eastern shore’s

ESREG.01.05.indd 1 4/12/11 2:25:04 PM

Page 2: Eastern Shore Real Estate Guide

Page 2 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 05 Page 2 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE® - Vol. 01, no. 05

www.sharonre.com [email protected]

Penny M. WindsorRhonda Richardson Carol L. Wolf

BEAUTIFUL LOT – Almost half acre building lot in well established subdivision with public well. Community pier. Just outside of Cambridge, convenient to surrounding towns. $48,000.00 DO7547696

CRAFTSMAN – Totally updated kitchen with oak floors, granite counter tops, warming lights and new ceramic top stove and back splash. New bath fitter shower. Screened front and back porches with one car garage and workshop. $135,000.00 DO7571234

BRICK CAPE COD – 3 bedrooms, 2-1/2 baths on corner lot with beautiful mature trees. Lots of existing flowers and flowerbeds to add color to your landscaping. Rear yard is fenced with a large shed for storage. Great Marsh Park, YMCA and Yacht Club are just a short distance away. Great buy. $139,990.00 DO7560549

A GEM OF A HOME - This 3 bedroom, 2 bath home is well built with classic charm of wood floors, arched doorways and more. Full dry, basement and full attic, enclosed porches, garage, off-street parking and double lot. $129,900.00 DO7556713

EASY LIVING - At this waterview 1st floor condo near Yacht Club and Marina – dock your boat across the street or walk to restaurants and parks. ONLY $85,000.00 DO7568374

UPDATED - Home has been updated since 2004-2005 with replacement windows, plumbing, drywall, roof and electric. Appliances convey, 2 bedroom, 1 bath, perfect starter home. $79,900.00 DO7565531

NEW LISTINGS!

ESREG.01.05.indd 2 4/12/11 2:27:17 PM

Page 3: Eastern Shore Real Estate Guide

Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 05 - Page 3

ESTATE SALE – 4.4 acres with 3 separate deeds on these waterfront properties with 3 bedroom, 3 bath main house, 2 bedroom guest house and waterfront building lot. Private setting with 448’ waterfront, outbuildings, paved drive and 2 car garage. $549,000.00 DO7362491

CHARM GALORE – In this 3 bedroom, 2 bath Cape Cod featuring 1st floor master bedroom. Gorgeous living room with fireplace and built-in bookcases, screened side porch, remodeled kitchen, garage, off street parking and more. $199,999.00 DO7537228

VICTORIAN HOME ON HIGH STREET – This 4 bedroom home offers 5 fireplaces, impressive foyer, spacious dining room and living room plus remodeled kitchen. The historic integrity remains with pocket doors, leaded windows, wood molding and trim. Must see to fully appreciate. $329,000.00 DO7518328

RESTORED – Beautiful Victorian with 3 finished floors on corner lot with wrap around porch, new kitchen, 3 new baths, new plumbing, wiring, landscaping and much more. SACRIfICING AT $466,740.00 DO7547400

GORGEOUS CONTEMPORARY – On large lot offers broad water views, sunsets, pier with boat lifts, inground pool and everything for entertaining and living the Eastern Shore lifestyle. Stunning and ready for you to enjoy this summer. $898,500.00 DO7560425

WATERfRONT RANCHER – This 3 bedroom, 2 bath home sits on beautiful dry lot just off the Choptank River. Lovely family room with fireplace, living room, dining room and screened waterside porch. $229,000.00 DO7556975

Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE® - Vol. 01, no. 05 - Page 3

[email protected]

Penny M. WindsorRhonda Richardson Carol L. Wolf

ESREG.01.05.indd 3 4/12/11 2:26:49 PM

Page 4: Eastern Shore Real Estate Guide

Page 4 - Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 05

ON THE COVER

For additional information on thislisting, from this realtor see page 15 or contact:

Sunshine Properties, Inc.Kelly MacomberOffi ce: 410.641.8550 / Cell: 443.553.4984www.sunshinepropinc.com

For advertising information in Eastern Shore’s Real Estate Guide

contact:

Craig LynchToll Free: 1-877-213-9220

Offi ce: 410-213-9200Fax: 410-213-9240

Email: [email protected]

Next Ad Submission DeadlineApril 29, 2011

Next Book DistributedMay 19, 2011

Want to see your home advertised in this magazine?Contact any of the real estate professionals

in this magazine.

