Ecological shift of oral microbiota - Universidade do Minho · PDF fileEcological shift of...

outubro de 2013

Universidade do MinhoEscola de Engenharia

Catarina Cubo da Fonte

Ecological shift of oral microbiota

UM

inho

|20

13C

atar

ina

Cub

o da

Fon

teE

colo

gic

al sh

ift

of

ora

l m

icro

bio

ta

Dissertação de Mestrado Mestrado Integrado em Engenharia BiomédicaRamo de Engenharia Clínica

Trabalho realizado sobre a orientação da Professora Doutora Mariana Contente Rangel HenriquesUniversidade do Minhoe doProfessor Doutor Wim TeughelsKatholieke Universiteit of Leuven

outubro de 2013

Universidade do MinhoEscola de Engenharia

Catarina Cubo da Fonte



- iii -

Acknowledgments

My first words are to my supervisors, Dr. Wim Teughels and Dr.ª Mariana Henriques, I

am especially grateful. They were always so understanding and available to help and meet with

me. I want to express my thankfulness to Dr. Wim Teughles for the opportunity to integrate his

investigation team in the Department of Periodontology of the Catholic University of Leuven. This

work would not be possible without his ideas and advices. I specially acknowledge to Dr.ª

Mariana Henriques for the patience, understanding, guidance and motivation.

I want to express a special thanks to Gitte Loozen and Martine Pauwels. Gitte was

untiring, I have to thank all the time she spent hearing my doubts and questions and explaining

me. I will always remember all the availability, her advices and what she taught me. Martine was

always helpful, especially with the molecular techniques I learned in the lab. She also had friendly

words to my work, when my bacteria did not grow or when some techniques did not work. I will

never forget her ‘Allez’ and complains about the weather. I also have to acknowledge to the

laboratory people for the hospitality and sympathy, and the good working environment, mainly to

Jesica and Mariana.

I would like to express a special word to my Erasmus mates (Joana Festa, José

Sequeiros, Mariana Roriz, Pedro Morais, Pedro Vieira and Sandro Queirós) for all mishaps and

experiences we lived together in a different country. Thank you to all Erasmus students I met

during my time in Leuven. I also would like to thank to LUK singers for each music moments.

Another special word goes to my course friends, they were like a new family I found in a

new city with which I grew up and I lived so good moments. Thank you for the fellowship and

friendship. I also have to thank to people from the academic choir, CAUM, for each rehearsal and

concert.

I also want to dedicate a special thanks to each person that encouraged me during thesis

writing, for their support and motivation.

My last words must be addressed to my beloved mother and father. I wish to stress their

unconditional love, confidence, support, help, encouragement, patience and understanding,

without them this could not be possible. Thank you.

To my maternal grandparents,

they would be proud of me.


- iv -


- v -

Ecological shift of oral microbiota - Abstract

The oral cavity is composed of several bacterial species living in a dynamic and complex

ecosystem. Periodontitis and dental caries are two of the most prevalent oral diseases,

nowadays. However, current treatments are not enough to fight these oral diseases, so

alternative ways are required, as the use of prebiotics and probiotics, which are already being

used in several fields.

The present work represents the study of the effect of a prebiotic compound (C7) on

cariogenic bacteria in order to understand whether addition of this compound leads to a decrease

of these bacteria. Streptococcus mutans and Streptococcus sobrinus were the cariogenic

bacteria used in this study because these are the main cariogenic bacteria. A probiotic strain,

Streptococcus salivarius, was also used in this study.

Firstly, quantitative Polymerase Chain Reaction (qPCR) was developed for Streptococcus

salivarius in order to allow an accurate determination of its presence in microbial communities.

The primers were chosen based on a conserved region of the dextranase gene of S. salivarius

and the best combination of primers and probe concentration was determined. This

quantification of this strain by this molecular technique was compared with microbial culturing

presenting a linear relationship.

It was also intended, the find a selective medium for each of the species used, so

different media were tested and TYCSB medium showed to be a good selective medium for S.

mutans and S. sobrinus. However no selective medium was found for S. salivarius.

In order to determine the effect of the prebiotic compound, dual species experiment for

each cariogenic bacterium and a probiotic species was carried out. Microbial culturing and qPCR

were used for bacteria quantification and pH was also measured. For S. mutans, the main

reduction was apparently due to the presence of S. salivarius and was not influenced by C7. For

S. sobrinus, the verified reduction was the result of presence of S. salivarius with influence of C7,

but no clear conclusions can be made about it.

In addition a Denaturing Gradient Gel Electrophoresis (DGGE) was performed to

understand the effect of the prebiotic compound in saliva microbiota. The results demonstrated

an ecological shift between different bacterial species present in saliva. So, S. salivarius seems to

be in higher amounts when C7 is present while other species seem to be present in higher

concentration when there is no C7.


- vi -


- vii -

Alterações ecológicas da microflora oral - Resumo

A cavidade oral é um ecossistema dinâmico e complexo no qual diversas espécies vivem

e interagem. Hoje em dia, a periodontite e as caries dentárias são duas das doenças orais mais

prevalentes no mundo. No entanto, os tratamentos atuais não têm sido suficientes para

responder a estas doenças, havendo necessidade de se utilizar outras alternativas. O uso de

prebióticos e probióticos pode ser uma hipótese, tendo em conta que já têm vindo a ser

utilizados noutras áreas.

Este trabalho representa o estudo do efeito de um composto prebiótico (C7) em

bactérias cariogénicas, tentando perceber de que forma a sua presença permite levar à

diminuição destas. Deste modo, foram utilizadas as principais bactérias cariogénicas

(Streptococcus mutans e Streptococcus sobrinus) e também uma espécie probiótica

(Streptococcus salivarius).

Assim sendo, foi desenvolvida uma metodologia de Polymerase Chain Reaction em

tempo real (qPCR) para S. salivarius, de modo a possibilitar a sua correta quantificação em

comunidades microbianas. A melhor combinação de concentrações dos primers e probe foi

definida e a quantificação por este método foi comparado com a cultura microbiana,

apresentando uma relação linear. A pesquisa de meios seletivos para cada uma das espécies

usadas foi também realizada neste trabalho, pelo que foram testados vários meios. O meio

TYCSB mostrou ser seletivo para ambas as espécies cariogénicas, contudo não foi encontrado

nenhum meio seletivo para o S. salivarius.

Para determinar o efeito do composto prebiótico foi utilizado um modelo de espécies

dual para cada bactéria cariogénica conjugando-a com a espécie probiótica. A quantificação

destas estirpes foi feita através de cultura microbiana e qPCR e o pH foi também medido. Para o

S. mutans, a principal redução verificada aparentou dever-se à presença do S. salivarius e não

devido à influência do C7. Para o S. sobrinus, a redução que se verificou também resultou da

presença do S. salivarius com uma ligeira influência do C7, embora estas conclusões não sejam

muito claras.

Para perceber o efeito do C7 na saliva foi realizado uma DGGE (Denaturing Gradient Gel

Electrophoresis), tendo os resultados demonstrado uma alteração ecológica entre as diferentes

espécies presentes na saliva. Assim, S. salivarius, pareceu estar mais presente quando o C7 se

encontra adicionado, enquanto outras parecem estar em maiores quantidades quando este

composto não se encontra presente.


- viii -


- ix -

Table of Contents

Acknowledgments ................................................................................................................... iii

Ecological shift of oral microbiota – Abstract ............................................................................ v

Alterações ecológicas da microflora oral – Resumo ................................................................. vii

Table of Contents ................................................................................................................... ix

Abbreviations .......................................................................................................................... xi

List of figures ......................................................................................................................... xiii

List of tables ......................................................................................................................... xvii

Chapter 1 – Introduction .......................................................................................................... 1

1.1. Main objectives .................................................................................................... 3

1.2. General concepts ................................................................................................. 3

1.2.1. The oral cavity ...................................................................................... 3

1.2.2. Oral biofilms ...................................................................................... 4

1.3. Plaque-related diseases ........................................................................................ 6

1.3.1. Dental plaque and oral diseases ............................................................ 6

1.3.2. Periodontitis ......................................................................................... 7

1.3.3. Dental caries ......................................................................................... 9

1.3.4. Ecological plaque hypothesis .............................................................. 11

1.4. New treatments ................................................................................................. 15

Chapter 2 – Development of a new qPCR for Streptococcus salivarius .................................... 19

2.1. Introduction ....................................................................................................... 21

2.2. Materials and Methods ....................................................................................... 22

2.2.1. Bacterial strains and culturing conditions ............................................ 22

2.2.2. Design of qPCR primers and probe ..................................................... 22

2.2.3. Construction of the qPCR plasmid standard ......................................... 23

2.2.4. qPCR optimization .............................................................................. 23

2.2.5. Comparison between qPCR and microbial culturing ............................. 23

2.3. Results and Discussion ...................................................................................... 24

2.3.1. Design of qPCR primers and probe ..................................................... 24

2.3.2. qPCR optimization .............................................................................. 25

2.3.3. Comparison between qPCR and microbial culturing ............................. 26

2.4. Conclusion ......................................................................................................... 26


- x -

Chapter 3 – Effect of a prebiotic compound on cariogenic and saliva bacteria ......................... 27

3.1. Introduction ....................................................................................................... 29

3.2. Materials and Methods ....................................................................................... 30

3.2.1. Bacterial strains and culturing conditions ............................................ 30

3.2.2. Media testing ...................................................................................... 31

3.2.3. Growth in dual-species model .............................................................. 31

3.2.4. DNA extraction and quantitative Polymerase Chain Reaction (qPCR) .... 32

3.2.5. Saliva collection and preparation ......................................................... 33

3.2.6. DNA extraction, PCR-DGGE assay ........................................................ 33

3.3. Results ............................................................................................................... 34

3.3.1. Selective medium for Streptococcus salivarius, Streptococcus mutans and

Streptococcus sobrinus ................................................................................. 34

3.3.2. Effect of a prebiotic compound on cariogenic bacteria ......................... 35

3.3.3. Effect of a prebiotic compound on bacteria present in saliva ................ 42

3.4. Discussion ......................................................................................................... 43

3.5. Conclusion ......................................................................................................... 48

Chapter 4 – Conclusion and future work ................................................................................ 51

Chapter 5 – References ......................................................................................................... 55


- xi -

Abbreviations

A. a.: Actinobacillus actinomycetemcomitans

AER: aerobic conditions

ANA: anaerobic conditions

BHI: Brain-Heart Infusion

bp: base pair

C7: prebiotic compound

CFU: colony-forming units

CO2: carbon dioxide

DGGE: Denaturing Gradient Gel Electrophoresis

DMF: Decayed, Missing, Filled

DMFS: Decayed, Missing, Filled Surfaces

DMFT: Decayed, Missing, Filled Teeth

DNA: deoxyribonucleic acid

dNTP: deoxynucleoside triphosphate

EDTA: ethylenediaminetetraacetic

Eh: redox potential

EMA: ethidium monoazide

EPS: Extracelular Polymeric Substances

FAM: 6-carboxyfluorescein

FOS: fructo-oligosaccharides

GC content: guanine-cytosine content

GCF: Gingival Crevicular Fluid

GI tract: gastrointestinal tract

GOS: galacto-oligosaccharides

gtf: glucosyltransferase

IPS: Intracelular Polymeric Substances

KCl: potassium chloride

L. fermentum: Lactobacillus fermentum

L. reuteri: Lactobacillus reuteri

L. rhamnosus: Lactobacillus rhamnosus

L. salivarius: Lactobacillus salivarius


- xii -

MgCl2: magnesium chloride

MM: Miminal Medium

MS: Mitis-Salivarius

MS-MUT: selective medium for Streptococcus mutans

MS-SOB: selective medium for Streptococcus sobrinus

OD: optical density

P. g.: Porphyromonas gingivalis

PCR: Polymerase Chain Reaction

PCR-DGGE: Polymerase Chain Reaction – Denaturing Gradient Gel Electrophoresis

PMA: propidium monoazide

qPCR: Quantitative Polymerase Chain Reaction

R2: correlation coefficient

S. mitis: Streptococcus mitis

S. mutans: Streptococcus mutans

S. oralis: Streptococcus oralis

S. salivarius: Streptococcus salivarius

S. sanguinis: Streptococcus sanguinis

S. sobrinus: Streptococcus sobrinus

SD: standard deviation

TAMRA: 6-carboxytetramethylrhodamine

Tm: melting temperature

TYC: Trypticase, Yeast, Cysteine

TYCSB: Trypticase Yeast Cysteine Sucrose Bacitracin

UV: ultraviolet

VBNC: Viable But Non-culturable Cells

w/v: weight per volume


- xiii -

List of figures

Figure 1 - Oral biofilm formation. A. Pellicle formation. The acquired pellicle is a thin layer that

consists of adsorbed organic molecules derived from the salivary glycoproteins attached to the

tooth surface. B. Initial adhesion. Specific receptors allow the initial adhesion of bacteria to the

pellicle. C. Maturation. Biofilm maturation results of interactions between later colonizers and

early colonizers, previously attached in a cell-to-cell reaction (co-aggregation). D. Dispersion.

Bacteria leave the biofilm and colonize a new site [2]. .............................................................. 4

Figure 2 - Ecological plaque hypothesis and prevention of periodontal diseases. Gingival

Crevicular Fluid (GCF). Redox potential (Eh) [10]. ................................................................... 13

Figure 3 - Ecological plaque hypothesis and prevention of dental caries [10]. .......................... 14

Figure 4 - Extended caries ecological hypothesis [20]. ............................................................ 15

Figure 5 - PCR amplification for detection of the dextranase gene of oral streptococcal species by

a PCR and a DNA probe (Ssal497T) with Ssal442F and Ssal615R primer pair: S. mutans (lane

1), S. sobrinus (lane 2), S. salivarius ATCC 7073 (lane 3), S. salivarius K12 (lane 4), S. salivarius

clinical strain (lane 5), S. salivarius TOVE-R (lane 6). Negative control (lane 7) was made with

physiological water. ............................................................................................................... 25

Figure 6: Number of colony forming units (CFU) of Streptococcus salivarius (Y-axis) versus

quantification of Streptococcus salivarius by quantitative Polymerase Chain Reaction (qPCR) (X-

axis). Correlation coefficient: R2=0.9741. ................................................................................ 26

Figure 7: Growth on Mitis-Salivarius agar plates (I) and on Trypticase Yeast Cysteine Sucrose

Bacitracin (TYCSB) plates (II). (A): Streptococcus salivarius, (B): Streptococcus mutans and (C):

Streptococcus sobrinus. ......................................................................................................... 35

Figure 8: Number of colony forming units (CFU) of Streptococcus mutans in dual species model

at 0 h, 24 h and 48 h: Growth of S. mutans testing the effect of C7 compound with (E) or without

(D) the presence of S. salivarius and glucose with (C) or without (B) S. salivarius. The negative

controls were made one with only the cariogenic bacterium (A) and another with the cariogenic

bacterium and S. salivarius without addition of glucose (F). Standard errors of the mean (n=3)


- xiv -

are represented by error bars. Significance (p<0.05) between the control (only S. mutans) and

test series was determined using Student’s t-test and are marked with *. ................................ 36

Figure 9: Number of Streptococcus mutans in dual species model at 0 h, 24 h and 48 h

determined by quantitative Polymerase Chain Reaction (qPCR). The effect on S. mutans of C7

compound with (E) or without (D) the presence of S. salivarius and glucose with (C) or without (B)

S. salivarius. The negative controls were made one with only the cariogenic bacterium (A) and

another with the cariogenic bacterium and S. salivarius without addition of glucose (F). Standard

errors of the mean (n=2 for 0 h and n=3 for 24 h and for 48 h) are represented by error bars.

