7/28/2019 echt004.pdf

1/7

Characterization of microsatellite markersin eastern white pineC.S. Echt, P. Yay-Matquardt, M. Hseih, and R. Zahorchak

Abstract: An enrichment cloning method was evaluated for the isolation of microsatellite loci from easternwhite pine and the resulting markers were examined for polymorphisms. A 200-fold enrichment was achieved forhighly abundant (AC), repeats, but for much less abundant (ACAG), repeats an enrichment of only 20-fold wasobtained. Using a single set of PCR conditions, 19 microsatellite loci were identified from 77 primer pairsevaluated. Genotyping of 16 (AC), loci in 16 unrelated white pines from the north-central United States revealedan average of 5.4 alleles per locus and an average observed heterozygosity of 0.515. Five loci were scoredamong megagametophytes from a single pine to obtain a haploid genotype of the segregating female meioticproducts. All loci segregated according to Mendelian expectations and linkage was established for two of theloci. It was concluded that (AC), loci are highly variable in this species and that SSR (simple.sequence repeat)markers can be efficiently developed for genome mapping and population genetics studies.Key words: Pinus strobus, forest genetics, simple sequence repeat, SSR, allelic diversity.Rbum4 :Une mCthode de clonage par enrichissement a Cte tvalu6e en vue de l'isolation de microsatellites chezle pin blanc et les marqueurs obtenus ont Cte examinks quant A leur polymorphisme. Un facteur d'enrichissementde 200 a CtC obtenu pour les shuences (AC),, lesquelles sont tr2s abondantes, tandis que pour les muenc esmoins abondantes (ACAG),, un facteur d'enrichissement de 20 seulement a CtC atteint. En utilisant une seule&rie de paramhtres pour l'amplification PCR, 9 loci de microsatellites ont pu etre identifits avec les 77 pairesd'amorces CvaluCes. L'analyse gtnotypique de 16 loci (AC), chez 16 pins blancs non apparent& provenant de laregion centre-nord des &tats-~nis indiquC une moyenne de 5.4 allhles par locus et une hCtCrozygotie moyenneobservCe se chiffrant 0,515. La sCgrCgation de cinq loci a CtC CtudiCe parmi des mCgagamCtophytes provenantd'un seul pin afin d'ttablir le genotype haploi'de des produits de la mCiose du c6t6 femelle. Tous les loci ontmontre une segregation mendblienne et une liaison gCnCtique a CtC Ctablie pour deux des loci. I1 en a Ctd concluque les loci (AC), sont tr&svariables chez cette esp&ceet que les microsatellites pourraient ainsi etre mis aupoint d'une manihre efficiente en vue de travaux de cartographie et d'etudes de g6nCtique des populations.Mots clks : Pinus strobus, gCnCtique de la for&, microsatellite, SSR, diversit6 alltlique.[Traduit par la R6dactionl

There are few marker systems cumndy available or suitablefor detailed genetic analyses of eastern white pine (Pinusstrobus). Eastern white pine is the only native five-needledpine (subgenus Strobus) in eastern North America and is anecologically and potentially economically important forestspecies. Only a handful of isozymes (Beaulieu and Simon1994a, 1994b; Eckert et al. 1981) or restriction fragmentlength polymorphisms (RFLPs) (Ahuja et al. 1994; Deveyet al. 1994) have been identified for use in white pine.Random amplified polymorphic DNA (RAPD) markers arewell suited for mapping disease traits (Devey et al. 1995)or for genome mapping in individual pines (Kubisiak et al.

Corresponding Editor: J.P. Gustafson.Received April 1, 1996. Accepted July 11, 1996.CS. Echt and P. May-Marquardt. North Central ForestExperiment Station, Institute of Forest Biotechnology,5985 County Road K,Rhinelander, WI 54501, U.S.A.M. Hseih and 8. Zaborchak. Research Genetics,Incorporated, 2 130 Memorial Parkway SW, Huntsville,AL 35801, U.S.A.

1995; Lu et al. 1995; Plomion et al. 1995; Nelson et al.1993, l W ) , but are of limited use for other types of studies.Our objective was to learn whether simple sequence repeats(SSRs), also known as micmatellites, could provide sufficientvariability for genetic studies in eastern white pine andwhether SSR marker development was practical. If so, SSRmarkers could find wide application in genome mapping andlinkage analysis, in analyzing genetic structures of naturaland breeding populations, and in genetic fingerprinting.