“All real estate advertised herein is subject to the Federal Fair Housing Act which makes it illegal to advertise any preference, limitations, or discrimination based on race, color, religion, sex,

handicap, familial status, or national origin, or intention to make any such preferences, limitation, or discrimination. We will not knowingly accept any advertising for real estate which is in violation of the law. All persons are hereby informed that all dwellings advertised are available on an equalopportunity basis.”

contact:

Craig LynchToll Free: 1-877-213-9220

AN ENTERTAINER’S DELIGHT This magnifi cent waterfront estate property features a brick and stone front with dramatic roof lines, a well thought-out interior, and gorgeous rooms throughout. Private resort setting, yard, patio, pier to dock, large pool, hot tub, deck, porches, and more! $1,499,000

1 Vol. 1 Issue No. 1 - Please saw you saw us in the Eastern Shore Home Improvement Guide

Who Should I Ask For: Specialty:

What Licenses Do You Have:

Service Area: When Were You Established:

What Are Your Hours:

email: web:

Vol. 1 Issue 1

Improving & EnhancingYour Home on the Shore

Hardscapes Perfection443.443.4444 | Page 15

www.ShoreHomeGuide.com

2. Here is Where

7. Business Categories

12. Featured in Each Issue

16. Would be Listed

MARYLAND’S EASTERN SHOREFeaturing: Kent, Queen Anne’s,

Talbot, Caroline, Dorchester, Wicomico & Somerset Counties

DETAILS ON THIS PROPERTY Sunshine Properties, Inc.Kelly Macomber 443-553-4984Located on Page 15

FOR ADVERTISING INFORMATIONCall Lynch Printing: 410/213-9200Toll Free 877/[email protected]

G INFORMATION

Vol. 01 : No. 05

YOUR RESOURCE FOR BUYING AND SELL ING ON THE SHOREREALESTATE g

uid

e

eastern shore’s Be sure to pick up BOTH publications!

Eastern Shore’s Real Estate Guide

to help you fi nd a REALTOR® or a home, and Eastern Shore’s Home Improvement Guide

to help you fi nd local business to improve your new home, or boost your

exisiting home’s value!

With over 25,000 publications distributed over the entire Eastern Shore, whether you are a home owner looking to buy or sell, a REALTOR® looking to gain exposure, or a home improvement business looking to

target clients, both of these publications are here for you!

REALESTATE gui

de

eastern shore’s

ESREG.01.05.indd 4 4/12/11 2:28:03 PM

Page 5: Eastern Shore Real Estate Guide

Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 05 - Page 5

MHBRMHBR MHBR MHBR H # 457# 4545# 45775700

Actual view from residence

Have it all at The Gateway Grand, Ocean City’s premier oceanfront property. Ocean and bay views. Private terraces and shared lounges. Indoor and outdoor pools. The Vista residences off er beach lovers twice the luxury all year long.

Schedule your tour of the new Vista models today. Sales offi ce open daily from 10 a.m. to 5 p.m.

GrandValueOC.com866-531-5942 Two 48th Street, Ocean City, MD 21842

TTHHHHEEE GGGGGGGAAAAAAAATTTTTTEEEEEEEWWWWWAAAAYYYY GGGGGRRRRAAANDD IINNNTTTRRROOODDDDUUUCCEEEESSS......

LuLuLuLuxuxuxuxuryryryry T T T Thrhrhreeeeeee- - anana d d FoFoururu -BB- eddede rooommom R Resese iddididennenencececec sss wiwithth B Bototth h hh OcOceaean nn n anand d BaBaBay yy ViViViV ewewws s StStara tingg at $6$69999,9,90000..

TCC_GG_SpringAd_RealEstate_42806a.indd 1 4/6/11 11:20:48 AMESREG.01.05.indd 5 4/12/11 2:28:50 PM

Page 6: Eastern Shore Real Estate Guide

Page 6 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 05

VERY NICE 3 BR rancher within short distance of Schumaker Park pavil-ion & playground. Family rm has FP w/gas insert, sunroom, wood & tile floors, granite countertops & central air, 2-car detached garage w/shop area & woodstove, 10x21 shed & paved drive. $199,900. (468513)

SPACIOUS COLONIAL Northwest spa-cious colonial has 3Br, 2.5 bath with great room, DR, beautiful kitchen, screened porch, large MBR w/ walk-in closet and bath. 2 car attached garage and fenced patio. $249,900. Call Jill Yost 443-523-1365. (471089)

23 TIDEWATER SEAFORD, DEGlamorous contemporary 4BR, 4 bath Seaford home in Holly Shores has full finished basement, FP in Fam Rm, beau-tiful cathedral ceilings & state of the art kitchen, 3 car garage, walk up attic, spe-cial financing available. $599,900. Call Jill Yost (578562)