Statistically significant differences (p<0.05) between the control (only S. mutans) and test series

were determined using Student’s t-test and are marked with *. ............................................... 37

Figure 10: Number of Streptococcus salivarius in Streptococcus mutans dual species model

experiment at 0 h, 24 h and 48 h determined by quantitative Polymerase Chain Reaction (qPCR):

S. mutans conjugated with S. salivarius and glucose (C), S. mutans together with S. salivarius

and the C7 compound (E). The control was made with the cariogenic bacterium and S. salivarius

(F). Standard errors of the mean (n=3) are represented by error bars. Statistically significant

differences (p<0.05) between the cariogenic bacterium (S. mutans) together with the probiotic

bacterium (S. salivarius) with and without glucose are marked with * and was determined using

Student’s t-test. ..................................................................................................................... 38

Figure 11: Number of colony forming units (CFU) of Streptococcus sobrinus in dual species

model at 0 h, 24 h and 48 h: Growth of S. sobrinus testing the effect of C7 compound with (E) or

without (D) the presence of S. salivarius and glucose with (C) or without (B) S. salivarius. The

negative controls were made one with only the cariogenic bacterium (A) and another with the

cariogenic bacterium and S. salivarius without addition of glucose (F). Standard errors of the

mean (n=3) are represented by error bars. Significance (p<0.05) between the control (only S.

sobrinus) and test series was determined using Student’s t-test and are marked with *. .......... 39

Figure 12: Number of Streptococcus sobrinus in dual species model at 0 h, 24 h and 48 h

determined by quantitative Polymerase Chain Reaction (qPCR): S. sobrinus culture testing the

effect of C7 compound with (E) or without (D) the presence of S. salivarius and glucose with (C)

or without (B) S. salivarius. The negative controls were made one with only the cariogenic

bacterium (A) and another with the cariogenic bacterium and S. salivarius without addition of


- xv -

glucose (F). Standard errors of the mean (n=3) are represented by error bars. Significance

(p<0.05) between the control (only S. sobrinus) and test series was determined using Student’s t-

test and are marked with *. .................................................................................................... 40

Figure 13: Growth of Streptococcus salivarius in Streptococcus sobrinus dual species model

experiment at 0 h, 24 h and 48 h with quantitative Polymerase Chain Reaction (qPCR): S.

sobrinus conjugated with S. salivarius and glucose (C), S. sobrinus together with S. salivarius and

the C7 compound (E). The control was made with the cariogenic bacterium and S. salivarius (F).

Standard errors of the mean (n=3) are represented by error bars. Statistically significant

differences (p<0.05) between the cariogenic bacterium (S. sobrinus) together with the probiotic

bacterium (S. salivarius) with and without C7 compound are marked with * and was determined

using Student’s t-test. ............................................................................................................ 41

Figure 14: PCR-DGGE analysis of effect of C7 compound in BHI and saliva after 24 h. BHI: Brain-

Heart Infusion. C7: prebiotic compound. ANA: Anaerobic Conditions. AER: Aerobic Conditions.

Black arrow: S. salivarius marker. Red rectangles: bands more clearly with the presence of C7

compound. Yellow rectangles: bands more clearly without the presence of C7 compound. ...... 42


- xvi -


- xvii -

List of tables

Table 1 – Comparison of the sequences of primers and probe designed for different strains of

mutans streptococci .............................................................................................................. 24

Table 2 – qPCR primers and probe: Guanine-Cytosine content (% GC), Melting temperature (Tm) 24

Table 3: Conditions used in dual-species model growth with each one of cariogenic bacteria

(Streptococcus mutans or Streptococcus sobrinus). Prebiotic compound (C7) ......................... 31

Table 4: Sequence and final concentrations of primers and probe used in quantitative

Polymerase Chain reaction (qPCR) assay for Streptococcus salivarius, Streptococcus mutans and

Streptococcus sobrinus .......................................................................................................... 32

Table 5: pH values for Streptococcus mutans in dual species model at 24 h and 48 h:

Assessment of pH variation of S. mutans culture testing the effect of C7 compound with (E) or



cariogenic bacterium and S. salivarius without addition of glucose (F) ..................................... 38

Table 6: pH values for Streptococcus sobrinus in dual species model at 24 h and 48 h:

Assessment of pH variation of S. sobrinus culture testing the effect of C7 compound with (E) or



cariogenic bacterium and S. salivarius without addition of glucose (F) ..................................... 41


- xviii -

Master Thesis Ecological shit of oral microbiota

Catarina Cubo da Fonte - 1 -

CHAPTER 1

Introduction

Ecological shit of oral microbiota Master Thesis

- 2 - Catarina Cubo da Fonte



1.1. Main objectives

The aim of this work is the evaluation of the effect of a prebiotic compound (C7) stimulating

Streptococcus salivarius to a mixture of cariogenic bacteria (Streptococcus mutans and

Streptococcus sobrinus). The purpose is to analyze and discover whether addition of this

compound leads to a decrease in the concentration of these cariogenic bacteria.

Moreover, the effect of this compound in saliva is also aimed in this work in order to test

which bacteria are stimulated by this prebiotic compound.

The discovery of a selective medium for each bacteria used (S. salivarius, S. mutans and

S. sobrinus) is also aimed to quantify these strains by microbial culturing. The development of a

quantitative Polymerase Chain Reaction (qPCR) for S. salivarius is another goal of this work to

make possible its quantification by this molecular technique.

1.2. General Concepts

1.2.1. The oral cavity

The oral cavity is a complex microbial ecosystem consisting of several bacterial species

that interact with each other competitively and cooperatively in a not isolated or confined

compartment within the human body [1]–[5]. The mouth comprises teeth, supporting tissues and

oral mucosa [6]. Bacteria colonize different structures such as teeth, tongue and oral mucosa,

and some bacteria are associated to the maintenance of oral health and balance with the host

and the environment, while others are related to biofilm formation and to oral diseases [1], [2].

The resident microflora differs in composition according to surface and consists not only by

Gram-positive and Gram-negative bacteria, but also by other species as yeasts [7], [8]. Several

oral bacteria are associated to systemic diseases such as cardiovascular diseases and bacterial

endocarditis [9].

The mouth has permanently shedding forces and organisms need to be firmly attached

to avoid being washed away [8]. Saliva is a complex fluid produced by salivary glands that helps

the mouth to get the optimal conditions for the growth of numerous microorganisms [6], [10],

[11].

Saliva has several protective functions such as the production of a digestive enzyme or

antibodies, keeping the warm, clean and moist conditions (maintaining the normal pH of the oral

microflora values around 6.75-7.25 and the temperature around 35-36 ºC) or helping the speech

[6], [8], [10]–[12]. Saliva has buffering capacity to restore the pH and is a primary source of



carbohydrates, peptides and amino acids associated to clearance of fermentable sugars in mouth

[7]. Saliva influences the ecology of the mouth with its ionic composition and organic

components such as glycoproteins and proteins [10].

1.2.2. Oral biofilms

Oral biofilms are aggregates of microorganisms attached to a surface or to each other

creating a dynamic and complex multispecies community called dental plaque leading to oral

disorders such as periodontitis or dental caries [1], [2]. “Animalcules” were observed for the first

time in gingival tooth scrapings by Antoine van Leeunwenhoek with a microscope [2], [13], [14].

Bacteria in biofilm form and act like a community and present some specific

characteristics such as complex interspecies interactions, surface attachment, extracellular

matrix of polymeric substances [1]. On the other hand, microorganisms that are free-floating and

not attached are called planktonic cells and their characteristics differ from biofilms, which

consist of with glycocalyx matrix and bacterial cells [2]. Planktonic cells can attach directly to

surfaces of the oral cavity or to bacterial cells already colonized [1].

Figure 1 - Oral biofilm formation. A. Pellicle formation. The acquired pellicle is a thin layer that consists of adsorbed organic molecules derived from the salivary glycoproteins attached to the tooth surface. B. Initial adhesion. Specific receptors allow the initial adhesion of bacteria to the pellicle. C. Maturation. Biofilm maturation results of interactions between later colonizers and early colonizers, previously attached in a cell-to-cell reaction (co-aggregation). D. Dispersion. Bacteria leave the biofilm and colonize a new site [2].

Biofilm formation is a natural and highly dynamic process (Figure 1). It begins with the

attachment of acquired pellicle by specific extracellular proteinaceous components (adhesins)

crucial for the initiation of biofilm formation [2], [3], [15]. This pellicle is an acellular

proteinaceous film, a thin layer of adsorbed organic molecules originates from the salivary

glycoproteins, phosphoproteins and lipids attached to a clean tooth surface and consists of

several components as glycoproteins, enzymes and other molecules [1]–[3], [8]. The

mechanisms involved in acquired pellicle formation include long-range forces (Coloumb



interactions, van der Waals forces and dipole-dipole interactions), medium-range forces

(hydrophobic interactions) and short range forces (covalent bonds, electrostatic interactions,

hydrogen bonds, ionic interactions and Lewis acid-base interactions) and are based on Gibbs law

of free enthalpy [2].

The second phase consists of initial adhesion of bacteria to the pellicle, which is

important for oral bacteria interactions with host molecules allowing the connection between

bacteria and receptors [1]–[3]. There are specific receptors in the pellicle on the tooth surface

that allow bacterial binding based on a recognition system [8]. The mechanisms involved in the

early attachments are the result of random bacterial movement and are based on electrostatic

attractions or physical attachments and later on chemical forces, which include hydrogen bonds,

hydrophobic interactions, calcium bridges, van der Waals forces, acid-base interactions and

electrostatic interactions [2], [3], [8], [13]. This early attachment is weak and reversible and

some bacteria previously attached may leave the tooth surface due to specific and non-specific

molecular interactions involved on it. Early colonizers are pioneer species that attach the tooth

surface mainly members of the genera Actinomyces and Streptococcus [2], [3], [7], [13].

The third phase comprises the attachment and biofilm maturation [2]. The attachment of

colonizers is made through salivary glycoproteins by connection to early colonizers, previously

attached to cells surfaces [1], [2]. Late colonizers include Gram-negative anaerobes, as for

example Fusobacterium nucleatum, Porphyromonas gingivalis, Treponema spp. [2], [8]. The

attachment of later colonizing bacteria is a cell-to-cell reaction mediated by adhesin-receptor

interactions called co-aggregation [1], [2], [8]. This specific process is very complex because

bacteria can only aggregate with specific bacteria according to polysaccharide recognition and

not with any random bacteria. When bacteria attach to the pellicle by specific interactions,

extracellular polymeric substances (EPS) excretion begins and attachment becomes stronger and

irreversible [2], [8], [13]. EPS is the major component of biofilms surrounding bacteria present in

biofilm establishing its structure, promoting bacterial accumulation to the tooth surface, providing

a communication medium between bacteria, and promoting biochemical and physiological

changes in the matrix of the biofilm [2], [13], [16]. EPS are largely insoluble and biosynthetic

polymers such as polysaccharides, proteins, nucleic acids and phospholipids [13]. A mature

biofilm has different microbial components from the initial biofilm [2]. The mature biofilm is a

stable situation that can enhance the resistance to antibiotics due to its complex structure and

multispecies composition, when compared to planktonic cells [1], [2].



The last phase in biofilm formation is the dispersion of biofilm cells and colonization

because bacteria leave the biofilm by erosion, sloughing, and seeding and so, they can spread to

colonize a new site [2]. This detachment is due to limited nutrients on biofilm requiring a new site

with more nutrients to grow and due to limitation of biofilm development (bacteria are better

protected against fluid shear force of saliva on rough surfaces) [2], [3].

Microorganisms in dental biofilm can cooperate and also compete with each other [1],

[2]. The bacteria present in biofilm maintain equilibrium with the host through microbial cell-cell

interactions helping the community dynamics [1], [3], [17]. From all oral bacteria, Streptococci

are Gram-positive that have the strongest ability to produce several kinds of bacteriocins such as

mutacins (lantibiotics and non-lantibiotics) [1], [2], [10]. Bacteriocins are non-specific proteins

produced derived of ribosomal synthesis of cationic peptides with antimicrobial activity [1], [2],

[4]. Quorum sensing system is a chemical communication process among bacteria characterized

by the production of signal molecules, transport, sense and control of bacterial growth [1], [2].

Moreover, some commensal bacteria present in the dental plaque are able to exclude

some pathogens and allochthonous bacteria by production of antimicrobial substances or

competition for nutrients [1], [3], [17]. However, the accumulation of dental biofilms also

modifies the bacterial composition leading to oral diseases such as periodontitis or dental caries

[1]. This modification is characterized by a shift in oral biofilms from Gram-positive bacteria to

Gram-negative anaerobic rods.

So, the biofilm results of the attachment of the bacterial cells to a clean surface (tooth

surface) forming an acquired pellicle, followed by accumulation and multiplication of bacteria

resulting in the colonization and maturation of biofilm [15].

1.3. Plaque-related diseases

1.3.1. Dental plaque and oral diseases

Dental plaque is a dynamic microbial ecosystem in which several Gram-positive and

Gram-negative bacteria, that interact with each other through microbial interactions, grow as a

biofilm maintaining a dynamic stability stage - microbial homeostasis [7]–[9], [18]–[20].

However, changes and imbalances in the oral microflora can occur and the microbial

homeostasis breaks down allowing the development of plaque-related diseases due to an

enrichment of pathogens and a reduction of beneficial bacteria within the microbial community

[4], [7], [19]. Oral diseases are the result of a shift in the balance of the resident microbiota [21].



Periodontal diseases are infections of the supporting tissues of the teeth that result of an

inflammatory response disturbing the harmonious relationship in the oral cavity [22]–[24].

Periodontal diseases are the most common infection diseases in the world and remain an

important health problem associated to tooth loss in adults [4], [24]–[26]. These diseases are

characterized by an increase of obligatory anaerobic bacteria as Gram-negative proteolytic

species [10].

Gingivitis is a reversible infection of the soft tissue of the mouth that does not destroy the

periodontal tissues [22]. Gingivitis results from accumulation of plaque triggering an

inflammatory response and increasing the gingival crevicular fluid [7]. Periodontitis is a

polymicrobial infection due to colonization of hard and soft surface tissues in the oral cavity that

can result in attachment loss and destruction of alveolar bone and eventually tooth loss [24],

[27]–[29]. So, periodontitis is a more severe stage of the infection that results of the evolution of

gingivitis [24].

Dental caries is an infectious disease due to bacterial action resulting of a process of

demineralization of enamel crystals and dentin by acids derived from interactions of specific

bacteria with sugars of the dental plaque leading to tooth destruction [30]–[33].

Dental diseases are one of the most prevalent diseases nowadays with high treatment

costs [10].

1.3.2. Periodontitis

The periodontium is a set of tissues that supports the tooth and can be divided in

gingiva, cementum, alveolar bone and periodontal ligament [33], [34]. Gingiva is the soft tissue

that covers the mouth. Cementum is a specialized calcified and hard tissue that covers the root

of the tooth. The alveolar bone is the bone in the jaw that supports and protects the teeth, and

the part of the maxilla that helps the resistance of mastication. The periodontal ligament is a

group of soft and connective tissue fibers that makes the connection between the tooth

attachment and the cementum [24], [33], [34]. The functions of periodontium are the support

and the attachment of the tooth to the bone of the jaw, and the protection and the resistance of

the tooth to the mastication forces [24], [33], [34].

The pathogenic microorganisms involved in oral biofilm originating periodontitis are

principally gram-negative pathogens such as Porphyromonas gingivalis (P. g.), Prevotella

intermedia, Fusobacterium nucleatum and Actinobacillus actinomycetemcomitans (A. a.) [23],

[24], [28]. However, these microorganisms are not in high number in initial lesion, but the



number increase with the development of disease [35]. The oral biofilm with pathogenic

microorganisms is the main etiological factor of periodontitis [24]. For instance, A. a. is a gram-

negative bacterium that is indigenous of the oral cavity [25], [36]. A. a. can induce the

periodontal disease by colonizing tooth surface with adhesins but it is also associated to systemic

infection as endocarditis. On the other hand, P. g. is an anaerobic, non-motile and non-

sporulating Gram-negative rod able to colonize the gingival sulcus and also the periodontal pocket

[14], [37]. Virulence factors of P. g. help this species to survive in adverse conditions of growth

as periodontal pocket.