SSRs are abundant sources of genetic variation in manyorganisms. By designing PCR primers specific to non-repetitive sequences that flank a repeat, small quantitiesof DNA can be assayed to detect length polymorphismsat an SSR site (Weber and May 1989). A PCR primer pairthus defines an SSR marker locus. The simple repetitivenature of SSRs can lead to strand slippage during DNAreplication (Hauge and Litt 1993; SchlStterer and Tautz1992), thus generating length polymorphisms. Dependingon the repeat motif and species involved, mutation ratesin mammalian systems can range from 1 X lo-' to 1.6 Xpe r locus per gamete per generation (Ellegren 1995;Weber and Wong 1993; Edwards et al. 1992). The mutationrates of SSRs in plants are not known.

Genome, 39: 1102-1 108 (1996). Printed in Canada / ImprimC au Canada

7/28/2019 echt004.pdf

2/7

Echt et al.High information content, definitive allele assignment,

and rapid analysis by PCR make SSR markers well suitedfor both linkage mapping and genetic diversity studies inplants (Akkaya et al. 1995; Plaschke et al. 1995; Bell andEcker 1994; Saghai-Maroof et al. 1994; Morgante et al.1994; Wu and Tanksley 1993). SSR markers have beendeveloped in several tree species, such as oak (Dow et al.1995), Citrus (Kijas et al. 1995), and radiata pine (Smithand Devey 1994). Characterization of two SSR markersin radiata pine (Pinus radiata), in the subgenus Pinus,show that (AC), SSR markers can be quite informative ina conifer species. We have found, in loblolly pine (Pinustaeda) and eastern white pine, several di-, tri-, and tetra-nucleotide SSR motifs that are each present at 20 000 -120 000 copies per haploid genome (C.S. Echt and P. May-Marquardt, submitted for publication). ' With a 1C (haploid)DNA content of 29 pg (Wakamiya et al. 1993), the mostabundan t.white pine SSRs are expected to be present atan average frequency of one every 220-1280 kilobases(kb), distances that are comparable to those estimated forseveral angiosperm crop species (Kresovich et al. 1995;R6der et al. 1995; Wu and Tanksley 1993).Materials and methodsSSR enrichment cloningHaploid DNA of eastern white pine parent P-312 was digestedwith a cocktail of EcoRV, HaeIII, RsaI, and Ssp1 restrictionendonucleases. The fraginents were ligated to 5' phosphory-lated BstXI linkers (Research Genetics, Inc.) and then sizefractionated on agarose gels to 200-700 base pairs (bp). Librariesenriched for SSR-bearing clones were obtained by the methodsof Ostrander et d. 1992), with some modifications. In brief, thepurified adapted fragments were ligated into the nonpalin-dromic BstXI site of pJCPl and recombinant vector was elec-troporated into JMG-1 (dut- ung- F') cells to produce a primaryuracil-substituted library. Jacqueline Pulido and Geoffrey Duykof the Harvard Medical School generously provided the vectorand host cells. From this library, circular single-stranded DNAwas rescued, purified, and used in primer extension reactionscontaining Taq DNA polymerase, a phosphorylated oligomerof the desired SSR as primer, dNTPs, and no dUTP. The double-stranded products, now enriched for SSR-bearing inserts, wereused to transform DHlOB (dut+ ung+) cells. SSR clones wereselected for sequencing following two rounds of colonyhybridization screening with a '*P end-labeled SSR probe.Either (AC),, or (ACAG),, probes were used and hybridizationswere performed at T, (temperature of dissociation) - 1C,with stringency washes at about T, - 45C.Sequencing and primer synthesisSequencing templates were generated from most clones by PCRamplification of the inserts from primers flanking the cloning site(S'AAAGGGGGATGTGCTGCAAGGCG and S'GCTTCCG-GCTCGTATGTTGTGTGG). Amplified products were then puri-fied by polyethylene glycol precipitation (Rosenthal et al. 1993)and resuspended in water. Alternately, plasmid DNA was puri-fied using Wizard Miniprep columns (Promega Corp.) and recov-ered in water. The templates were used in forward and reversedideoxy dye terminator cycle sequencing reactions and ana-lyzed on a 373A automated DNA sequencer according to the