CHARMING rancher in a private setting. 3 bedrooms, 2 baths, fireplace in living room. Outside includes a deck, patio & a attached garage. $174,900. Call Jill Yost 443-523-1365. (470187)

NEW 3 BR 2 bath country Cape in He-bron has city services, central air, large front porch, main floor bedroom & bath. $169,900. Call Jill Yost 443-523-1365. (469208)

GREAT RANCHER Just around the corner from marina, over 4.5 acres sur-rounded by County Park. 3 bedroom rancher with central air, family room, and several outbuildings. $155,000. (468341)

CUSTOM bUILT 5bR, 3.5 bath Contem-porary with beautiful fireplace, cathedral ceiling Great Room, hardwood & tile floors, loft overlooking Great Room, of-fice, 2 master bedrooms, deck & 3 car garage on cul-de-sac just 13 miles East of Salisbury. $424,900 Call Jill Yost @ 443.523.1365 (453550)

CHARMING HOME In established neighborhood. Nice kitchen with tile floor, center island, recessed lighting, 2-car detached garage and large deck. $229,900. Call Jill Yost 443-523-1365.

SPECTACULAR RIVER VIEWS, Three acres, waterfront on creek, pond on property. 3BR, 3 baths new contempo-rary home with spacious rooms. Third floor loft room and much more. $624,900 Call Jill Yost 443.523.1365 (461623)

Jill Yost REALTOR® / AGENT

cell 443.523.1365 office 1.800.842.5704

[email protected]

Long & Foster® Real Estate, Inc.

Salisbury, Md

Page 6 - Please Say You Saw It In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 05

ESREG.01.05.indd 6 4/12/11 2:29:25 PM

Page 7: Eastern Shore Real Estate Guide

Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 05 - Page 7

107 S. Commerce StreetCentreville, MD 21617

www.AshleyPremier.com

410.758.3000 410.763.7000

123 N. Washington StreetEaston, MD 21601

PRESQUILE ON THE WYEEaston - Over 5 Acres and 800 feet of Waterfront $2,599,000 Joyce Wallace 410-829-5031

CENTREVILLEBeautiful 5 br, 3 ba, 1st & 2nd flr masters. Gorgeous inground pool and patio area. HUGE outbuilding w/elec/water/concrete floor. All on 2 acres in a lovely country location. $585,000 Kelli Miles 410-490-9107

HaRmONY Nice Farmette that has been redone w/new roof, siding, replacement windows. There is a stream and small pond. Mostly cleared; bring the horses. $298,000 Shirley Joyce 410-310-8635

TOTaL PRIVaCY - ON THE WaTER10+ Acres, tree lined drive. 5500 SF Georgian Revival Colonial, pier, boatlift, waterside pool. $2,100,000 Jack Ashley 410-310-0800

CHURCH HILLEquestrian Delight- 41.56 Acre Farm w/4 Stall Barn, Fenced Pasture, Run In Shed and Track. Remodeled kitchen and baths, sunroom, separate in-law suite. $634,900 Norma Coursey 410-490-1307

CENTREVILLE15 acres, deer and wildlife abound.Warm and inviting home with lots of upgrades and tons of space for the whole family. $399,900. Joyce Wallace 410-924-5031

CENTREVILLEA BEAUTY- Great kitchen w/breakfast area overlooking farm fields. Gas fire place in spacious living room, bright and airy foyer and open dining. Large master suite w/soaking tub,separate shower. (QA7526897) $424,900 Norma Coursey 410-490-1307

WYE mILLS2+ unrestricted acres in picturesque Wye Mills. from the public boat ramp. First floor master, living areas upstairs and down, inground pool, and more! $450,000 Cynthia DeGuzman 410-725-6977

CENTREVILLE4 BR, 2.5 bath, hrdwd flrs,office, cherry cabinets, dual ovens, stone gas fireplace, 3 sided fireplace, wet bar,two zone HVAC,sky lights. $379,000 David Kaufmann 443-223-3026

79+ Wooded Acres in Queen Anne Co. $475,000

ESREG.01.05.indd 7 4/12/11 2:29:58 PM

Page 8: Eastern Shore Real Estate Guide

Page 8 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 05

“Main Office”(Between Panera Bread & Barnes & Noble)Salisbury Blvd, Salisbury, MD 21801

410.912.4700 800.241.9590

Prudential Carruthers SalisburyPrudentialCarruthers.com

“Model Home”Captain’s Cove, VA757.854.0548

Captain’s Galley Condo, Crisfield410.968.9686

Visit us Online Search the Entire MLS

www.prudentialcarruthers.com

Page 8 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 05

An independently owned and operated member of the Prudential Real Estate Affiliates.