The aim of therapy and treatment for patients with periodontitis is to halt the progression

of the disease removing the inflammation and reducing the periodontopathogens from the

subgingival area [23], [24], [27]. Traditional treatment involves scaling and root planning

conjugated with antibiotics [23], [24], [26], [27].

Scaling and root planning is a surgical therapy that consists in removing supra- and

subgingival plaque and the plaque from the root surfaces of the teeth preventing the progression

of periodontitis [14], [24]. The most effective method in scaling and root planning used is called

periodontal debridement and aims to stimulate the regeneration of lost and damaged tissues and

to reduce deep probing depth [24], [38]. This technique has several benefits such as the

reduction of clinical inflammation, disease progression and probing depth, gain of clinical

attachment, and microbial shifts of oral cavity to an oral microflora with less pathogen. However,

scaling and root planning is technically difficult to perform due to some mechanical limitations

and time consuming [24], [38]. Moreover, this technique is disagreeable for patients and some

bacteria present can persist and recolonize [24], [27], [38].

The use of antibiotics is an adjunctive therapy to treat periodontitis [24]. The application

of antibiotics can be systemic or local depending on severity of periodontitis. The most commonly

systemic antibiotics used are tetracycline, ciprofloxacin, metronidazole and penicillins [24]. This

type of pharmacologic administration is easy to perform, but is also associated to resistance of

bacterial species. On the other hand, local delivery gives site specific and therapeutic level at the

site of infection allowing localized treatment areas [24]. Tetracyclines, metronidazole and

chlorhexidine are drugs used for local delivery. The disadvantages are associated to their cost

due to successive treatments and in the inconvenience by changing oral hygiene habits [26].

However, this is not a definitive solution because (re)colonization of the periodontal pockets and



resistance to antibiotics can occur, which is more difficult with bacteria within biofilm [4], [23],

[24], [27], [29].

Periodontopathogens can also enter the blood stream triggering new infections [24]. For

this reason, periodontal diseases have been investigated in order to verify their association to

other diseases. Current research supposes periodontal diseases increase cardiovascular diseases

[22]. Genetic factors such as age, hypertension and diabetes or environmental factors as diet,

stress or cigarette smoking are tested risk factors associated to cardiovascular diseases.

Periodontopathogens have been found in the association of etiology in cardiovascular diseases

[22].

1.3.3. Dental caries

Dental caries is one of the most common diseases affecting humans and one of the

most prevalent chronic diseases, characterized by a very slowly progression in the majority of

individuals and becoming the most expensive part of the body to treat [18], [30], [39], [40]. Pain,

localized destruction of the hard tissues, tooth destruction and tooth loss and impaired quality-of-

life are some consequences of untreated caries [18], [41].

When a biofilm on tooth surface is able to attach, grow, develop and mature, the process

of formation of dental caries can initiate and progress, leading to the loss of mineral from the

tooth and the localized destruction of the tooth [8], [40], [42]. Although the presence of biofilm is

necessary to develop dental caries, not all biofilms lead to dental caries, i.e., the amount is not

enough to trigger this process, and in this case teeth can be healthy covered by biofilms [40].

Consumption of fermentable carbohydrates are the key environmental factors involved in

initiation and development of dental caries [7], [10], [16]. Sucrose is the most cariogenic dietary

carbohydrate because it is fermentable and used as a substrate for extracellular glucan synthesis

by glucosyltransferases from mutans streptococci and the synthesis of extracellular (EPS) and

intracellular (IPS) polyssacharides in the dental plaque [16]. Low pH environment promotes a

change in the resident oral plaque, while EPS promote changes in the composition of matrix of

the biofilm [16]. EPS such as glucosyltransferases and fructosyltransferases help bacterial

adherence and accumulation on tooth surface and create biochemical and structural changes in

the matrix of biofilm, such increase the porosity. IPS such as glycogen-like help to maintain a low

pH in the matrix of dental plaque and to exposure organic acids to tooth surfaces. Then, sugar

can easily diffuse into the biofilm and decreasing local pH by microbial catabolism [16].

Furthermore, sucrose is able to reduce the concentrations of the most important ions in



maintaining the mineral equilibrium between the tooth and the oral environment (calcium,

inorganic phosphorus and fluoride) [16].

An increase of sucrose-rich diet and carbohydrates metabolism promotes acidification

creating conditions for ‘low-pH’ non-mutans streptococci species grow, increasing the risk of

dental caries [10], [16], [20]. Acid production exposure the dental plaque continuously under the

critical pH for demineralization of tooth surfaces leading to net mineral loss and chemical

dissolution [10], [16], [18], [20], [30]. This destruction can affect enamel, dentin and cementum

[40], [42], [43]. Enamel and dentin are part of the tooth. Enamel is a hard, inert and acellular

tissue that covers the crown and it is also the most highly mineralized tissue found in the body.

Dentin is a hard, elastic, resilient, sensitive, connective and avascular tissue that supports the

enamel [6]. Consequently, acid production by oral bacteria due to sugar metabolism decreases

environmental pH. So, dental caries is an endogenous disease that consists of metabolic events

in dental biofilms resulting in an imbalance in the equilibrium between biofilm fluid and tooth

mineral [10], [18], [20], [42]. As a consequence, acid production increases, environmental pH

decreases and chemical composition of dental plaque shifts to a predominantly Gram-negative

bacteria such mutans streptococci and lactobacilli [10], [18]–[20].

The traditional detection of dental caries is made by visual examination (white opaque

lesions as a consequence of enamel translucency) and radiographs [41], [43]. Recently, other

methods have been developed, e.g. methods based on fiber-optics, fluorescence or electrical

impedance [41].

It has been used the DMF index to quantify caries, where D is for decayed teeth, M is for

teeth missing and F is for teeth previously filled [44]. This index can be applied to teeth entirety

(DMFT) or to all surfaces of the teeth (DMFS) [44]. However, the application of DMF index has

been decreasing nowadays, except in the quantification of treatment received, mainly due to

modern preventive and restorative technology [44].

Several microorganisms are involved in the formation of dental caries. These

microorganisms should be able to produce acid and to tolerate a low-pH environment [18].

Non-mutans streptococci and Actinomyces species are present in high levels at the initial

stage of plaque formation, probably due to adhesins which facilitate their adhesion to proteins

and sugar chains of acquired pellicle on tooth surface [18], [20], [35]. These species can acidify

the environment through degradation of carbohydrates creating acidic and anaerobic conditions

[35]. Non-mutans streptococci strains such as Streptococcus sanguinis, Streptococcus oralis and



Streptococcus mitis are the initial colonizers involved and mutans streptococci are present in low

level [18], [20]. When dental caries is developed, the most common species present are

Actinomyces and Streptococcus [20].

Mutans streptococci are a group of microorganisms (such as Streptococcus mutans and

Streptococcus sobrinus) able to grow and develop at conditions of high sugar and low pH [7],

[10], [18], [19]. Mutans streptococci are highly acidogenic and aciduric species able to produce

water-insoluble extracellular glucan from sucrose by glucosyltransferase promoting bacterial

adhesion to tooth surface and to other bacteria [18], [20], [35]. Although mutans streptococci

are associated to dental caries, the disease can occur in the absence of these microorganisms

[19]. Mutans streptococci are the major pathogens involved in dental caries formation (specially

related with sucrose-rich diet) due their aciduric and acidogenic characteristics [18], [20]. S.

mutans is the main etiological agent of human dental caries [17]. Additionally, S. sobrinus is also

associated with the formation of dental caries [39]. The risk of transmission from mother to child

is another etiological factor of dental caries [45].

An invasive intervention in clinical dentistry is an operative way involved on caries

treatment [46]. Vaccination, gene therapy or antimicrobial treatment are several ways to control

dental caries, however elimination of specific bacteria responsible for caries is not an effective

method because these bacteria are essential for mouth equilibrium [20]. An alternative is the use

of probiotics to treat caries infection through interfere on oral colonization of cariogenic bacteria

[5].

S. mutans and S. sobrinus are also associated with non-oral infections [39]. Diabetes

can also be related to dental caries due to salivary dysfunction [12].

1.3.4. Ecological plaque hypothesis

The mouth comprises surfaces such as mucosal surfaces and teeth (non-shedding

surfaces) with different oral microflora. Some of these places, for example, teeth, allowing the

attachment and growth of bacteria which leads to the dental plaque and later to disease, e.g.,

periodontitis or caries [10].

The resident oral microflora is characterized by a dynamic relationship with inter-

microbial and host-microbial interactions. This microbial homeostasis leads to the stability of

microflora [10]. Alterations between microbial ecosystem and host tissue are responsible for

initiation of oral diseases [35].



The resident oral microflora has endogenous proteins and glycoproteins (mucins) as the

main sources of carbon and nitrogen. Any change in the environment increasing oral pathogens

within the microbial community will cause an imbalance in the microflora [10]. Changes in the

nutrient status at the site, the diet, the dentition and radiation therapy are possible causes for

alterations on oral microflora [10].

In a healthy situation, dental plaque results from a biofilm formation: conditioning film,

early colonizers, attachment and colonization, later colonizers, co-aggregration and a microbial

community [10]. In case of periodontitis, there is an increase of levels of obligatory anaerobic

bacteria as a result of development of an inflammatory host response [10]. This increase will

lead to inactivation of host proteins. In the case of dental caries, there is an increase on levels of

acid-tolerating bacteria, principally mutans streptococci and lactobacilli, which will lead to

demineralization of enamel as a result of development of an infection [10]. This increase in

acidogenic and aciduric bacteria will lead to a decrease in pH by metabolizing dietary sugars to

acid, creating an optimal growth conditions for these species.

There are two hypothesis to explain the different bacteria species present in diseased

and healthy sites [10], [19]. The ‘specific plaque hypothesis’ proposes that only a small

percentage of organisms present in dental plaque are actively involved in disease [7], [10], [19].

This hypothesis focuses the treatment only against microorganisms responsible for the disease

[19]. However, caries can appear in the absence of typical etiological agents and these species

can be present without caries lesion development [7], [10], [18].

On the other hand, the ‘non-specific plaque hypothesis’ proposes that interactions

between bacteria present in dental plaque and the host can lead to a disease situation [7], [10],

[19]. So, dental caries and processes associated to their development can be controlled [18].

The ‘ecological plaque hypothesis’ is an alternative explanation to define the relationship

between dental plaque bacteria and the host in health and disease resulting from the

combination of specific and non-specific plaque hypothesis [7], [10], [16], [18], [19]. This

hypothesis is an ecological and dynamic model based on changes in microbial and

environmental dynamics (key factors) in oral microflora leading to the development of oral

diseases [7], [10], [35].

In case of periodontal diseases (Figure 2), putative periodontal pathogens exist on

healthy sites in a small proportion, but when plaque biomass accumulates, an inflammatory host

response is triggered [10]. This results on the increase of flow of gingival crevicular fluid (derived



from blood plasma and is rich in nitrogenous compounds as peptides, amino acids and proteins)

and alteration of local nutrients status and pH will change to a neutral value [7], [10], [35]. The

consequences are an increase in pH (to a neutral value), a decrease in redox potential (Eh) and

an outgrowth in proteolytic, anaerobic and asaccharolytic Gram-negative bacteria [7], [10]. The

microbial shift of periodontitis consists of an enrichment of anaerobic obligatory and proteolytic

bacteria (such as Porphyromonas gingivalis) due to increase of gingival crevicular fluid. This

results from host defense induced by colonization when bacteria promote a neutral pH

environment and increase Gram-negative and unculturable bacteria in the mouth [21], [35].

Figure 2 - Ecological plaque hypothesis and prevention of periodontal diseases. Gingival Crevicular Fluid (GCF). Redox potential (Eh) [10].

In case of dental caries (Figure 3), potentially cariogenic bacteria exist at neutral pH in a

low level (clinically insignificant) [10]. A low-sugar diet promotes a stable plaque microflora and

demineralization and remineralization are in equilibrium [7], [10]. However, with an increase in

the frequency of fermentable carbohydrates consumption, pH will decrease and acid-tolerating

bacteria will proliferate, stimulating demineralization [10], [19]. This situation will shift the

subgingival microflora from mainly Gram-positive bacteria to a more cariogenic resident plaque

microflora with high levels of anaerobic, asaccharolytic and obligatory Gram-negative organisms,

the best adapted to high sugar and low pH, such as mutans streptococci and lactobacilli, on oral

cavity [7], [10], [16]. The microbial shift of dental caries are characterized by increase of

population of aciduric bacteria (mutans streptococci and lactobacilli) and enrichment of

cariogenic potential of supragingival plaque [21], [35].



Figure 3 - Ecological plaque hypothesis and prevention of dental caries [10].

Prevention strategies depend on type of dental disease but the main idea is interfering on

factors responsible for diseases shifting to a health situation [7], [19].

In case of periodontitis, the site should be less anaerobic and the flow of gingival

crevicular flow would be reduced in order to avoid growth of putative pathogens [7], [10]. Anti-

inflammatory and antimicrobial agents reduce gingival crevivular fluid and growth of some

periodontopathogens becomes restrict according their essential nutrients. Oxygenating and redox

agents are an alternative to create an incompatible environment for growth of obligatory

anaerobes when the redox potential of periodontal pocket can be raised to create these

conditions [7]. Methylene blue is a redox dye able to prevent the growth of obligatory anaerobes

by the increase of redox potential and decrease of gingival crevicular fluid [7], [10].

In the case of dental caries, the actions are based on inhibition of plaque acid production

and consumption of non-fermentable sugar compounds [10]. Fluoride is able to enhance

remineralization and acid resistance of enamel. Antimicrobial agents as chlorhexidine reduces

the impact of pH changes and demineralization, promoting mechanical cleaning of plaque [7],

[10]. Other alternative sweeteners, also known as sugar substitutes, act as promoter of

remineralization of enamel and stimulate saliva flow when there is no significant acid production

[7], [10].

An extended caries ecological hypothesis (Figure 4), based on the ecological hypothesis,

proposes three reversible stages in the caries process to explain the relationship between the

composition of the dental plaque and dental caries process, conjugating microbiological,

biochemical, ecological and clinical perspectives [18], [20]. Dynamic stability stage is composed

mainly by non-mutans bacteria (non-mutans streptococci and Actinomyces) promoting a natural



pH cycle for development, growth and equilibrium in the oral cavity [18], [20]. These bacteria

can produce acids from sugary foods and these acids can demineralize enamel, but the

equilibrium is easily achieved by changes between mineral net gain and mineral net loss helping

demineralization and remineralization balance. This situation stimulates selection and increase

of ‘low-pH’ non-mutans bacteria and microbial acid-induced adaptation creating an acidogenic

stage [18], [20]. However, if acidification steps are rarely, balance will shift to net mineral gain

tending to remineralization. The acidic environment increases aciduric bacteria allowing lesion

development and net mineral loss creating an aciduric stage [18], [20].

Figure 4 - Extended caries ecological hypothesis [20].

1.4. New treatments

As current treatment options are not solving the problem of oral disorders, specially due

to antibiotic resistance, other options have to be investigated [21], [47]. Included in these new

options are probiotics and prebiotics, which are emerging in diverse fields, as oral health.

Probiotics are defined as live microorganisms, which when administered in certain

quantities, have health benefits on the host (humans and animals) [4], [5], [21], [46], [48], [49].

First definition for probiotics was introduced by Lilly & Stillwell in 1965 and then several

alterations were made [5], [50]. Probiotics are characterized by beneficial effects (immune

stimulation, immune modulation of host defenses, anticarcinogenic effects, antidiabetic

characteristics, cancer prevention, …), production of antimicrobial substances (depending on pH,

catalase, proteolytic enzymes and temperature), adhesion to the mucosa, degradation of toxins,



improvement of colonization resistance, and competitive exclusion mechanisms [4], [46], [47],

[49]–[51].