manufacturer's instructions (Perkin-Elmer-ABI). Primer pairs forSSR markers were designed with the aid of the PRIMER 0.5 pro-gram (Whitehead Institute, Cambridge, Mass.) and synthesizedas MapPairsTM y Research Genetics, Inc.Marker analysisNew primer pairs were tested in PCR by amplifying sixP. strobus haploid DNA samples. PCR reactions contained10 ng DNA template in 10 pL of reaction buffer containing50 mM Tris-Cl (pH 9.0), 20 mM ammonium sulfate, 12%sucrose, 0.2 mM cresol red, 100 pg/mL gelatin, 3.5 mM mag-nesium chloride, 200 pM each dNTP, 200 nM each primer,and 0.025 UIpL Tfl +ermostable DNA polymerase (EpicentreTechnologies). A touchdown amplification protocol was runon an MJ Research PTG-100 thermocycler. The first two cyclesincluded a denaturing skep at 94OC for 1 min, an annealingstep at 60C for 1 min, and $n extension step at 70C for 35 s.The next 18 cycles consisted of a denaturing step at 93C for45 s, an annealing step at 59C for 45 s (which subsequentlywas decreased by O.SC every cycle until a final temperature of50.5"C was reached), and an extension step at 70C for 45 s.Conditions for the last 20 cycles were 92C for 30 s, 50C for30 s, and 70C for 60 s, followed by a final extension at 70Cfor 5 min. Amplification products were examined on horizontal1.5% TreviGel-500 agarose gels (Trevigen, Inc.) in 1X TAE(Tris-acetate-EDTA) containing 0.2 pg/mL ethidium bromide.Markers that amplified cleanly at or near the expected sizewere further characterized to detect size variations among 16 dif-ferent R strobus trees. Positive and negative controls were runfor each primer pair. After amplification, one volume of a stopsolution (deionized 95% formamide, 10 mM NaOH, 0.05%bromophenol blue, plus 0.05% xylene cyanol) was added toindividual PCR reactions. Samples were denatured at 95C for2 min before loading 3.0 pL onto pre-electrophoresed verticaldenaturing polyacrylamide gels. The composition of the0.4 mm X 43 cm ong gels was 6% acrylarnide (acrylarnide-bis-acrylamide 19: ), 8 M urea, and 1X TBE (Tris-borate-EDTA).For glass plate preparation, ~ c r ~ l e a s e ~ ~Stratagene CloningSystems) was used for a nonstick coating on one plate andy-methacryloxypropyltrimethoxysilane (Sigma Chemical Co.)for the gel binding treatment on the other. The upper reservoirbuffer was 1X TBE and the lower reservoir buffer was 0.66XTBE plus 0.5 M sodium acetate (Sheen and Seed 1988). Gelswere electrophoresed at 50C constant temperature, with 100 Wlimiting power, for 2-2.5 h. Separated markers were stainedwith silver following the Promega Silver sequenceTM rotocol,with some modifications. All solutions were freshly preparedwith 18 Ma-cm water (d.i. water) and all steps were done atroom temperature, but the developer solution was prechilledto 10-12C to reduce background staining. After electrophoresis,the gel, bound to a glass plate, was fixed for 20 min with 7.5%glacial acetic acid and then given three 2-min rinses with d.i.water. Used fixing solution was stored at 4C for later use.The gel was stained for 30 min in 6 mM silver nitrate plus0.056% formaldehyde and then rinsed with d.i. water for 5 s. Fordevelopment of the stain, 800 mL of chilled developer (0.28 Msodium carbonate, 0.056% formaldehyde, plus 8 pM sodiumthiosulfate) was added with gentle agitation and then decantedwhen the first bands became visible. An additional 1200mL ofdeveloper was added and agitation continued until developmentwas nearly complete. The developing reaction was stopped byadding 1200 mL of chilled used fixing solution and then thegel was rinsed thoroughly with d.i. water and air-dried. Imageswere recorded either by making contact ~ r i n t s n APC film(Promega Corp.) or by digital capture witb a flatbed scanner.C.S. Echt and P. May-Marquardt. Abundance of All SSR allele sizes were measured to a 1-bp accuracy usingmicrosatellite loci in pine. Submitted for publication. molecular weight standards of either +XI74 phage DNA

7/28/2019 echt004.pdf

3/7

Genome, Vol. 39, 19Table 1. SSR loci, forward and rev erse primer sequences, marker sizes expected from cloned sequencesa, andoptimum primer annealing temperatures.