3 Bedrooms, 2 Baths$117,600(468611)

2 Bedrooms, 1 Bath$117,900(471773)

3 Bedrooms, 1.5 Baths$114,900(467744)

3 Bedrooms, 2 Baths$132,495(470115)

2 Bedrooms, 1 Bath$89,900(469294)

3 Bedrooms, 1 Bath$89,000(465367)

3 Bedrooms, 1 Bath$69,900(467666)

3 Bedrooms, 2.5 Bath$83,000(468712)

3 Bedrooms, 2.5 Baths$164,900(471192)

3 Bedrooms, 2 Baths$159,900(468314)

4 Bedrooms, 2 Baths$149,900(470366)

3 Bedrooms, 2 Baths$164,900(470763)

3 Bedrooms, 2 Baths$174,986(468882)

Smart Phone?Here’s the QR Code

for SALISBURY Prudential CarruthersREALTORS Website

www.facebook.com/SalisburyHomes

1.2 ACRES

3 Bedrooms, 2 Baths$177,900(469555)

3 Bedrooms, 2 Baths$179,900(465077)

ESREG.01.05.indd 8 4/12/11 2:30:43 PM

Page 9: Eastern Shore Real Estate Guide

Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 05 - Page 9

Kevin White

MAnAGeR

CinDYWeLSh

302-381-6910

“Main Office”(Between Panera Bread & Barnes & Noble)Salisbury Blvd, Salisbury, MD 21801

410.912.4700 800.241.9590

Prudential Carruthers SalisburyPrudentialCarruthers.com

“Model Home”Captain’s Cove, VA757.854.0548

Captain’s Galley Condo, Crisfield410.968.9686

JOhn B.ROBinSOn

443-235-5563

KAthLeen SheeRAn

410-968-3333

SALLY StOut

410-726-3506

Steve viLKAS

443-880-8560

LeAWiMBROW

410-430-6923

BiLLieWiLKeRSOn

410-251-1709

ShAROn ShiRK

410-251-6990

Please Say You Saw It In EASTErn ShorE’S rEAL ESTATE GUIDE- Vol. 01, no. 05 - Page 9

4 Bedrooms, 3.5 Baths32.5 Acres $1,800,000

(469465)

3 Bedrooms, 2.5 Baths$1,495,000(460879)

4 Bedrooms, 2.5 Baths$189,850(466439)

2 Bedrooms, 1.5 Baths$179,000(470326)

3 Bedrooms, 2 Baths$199,750(463924)

3 Bedrooms, 2 Baths$249,000(467835)

4 Bedrooms, 2 Baths$315,000(467876)

5 Bedrooms, 3 Baths$269,900(469550)

4 Bedrooms, 2.5 Baths$275,000(464516)

3 Bedrooms, 2.5 Baths$282,000(471639)

3 Bedrooms, 2.5 Baths$199,000(470767)

4 Bedrooms, 2.5 Baths$369,800(466803)

JOhnphiLLipS

410-603-6555

WATERFRONT21+ ACRES

4 Bedrooms, 1.5 Baths $289,900(468221)

15 ACRES

Visit us Online Search the Entire MLS

www.prudentialcarruthers.comAn independently owned and operated member of the Prudential Real Estate Affiliates.

MARYKinniKin

443-359-0268

SKip LYOnS

443-235-0200

RuStYMOLnAR

410-726-2095

AnnA MYeRS

443-956-2662

BiLL BABKOWSKi

410-430-3269

BOBCALDWeLL

410-251-2799

JeffReY JACKSOn

609-839-9078

4 Bedrooms, 2.5 Baths$329,000(471224)

4 Bedrooms, 2.5 Baths$279,900(466099)

ESREG.01.05.indd 9 4/12/11 2:31:58 PM

Page 10: Eastern Shore Real Estate Guide

Page 10 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 05

8407 Fishing island rd., westover - Comfortable and spacious home on 1.07 acre

lot close to the bay. 3 BR and 2BA plus large kitchen and LR. Fenced yard and

storage shed. $145,000 MLS# 464263

1204 orChard Cr., salisbury Close to the Universtiy- city

services and no city taxes. 3 bedroom 2 bath rancher with sunroom, living room, family room with fireplace, and din-

ing room. $205,000 MLS# 448793

20 sandyhooK rd.,oCean pines - An Ocean

Pines best buy! Remodeled with all new appliances. 3 bed 2 bath home with large

fenced rear yard conve-nientlly located inside the

North Gate of Ocean Pines $177,853 MLS# 465630

8605 Middlesex dr., delMar 4 bedsrooms 2 baths on .95 acres in Essex Ridge. Open floorplan with first floor bed

and bath $215,000 MLS# 471481

426 prisCilla st., salisbury REMODELED! This beautiful

home boasts 3BR and 2.5 BA including a 1st floor master, hardwood and tile flooring.