The main field of research of probiotics is the gastrointestinal (GI) tract and they are

already being used in the GI tract (particularly the colon, a very heavily colonized site) to restore

numbers of beneficial bacteria and decrease numbers of pathogenic bacteria [5], [21], [46]–

[48], [51]. Bifidobacteria and lactobacilli are the most commonly probiotic species used such as

Lactobacillus acidophilus, Lactobacillus casei, Lactobacillus rhamnosus, and Bifidobacterium

bifidum or Bifidobacterium infantis [5], [21], [46]–[48], [51].

Probiotics require in vitro tests and substantiation of efficacy with human trials before

their use on humans in order to guarantee their beneficial effects [4].

In recent years use of probiotics has also been demonstrated for urogenital infections,

atopic disease, voice prostheses and in the dental field [4], [5], [21], [46], [47].

An ‘oral probiotic’ needs to able to adhere and colonize surfaces in the oral cavity such

as hard non-shedding surfaces [4], [27], [46]. Oral probiotics should also not be able to ferment

sugars, otherwise pH will decrease and caries will develop [4].

Some lactobacilli strains such as L. fermentum, L. salivarius and L. rhamnosus are used

in dairy products (a way for probiotic administration), others are present in resident oral

microflora [46]. L. rhamnosus GG has inhibitory activity against cariogenic streptococci [5], [47].

Lactobacillus species are also able to produce inhibiting substances avoiding and preventing

adhesion and colonization of pathogenic bacteria [46]. For example, consumption of yogurt

containing L. reuteri reduces S. mutans [46]. This reduction is verified during the period of yogurt

consumption and some days after cessation of consumption, thereby studies are required to

analyze caries-inhibiting effect after the probiotic administration [46], [47]. A reduction in mutans

streptococci was also detected with Bifidobacterium DN-173 010 consumption [46]. L. reuteri is

also able to reduce gingivitis [46]. Lactobacilli and bifidobacteria can inhibit growth and

colonization of periodontopathogens to hard and soft tissues and can inhibit cariogenic

streptococci [4], [47].

The best effect on the oral microbiota was seen when working with probiotic indigenous

oral bacteria. Indigenous bacteria are already present in the oral microflora, do not need

adaptation and do not change with intervention or disease [4], [50].

One example of such a bacterium is Streptococcus salivarius [46]. S. salivarius already

demonstrated inhibitory effect on volatile sulfur compounds by competition for colonization sites



against other species [46]. This bacterium is one of the early colonizers of epithelial surfaces of

the oral cavity [21].

An ideal way to stimulate the indigenous beneficial microbiota would be by prebiotics.

Prebiotics are non-digestible food ingredients (substances or nutrients) that can beneficially

affect, by stimulation, the growth and/or the activity of some bacterial species of the host [47]–

[51].

To be considered as prebiotics, a dietary substrate needs to: be resistant and available in

order to be used as fermentation substrate; be selective for beneficial bacteria; induce beneficial

effects within the host by prebiotic fermentation [51], [52].

Prebiotics are non-digestible carbohydrates such as oligosaccharides [51].

Oligosaccharides are soluble short-chain polysaccharides with low degree of polymerization and

can be found in fruits and vegetables and also produced by hydrolysis of polysaccharides.

Lactulose, lactosucrose, fructo-oligosaccharides (FOS), galacto-oligosaccharides (GOS), gluco-

oligosaccharides or xylo-oligosaccharides are some examples of oligosaccharides with prebiotic

potential [21], [51], [52]. Prebiotics are often studied for application o GI tract, but other studies

should be carried out to define their applicability into other areas [52].

Prebiotics produce protective metabolites, increase mineral absorption and reduce the

risk of cancer, e.g., colon cancer [49], [51]. Prebiotics stimulate beneficial components

proliferation in the microflora, specially components with probiotic characteristics such as

lactobacilli and bifidobacteria [21], [49], [52]. The increase of these beneficial bacteria improve

resistance to pathogenic bacteria due to production of natural antibiotics with inhibitory

properties and antimicrobial effects [51].

Different techniques have been developed to enumerate bacteria such as Polymerase

Chain Reaction (PCR) or Denaturing Gradient Gel Electrophoresis (DGGE) due to their

applicability to culturable as well unculturable cells verifying that species present in disease are

already on microflora in an healthy stage but at low numbers [21], [52].

The combination of pre and probiotics could be another point of interest for prevention

and treatment to improve oral health [4]. A mixture that contains pre and probiotics and that

beneficially affects the host is known as symbiotic [5], [50]. Previous research already

demonstrated the inhibitory effect of pre and probiotics for head/neck, oral and respiratory

tracts, pancreas and liver, and kidney, bladder and vagina [48]. Regarding to the oral cavity, the

inhibitory effect of one specific prebiotic compound on the levels of several periodontopathogens



was already demonstrated however the effect of this prebiotic compound needs to be tested on

cariogenic bacteria [48].

Further, some dairy food products have health benefits and have been investigated in

order to use them properly [48]. It is already known that body’s microbiota can be controlled and

modified according to use of pre and probiotics, but an evidence of probiotic therapy on oral

diseases is required [46], [48].



CHAPTER 2

Development of a new qPCR for Streptococcus salivarius





2.1. Introduction

Quantification of oral streptococci is normally made by microbial culturing, which is

laborious and time-consuming and has several disadvantages [53]. However, a quantitative

analysis is always required to detect, count and control bacteria associated to dental caries [39].

So, several methods have been developed to quantify and identify different bacteria in the mouth

such as biochemical, immunological and genetic tests [32], [39], [54]. The majority of these

methods are, however qualitative and based on bacterial detection systems that are time-

consuming, laborious and with possibility of contamination [39], [54]. Therefore, the use of

molecular methods such as DNA-based methodologies would solve these problems and their use

have been increasing [55].

Quantitative PCR (qPCR) assay is a method based on 5’-3’ exonuclease activity of Taq

polymerase and DNA copy number [39]. qPCR enumerates the accumulation of reporter

fluorescence as a result of the cleavage of the probe during PCR amplification [9], [39]. The

probe consists of a specific sequence labeled with a fluorescent reporter dye and a quencher

emitting fluorescence. The quencher dye avoids the extension of the probe by the polymerase

and when it is cleaved it allows the accumulation of the reporter fluorescence [9]. The probe is

normally marked with intercalating dyes (non-specific sequences of fluorescents dyes emitting a

large fluorescence when intercalate into double-stranded DNA) [56].

This method requires only a small volume of sample and amplifies and quantifies the

nucleic acid sequences at the same time and so there is no need to run a gel to see the product.

Thus, qPCR is an accurate, sensitive, precise, specific, fast, reliable, powerful and useful method

with a low possibility of contamination [9], [39], [56], [57].

qPCR assays are already developed for Streptococcus mutans and Streptococcus

sobrinus, the main cariogenic bacteria [39]. However, the quantification of Streptococcus

salivarius by a qPCR assay is also required due to the great interest in this microorganism as a

probiotic strain. Nowadays, the interest on probiotics is growing due to their beneficial health

effects [58]. S. salivarius is an important microorganism of the oral microbiota and it is the most

abundant species of streptococcal present in the oral cavity and an early colonizer of oral

surfaces with potential for use as an oral probiotic [59], [60].

Streptococcus species have a specific conserved locus on the dextranase gene.

Dextranase gene is an enzyme that hydrolyses glucans in the plaque matrix and it could even be

one of the responsible for the virulence of these strains [54].



So, in this stage a qPCR assay was developed for the culture-independent enumeration

of S. salivarius and to maximize the specificity of the qPCR assay in environmental samples.

2.2. Materials and Methods

2.2.1. Bacterial strains and culturing conditions

In the present work Streptococcus mutans ATCC 25175, Streptococcus sobrinus ATCC

33478, Streptococcus salivarius TOVE-R, Streptococcus salivarius clinical strain, Streptococcus

salivarius K12 and Streptococcus salivarius ATCC 7073 were the bacteria used. Bacteria were

maintained on blood agar plates (Blood Agar Base II, Oxoid, Basingstoke, UK) supplemented with

5% sterile horse blood (Biotrading, Keerbergen, Belgium), 5 µg/ml hemin (Sigma Chemical Co,

St. Louis, MO) and 1 µg/ml menadion. One day before each experiment, bacteria were collected

from blood agar plates and incubated overnight in 10 ml Brain-Heart Infusion (BHI) broth

(Becton, Dicksinson and Company, France) at 37 ºC in a 5% CO2 environment. Bacterial

concentration was adjusted by optical density measurements at a wavelength of 600 nm

(Smartspec 3000, BioRad, USA).

2.2.2. Design of qPCR primers and probe

The forward primer (Ssal442F) was based on the dextranase gene from S. salivarius and

was selected from Igarashi et al. (2001). The reverse primer (Ssal615R) and probe (Ssal497T)

were also based on the dextranase gene from S. salivarius and were designed with primer 3

software. A search with BLAST (http://www.ncbi.nlm.nih.gov/BLAST/) and Probe Match [61]

was carried out in order to assess, in silico, the homology of the selected primers and the probe

with unrelated sequences. The primers-probe set for primer-dimers, melting temperature, hairpin

configuration and GC content were checked with OligoAnalyzer (Integrated DNA Technologies,

Coralville, IA, USA). Primers and probe were synthesized by Eurogentec (Seraing, Belgium). The

probe was 5’ labeled with a fluorescent dye as a reporter, FAM (6-carboxyfluorescein), and

another fluorescent dye as a quencher, 3’ TAMRA (6-carboxytetramethylrhodamine). A PCR assay

against S. mutans, S. sobrinus and 4 different strains of S. salivarius was performed as a

confirmation of the forward and reverse primer. The PCR steps consisted of an initial 1 min at 94

ºC, followed by 26 cycles of 94 ºC for 1 min, 60 ºC for 1 min and 72 ºC for 1 min, and an

additional cycle of 5 min at 72 ºC. PCR fragments were checked in an electrophoresis on 1%

agarose gel.



2.2.3. Construction of the qPCR plasmid standard

A fragment of 192 bp of the S. salivarius dextranase gene was used as a standard for the

qPCR and was amplified with the forward primer Ssal442F (5´- AACGTTGACCTTACGCTAGC -3’)

and lately designed reverse primer Ssal615R (5´- ACCGTAACGTGGGAAAACTG -3’). This

fragment was purified with the QIAquick PCR purification kit (Qiagen, Hilden, Gemany), cloned

with the pGEM-T easy plasmid vector system (Promega, Madison, WI, USA) and used to

transform Escherichia coli DH5α. High Pure Plasmid Isolation Kit (Roche Diagnostics GmbH,

Mannheim, Germany) was used to isolate the plasmids from the clones, according to the

manufacturer’s instructions. The validation of the DNA sequence of the plasmid was made by

sequencing with the BigDye Terminator v1.1 cycle sequencing kit (Applied Biosystems, Foster

City, CA, USA). Dye ex sequencing purification kit (Qiagen) was used to purify the sequencing

product and ABI 310 Genetic Analyzer (Applied Biosystems) was used to analyze it. Plasmid

concentration and purity were determined with GeneQuant RNA/DNA calculator (Amersham

Pharmacia Biotech). Each qPCR run was performed with a 10-fold dilution series of the plasmid

to construct the standard curve.

2.2.4. qPCR optimization

A quantitative Polymerase Chain Reaction (qPCR) assay was performed with a CFX96

Real-Time System (BioRad, CA, USA). Taqman 5’ nuclease assay PCR method was used in order

to detect and quantify bacterial DNA. Taqman reactions contained 12.5 µl mastermix

(Eurogentec, Seraing, Belgium), 4.5 µl sterile water, 1 µl of each primer and probe, and 5 µl

template DNA. Individual primer concentrations ranging from 100 to 900 nM and probe

concentration ranging from 50 to 200 nM were tested. Assay conditions steps involved an initial

step for 2 min at 50 ºC, followed by a denaturation step at 95 ºC for 10 min and 45 cycles of 95

ºC for 15 s and 60 ºC for 1 min.

2.2.5. Comparison between qPCR and microbial culturing

An overnight culture of Streptococcus salivarius TOVE–R was used to compare qPCR and

microbial culturing. For microbial culturing, 10-fold serial dilutions in sterile saline were used.

For that, 50 µl of each dilution was plated on blood agar plates with a spiral platter (L.E.D.

Techno). The plates were incubated in a 37 ºC and 5% CO2 environment for 3 days and the

colony-forming units (CFU) were determined considering plates with colony counts between 20

and 300. For qPCR, 100 µl aliquots of each dilution were used for DNA extraction with the

QIAamp DNA mini kit according to the manufacturar’s instructions (QIAGEN). qPCR was



performed as described previously. The experiment was repeated five times and values were log-

transformed to calculate an orthogonal regression.

2.3. Results and Discussion

2.3.1. Design of qPCR primers and probe

qPCR assay for S. salivarius could not be designed against 16S rRNA gene such as for

other oral bacteria because this is not specific for every species of Streptococcus. So, a

conserved locus of the dextranase gene of S. salivarius ranging from base number 442 to base

number 615 was the base of the design of qPCR primers due to its specific and conserved

sequences [54]. The design of the PCR primers was developed on the basis of the comparison of

the nucleotide sequences of the dextranase gene of S. salivarius, S. mutans and S. sobrinus and

the consensus sequence of the alignment served as template (Table 1).

Table 1 – Comparison of the sequences of primers and probe designed for different strains of mutans streptococci

Strain Accession

number Primer Ssal442F Primer Ssal497T Primer Ssal615R

57.I CP002888.1 AACGTTGACCTTACGCTAGC GTAGCGTCAGAGTGGTTGAC CAGTTTTCCCACGTTACGGT

JIM8777 FR873482.1 AACGTTGACCTTACGCTAGC GTAGCGTCAGAGTGGTTGAC CAGTTTTCCCACGTTACGGT

CCHSS3 FR873481.1 AACGTTGACCTTACGCTAGC GTAGCGTCAGAGTGGTTGAC CAGTTTTCCCACGTTACGGT

Primers for PCR were obtained by comparison of the nucleotide sequences of the

dextranase genes of S. salivarius, S. mutans and S. sobrinus. The forward primer (Ssal442F) was

kept from a PCR assay from Igarishi et al. (2001) and a new reverse primer (Ssal615R) was

designed reducing the fragment length from 2271 base pairs (bp) to 192 bp. A qPCR probe

(Ssal497T) was designed between the beginning of the forward primer and the end of the reverse

primer (Table 2).

Table 2 – qPCR primers and probe: Guanine-Cytosine content (% GC), Melting temperature (Tm) Oligonucleotide name Sequence (5’-3’) Position %GC Tm (ºC)

Forward primer: Ssal442F AACGTTGACCTTACGCTAGC 442 to 458 50 60

Reverse primer: Ssal615R ACCGTAACGTGGGAAAACTG 615 to 634 45 58

Taqman probe: Ssal497T GTAGCGTCAGAGTGGTTGAC 497 to 516 55 62

A PCR assay against S. mutans, S. sobrinus and four strains of S. salivarius was carried

out to test the specificity of the primers (Figure 5).



Figure 5 - PCR amplification for detection of the dextranase gene of oral streptococcal species by a PCR and a DNA probe (Ssal497T) with Ssal442F and Ssal615R primer pair: S. mutans (lane 1), S. sobrinus (lane 2), S. salivarius ATCC 7073 (lane 3), S. salivarius K12 (lane 4), S. salivarius clinical strain (lane 5), S. salivarius TOVE-R (lane 6). Negative control (lane 7) was made with physiological water.