Locus Repeat PCR primers Size(bp)Annealing temperature

("C)RPS 1bRPS2RPS6RPS12RPS18RPS20RPS25bRPS34bRPS39RPS5ORPS60RPS84RPS90RPS118bRPS119RPS 124RPS 127RPS 150RPS 160

(AC),,(AC)

.(AC)14(AC)17(AC)14(AC),,(AT),(AC), AG(AT),(AC)14(AC)17(AC)17(AC),,(AT),(CT),,(AC), ,(AC),3(AC),,(AC) ,,(AT),(AC),,(AC),O(AT),(GAG14(ACAG), AGGC(AGAC),

GCCCACTATTCAAGATGTCAGATGTTAGCAGAAACATGAGGCATGGTGTTGGTCATTGTTCCATGGAGGCTATCACGTATGCACCr n C T A A T C A G T G T G C G C T A C ACACCGCTGCCCTATTTTACATCAATGTGGAGATGGTGATTACTTCTGACCTAACCAGAAACCTTTCTAATCAGTGTGCGCTACATCACCGCTGCCCTATTTTACAACTTCCCCACAGGTTAACACAAACAAGATAGGCGGGATTCACACATATGGCAGAACACACAGATCGTCGCACTATCGAACCAGTGTTCTCTTATCACAGCGGCACTATAATGAAATAGCGCAGCCAGCTCCAACCAGAATCGGCTCGCTGACCCAATAACCCAGAAATCTGTT'ITAGAGCACACATGAAATGTCAGAATGCACGATAATGGCGGTGAGAACAACCACCTGTCCTTCGTACATCCACCmGGTCATTGTATTTTTGGACCTTCCTTTTCCTTCTTGCTCCACACCCATTGTGGTGTGTTTGTGCCTCCGACCATAAACCTTAATGCATTGTGGTGTGTTTGTGAACCACCTCCGACCATAAACTTGTGAGAAGATACTTCCTCCACCTTGTCTTCTAAAAAACACTTTTAGAGTTCTCACTTCACAATAGGTGATTTCACACAATTTTGAGTGTTTACTTCCTCCAAGTTACTATTGTCACCTTGTCTTCTAAAAAACACTITTTCCATCAGTGAGCAGTGGCACTTGGGCTTCCTCTTCACTAAGAACTCTCCCTCTCACCTCATTGTTCCCCAAATCAT

"GenBank accession Nos.U60239-U60258.d dsdigested with Hue111 or pGEM DNA markers (Promega Corp.)mixed with poly(dA) (Pharmacia Biotech Inc.) that had beensonicated to produce a 1-bp ladder. Haploid linkage analysiswas performed using MAPMAKER (Lander et al. 1987), generouslyprovided by S. Tingey, Du Pont Inc., on a Macintosh computer.An upper recombination fraction of 0.30 and a minimum LODlimit of 4.0 were used for detecting linkages.ResultsEnrichment cloning and sequencingInitial attempts by our laboratory to develop (AC), markersinvo lve d c lon ing s i z e -se l e ct e d Sa u3A I f r a gme n t s i n toM1 3m p18 (C.S . Echt , unpubl i shed da ta ) . Only 5 (AC),clones, with an average insert size of 400 bp, were obtained

out of 60 000 plaques screened. This frequency of recovewas much lower than expec ted and led us to use the S Senr ichment c loning method descr ibed in Mater ia l s amethods. The enriched library had an average insert size303 bp and an (AC), c lone f requency of 30%. Using estimate for white pine of one (AC), site every 221 kilobapairs (kbp), for n > 11 (C.S. Echt and P.May-Marquarsubmitted for publication, see footnote I ) , a n (AC), clofrequency of 0.14% would be expected from a representatinonenriched library. Enrichment thus provided over a 20fold increase in the frequency of (AC), clones.One hundred an d for ty clones were selected by colohybridization, 99 were sequenced, and 8 4 unique sequencwere obta ined. Seventy-e ight of these conta ined (AC

7/28/2019 echt004.pdf

4/7

Echt et at.Table 2. SSR allele number, sizes, and observed heterozygosity among clones of 16P. strobus individuals from the north-central United States Great Lakes region.-- -- - -- --

No. of Allele size Repea t unitLocus Repeat sequence alleles range (bp) no. (n) HORPS 1bRPS2RPS6RPS 12RPS 18RPS20RPS25bRPS34bRPS39RPS50RPS60RPS84RPS90RPS118bRPS 124RPS 127RPS 150RPS 160

193-207149-171159-164163-209162-166138-17497-1 15145-149172-174160-1 8826 1-279145-163138-164, null148-164147-153194-196248246

sequences ranging from 5 to 23 repeat units (Fig. I ), withan average repeat length of 13.6 units. Fifty-seven (73%)of the (AC), repeats had n > 10. By standard definitions(Weber 1 990) , 11 (14%) of the repeat sequences wereimperfect and 19 (24%) were compound. Sixteen of thecompound repeats involved the sequence (AT), and oneeach involved (AG),,, (CG),, or (ACCC),.Selection for (ACAG), sequences was much less success-ful, with an enriched library frequency of 0.3% giving anenrichment factor of 22, based on the genome frequencye s t i m a t e o f o n e ( A C A G ) , e v e r y 1 9 3 0 k b p f o r n > 5(C.S. Echt and P. May-M arquardt, submitted for publication,see footnote 1). Only 30 clones were selected and sequencedand 13 fell into two repetit ive sequence classes . For all(ACAG), sequences, the longest uninterrupted repeat lengthwas n = 3 and a l l repeats were either compound or imperfect.