Screend porch and rear deck plus garage and shed.

$134,900 MLS# 467906

29833 deer harbour dr., salisbury - 5 bedrooms, 3.5 baths with first floor master in Deer Harbour. $278,000 MLS# 471778

9331 Croppers island rd., newarK custom built 4 bedrm 2.5 bath home on 1.5 acres in Newark. attention to detail throughout,

gourmet kitchen and delux master suite with private porch.

$369,800 MLS#466803

lots

Sally Todd Stout 410.726.3506

[email protected]

2618 N. Salisbury Blvd. Suite 120, Salisbury, MD 21801 • 410-912-4700An Independently owned and operated member of the Prudential Real Estate Affiliates

Skip Lyons 443.235.0200

[email protected]

34335 parKer pl., pittsvilleLocation! Close to Salisbury

and Ocean City, this 3 bed and 2 bath home on .23 acre lot with above ground pool is a great value- must see! 100%

financing available to qualified buyers. $144,900 MLS#466689

134 nina ln., Fruitland .41 acres $69,900 nantiCoKe rd., nantiCoKe 4.06 acres $69,900 2310 hudson, salisbury .22 acres $13,358

Cove st., CrisField .20 acres $13,900 Cove st., CrisField .17 acres $11,900

20214 nantiCoKe rd.700 feet of private beach on Nanticoke River on this 13 acre parcel with 4 bedroom

1600 square foot home. $579,258 MLS# 463711

28305 nantiCoKe rd., salisbury - Spacious

2100 square foot home on 1.62 acres with fenced yard, outbuilding and two

master suites, a great value! $199,900 MLS# 457283

7 139th st., oCean CityLooking for a great invest-

ment? This first floor 2 bed 2 bath unit is only 1/2 block from the beach with great rental potential! $239,900

MLS# 468214

404 st. luKe’s rd., FruitlandRemodeled 2400 square foot home with 5 bedrooms and 2 baths. Large kitchen and liv-ing room plus separate room

for office space. $179,500 MLS# 460474

231 Canal parK dr - salisbury2 bedroom 2 bath condo in Canal Woods- enjoy maintenance free living! Freshly painted and great

views of the pond in this first floor unit. $93,900 MLS# 465784

1201 taney ave., salisbury - Close to University, city services and no city tax. This 1766 sq foot 3 bedroom 2 bath home with basement on a lg corner lot is a must see. $169,900

MLS#470064

reduCed new listing

new listing

161 nina ln, FruitlandBeautiful 5 BR home in East Field subdivision. 1st floor BR & BA along with large

LR, formal DR, FP, and back deck.

$269,900 MLS# 469550

reduCed

reduCed

reduCedreduCed

reduCed

reduCed

reduCed

See more of these listings at

www.youtube.com-enter property

address.

ESREG.01.05.indd 10 4/12/11 2:33:10 PM

Page 11: Eastern Shore Real Estate Guide

Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. No. 04 - Page 11 Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. No. 04 - Page 11

7802 Coastal HighwayOcean City, Maryland 21842

MELISSA BEROTTIREALTOR®, Licensed in MD

Cell: 443-497-1888Office: 410-723-0988Email: [email protected]

Please Say You Saw It In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 05 - Page 11

Austin Circle- Fabulous 4 bedroom home located just minutes from downtown Berlin. Great kitchen, gas fi replace, 3 full baths, open living area, fi rst fl oor master suite w/whirlpool tub, and a bonus room with a full bath as well. Great backyard with a rear screened deck for you to BBQ. This Contemporary home also features an oversized attached garage w/plenty of storage, ceiling fans in every room, and a vinyl fenced in rear yard...Priced to sell at $284,500!! Call Melissa Berotti

for your appointment to see Austin Circle today at 443-497-1888

ESREG.01.05.indd 11 4/12/11 2:34:19 PM

Page 12: Eastern Shore Real Estate Guide

Page 12 - Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 05 Page 12 - Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 05