A band at 200 bp was displayed for all strains of S. salivarius (lanes 3, 4, 5 and 6) and

no amplification was observed for S. mutans (lane 1) and for S. sobrinus (lane 2). Looking at

negative control, made with physiological water (lane 7), no amplification can be observed

meaning no detection of contamination in this PCR assay. So, PCR amplification was verified only

for S. salivarius strains. This indicates that the PCR primers and probe were specific for this

species.

2.3.2. qPCR optimization

Data were collected during the annealing phase of qPCR assay. The optimal qPCR

primers concentration was determined by titration assays. The best concentrations were obtained

with 400 nM for the forward primer and 100 nM for the reverse primer. For the probe, the best

result was obtained for a concentration of 100 nM. The reaction efficiency was on average

94.87% (± 2.36 SD). The reaction efficiency was calculated from the slope of the standard curve

[= 10(-1/slope) – 1]. The lowest reproducible detection level of the qPCR was 4 plasmids per reaction,

each containing one target sequence.



2.3.3. Comparison between qPCR and microbial culturing

Microbial culturing of S. salivarius was carried out and compared with qPCR for the same

strain (Figure 6).

Figure 6: Number of colony forming units (CFU) of Streptococcus salivarius (Y-axis) versus quantification of Streptococcus salivarius by quantitative Polymerase Chain Reaction (qPCR) (X-axis). Correlation coefficient: R2=0.9741.

Comparing these two different culture techniques for S. salivarius, a high degree of

correlation (R2 = 0.9741) can be observed. This means a clear linear relationship between the

results obtained through both techniques. Further, qPCR values are almost 1.47 times more

bacteria than microbial culturing, which could be explained by counting of live and dead cells by

this molecular method [55]. So, it was concluded that qPCR assay for S. salivarius allows the

quantification of this strain with a linear relationship to results obtained by microbial culturing.

2.4. Conclusion

A qPCR assay for the enumeration of S. salivarius was needed. Primers were chosen

based on the dextranase gene of S. salivarius, a conserved region and tested on 4 different

strains of S. salivarius and 2 other strains (S. mutans and S. sobrinus). Only S. salivarius were

amplified, whereby it can be concluded that this qPCR assay is highly specific for S. salivarius

and allowing the detection and identification of this bacterium on environmental samples.

Further, qPCR were compared with microbial culturing and results presented a linear relationship

corroborating the correct quantification of this strain by qPCR.

In conclusion, a TaqMan qPCR assay specific for S. salivarius was developed based on

the dextranase gene.

0

1

2

3

4

5

6

7

8

0 2 4 6 8 10

Mic

robi

al c

ultu

ring

log 1

0 (C

FU/m

l)

qPCR log10 (bacteria/ml)



CHAPTER 3

Effect of a prebiotic compound on cariogenic and saliva bacteria





3.1. Introduction

The mouth is a complex ecosystem with several microorganisms creating dynamic

interactions and growing as a biofilm, called dental plaque. However, under certain conditions,

changes in the dental plaque and in the oral environment can lead to serious infections, such as

periodontitis and dental caries [62].

According to the ‘ecological plaque hypothesis’ in dental caries, when an increase in the

frequency of fermentable carbohydrates consumption is verified, pH decreases and acid-

tolerating bacteria proliferate increasing cariogenic bacteria in dental plaque [7], [10].

Nowadays traditional therapy (mechanical instrumentation and antimicrobial treatment),

as well as alternative ones, as vaccination are not the most appropriate since they are very

invasive and can cause resistance [20], [46]. So, alternative ways are required, and probiotics

and prebiotics are emerging in diverse fields like a viable hypothesis in the prevention and

treatment of several diseases [21], [47], [52].

Probiotics are live microorganisms which, when administered in correct quantities,

confer benefits to the host [21]. Lactobacilli and bifidobacteria are the most common probiotic

strains [62]. Some lactobacilli strains with probiotic properties can even be found in the mouth.

For examples, some studies have already demonstrated the potential of Lactobacillus reuteri and

Lactobacillus rhamnosus GG in Streptococcus mutans reduction through yoghurt consumption

[62]. Other properties of probiotics are cancer risk reduction, immune response induction and

antimicrobial potential [62]. Streptococcus salivarius is an oral probiotic strain that lives in the

oral cavity of healthy people. For example, it was already proven that S. salivarius can reduce

volatile sulphur compounds [62]. These compounds are derived from the bacterial degradation of

sulphur containing amino acids in the oropharynx and are involved in halitosis (bad breath) [62].

Prebiotics can be a complement to probiotics in the treatment and control of oral

diseases stimulating the growth of beneficial indigenous bacteria. Prebiotics are able to promote

the growth and activity of beneficial microorganisms and to inhibit the growth and activity of

pathogenic microorganisms. So, the combination of pre and probiotics can improve oral health

conditions [62].

In the case of the oral cavity, oral probiotics need to be able to adhere and colonize oral

surfaces and to be part of the biofilm in order to stimulate the reduction of cariogenic bacteria

levels [62]. So, the identification of oral strains is a very important step. However, cultivation

methods cannot detect unculturable strains. Unculturable strains are live bacteria with metabolic



activity but unable to develop into colonies on culture media as a result of natural stress [63]. So,

culture-independent molecular methods are required such as quantitative Polymerase Chain

Reaction (qPCR) or Polymerase Chain Reaction – Denaturing Gradient Gel Electrophoresis (PCR-

DGGE).

qPCR is an accurate and precise method that enumerates the PCR product during

amplification [56]. PCR-DGGE is a cultivation-independent molecular fingerprinting technique that

does not require cultivation, and that can be used for the identification of cultivable and

unculturable microorganisms in the oral cavity [64]. The separation is based on electrophoretic

mobility of a partially melted DNA molecule in polyacrylamide gels [65].

In this chapter, a prebiotic compound (C7) was assessed in order to see its effect in the

growth of two main cariogenic bacteria (S. mutans and S. sobrinus) and one probiotic strain (S.

salivarius). The aim was to discover if the addition of this compound leads to a decrease in the

concentration of these cariogenic bacteria. Further, the effect of this compound on the

microorganisms present in the human saliva was also tested to verify any microbial shift in the

presence of a probiotic strain (S. salivarius).

3.2. Materials and Methods

3.2.1. Bacterial strains and culturing conditions

Streptococcus sobrinus ATCC 33478 and Streptococcus mutans ATCC 25175 were the

cariogenic bacteria used. Streptococcus salivarius K12 was used as a beneficial bacterium. All

bacteria were maintained on blood agar plates (Blood Agar Base II, Oxoid, Basingstoke, UK)

supplemented with 5% sterile horse blood (Biotrading, Keerbergen, Belgium), 5 µg/ml hemin

(Sigma Chemical Co, St. Louis, MO) and 1 µg/ml menadion. Bacteria were collected from blood

agar plates one day before each experiment and incubated overnight in 10 ml Brain-Heart

Infusion (BHI) broth (Becton, Dicksinson and Company, France) at 37 ºC in a 5% CO2

environment.

Different media were used in order to find a selective substratum for S. salivarius, S.

mutans and S. sobrinus: Mitis-Salivarius (MS) agar (Becton, Dicksinson and Company, France),

Trypticase Yeast Cysteine Sucrose Bacitracin (TYCSB) agar (Becton, Dicksinson and Company,

France) and blood agar. MS agar and TYCSB agar were tested as a possible culture medium and

blood agar was used as a positive control.



3.2.2. Media testing

To find an appropriate medium for specific growth of S. mutans and S. sobrinus, cultures

of each bacteria and S. salivarius were grown overnight and the concentration was adjusted to

1×107 cells/ml by measuring the optical density (OD) at a wavelength of 600 nm (Smartspec

3000, BioRad, USA). 100 µl of the bacterial suspension containing 1×107 bacteria was spread

with a sterile loop on both MS and TYCSB plates and were incubated at 37 ºC in a 5% CO2

environment for 3 days. Bacterial growth was observed by light microscopy.

3.2.3. Growth in dual-species model

Overnight cultures of cariogenic bacterium (S. mutans or S. sobrinus) and S. salivarius in

BHI were used. The optical density was measured at 600 nm and suspensions were prepared

containing approximately 1×107 cells/ml. Experiments were carried out in a dual-species model

in 24 wells plate with 1 ml of the cariogenic bacteria (S. mutans or S. sobrinus) and 1 ml of S.

salivarius. Different conditions were tested: the cariogenic bacterium with or without C7

compound (200 µl) and both species (the cariogenic bacterium with S. salivarius) with or without

C7 compound (200 µl). The positive control was made with glucose (200 µl) and was tested not

only with the cariogenic bacterium alone, but also with both species. The negative control was

made only with BHI. S. salivarius was replaced by BHI in the conditions where only the cariogenic

strain was tested in order to get the same volume. A final concentration of 1 mg/ml was used for

C7 compound and for glucose. The different components of each condition assessed can be

observed in Table 3.

Table 3: Conditions used in dual-species model growth with each one of cariogenic bacteria (Streptococcus mutans or Streptococcus sobrinus). Prebiotic compound (C7)

Condition

Main bacteria Second bacteria Added sugar

A Cariogenic bacterium -- --

B Cariogenic bacterium -- Glucose

C Cariogenic bacterium S. salivarius Glucose

D Cariogenic bacterium -- C7

E Cariogenic bacterium S. salivarius C7

F Cariogenic bacterium S. salivarius --

At 0 h, 100 µl of each condition were used to make dilutions of each condition, whereas

500 µl of each sample was kept at -20 ºC until DNA extraction was performed. 50 µl of each

dilution was plated on TYCSB plates with a spiral platter (L.E.D. Techno). The plates were

incubated in a 37 ºC and 5% CO2 environment for 3 days and the colony-forming units (CFU)

were determined in plates with colony counts between 20 and 300. Selective microbial plating for



the cariogenic strain tested was carried out also at 24 h and 48 h. Furthermore, at 24 h and 48

h, 300 µl of each condition was used to measure the pH. This experiment was repeated at least

three times.

3.2.4. DNA extraction and quantitative Polymerase Chain Reaction (qPCR)

The samples were kept at -20 ºC until use. The DNA extraction was performed with the

QIAamp DNA mini kit according the manufacturer’s instructions (Qiagen). A quantitative

polymerase chain reaction (qPCR) assay was performed with a CFX96 Real-Time System

(BioRad, CA, USA). In order to quantify the concentration of bacterial DNA of S. mutans and S.

salivarius present in the samples Taqman 5’ nuclease assay PCR method was used. The

construction of primers and probe for S. mutans was based upon the glucosyltransferase B (gtfB)

gene and the primers used can be observed in Table 4. For S. salivarius primers and probe were

designed based on the dextranase gene of S. salivarius JCM5707 (Table 4). And for S. sobrinus

primers and probe (Table 4) were constructed based upon the glucosyltransferase T (gtfT) gene.

Table 4: Sequence and final concentrations of primers and probe used in quantitative Polymerase Chain reaction (qPCR) assay for Streptococcus salivarius, Streptococcus mutans and Streptococcus sobrinus

Primers and probe Sequence (5’-3’) Concentration (nM)

S. salivarius forward 5’-AACGTTGACCTTACGCTAGC-3’ 400

S. salivarius reverse 5’-ACCGTAACGTGGGAAAACTG-3’ 100

S. salivarius probe 5’-GTAGCGTCAGAGTGGTTGAC-3’ 100

S. mutans forward 5’–GCCTACAGCTCAGAGATGCTATTCT-3’ 900

S. mutans reverse 5’- GCCATACACCACTCATGAATTGA-3’ 900

S. mutans probe 5’-TGGAAATGACGGTCGCCGTTATGAA-3’ 900

S. sobrinus forward 5’-TTCAAAGCCAAGACCAAGCTAGT-3’ 200

S. sobrinus reverse 5’-CCAGCCTGAGATTCAGCTTGT-3’ 200

S. sobrinus probe 5’-CCTGCTCCAGCGACAAAGGCAGC-3’ 250

Taqman reactions contained 12.5 µl mastermix (Eurogentec, Seraing, Belgium), 4.5 µl

sterile water and 1 µl of each primer and probe. For S. mutans qPCR steps consisted of an initial

2 min at 50 ºC, followed by a denaturation step for 10 min at 95 ºC, followed by 45 cycles of 95

ºC for 15 s and 60 ºC for 60 s. For S. salivarius qPCR steps involved an initial step for 2 min at

50 ºC, followed by a denaturation step at 95 ºC for 10 min and 45 cycles of 95 ºC for 15 s and

60 ºC for 1 min. qPCR steps used for S. sobrinus consisted of an initial step at 50 ºC for 2 min,

followed by 10 min at 95 ºC and 60 cycles of 95 ºC for 15 s and 58 ºC for 1 min. A plasmid

standard curve was used in order to quantify the concentration of bacterial DNA of S. mutans and

S. salivarius.



3.2.5. Saliva collection and preparation

Saliva was collected from 4 healthy volunteers in a sterile tube and 9 ml saliva was

pooled. S. salivarius K12 was washed, after overnight growth, the culture was centrifuged at

7000 rpm for 10 min and the pellet was re-suspended in physiological water. The concentration

was adjusted to 1×109 cells/ml by optical density (OD) measured at 600 nm (Smartspec 3000,

BioRad, USA). A suspension of 900 µl of S. salivarius was added to the pooled saliva and it was

mixed and divided in 2 parts. One part was centrifuged at 7500 rpm for 10 min and the pellet

was re-suspended in BHI. C7 compound (1 mg/ml, final concentration) was added to each part

(with and without centrifugation) and physiological water was used as negative control. Each

condition was divided and then one part was incubated in an aerobic incubator at 37 ºC and

another part was incubated in an anaerobic incubator (80% N2, 10% H2 and 10% CO2). At 0, 24

and 48 h, 100 µl of the suspension obtained in each condition was stored at -20 ºC until DNA

extraction was performed.

3.2.6. DNA extraction, PCR-DGGE assay

The DNA was extracted using QIAamp DNA Mini Kit according to the manufacturer’s

instructions (Qiagen). Extracted DNA was amplified by PCR assay using universal bacterial 16S

rDNA primers: P338F (forward), 5’ – CAGGCCTAACACATGCAAGTC – 3’; P518R (reverse), 5’ –

ATTACCGCGGCTGCTGG – 3’. Reactions contained 1 µl of each primer, 0.5 µl of AmpliTaq® DNA

polymerase (Roche), 1.2 µl of MgCl2, 1.6 µl of deoxynucleoside triphosphate (dNTP), 10.7 µl of

sterile Milli-Q water, 2 µl of 10X Taq Buffer with KCL (MgCl2 free) (Fermentas), 0.625 µl of bovine

serum albumin and 2 µl of each sample. The PCR steps consisted of an initial 5 min at 94 ºC,

followed by 30 cycles of 94 ºC for 30 s, 53 ºC for 1 min and 72 ºC for 1 min and an additional

cycle of 12 min at 72 ºC. S. salivarius was used as positive control. Quality of PCR product was

evaluated by electrophoresis in 1% agarose gel run at 90 V for 20 min.

Denaturing Gradient Gel Electrophoresis (DGGE) was performed using the DCodeTM

Universal Mutation Detection System (BioRad, Hercules, California, USA) based on the protocol

of Muyzer et al. (1993). So, 8% (w/v) of polyacrylamide gels in 1X Tris-acetate-

ethylenediaminetetraacetic (TAE) diluted from 50X TAE buffer stock (121.24 g Tris, 20.5 g

sodium acetate anhydrate, 9.8 g ethylenediaminetetraacetic (EDTA), 250 ml Milli-Q water and pH

adjusted to 7.8 to a final volume of 500 ml) were made with denaturing gradient ranging from 45

to 60% in order to load PCR products. Denaturing solutions were made from a 0% denaturation

buffer [10 ml 40% acrylamide/Bis Solution (BioRad), 2.5 ml 2% Bis Solution (BioRad), 1 ml 50X



TAE and Milli-Q water till 50 ml] and 60% denaturation buffer [10 ml 40% acrylamide/Bis Solution

(BioRad), 2.5 ml 2% Bis Solution (BioRad), 12.5 g urea (Sigma), 12 ml formamide (Sigma), 1 ml

50X TAE and Milli-Q water till 50 ml]. Polyacrylamide gels were polymerized by adding

ammonium persulfate solution 10% (BioRad, Hercules, California, USA) and TEMED into each of

the denaturing solutions right before pouring the gradient gel. Electrophoresis was performed at a

constant voltage of 75 V at 60 ºC for 16 h in 1X TAE buffer. DGGE standard markers were used

and PCR products were directly loaded in each lane. S. salivarius was used as positive control.