SSR marker diversityPrimer pairs were made from 70 of the (AC), sequences and7 of the (ACAG), sequences. Under a single set of PCRconditions, 19 suitable markers were obtained (Table 1).T h e l o c u s d e s i g n a t i o n R P S i s a n a b b r e v i a t i o n f o r"Rhinelander, Pinus strobus." A marker was deemed suitablewhen a single locus amplified efficiently at the expected sizeand with a minimum of s tutter bands when assayed onsilver-stained denaturing polyacrylamide gels. All markersreported in Table 1 contained the target SSR sequence, asdetermined by Southern hybridizations of the PCR.productswith oligonucleotide probes. The marker rpsl50, selectedfrom the (ACAG), library, also contained a (GAG), repeat,which was listed as the main repeat sequence in Table 1because of its longer repeat length.Allelic diversity at 16 (AC), lo ci was measured in 16unrela ted t rees growing in the s ta tes of Wiscons in and

Fig. 1. Length distributions of (AC), in sequences obtainedfrom enrichment cloning. Values for n correspond to thelongest perfect repeat run.

5 7 9 11 13 15 17 19 21 23n for (AC),

Minnesota (Table 2). Heterozygosity w as detected by deter-mining the haploid genotype of eight m egagametophytesfrom each tree. Examples of segregating alleles for a locusare shown in Fig . 2 . Al l loc i were polymorphic w i th inthe group of 16 trees examined. There was an average of5 .4 a l l e l e s pe r locus (86 a l l e l e s to t a l ) , and obs e rvedheterozygosity values (Ho) ranged from 0.125 to 0.812,with an average value of 0.515. T he two non;(AC), loci,RPS 150 and R PS 160, were not polymorphic. There w erefive (AC), loci, not among those listed in Table 1, whosePCR produ cts differed in size by 10-34 bp from what was

7/28/2019 echt004.pdf

5/7

Genome, Vol. 39, 199Fig. 2. Segregation of allele s of locus RPS84 among megagametophytes of 10 eastern white pine trees. Thesmallest allele observed for this locus was 145 bp and contained 10 (AC) repeats (tree C163), while thelongest allele was 163 bp and contained 19 repeats (trees N155 and H952). Spacing between the stutter bandswas 2 nucleotides and the top-most fragment is the correct allele size based on the cloned insert sequence(obtained from tree P-312).

expected and all were m onomorphic among the 16 treesexamined.Five loci were genotyped in the eastern white pine par-ent P-18 an d all loci met M endelian expectations for 1:1segregation among the 7 2 megagametophytes scored. Forloci R PS 12, RPS50, RPS84, RPS90, and RPS 118b, therespective X2 values were 0.00, 0.68, 0.00, 0.25, and 0.01.Linkage was found between RPS90 and RPS 118b, givinga recombination fraction of 0.23 with a LOD of 4.32.DiscussionThe enrichme nt method describe d by O strander et al. (1993)worked wel l in whi te p ine for (AC), loci but not for(ACAG), loci. (ACAG), sequenc es were initially chosen forselection because they had previously been enriched withsuccess from several mammalian genomes. Poor recoveryof (ACAG), from the white pine genome was probablydue to the comparatively low genomic density of thesesites and association of the sequence with repetitive DNA .This motif appears to be rare in plants in general, as itwas not found in a DNA database survey (Wang et al .1994). Given the success of the (AC),, enrichment, and theconversion of about 20% of (AC), clone sequences to SSRmarkers, further development of selected classes of SSRmarkers i s warranted in eastern w hite pine. Through appli-cation of screening methods to identify noninformativeclones before sequencing, the sequence-to-marker successrate could be improved. For example, hybridization withlabeled total genomic DNA could identify clones contain-ing repetitive DNA (Smith and Devey 1994), while PCRscreening of the inserts using various combinations of uni-versal and SSR-specific primers could identify cloneshaving the SSR site too close to an end of the cloned frag-ment. Approximately 12% of the clones we sequenced hadthe SSR run too close to an insert end to allow for suitableprimer-pair selection.Ou r initial nonenriched M13 library had a very low fre-quency (8 X of (AC),-bearing clones, app aren tlybecause m ost Sau3AI fragmen ts carrying (AC), sites existin the 1-6 kbp range (Smith and Devey 1994; C.S. Echt,unpub l i shed da t a ) and were t hus exc luded f rom the200-600 bp size selected fragments used for cloning. This