$15,000 GRANT FOR BUYER * Available through SNHS* $95,000 (www.LNF.com\470074)* 4BR/2BA classic; 1954 Sq. Ft.* Move in ready - nicely updated* 9’ Ceilings; W-U Attic; Bsmt* C. Air; DOUBLE LOT

$15,000 GRANT FOR BUYER * Available through SNHS* NOW $70,950 (www.LNF.com\465412)* 4BR/1.5BA cutie; 1848 Sq. Ft.* New Roof & C. Air* Walk-up Attic; Basement* Fenced Yd w/Koi Pond

$15,000 GRANT FOR BUYER * Available through SNHS* $162,000 (www.LNF.com\470558)* 4BR/2BA gem; 1952 Sq. Ft.* Fireplace; beautiful HW fl oors* 3 Season Porch; brick Patio* Fenced DOUBLE LOT; 2 C. garage

QUALIFIES for RURAL HOUSING! * Covered Bridge location provides special fi nancing!* $280,000 (www.LNF.com\470772)* 3BR/2.5BA jewel; 2800 Sq. Ft.* 2 Bonus Rms: now used as “Man Cave” & Offi ce with private entry* Exceptional use of Oak Wood throughout* Porch, Pool & Garages for 3 cars

RUARK’S MODEL HOME* Talk about bells and whistles!!!* 4BR/3BA w/ First Floor B&B* A WOW Master Bathroom * Potential 5th BR* Garage on own HVAC system* $325,000 (www.LNF.com\471393)

COUNTY TAXES W/ CITY SERVICES * $185,000 (www.LNF.com\469586 )* 4BRs/1 full, 2 half Baths, on .4 A * 2 Bonus Rms; 2617 Sq. Ft.* 3 Zone HVAC; Basement* AWESOME Kitchen & FR Addition* 3 Season Porch; Deck* Outstanding location near S.U. & PRMC

LOTS of LOTS! City: $19,900 (463053) or County: .4A for $29,900 (463041) CALL NANCY ALTHAUS 410-726-6080

GOLDEN OPPORTUNITY * To own in FOXCHASE!* $300,000 (www.LNF.com\458215)* 4BR/3BA Original Modle Home* First fl oor Offi ce* 2 Bonus Rooms* Expanded FR w/brick FP* 3 Zone HVAC; 3400 Sq. Ft* .8 Acres w/IGI

FIRST FLOOR MASTER * $265,000 (www.LNF.com\470073)* 4BR/3BA w/2nd fl r MBR also* Like to entertain? Awesome FR & Deck* 2436 Sq. Ft of perfection! * 1.74 A. park-like setting on Cul-de-Sac* Great Eastside location

LIVE FREE & EASY * No better time than the present!* Resize & relax @ Mallard Landing* NOW $113,900* 1BR/1.5 BA; (www.lnf.com\470127)* Bonus Rm; 1187 Sq. Ft)* “Oxford” modle w/upgrades* One of the few to have a Fireplace

THINK ABOUT ITWhether you rent or own, YOU pay for the house you live in. So, why pay the Landlord? Rates are THE GREATEST EVER! Doesn’t it make sense to invest in

yourself? Call Nancy Althaus 410-726-6080 for FREE Buyer counseling.

FIRST FLOOR MASTER * Call for the new pricing value.* (www.LNF.com\465146)* 3BR/2.5BA Townhouse; 1916 Sq. Ft.* 2 Bonus Rooms = 4th BR & Craft Rm.* FR w/FP; E-I Kitchen; Formal LR & DR* California-style fi nished Garage

ESREG.01.05.indd 12 4/12/11 2:35:07 PM

Page 13: Eastern Shore Real Estate Guide

Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 05 - Page 13

Vickie D. Rohrer, REALTOR®Direct: 401-334-3076 • Offi ce: 410-912-0310

http://[email protected]

Tom Rohrer, Leasing ConsultantDirect: 443-397-1140 • Offi ce: 410-912-0310

[email protected]

Come visit us at our new location!327 Tilghman Road • Salisbury, MD 21804

MOTIVATED - Beautiful Bay and Skyline views from this nice 3

Bedroom, 2 Bathroom townhouse with boat slip.