Gels were rinsed and stained in 200 ml 1X TAE buffer with 13 µl Gel Red Nucleic Acid Stain

(Biotium) for 30 min. The DGGE images were digitally captured and recorded with UV

transillumination. The processing of the DGGE gels was made with the Bionumerics software 2.0

(Applied Maths, Kortrijk, Belgium).

3.3. Results

3.3.1. Selective medium for Streptococcus salivarius, Streptococcus mutans and Streptococcus sobrinus

To test the effect of a prebiotic compound on cariogenic bacteria, a selective medium for

cariogenic strains (S. mutans and S. sobrinus) had to be defined, as well as, for the beneficial

strain, S. salivarius. Different media were used and each strain was plated on each different

medium.

After CO2 incubation for 3 days, growth was observed on MS agar plates with every strain

used: S. salivarius (Figure 7-IA), S. mutans (Figure 7-IB) and S. sobrinus (Figure 7-IC). On the

other hand, on TYCSB plates growth was only observed for S. mutans (Figure 7-IIB) and for S.

sobrinus (Figure 7-IIC) and non-growth was seen for S. salivarius (Figure 7-IIA).



Figure 7: Growth on Mitis-Salivarius agar plates (I) and on Trypticase Yeast Cysteine Sucrose Bacitracin (TYCSB) plates (II). (A): Streptococcus salivarius, (B): Streptococcus mutans and (C): Streptococcus sobrinus.

It was concluded that MS medium could not be used as a selective medium for any

strain, but otherwise TYCSB medium could be used for S. mutans and for S. sobrinus. A selective

medium for S. salivarius was not found.

3.3.2. Effect of a prebiotic compound on cariogenic bacteria

The effect of the prebiotic compound (C7) on S. mutans in dual species model with S.

salivarius was tested first (Figure 8).

I

II

A B C

A B C



Figure 8: Number of colony forming units (CFU) of Streptococcus mutans in dual species model at 0 h, 24 h and 48 h: Growth of

S. mutans testing the effect of C7 compound with (E) or without (D) the presence of S. salivarius and glucose with (C) or without

(B) S. salivarius. The negative controls were made one with only the cariogenic bacterium (A) and another with the cariogenic

bacterium and S. salivarius without addition of glucose (F). Standard errors of the mean (n=3) are represented by error bars.

Significance (p<0.05) between the control (only S. mutans) and test series was determined using Student’s t-test and are marked

with *.

An increase was detected in S. mutans concentration in all conditions after 24 h, when

compared to 0 h. At 24 h, significant differences were detected in all conditions (p<0.05), when

compared to the control (condition A). However, looking at Figure 8, S. mutans had less growth

in all conditions where S. salivarius is present. The lowest value can observed when S. mutans is

conjugated with S. salivarius and glucose (condition C).

At 24 h, another significant difference (p<0.05) could be found when S. mutans was

conjugated with S. salivarius (condition F) in comparison to the presence of glucose (condition C).

A reduction in all conditions was detected from 24 h to 48 h. A significant reduction

could be observed when S. mutans is present together with S. salivarius and glucose (condition

C) and C7 (condition E) (p<0.05), when compared with only the cariogenic bacterium (condition

A).

Quantitative Polymerase Chain Reaction (qPCR) analysis was also carried out to see the

effect of a prebiotic compound on S. mutans in dual species model, under the presence of the

two compounds, C7 and glucose, and the results can be seen in Figure 9.

0

1

2

3

4

5

6

7

8

9

10

A B C D E F

log1

0 (C

FU/m

l)

0 h

24 h

48 h

* *

*

*

*

* *



Figure 9: Number of Streptococcus mutans in dual species model at 0 h, 24 h and 48 h determined by quantitative Polymerase Chain Reaction (qPCR). The effect on S. mutans of C7 compound with (E) or without (D) the presence of S. salivarius and glucose with (C) or without (B) S. salivarius. The negative controls were made one with only the cariogenic bacterium (A) and another with the cariogenic bacterium and S. salivarius without addition of glucose (F). Standard errors of the mean (n=2 for 0 h and n=3 for 24 h and for 48 h) are represented by error bars. Statistically significant differences (p<0.05) between the control (only S. mutans) and test series were determined using Student’s t-test and are marked with *.

From Figure 9, it is possible to observe that after 24 h there was less growth of S.

mutans when S. salivarius is present (condition F) and when these bacteria are together with

glucose (condition C). These reductions are significant (p<0.05) in comparison with control

(condition A). After 48 h no significant reductions were detected.

The use of qPCR allowed also the determination of the number of S. salivarius present in

each condition (Figure 10).

0

1

2

3

4

5

6

7

8

9

10

A B C D E F

log1

0 (b

acte

ria/m

l)

0 h

24 h

48 h

* *



Figure 10: Number of Streptococcus salivarius in Streptococcus mutans dual species model experiment at 0 h, 24 h and 48 h determined by quantitative Polymerase Chain Reaction (qPCR): S. mutans conjugated with S. salivarius and glucose (C), S. mutans together with S. salivarius and the C7 compound (E). The control was made with the cariogenic bacterium and S. salivarius (F). Standard errors of the mean (n=3) are represented by error bars. Statistically significant differences (p<0.05) between the cariogenic bacterium (S. mutans) together with the probiotic bacterium (S. salivarius) with and without glucose are marked with * and was determined using Student’s t-test.

A significant increase (p<0.05) was detected when S. salivarius is present together with

S. mutans (condition F) after 24 h, when compared with the presence of these bacteria together

with glucose (condition C). A small increase was verified when C7 compound or glucose are

present, comparing with condition F, but not significant. After 48 h, no significant differences

were detected.

In order to complement the study, since oral bacteria are able to affect oral environment,

the pH was measured for all conditions at both 24 h and 48 h (Table 5).

Table 5: pH values for Streptococcus mutans in dual species model at 24 h and 48 h: Assessment of pH variation of S. mutans culture testing the effect of C7 compound with (E) or without (D) the presence of S. salivarius and glucose with (C) or without (B) S. salivarius. The negative controls were made one with only the cariogenic bacterium (A) and another with the cariogenic bacterium and S. salivarius without addition of glucose (F)

pH values

Condition A B C D E F

24 h 5.57 4.93 4.85 5.55 4.84 5.41

48 h 5.62 4.99 4.86 5.57 4.85 5.41

An average pH of 5.57 was determined after 24 h of the start of the experiment in the

control, only with S. mutans (condition A). A lower pH value was detected for almost all the

conditions. There is a slight difference between S. mutans and glucose (condition B) and S.

mutans and glucose with S. salivarius (condition C) and S. mutans together with S. salivarius and

C7 (condition E). Besides these slight differences, the pH in condition B is always slightly higher.

0

1

2

3

4

5

6

7

8

9

C E F

log1

0 (b

acte

ria/m

l)

0 h

24 h

48 h

*



An extra pH decrease was seen when S. salivarius was present together with glucose (condition

C) and the same was observed when S. salivarius was present together with C7 compound

(condition E) when comparing with only S. salivarius (condition F), all of them with S. mutans.

The values for 48 h were almost the same and no variations were detected (Table 5).

Afterwards, the effect of a prebiotic compound for S. sobrinus, the other cariogenic

bacterium used in this study, in dual species model with S. salivarius was tested (Figure 11).

Figure 11: Number of colony forming units (CFU) of Streptococcus sobrinus in dual species model at 0 h, 24 h and 48 h: Growth

of S. sobrinus testing the effect of C7 compound with (E) or without (D) the presence of S. salivarius and glucose with (C) or

without (B) S. salivarius. The negative controls were made one with only the cariogenic bacterium (A) and another with the

cariogenic bacterium and S. salivarius without addition of glucose (F). Standard errors of the mean (n=3) are represented by error

bars. Significance (p<0.05) between the control (only S. sobrinus) and test series was determined using Student’s t-test and are

marked with *.

A large and significant increase (p<0.05) can be observed after 24 h when S. sobrinus is

present together with the C7 compound (condition D), if it is compared with S. mutans alone

(condition A).

After 48 h (Figure 11) it was observed that the increase in condition D was no longer

present and no more significant differences were detected. Further, the control value (condition

A) seems to be very low.

qPCR analysis was also carried out to see the effect of a prebiotic compound on S.

sobrinus in dual species model in real time and results can be seen in Figure 12.

0

1

2

3

4

5

6

7

8

9

A B C D E F

log1

0 (C

FU/m

l)

0 h

24 h

48 h

*



Figure 12: Number of Streptococcus sobrinus in dual species model at 0 h, 24 h and 48 h determined by quantitative Polymerase Chain Reaction (qPCR): S. sobrinus culture testing the effect of C7 compound with (E) or without (D) the presence of S. salivarius and glucose with (C) or without (B) S. salivarius. The negative controls were made one with only the cariogenic bacterium (A) and another with the cariogenic bacterium and S. salivarius without addition of glucose (F). Standard errors of the mean (n=3) are represented by error bars. Significance (p<0.05) between the control (only S. sobrinus) and test series was determined using Student’s t-test and are marked with *.

Looking after 24 h, conditions C, E and F show apparently a lesser growth than the

others. A significant difference (p<0.05) was detected in the presence of S. salivarius together

with S. sobrinus and C7 compound (condition E), when compared with control only with S.

sobrinus (condition A). Another significant difference (p<0.05) was obtained comparing the

growth of S. sobrinus together with S. salivarius with and without the C7 compound. On the other

hand, the large increase seen in the culturing results on condition D (Figure 11) is no more

visible.

qPCR analysis for S. salivarius in S. sobrinus dual species model experiment is displayed

in Figure 13. Values at the beginning of the experiment are similar.

0

1

2

3

4

5

6

7

8

9

A B C D E F

log1

0 (b

acte

ria/m

l)

0 h

24 h

48 h

*



Figure 13: Growth of Streptococcus salivarius in Streptococcus sobrinus dual species model experiment at 0 h, 24 h and 48 h with quantitative Polymerase Chain Reaction (qPCR): S. sobrinus conjugated with S. salivarius and glucose (C), S. sobrinus together with S. salivarius and the C7 compound (E). The control was made with the cariogenic bacterium and S. salivarius (F). Standard errors of the mean (n=3) are represented by error bars. Statistically significant differences (p<0.05) between the cariogenic bacterium (S. sobrinus) together with the probiotic bacterium (S. salivarius) with and without C7 compound are marked with * and was determined using Student’s t-test.

Growth of S. salivarius after 24 h was significant (p<0.05) without the addition of any

carbon source (glucose or C7 compound) (condition F), when compared with addition of C7

compound (condition C). Further, the lesser growth was verified when C7 compound is present

together with S. salivarius and S. sobrinus (condition E), although it was not significant.

The pH values for S. sobrinus in dual species model with S. salivarius were determined

(Table 6).

Table 6: pH values for Streptococcus sobrinus in dual species model at 24 h and 48 h: Assessment of pH variation of S. sobrinus culture testing the effect of C7 compound with (E) or without (D) the presence of S. salivarius and glucose with (C) or without (B) S. salivarius. The negative controls were made one with only the cariogenic bacterium (A) and another with the cariogenic bacterium and S. salivarius without addition of glucose (F)

pH values

Condition A B C D E F

24 h 5.76 5.06 4.95 5.64 4.87 5.60

48 h 5.78 5.08 4.99 5.64 4.89 5.64

An average pH of 5.76 was detected in the control (condition A) when looking after 24 h

of the start of the experiment. A lower pH than the control was observed when S. sobrinus is

present with glucose (condition B), glucose and S. salivarius (condition C), and S. salivarius and

C7 compound (condition E). The pH was higher in condition B and the difference was greater

between conditions B and E than between B and C. The lowest values are observed when S.

salivarius is present together with glucose (condition C) or the C7 compound (condition E).

0

1

2

3

4

5

6

7

8

9

10

C E F

log1

0 (b

acte

ria/m

l)

0 h

24 h

48 h

*



However, when S. salivarius was present together with S. sobrinus pH was higher. So, when

glucose or the C7 compound was present, an extra decrease can be seen. The values after 48 h

are approximately the same and there were no variations observed (Table 6).

3.3.3. Effect of a prebiotic compound on bacteria present in saliva

A PCR-DGGE analysis was performed in order to understand the effect of a prebiotic

compound (C7) on the whole bacterial community present in human saliva and BHI medium was

used as a positive control. The results are shown in Figure 14.

Figure 14: PCR-DGGE analysis of effect of C7 compound in BHI and saliva after 24 h. BHI: Brain-Heart Infusion. C7: prebiotic compound. ANA: Anaerobic Conditions. AER: Aerobic Conditions. Black arrow: S. salivarius marker. Red rectangles: bands more clearly with the presence of C7 compound. Yellow rectangles: bands more clearly without the presence of C7 compound.

S. salivarius was used as a mark (black arrow) and some differences were detected

according to the presence or not of the prebiotic compound. Comparing the results with and



without the C7 compound it is possible to see some bands more clearly, mostly in anaerobic

conditions. These bands appear at the same length of S. salivarius fragment. So, it seems that S.

salivarius is stimulated by C7 compound in BHI and saliva (red rectangles). On the other hand

some bands are more pronounced when C7 compound is not present (yellow rectangles). So, an

ecological shift is visible in the whole community.

3.4. Discussion

According to the ecological plaque hypothesis, an alternative strategy to treat and prevent

ecological shift in oral diseases is related to the use of beneficial indigenous bacteria and

probiotics stimulated by the use of prebiotics [21]. Probiotics and prebiotics are an alternative to

change and prevent ecological shift in oral diseases.

A selective medium is essential to cultivate a specific microorganism, because it allows

the growth of certain microorganisms inhibiting others.

Mitis-Salivarius (MS) agar is normally used for mutans streptococci isolation [66], [67].

MS was tested for S. salivarius, S. mutans and S. sobrinus (Figure 7-I). As expected, S. mutans

and S. sobrinus grew on this medium [66]. However S. salivarius also grew on MS agar plates. It

is also not possible to distinguish between S. mutans (Figure 7-IB) and S. sobrinus (Figure 7-IC),

as expected [66], [68]. So, it was concluded that this medium is non-selective neither for the

cariogenic strains neither for the beneficial strain. Hirasawa et al. ( 2003) developed a selective

medium for S. mutans (MS-MUT) and for S. sobrinus (MS-SOB) based on MS agar medium

combined with reduced levels of sucrose and several antibiotics (sulfisoxazole, bacitracin,

cinoxacin and fleoxacin).

On the other hand, Van Palenstein et al. (1983) developed a selective medium for the

main cariogenic bacteria (S. mutans and S. sobrinus). The medium trypticase, yeast, cysteine

(TYC) agar was modified by addition of bacitracin (TYCSB) and seemed to be selective for these

bacteria [68]. In this study, it was confirmed that TYCSB allowed the growth of S. mutans and S.

sobrinus (Figure 7-II). S. salivarius did not grow on TYCSB plates and this absence of growth is

probably due to components of TYCSB medium when compared with MS agar medium.

Comparing MS and TYCSB components, a possible explanation is the presence of salts (Na2SO3,

NaHCO3, NaCl, Na2HPO4·12H2O and C2H3O2Na·3H2O) on TYCSB medium, stimulating bacterial

growth. In conclusion, a selective medium (TYCSB) was found for the two cariogenic strains.