points to the importance of characterizing restriction e nzymand SSR combinations by Southern blot analysis befoSSR library construction. The combination of blunt engenerating restriction enzymes we used for the enrichelibrary did work for generating small (AC),-bearing fragments,but may need to be optimized for diffesent SSR motifThe lower limit of the number of (AC), repeat uniwas usually found at n = 8, although RPS12 had one allewith n = 5, assuming that the reduction in length of thallele was due entirely to loss of simple sequence repeunits. As seen with locus RPS39, the longer repeat lengthof n = 18 o r n = 17 are not always highly variable, as generally the rule with human SSRs (Weber 1990). ITable 2 the number of repeat units is given as a function othe (AC), repeat, but in some compound repeats, otherepeat motifs could have been involved, such as the (AG)element of RPS84 or the (AT)9 element of RPS25b. A higincidence of associated (AT), sequenc es was also observeamong (AC), and (AG), loci examined in radiata pin(Smith and Devey 1994), and the (AT), motif may be thmost common among plants (Wang et al. 1994). Loci RPSand RPS 18 had alleles that differed by 1 nucleotide, a sizvariation not consistent with a step-wise model for dinucleotide repeat mutations (Valdes et al. 1993). These loalso contained (A), repeats, however, so it is assumed tha m utation in the mononucleotide repeat was responsible fthe unique allele sizes.Smith and Devey (1994) examined allelic diversity atwo (AC), loci in 40 radiata pines ( P . radiata ) distributeamong four populations. They found H, alues ranginfrom 0 to 0.85, with a mean of 0.625, and an average o6 alleles per locus. These values are comparable to those wdetermined for P. strobus, where H, anged from 0.125 t0.812, with a mean of 0.515, and an average of 5.4 alleleper locus. In contrast, isozyme diversity in eastern whipine is notably lower. Among 300 individuals distributein 10 populations in Quebec, C anada, 18 isozyme loci haa mean H, f 0.176 with an average of 1.96 alleles pelocus (Beaulieu and Simon 1994b).Segregation data was obtained for only five white pinSSR loci. All segregated normally and linkage was establ i shed be tween two marke rs (RP S 90 and kP S 118bPreliminary genome mapping has placed all five SSR lo

7/28/2019 echt004.pdf

6/7

Echt et al.

in linkage groups in a RAPD marker map of eastern whitepine (C.S. Echt, unpublished data). The abundance, easeof genotyping, and high allelic diversity found for (AC),loci in pines should make them useful markers for genomemapping and population genetics studies.The SSR marker detection system we describe, usingsilver staining of denaturing polyacrylamide gels, is quickand convenient. We calculate that the cost of reagents usedfor a single silver staining reaction, plus one half sheet ofAPC film for gel documentation, amounts to $US 11. Iftwo gels are processed in a single staining reaction anddigital imaging is used fo r documentation, then the costis reduced to $US 4 .50 . The use of sharktooth combs hav-ing a 4X-offset microtitre format allows 133 sample lanes(not including standards) to be loaded on a 33 cm widegel, and by loading two or more markers of different sizeranges in each lane, over 500 genotypes could be generatedper day. This system could thus generate data economicallyand at sufficient rates to support most genetic studies.Although we were not successful in obtaining markersbased on (ACAG), repeats, it is possible that other tri-and tetra-nucleotide repeats will yield usable markers. Thenext step is to perform enrichment cloning for abundanttri- and tetra-nucleotide SSR motif clones and to learnwhether these repeats are as informative as those of (AC),.The advantage of the longer repeat SSRs is that they aremore amenable to both automated and manual analysisthan are the dinucleotide repeats, in large part owing toreduction or elimination of stuttering artifacts (Hauge andLitt 1993; Edwards et al. 1991).Conservation of SSR loci has been observed amongmammalian genomes (Blanquer-Maumont and Crouau-Roy1995; Moore et al. 1991) and among Citrus species (Kijaset al. 1995). This raises the possibility that some whitepine SSR markers could be used in other conifers, thusbenefiting conifer SSR marker development efforts andextending the potential uses of the markers to comparativegenome mapping. Preliminary data from our laboratory,however, indicate that most SSR primers can only beexpected to amplify markers among members of the samepine subgenus, and will have low success rates when usedin more distantly related species. It is our opinion that thebest strategy for pine SSR marker development is to developmarkers for soft pines (subgenus Strobus) and hard pines(subgenus Pinus) separately. The use of white pine SSRmarkers for comparative genome mapping across the genusis thus probably quite limited, but should prove usefulamong closely related species. No single marker systemis optimally suited for all studies, however, and the useof SSR markers would be expected to be augmented byother types of markers as the study dictates.ReferencesAhuja, M.R., Devey, M.E., Groover, A.T., Jermstad, K.D., andNeale, D.B. 1994. Mapped DNA probes from loblolly pinecan be used for restriction fragment length polymorphismmapping in other conifers. Theor. Appl. Genet. 88: 279-282.Akkaya, M.S., Shoemaker, R.C., Specht, J.E., Bhagwat, A.A.,and Cregan, P.B. 1995. Integration of simple sequence repeatDNA markers into a soybean linkage map. Crop Sci. 35:

1439-1445.

Beaulieu, J., and Simon, J.P. 1994a. Inheritance and linkagerelationships of allozymes in Pinus strobus L. Silvae Genet.43: 253-261.Beaulieu, J., and Simon, J.P. 1994b. Genetic structure andvariability in Pinus strobus in Quebec. Can. J. For. Res.24: 1726-1733.Bell, C.J., and Ecker, J.R. 1994. Assignment of 30 microsatel-lite loci to the linkage map of Arabidopsis. Genomics, 19:137-144.Blanquer-Maumont, A., and Crouau-Roy, B. 1995. Poly-morphism, monomorphism, and sequences in conservedmicrosatellites in primate species. J. Mol. Evol. 41: 492-497.Devey, M.E., F iddler, T.A., Liu, B.H., Knapp, S.J., andNeale, D.B. 1994. An RFLP linkage map for loblolly pinebased on a three-generation outbred pedigree. Theor. Appl.Genet. 88: 273-278.Devey, M.E., Delfino-Mix, A., Kinloch, B.B., and Neale, D.B.1995. Random amplified polymorphic DNA markers tightlylinked to a gene for resistance to white pine blister rust insugar pine. Proc. Natl. Acad. Sci. U.S.A. 92: 2066-2070.

Dow, B.D., Ashley, M.V., and Howe, H.F. 1995. Characterizationof highly variable (GAICT), microsatellites in the bur oak,Quercus macrocarpa. Theor. Appl. Genet. 91: 137-14 1.Eckert, R.T., Joly, R.J., and Neale, D.B. 1981. Genetics ofisozyme variants and linkage relationships among allozymeloci in 35 eastern white pine clones. Can. J. For. Res. 11:573-579.Edwards, A*,Civitello, A., Hammond, H.A., and Caskey, T.C.1991. DNA typing and genetic mapping with trimeric andtetrameric tandem repeats. Am. J. Hum. Genet. 49: 746-756.Edwards, A., Hammond, H.A., Jin, L., Caskey, C.T., andChakraborty, R. 1992. Genetics variation at five trimericand tetrameric tandem repeat loci in four human populationgroups. Genomics, 12: 241-253.Ellegren, H. 1995. Mutation rates at porcine microsatellite loci.Mamm. Genome, 6: 376-377.Hauge, X.Y., and Litt, M. 1993. A study of the origin of'shadow bands' seen when typing dinucleotide repeat poly-morphism~ y the PCR. Hum. Mol. Genet. 2: 41 1-415 .Kijas, J.M.H., Fowler, J.C.S., and Thomas, M.R. 1995. Anevaluation of sequence tagged microsatellite site markersfor genetic analysis within Citrus and related species.Genome, 38: 349-355.Kresovich, S., Szewc-McFadden, A.K., Bliek, S.M., andMcFerson, J.R. 1995. Abundance and characterization ofsimple-sequence repeats (SSRs) isolated from a size-fractionated genornic library of Brassica napus L. (rapeseed).Theor. Appl. Genet. 91: 206-21 1 .Kubisiak, T.L., Nelson, C.D., Nance, W.L., and Stine,M. 1995.RAPD linkage mapping in a longleaf pine X slash pine F-1family. Theor. Appl. Genet. 90: 1 1 19-1 127.Lander, E.S., Green, P., Abrahamson, J., Barlow, A., Daly, M.J.,Lincoln, S.E., and Newburg, L. 1987. MAPMAKER: aninteractive computer package for constructing primary geneticlinkage maps of experimental and natural populations.Genomics, 1: 174-181.Lu, M.Z., zmidt, A.E., and Wang, X.R. 1995. Inheritance ofRAPD fragments in haploid and diploid tissues of Pinussylvestris (L.). Heredity, 74: 582-589.Moore, S.S., Sargeant, L.L., King, T.J., Mattick, J.S.,Georges, M., and Hetzel, D.J.S. 1991. The conservation ofdinucleotide microsatelli tes among mammalian genomesallows the use of heterologous PCR primer pairs in closelyrelated species. Genomics, 10: 654-660.Morgante, M., Rafalski, A., Biddle, P., Tingey, S., andOlivieri, A.M. 1994. Genetic mapping and variability of