$289,900 (WO470920)

LOCATION, LOCATION, LOCATION - Nice 3 Bedroom, 2 Bathroom

condo. Walk to SU. Look at this price! $79,900 (WO471027)

UPLAND - 3 Bedroom, 2.5 Bathroom $1,650/month

3 Bedroom, 2 Bathroom rancher in The Stonegate Subdivision.

Come take a LOOK at this. $149,900 (WO466961)

CROSSWINDS CONDOS - 2-3 Bedrooms, 1-2 Bathrooms from

$750-850/month

SUPER NICE - 3 Bedroom, 2 Bathroom mobile on .25 acres. Nice Florida room w/ fi replace.

Just minutes to Bethany Beach. $124,900 (WO471579)

ZIRCON - 3 Bedroom, 2.5 Bathroom $1,300/month

UNION - 3 Bedroom, 2 Bathroom $1,600/month

LOCATION, LOCATION, LOCATION - Nice 3 Bedroom, 2 Bathroom condo. Walk to SU. Wow, what a price. Buy both! Live in one, rent the other. $79,900 (WO471028)

WYE OAK - 3 Bedroom, 2.5 Bathroom $1,350/month

Open Loft Waterfront townhouse with boat slip. 1 Bedroom, 1.5

Bathrooms with pool. Walk to the boardwalk. $219,900 (WO471000)

SHARPTOWN - 4 Bedroom, 2 Bathroom $900/month

WATERFRONT

WATERFRONT

ESREG.01.05.indd 13 4/12/11 2:36:07 PM

Page 14: Eastern Shore Real Estate Guide

Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 05 - Page 14

Staples & Associates Insurance offers peace of mind through quality insurance products and a caring staff of professionals that is always ready to serve. As a full service Insurance Agency providing Auto, Home, Life, Business, and Farm insurance solutions, Staples & Associates Insurance can help you control uncontrolable cirumstances.

Securities offered through Billy Staples as a Registered Representative of Nationwide Securities, LLC P.O. Box 183137, Columbus, OH 43218, 888-753-7364. Member FINRA, SIPC. DBA Nationwide Advisory Services, INc. in AR, FL, IL, WV. DBA NAtionwide Advisory Services in MA, NY, OK. Representative of Nationwide Life Insurance Copman af liated companies and other companies.

Billy Staples, MBA

Staples & Associates Insurance

1410 S. Salisbury Blvd.Salisbury, MD 21801

[email protected]: 410.546.3999 | Fax: 410.546.6165

On Your Side Certified Agent

Nationwide Financial Network®

37101.22.13.indd 6 4/12/11 3:21:59 PMESREG.01.05.indd 14 4/12/11 3:25:16 PM

Page 15: Eastern Shore Real Estate Guide

Please Say You Saw This Ad In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 05 - Page 15

Kelly MacomberCell: 443-553-4984

Offi ce: 410-641-8550www.sunshinepropinc.com

Sunshine Properties, Inc.61 Quarter Staff Place • Berlin, MD 21811

AN ENTERTAINER’S DELIGHT! Welcome to this magnifi cent waterfront estate property of over fi ve acres. The home and grounds area true respite. Highlights are many both inside and out. The home features a brick and stone front with dramatic roof lines, a well thought-out interior, and gorgeous rooms throughout. The main level is spacious and includes formal living and dining rooms, large open kitchen with table area, family room, game (or lounge) room, and a master suite. The upper level has four bedrooms and over three full baths with a spectacular theatre/media room. The exterior has it all! Private resort

setting, yard, patio, pier to dock, large pool, hot tub, deck, porches, and more!

Priced to sell at $1,499,000! Call Kelly Macomber today for your appointment to see this stunning home!

Visit this home online at www.MR4.View24Hours.com

Please Say You Saw It In EASTERN SHORE’S REAL ESTATE GUIDE - Vol. 01, No. 05 - Page 15

ESREG.01.05.indd 15 4/12/11 2:37:52 PM

Page 16: Eastern Shore Real Estate Guide

Page 16 - Please Say You Saw This Ad In EASTErn ShorE’S rEAL ESTATE GUIDE - Vol. 01, no. 05

ALL BRICK BEAUTY Offering a complete re do inside! Beautifully refinished hard-wood floors, all new kitchen with upgraded appliances, new tile floors, new high end cabinets, faucet, sink. A complete package! Custom painted through out. lovely crown molding. All new bathrooms. Two masonry fireplaces. Partial basement. Full walk up attic. This is a showplace!New high efficiency oil furnace installed 2007. $179,900 (471190)

2.26 ACRES Great potential for an in home business, in law quarters or just a lot of home for the money! Huge Deck w/screened room, lg open floor plan, skylights on the 2nd flr, Loads of possi-bilites w/adddition side, ramp already in place! Highly motivated seller that is easy to work with. Bring all offers for this coun-try living yet walk to Wor Wic convenient location!. $195,000 (467871)

SOLD!