However, a selective medium for the beneficial strain still need to be found. A modified

minimal medium (MM) was the hypothesis tested (data not shown). A minimal medium contains

the minimum nutrients (as carbon source) and essential elements for protein and nucleic acid

synthesis by microorganisms. The MM medium used did not allow selective growth of S.

salivarius, since S. mutans and S. sobrinus also grew. In conclusion, MM medium could not be

used as a selective medium for S. salivarius, thereby no selective medium for this beneficial

strain was found.

To test whether addition of a prebiotic compound (C7) conjugated with a probiotic strain

(S. salivarius) on cariogenic bacteria (S. mutans and S. sobrinus), dual species experiments were

carried out. S. mutans is a cariogenic bacterium present in high levels in caries [2]. Looking at

Figure 8, significant differences were detected in all conditions after 24 h, when compared to

control (condition A). Besides these significant differences, conditions with S. salivarius

(conditions C, E and F) seem to have less growth of S. mutans. So, S. salivarius seems to have

effect on S. mutans reduction. This can be explained by the beneficial effect of S. salivarius as a

probiotic strain [60]. On the other hand, C7 compound seems to not have effect on lesser growth

of S. mutans, because reduction of S. mutans is only verified when C7 is conjugated with S.

salivarius and not when S. mutans is alone with C7. Further, the presence of glucose with S.

mutans and S. salivarius resulted in the lowest growth of the cariogenic bacterium, when

compared with the presence of C7 compound, but actually glucose can be metabolized by S.

mutans [69]. So, glucose seems to stimulate S. mutans growth, however cannot be used as a

prebiotic compound due its metabolism by this cariogenic bacterium [69]. Thus, the verified

lowest increase of S. mutans are probably due to the presence of S. salivarius and not because

of presence of C7 compound.

After 48 h, all conditions presented a reduction in relation to 24h. All conditions with S.

salivarius significantly decreased when compared with the control (S. mutans alone). C7

compound seems not to have influence in the verified reduction, however the reduction in the

presence of C7 compound is slightly higher than without the compound, showing the

enhancement of probiotics by prebiotics, as expected [58]. Further, another significant reduction

was verified in the presence of glucose, a carbon source that can be metabolized by S. mutans

[69]. So, the significant reductions could be probably as a result of the presence of S. salivarius

and has no variation due to C7 compound.



Another significant difference was verified comparing S. mutans and S. salivarius with

and without glucose. The absence of glucose seems to be more positive, when compared to S.

mutans and S. salivarius which did not is clearly evident, when comparing this condition without

supplement to the control.

qPCR was performed for S. mutans quantification in dual species experiment (Figure 9).

Lesser growth of this cariogenic bacterium can be observed when S. mutans is present together

with S. salivarius, with or without the presence of glucose, when compared to only S. mutans.

This could mean an influence of S. salivarius leading to S. mutans inhibition, supporting its effect

as a probiotic [60]. However, the presence of C7 compound in S. mutans and S. salivarius had

no significant difference, even conjugated with S. salivarius. So, the presence of C7 compound

did not influence S. mutans growth. The growth of S. mutans is little lower when glucose is

presence. However, glucose cannot be considered as a prebiotic in this case because it is

metabolized by S. mutans [69]. In conclusion, the reduced growth of S. mutans after 24 h was

probably motivated by the presence of S. salivarius and not because of presence of C7

compound.

Looking at 48 h, no significant reductions were observed and the values obtained by

qPCR are also counting dead cells, which constitutes a limitation of current biological

technologies for quantification of specific cells and/or strains in mixed samples [70]. Thus,

certainly some conditions had an increase in concentration resulting from dead cells counting by

qPCR.

Comparing microbial culturing and qPCR for S. mutans in dual species experiment, the

presence of S. salivarius seems to have reducing effect on S. mutans and the presence of C7

compound does not have influence on it. Further, the presence of glucose also stimulates the

reduction of S. mutans, however glucose cannot be used as a prebiotic. The values obtained

were almost the same although the higher values for qPCR for 48 h, when compared with

microbial culturing, probably due to the count of dead cells.

Behind the analysis of cariogenic bacterium concentration due to the presence of

glucose or C7 compound, it is important to take a look in the behavior of the probiotic strain

used. Thus, looking at Figure 10, a significant increase was verified when S. salivarius is present

together with S. mutans. This can corroborate the hypothesis of S. salivarius as an important oral

probiotic [2], [60]. C7 compound seems to not have influence on S. salivarius growth.



Comparing S. mutans (Figure 9) and S. salivarius (Figure 10) concentrations in S.

mutans dual species experiment, it was concluded that the presence of S. salivarius could leave

to a reduction of S. mutans.

The effect of pH in dual species experiments was tested because a low pH can be the

result of acid production by oral streptococci due to sugar intake and later to demineralization

[69], [71].

The pH of different conditions tested did not suffer variations and the values were

maintained almost constant after 24 h and after 48 h (Table 5). However, all of them can be

characterized by an acidic environment. Although no significant differences were detected, it is

important to analyze pH values obtained for the different conditions. A higher decrease in pH was

verified when glucose or C7 compound is combined with S. salivarius, compared with control

with only S. mutans, which could mean the influence of these supplements, separately, in pH

reduction.

Analyzing the conditions of S. mutans where C7 is present, when S. salivarius is present,

the pH (4.8) falls. However when S. mutans is only present with C7, pH value (≈5.6) is similar to

the control (≈5.6). When S. mutans is conjugated only with S. salivarius (condition F), pH is

almost around 5.4, nearly to the value obtained when S. mutans was alone (condition A).

Similar dual species experiments were also carried out to see the effect of prebiotic

compound used in this study in another cariogenic bacterium, S. sobrinus (Figure 11). After 24

h, S. salivarius seems to have an effect on S. sobrinus, but not a significant effect. However,

compared to 0 h, these conditions had a non-significant decrease when conjugated with a carbon

source (glucose or C7 compound).

On the other hand, a large and significant increase was verified when S. sobrinus is

present together with C7 compound after 24 h. This could be associated to unculturable cells

present [72]. The viable but non-culturable cells (VBNC) are still with metabolic activity but

cannot be detected using classical cultivation on agar substrates solid media [73]. Further, in this

state bacteria are able to resuscitate and become culturable again, but still metabolically inactive

[63], [74]. VBNC can be a result of different situations such as natural stress, extremes of

temperature, pH, oxygen concentration [63], [74].

After 48 h, all conditions suffered a reduction on S. sobrinus, maybe due to the lack of

nutrients for growth, which seems to be more accentuated when S. sobrinus is alone (condition

A), probably due to VBNC state as a consequence of lack of the required nutrients [74].



So, it was concluded that there is no effect of the C7 compound, only a small effect of

presence of S. salivarius but not really clear.

Regarding to qPCR of S. sobrinus in dual species experiment after 24 h (Figure 12),

glucose has no influence on S. sobrinus reduction. On the other hand, the presence of S.

salivarius leads to a lesser growth of S. sobrinus, both with and without the presence of C7

compound, which is significant in the presence of this compound. The presence of S. salivarius

seems to stimulate a lesser growth of S. sobrinus, although the little differences, when compared

to other conditions. Once again, S. salivarius appears with probiotic potential [60]. So, it was

concluded that the presence of S. salivarius has influence on S. sobrinus and the presence of C7

compound seems to be positive for it.

As explained before, qPCR cannot distinguish between live and dead cells [55]. So, some

verified increases can be due to this limitation of qPCR method.

Comparing microbial culturing (Figure 11) and qPCR (Figure 12) for S. sobrinus in dual

species experiment, the presence of S. salivarius seems to have reducing effect on S. sobrinus

with influence by the presence of C7 compound. This was not really clear in microbial culturing

maybe due to viable but non-culturable cells [63]. Further, the large increase verified on S.

sobrinus when is conjugated only with C7 compound after 24 h in microbial culturing is not

observed in qPCR.

Regarding to the variation of S. salivarius in dual species experiment of S. sobrinus by

qPCR, a significant increase was detected when S. salivarius is present together with S. sobrinus,

highlighting the effect of this probiotic strain, already tested [60]. This was verified in comparison

with presence of C7 compound. So, this corroborates the effect of S. salivarius in S. sobrinus that

was already verified by qPCR for S. sobrinus in Figure 12.

Comparing values of S. sobrinus (Figure 12) with S. salivarius (Figure 13) the presence

of S. salivarius together with S. sobrinus caused a little reduction on this cariogenic bacterium

due to an increase of S. salivarius, which however seems to be stimulated by C7 compound.

The pH values for S. sobrinus maintained their values through time, depending on

conditions considered (Table 6). However, pH fall was verified for conditions with S. sobrinus and

glucose (≈5), and glucose and S. salivarius (≈5). The other pH fall, when compared with only S.

sobrinus, was verified when S. sobrinus was conjugated with S. salivarius and C7 compound

(4.9). So, without addition of glucose or C7 compound, but with addition of only S. salivarius

(5.6), no decrease of pH was verified.



The PCR-DGGE is a molecular fingerprinting method against 16S rRNA that was used to

examine the effect of C7 compound in BHI and saliva after 24 h [75]. For this analysis, saliva

samples were collected from healthy people. DGGE allows the analysis of unculturable species

present in saliva in which PCR product are separated based on nucleotide composition. Looking

at Figure 14, the addition of C7 compound altered the composition of samples and differences

between conditions are evident. S. salivarius band is more clearly marked in the presence of this

prebiotic compound, mainly under anaerobic conditions. This means that in the presence of C7

compound there is an increase of the probiotic strain in saliva meaning that C7 compound

stimulates S. salivarius. It is known that prebiotics enhance the growth of beneficial bacteria as

lactobacilli and bifidobacteria [52].

With these results, it can be hypothesized that C7 compound stimulates also beneficial

streptococci as S. salivarius, a beneficial bacterium already present in the mouth. Further, other

strains have their bands more evidence in the presence of C7 compound. On the other hand,

some bands are more evident without the presence of C7 compound, marked as yellow

rectangles in Figure 14. In generally, it can be concluded that under anaerobic conditions

presence of S. salivarius was more evident when conjugated with C7 compound and seems to be

stimulated by this prebiotic compound. So, it seems that exists an ecological shift when C7 is or

is not present that leads some bands to be more or less marked according to it.

In conclusion, C7 compound seems to influence the presence of S. salivarius in saliva

sample. Saliva is a complex fluid where several bacteria present in the mouth grow together. So,

the results about the effect of a prebiotic compound in dual species experiment concluded that S.

salivarius has more influence on cariogenic bacteria reduction than the C7 compound.

Conjugating the experiments of saliva with the cariogenic bacteria, it could be hypothesized that

the effect of C7 compound stimulates an ecological shift to more presence of S. salivarius. On

the other hand, S. salivarius has a positive effect on cariogenic bacteria reduction. So, C7

compound seems to be involved in dental caries etiological bacteria reduction by the effect of S.

salivarius.

3.5. Conclusion

TYCSB was the selective medium used for S. mutans and for S. sobrinus. However, a

selective medium for the probiotic strain used was not found.



S. salivarius, the probiotic strain used in this study, seems to have a reduction effect on

S. mutans. However, C7, the prebiotic used, does not influence this reduction. When glucose is

conjugated with S. salivarius, S. mutans also suffers a reduction, however glucose cannot be

used as a prebiotic. The results of qPCR confirmed the influence of S. salivarius on S. mutans

reduction.

For S. sobrinus, the prebiotic compound seems to have influence in a little reduction

when the cariogenic bacterium is conjugated with the probiotic strain, however it was not really

clear.

On the other hand, analyzing a PCR-DGGE of saliva, the prebiotic seems to stimulate a

microbial shift, evidencing S. salivarius, when the prebiotic is present. Other shifts were verified

for other strains meaning a shift in the whole community in the mouth.

In conclusion, the prebiotic compound seems to influence the presence of S. salivarius

on saliva. Dual species experiments concluded that apparently S. salivarius have influence on S.

mutans reduction and not really clear on S. sobrinus. In conclusion, C7 compound has a positive

effect on S. salivarius, which by turn stimulates cariogenic bacteria reduction.





CHAPTER 4

Conclusion and future work





The present work presented an application, for the first time, of the technique of

quantitative Polymerase Chain Reaction (qPCR) for quantification of Streptococcus salivarius.

Moreover, it was also aim to study the effect of a prebiotic compound (C7) on cariogenic bacteria

and also on oral flora present in saliva, in order to understand whether addition of this compound

leads to a decrease of these bacteria (Streptococcus mutans and Streptococcus sobrinus).

Additionally, the effect of a probiotic species (Streptococcus salivarius) present in the mouth, was

also tested.

The enumeration by qPCR presented a linear relationship with the microbial culturing of

S. salivarius. So, this new method for this probiotic strain allowed its quantification, eliminating

gel electrophoresis analysis.

Regarding the dual species experiments, a selective medium for S. mutans, S. sobrinus

and S. salivarius was searched. TYCSB medium was the selective medium used in this study for

the cariogenic bacteria. However no selective medium was found for the probiotic strain.

Analyzing the effect of the prebiotic compound (C7) in cariogenic bacteria reduction, no

clear conclusions were possible to obtain. For S. mutans, the major influence in its reduction was

probably due to the probiotic strain (S. salivarius) but there was no influence of C7. For S.

sobrinus, there was some reduction in the presence of S. salivarius with stimulation of the

prebiotic compound (C7), however this was not completely clear with the experiments performed.

On the other hand, it was shown that C7 had an effect in the oral microbiota present in

human saliva, since it was verified an ecological shift in the whole community. S. salivarius

seems to be more present when C7 is added to saliva. On the other hand, other species are in

higher amounts in saliva when C7 is not present.

As future work, it would be interesting to find a selective medium for S. salivarius in order

to quantify by microbial culturing this probiotic strain in a dual species model experiment with

cariogenic bacteria.

Another suggestion is related to other energy sources, other compounds or substrates

that should be found in order to explore the relation and stimulation in beneficial and pathogenic

bacteria present in the mouth and involved in dental caries.





CHAPTER 5

References





[1] K. Hojo, S. Nagaoka, T. Ohshima, and N. Maeda, “Bacterial interactions in dental biofilm development,” J. Dent. Res., vol. 88, no. 11, pp. 982–990, Nov. 2009.

[2] R. Huang, M. Li, and R. L. Gregory, “Bacterial interactions in dental biofilm,” Virulence, vol. 2, no. 5, pp. 435–444, 2011.

[3] W. Teughels, N. Van Assche, I. Sliepen, and M. Quirynen, “Effect of material characteristics and/or surface topography on biofilm development.,” Clin. Oral Implants Res., vol. 17 Suppl 2, pp. 68–81, 2006.

[4] W. Teughels, G. Loozen, and M. Quirynen, “Do probiotics offer opportunities to manipulate the periodontal oral microbiota?,” J. Clin. Periodontol., vol. 38 Suppl 1, pp. 159–77, Mar. 2011.

[5] W. Teughels, M. Van Essche, I. Sliepen, and M. Quirynen, “Probiotics and oral healthcare,” Periodontol. 2000, vol. 48, pp. 111–147, Jan. 2008.

[6] A. R. Ten Cate, “Structure of the Oral Tissues,” in in Oral Histology - Development, Structure and Function, 1998, pp. 1–9.

[7] P. D. Marsh, “Microbial Ecology of Dental Plaque and its Significance in Health and Disease,” Adv. Dent. Res., vol. 8, no. 2, pp. 263–271, 1994.

[8] P. D. Marsh and B. Nyvad, “The oral microflora and biofilms on teeth,” in in Dental Caries - The Disease and its Clinical Management, 2008, pp. 163–187.

[9] N. Suzuki, A. Yoshida, and Y. Nakano, “Quantitative Analysis of Multi-Species Oral Biofilms by TaqMan Real-Time PCR,” Clin. Med. Res., vol. 3, no. 3, pp. 176–185, 2005.