7/28/2019 echt004.pdf

7/7

Genome, Vol. 39, 9seven soybean simple sequence repeat loci. Genome, 37:763-769.Nelson, C.D., Nance, W.L., and Doudrick, R.L. 1993. A partialgenetic linkage map of slash pine (Pinus elliottii Engelmvar. elliottii) based on random amplified polymorphic DNAs.Theor. Appl. Genet. 87: 145-151.Nelson, C.D., Kubisiak, T.L., Stine, M., and Nance, W.L. 1994.A genetic linkage map of longleaf pine (Pinus palustrisMill.) based on random amplified polymorphic DNAs.J. Hered. 85: 433-439.Ostrander, E.A., Jong, P.M., Rine, J., and Duyk, G. 1992.Construction of small-insert genomic DNA libraries highlyenriched for microsatellite repeat sequences. Proc. Natl.Acad. Sci. U.S.A. 89: 3419-3423.Plaschke, J., Ganal, M.W., and Roder, M.S. 1995. Detectionof genetic diversity in closely related bread wheat usingmicrosatellite markers. Theor. Appl. Genet. 91: 1001-1 007.Plomion, C., Bahrman, N., Durel, C.-E., and O'Malley, D.M.1995. Genomic mapping in Pinus pinaster (maritime pine)using RAPD and protein markers, Heredity, 74: 661-668.Rosenthal, A., Coutelle, O., and Craxton, M. 1993. Large-scaleproduction of DNA sequencing templates by microtitre for-mat PCR. Nucleic Acids Res. 21: 173-174.Roder, M.S., Plaschke, J., Konig, S.U., Borner, A,,Sorrells, M.E., Tanksley, S.D., and Ganal, M.W. 1995.Abundance, variability and chromosomal location ofmicrosatellites in wheat. Mol. Gen. Genet. 246: 327-333.Saghai-Maroof, M.A., Biyashev, R.M., Yang, G.P., Zhang, Q.,and Allard, R.W. 1994. Extraordinarily polymorphic

microsatellite DNA in barley: species diversity, chromosomlocations, and population dynamics. Proc. Natl. Acad. SU.S.A. 91: 5466-5470.Schlotterer, C., and Tautz, D. 1992. Slippage synthesis of simsequence DNA. Nucleic Acids Res. 20: 21 1-215.Sheen, J., and Seed, 33. 1988. Electrolyte gradient gels DNA sequencing. BioTechniques, 6: 942-944.Smith, D.N., and Devey, M.E. 1994. Occurrence and inheritanof microsatellites in Pinus radiata. Genome, 37: 977-98Valdes, A.M., Slatkin, M., and Freimer, N.B. 1993. Allele fquencies at microsatellite loci: the stepwise mutation modrevisited. Genetics, 133: 737-749.Wakamiya, I., Newton, R.J., Johnston, J.S., and Price, H1993. Genome size and environmental factors in the genPinus. Am. J. Bot. 80: 1235-1241.Wang, Z., Weber, J.L., Zhong, G., and Tanksley, S.D. 19Survey of plant short tandem DNA repeats. Theor. ApGenet. 88: 1-6.Weber, J.L. 1990. Informativeness of human (dC-dA),:(dGdT), polymorphisms. Genomics, 7: 524-530.Weber, J.L., and May, P. 1989. Abundant class of human DNpolymorphisms which can be typed using the polymerachain reaction. Am. J. Hum. Genet. 44: 388-396.Weber, J.L., and Wong, C. 1993. Mutation of human shtandem repeats. Hum. Mol. Genet. 2: 1123-1 128.Wu, K.S., and Tanksley, S.D. 1993. Abundance, polymorphiand genetic mapping of microsatellites in rice. Mol. GGenet. 241: 225-235.