GORGEOUS! 9 foot ceilings! Hardwood floors! Granite countertops! Lots of windows! 3 car garage! This 4 bedroom home has it all. Delmar school district. $275,000 Call Elaine Gordy 410-726-9001 (467424)

BEAUTIfUL LOCATIOn across from Tony Tank Lake. Gorgeous home with hard-wood floors, brand new gourmet kitchen, screened porch, fenced yard, 2 car garage, 2 fireplaces, 4 bedrooms, 2.5 baths & hardwood floors!! BEST Of BOTH WORLDS: COUnTY TAxES & CITY SERvICES... CALL ELAInE GORDY 410.726.9001 $324,900 (468678)

BEAUTIfUL TOWnHOME - Very well cared for one owner home in the new-est section of Stone Gate. Privacy in the back yard, attached storage shed. Huge living area flows into a large kitchen and dining area perfect for entertaining. Upstairs the master bed-room affords privacy and a larger than life walk in closet. This floorplan offers the most living space for the dollar in a Salisbury townhome. $139,900 (470250)

GREAT RAnCHER! - Beautiful little one owner home. Hardwood floors, oil furnace replaced 8 years ago, roof is 12 years old. Solid, well built and well cared for home. $69,900 (470283)

BEAUTIfUL double wide home with ca-thedral ceilings, 3 bedrooms, 2 baths, fireplace, deluxe master bathroom, almost 1800 square feet. Only 6 years old this home has been gently lived in, very clean and well cared for. New shed. Nicely landscaped.$59,900 (469554)

DELIGHTfULLY DECORATED Easy liv-ing home with a delightful screened porch, rear deck, full walk up attic, lovely upgraded kitchen with pantry, 2 lazy susans, appliance garage. HOA maintains the yard, sprinklers, shrub-bery, mulch. Lock it up and go lifestyle in a very comfortable setting. Located near the historic Teackle Mansion. $174,000 (471165)

CLOSE TO BEACH! - 3 Bedrooms, 2 baths, great floorplan, home features a sun-room overlooking a large back yard, an oversized 2 car detached garage, paved driveway, rear deck. Very com-fortable, convenient and economical. 15 minute drive to the beach. Call Elaine Gordy 410.726.9001 $164,900 (462211)

SPRInG CHASE BEAUTY located on a beau-tiful lot overlooking a serene and private wooded area. Comfortably updated and ready to move into this custom decorat-ed home is warm and perfect for anyone looking for a low maintenance home in a convenient location. $179,900 (462362)

GREAT LOCATIOn Close to Salisbury Uni-versity. Nice waterfront end unit with great views and extra windows. Water-front balcony. Updated bathrooms. Very nice, convenient carefree living. Condo fee includes water, sewer, and trash fee. No maintenance, no worries. $109,900 (466282)

LOvELY REMODELED and updated home on a very quiet dead end street. New carpeting, new vinyl, replacement windows,new exterior doors, brand new bathroom with tile wall and floors, freshly painted. Great back yard with a deck overlooking a wooded back drop. Attached garage. Well maintained and gently lived in, this home is in move in condition. .$159,900 (466607)

EASY LIvInG LIfESTYLE! Custom built, gently lived in one owner home in a convenient, well manicured com-munity. Lg open one floor living w/9 ft ceils, designer kitchen, FR w/FP, screened porch overlooking a peaceful, tranquil setting. Attached 2 car garage. $239,900 (454671)

PREPARE fOR nO MAInTEnAnCE! Prepare for low heating & cooling costs! Lock it up and go on vacation! - No worries! This lovely, all brick, Village in the Park home provides you peace of mind, se-curity & elegance! Move in tomorrow! Very private setting this 3 bedroom, 2 bath home with 2 car garage is a carefree home in a convenient location. $274,900 (457227)

Elaine Gordy410-726-9001

1-800-842-5704 [email protected]

LonG & FostEr rEaL EstatE , Inc.

LOTS...LOTS...LOTS 2.3 acres south of Salisbury. Country living! Cleared, perced, ready to go! fruitland School District. $69,900

Beautiful wooded private 1.5 acre lot in established neighborhood. Approved & ready to build on! $69,900

REDUCED

REDUCED

REDUCED

ESREG.01.05.indd 16 4/12/11 2:38:50 PM


Recommended