[10] P. D. Marsh, “Are dental diseases examples of ecological catastrophes?,” Microbiology, vol. 149, no. 2, pp. 279–294, Feb. 2003.

[11] C. A. Squier and M. W. Finkelstein, “Oral Mucosa,” in in Oral Histology - Development, Structure and Function, 1998, pp. 345–385.

[12] M. Jawed, S. M. Shahid, S. A. Qader, and A. Azhar, “Dental caries in diabetes mellitus: role of salivary flow rate and minerals.,” J. Diabetes Complications, vol. 25, no. 3, pp. 183–186, 2011.

[13] M. J. Verkaik, “Oral Biofilms - Mechanical and Chemical Control Measures,” Rijksuniversiteit Groningen, 2011.

[14] F. A. Roberts and R. P. Darveau, “Beneficial bacteria of the periodontium,” Periodontol. 2000, vol. 30, pp. 40–50, Jan. 2002.

[15] Z. T. Wen and R. A. Burne, “Functional Genomics Approach to Identifying Genes Required for Biofilm Development by Streptococcus mutans,” Appl. Environ. Microbiol., vol. 68, no. 3, pp. 1196–1203, 2002.



[16] A. F. P. Leme, H. Koo, C. M. Bellato, G. Bedi, and J. A. Cury, “The Role of Sucrose in Cariogenic Dental Biofilm Formation - New Insight,” J. Dent. Res., vol. 85, no. 10, pp. 878–887, Oct. 2006.

[17] Z. T. Wen, D. Yates, S.-J. Ahn, and R. A. Burne, “Biofilm formation and virulence expression by Streptococcus mutans are altered when grown in dual-species model,” BMC Microbiol., vol. 10, no. 1, p. 111, 2010.

[18] N. Takahashi and B. Nyvad, “Caries Ecology Revisited: Microbial Dynamics and the Caries Process,” Caries Res., vol. 42, no. 6, pp. 409–418, Jan. 2008.

[19] P. D. Marsh, “Dental plaque as a biofilm and a microbial community - implications for health and disease,” BMC Oral Health, vol. 6 Suppl 1, p. S14, Jan. 2006.

[20] N. Takahashi and B. Nyvad, “The Role of Bacteria in the Caries Process: Ecological Perspectives,” J. Dent. Res., vol. 90, no. 3, pp. 294–303, 2011.

[21] D. A. Devine and P. D. Marsh, “Prospects for the development of probiotics and prebiotics for oral applications,” J. Oral Microbiol., vol. 1, no. 6, pp. 1–11, Jan. 2009.

[22] A. Bhardwaj and S. V. Bhardwaj, “Periodontitis as a risk factor for cardiovascular disease with its treatment modalities: a review,” J. Mol. Pathophysiol., vol. 1, no. 1, pp. 77–83, 2012.

[23] C. G. Van Hoogmoed, G. I. Geertsema-doornbusch, W. Teughels, M. Quirynen, H. J. Busscher, and H. C. Van der Mei, “Reduction of periodontal pathogens adhesion by antagonistic strains,” Oral Microbiol. Immunol., vol. 23, pp. 43–48, 2008.

[24] S. Kothari, G. Gnanaranjan, and P. Kothiyal, “Periodontal chip: an adjunct to conventional surgical treatment,” Int. J. Drug Res. Technol., vol. 2, no. 6, pp. 411–421, 2012.

[25] I. Sliepen, M. Van Essche, M. Pauwels, J. Van Eldere, J. Hofkens, M. Quirynen, and W. Teughels, “Colonization of hard and soft surfaces by Aggregatibacter actinomycetemcomitans under hydrodynamic conditions,” Oral Microbiol. Immunol., vol. 23, pp. 498–504, 2008.

[26] A. Azarpazhooh, P. S. Shah, H. C. Tenenbaum, and M. B. Goldberg, “The Effect of Photodynamic Therapy for Periodontitis: A Systematic Review and Meta-Analysis,” J. Periodontol., vol. 81, no. 1, pp. 4–14, 2009.

[27] W. Teughels, M. G. Newman, W. Coucke, A. D. Haffajee, H. C. Van Der Mei, S. Kinder Haake, E. Schepers, J.-J. Cassiman, J. Van Eldere, D. van Steenberghe, and M. Quirynen, “Guiding Periodontal Pocket Recolonization: a Proof of Concept,” J. Dent. Res., vol. 86, no. 11, pp. 1078–1082, 2007.

[28] I. Sliepen, M. Van Essche, G. Loozen, J. Van Eldere, M. Quirynen, and W. Teughels, “Interference with Aggregatibacter actinomycetemcomitans: colonization of epithelial cells under hydrodynamic conditions,” Oral Microbiol. Immunol., vol. 24, pp. 390–395, 2009.



[29] M. Van Essche, M. Quirynen, I. Sliepen, G. Loozen, N. Boon, J. Van Eldere, and W. Teughels, “Killing of anaerobic pathogens by predatory bacteria,” Mol. Oral Microbiol., vol. 26, pp. 52–61, 2011.

[30] A. Sheiham, “Dietary effects on dental diseases,” Public Health Nutr., vol. 4, no. 2B, pp. 569–591, Sep. 2001.

[31] R. J. Gibbons and J. van Houte, “Dental caries,” in in Annual Review of Medicine, vol. 26, 1975, pp. 122–136.

[32] T. Oho, Y. Yamashita, Y. Shimazaki, M. Kushiyama, and T. Koga, “Simple and rapid detection of Streptococcus mutans and Streptococcus sobrinus in human saliva by polymerase chain reaction,” Oral Microbiol. Immunol., vol. 15, no. 4, pp. 258–262, Aug. 2000.

[33] A. R. Ten Cate, “Repair and Regeneration of Dental Tissue,” in in Oral Histology - Development, Structure and Function, 1998, pp. 408–423.

[34] E. Freeman, “Periodontium,” in in Oral Histology - Development, Structure and Function, 1998, pp. 253–288.

[35] N. Takahashi, “Microbial ecosystem in the oral cavity: Metabolic diversity in an ecological niche and its relationship with oral diseases,” Int. Congr. Ser., vol. 1284, pp. 103–112, Sep. 2005.

[36] B. Brito Bezerra, O. Andriankaja, J. Kang, S. Pacios, H. Jin Bae, Y. Li, V. Tsiagbe, H. Schreiner, D. H. Fine, and D. T. Graves, “A . actinomycetemcomitans-induced periodontal disease promotes systemic and local responses in rat periodontium,” J. Clin. Periodontol., vol. 39, pp. 333–341, 2012.

[37] J. Travis, R. Pike, T. Imamura, and J. Potempa, “Porphyromonas gingivalis proteinases as virulence factors in the development of periodontitis,” J. Periodontal Res., vol. 32, pp. 120–125, 1997.

[38] G. M. Zanatta, S. Bittencourt, F. H. Nociti Jr., E. A. Sallum, A. W. Sallum, and M. Z. Casati, “Periodontal Debridement With Povidone-Iodine in Periodontal and Biochemical Observations,” J. Periodontol., vol. 77, no. 3, pp. 498–505, 2006.

[39] A. Yoshida, N. Suzuki, Y. Nakano, M. Kawada, T. Oho, and T. Koga, “Development of a 5 ′ Nuclease-Based Real-Time PCR Assay for Quantitative Detection of Cariogenic Dental Pathogens Streptococcus mutans and Streptococcus sobrinus,” J. Clin. Microbiol., vol. 41, no. 9, pp. 4438–4441, 2003.

[40] O. Fejerskov, B. Nyvad, and E. A. M. Kidd, “Pathology of dental caries,” in in Dental Caries - The Disease and its Clinical Management, 2008, pp. 19–48.



[41] S. Twetman, S. Axelsson, G. Dahlén, I. Espelid, I. Mejàre, A. Norlund, and S. Tranæus, “Adjunct methods for caries detection: a systematic review of literature,” Acta Odontologica Scandinavica, vol. 71, no. 3–4, pp. 1–10, 2012.

[42] O. Fejerskov, E. A. M. Kidd, B. Nyvad, and V. Baelum, “Defining the disease: an introduction,” in in Dental Caries - The Disease and its Clinical Management, 2008, pp. 3–6.

[43] O. Fejerskov, B. Nyvad, and E. A. M. Kidd, “Clinical appearances of caries lesions,” in in Dental Caries - The Disease and its Clinical Management, 2008, pp. 7–18.

[44] B. A. Burt, V. Baelum, and O. Fejerskov, “The epidemiology of dental caries,” in in Dental Caries - The Disease and its Clinical Management, 2008, pp. 123–145.

[45] A. Yano, N. Kaneko, H. Ida, T. Yamaguchi, and N. Hanada, “Real-time PCR for quantification of Streptococcus mutans,” FEMS Microbiol. Lett., vol. 217, pp. 23–30, 2002.

[46] J. H. Meurman and I. Stamatova, “Probiotics: contributions to oral health,” Oral Dis., vol. 13, no. 5, pp. 443–51, Sep. 2007.

[47] J. H. Meurman, “Probiotics: do they have a role in oral medicine and dentistry?,” Eur. J. Oral Sci., vol. 113, no. 3, pp. 188–196, Jun. 2005.

[48] G. Reid, “Probiotics and prebiotics – Progress and challenges,” Int. Dairy J., vol. 18, no. 10–11, pp. 969–975, Oct. 2008.

[49] A. Homayoni Rad, F. Akbarzadeh, and E. V. Mehrabany, “Which are more important: Prebiotics or probiotics?,” Nutrition, vol. 28, no. 11–12, pp. 1196–1197, 2012.

[50] J. Schrezenmeir and M. de Vrese, “Probiotics, prebiotics, and synbiotics--approaching a definition,” Am. J. Clin. Nutr., vol. 73, no. 2 Suppl, p. 361S–364S, Feb. 2001.

[51] T. S. Manning and G. R. Gibson, “Prebiotics,” Best Pract. Res. Clin. Gastroenterol., vol. 18, no. 2, pp. 287–298, 2004.

[52] M. Roberfroid, “Prebiotics: The Concept revisited,” J. Nutr., vol. 137, no. 3 Suppl 2, p. 830S–837S, Mar. 2007.

[53] M. Van Essche, I. Sliepen, G. Loozen, J. Van Eldere, M. Quirynen, Y. Davidov, E. Jurkevitch, N. Boon, and W. Teughels, “Development and performance of a quantitative PCR for the enumeration of Bdellovibrionaceae,” Environ. Microbiol. Rep., vol. 1, no. 4, pp. 228–233, Aug. 2009.

[54] T. Igarashi, Y. Yano, A. Yamamoto, R. Sasa, and N. Goto, “Identification of Streptococcus salivarius by PCR and DNA probe,” Lett. Appl. Microbiol., vol. 32, pp. 394–397, 2001.



[55] G. Loozen, N. Boon, M. Pauwels, M. Quirynen, and W. Teughels, “Live/dead real-time polymerase chain reaction to assess new therapies against dental plaque-related pathologies.,” Mol. Oral Microbiol., vol. 26, no. 4, pp. 253–61, Aug. 2011.

[56] Brookman-Amissah, Ha. Packer, E. Prediger, and J. Sabel, qPCR Application Guide. 2012.

[57] J. Hellemans, G. Mortier, A. De Paepe, F. Speleman, and J. Vandesompele, “qBase relative quantification framework and software for management and automated analysis of real-time quantitative PCR data,” Genome Biol., vol. 8, no. 2, p. R19, Jan. 2007.

[58] B. M. Corcoran, R. P. Ross, G. F. Fitzgerald, and C. Stanton, “Comparative survival of probiotic lactobacilli spray-dried in the presence of prebiotic substances,” J. Appl. Microbiol., vol. 96, no. 5, pp. 1024–1039, Jan. 2004.

[59] P. M. Giffard, C. L. Simpson, C. P. Milward, and N. A. Jacques, “Molecular characterization of a cluster of at least two glucosyltransferase genes in Streptococcus salivarius ATCC 25975,” J. Gen. Microbiol., vol. 137, no. 11, pp. 2577–2593, Nov. 1991.

[60] J. P. Burton, P. A. Wescombe, C. J. Moore, C. N. Chilcott, and J. R. Tagg, “Safety Assessment of the Oral Cavity Probiotic Streptococcus salivarius K12,” Appl. Environ. Microbiol., vol. 72, no. 4, pp. 3050–3053, 2006.

[61] J. R. Cole, B. Chai, R. J. Farris, Q. Wang, A. S. Kulam-Syed-Mohideen, D. M. McGarrell, A. M. Bandela, E. Cardenas, G. M. Garrity, and J. M. Tiedje, “The ribosomal database project (RDP-II): introducing myRDP space and quality controlled public data,” Nucleic Acids Res., vol. 35, pp. D169–172, 2007.

[62] R. S. Reddy, L. A. Swapna, T. Ramesh, T. R. Singh, N. Vijayalaxmi, and R. Lavanya, “Bacteria in Oral Health – Probiotics and Prebiotics A Review,” Int. J. Biol. Med. Res., vol. 2, no. 4, pp. 1226–1233, 2011.

[63] J. D. Oliver, “The Viable but Nonculturable State in Bacteria,” J. Microbiol., vol. 43, no. Special issue, pp. 93–100, 2005.

[64] Y. Li, D. Saxena, V. M. Barnes, H. M. Trivedi, Y. Ge, and T. Xu, “Polymerase chain reaction-based denaturing gradient gel electrophoresis in the evaluation of oral microbiota.,” Oral Microbiol. Immunol., vol. 21, no. 5, pp. 333–9, Oct. 2006.

[65] G. Muyzer, E. C. de Waal, and A. G. Uitterlinden, “Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA,” Appl. Environ. Microbiol., vol. 59, no. 3, pp. 695–700, 1993.

[66] M. Hirasawa and K. Takada, “A New Selective Medium for Streptococcus mutans and the Distribution of S. mutans and S. sobrinus and Their Serotypes in Dental Plaque,” Caries Res., vol. 37, no. 3, pp. 212–217, 2003.



[67] O. G. Gold, H. V. Jordan, and J. Van Houte, “A selective medium for Streptoocccus mutans,” Arch. Oral Biol., vol. 18, pp. 1357–1364, 1973.

[68] W. H. Van Palenstein Helderman, M. Ijsseldijk, and J. H. Huis In ’t Veld, “A selective medium for the two major subgroups of the bacterium Streptococcus mutans isolated from human dental plaque and saliva.,” Arch. Oral Biol., vol. 28, no. 7, pp. 599–603, Jan. 1983.

[69] S. M. Colby and R. R. B. Russell, “Sugar metabolism by mutans streptococci,” J. Appl. Microbiol. Symp. Suppl., vol. 83, p. 80S–88S, Jan. 1997.

[70] K. Rudi, B. Moen, S. M. Drømtorp, and A. L. Holck, “Use of Ethidium Monoazide and PCR in Combination for Quantification of Viable and Dead Cells in Complex Samples,” Appl. Environ. Microbiol., vol. 71, no. 2, pp. 1018–1024, 2005.

[71] Y.-H. Li, M. N. Hanna, G. Svensäter, R. P. Ellen, and D. G. Cvitkovitch, “Cell Density Modulates Acid Adaptation in Streptococcus mutans: Implications for Survival in Biofilms,” J. Bacteriol., vol. 183, no. 23, pp. 6875–6884, 2001.

[72] C. A. Fux, J. W. Costerton, P. S. Stewart, and P. Stoodley, “Survival strategies of infectious biofilms,” Elsiever, vol. 13, no. 1, pp. 34–40, Jan. 2005.

[73] E.-M. Decker, “The ability of direct fluorescence-based, two-colour assays to detect different physiological states of oral streptococci,” Lett. Appl. Microbiol., vol. 33, no. 3, pp. 188–192, Sep. 2001.

[74] J. T. Trevors, “Viable but non-culturable (VBNC) bacteria: Gene expression in planktonic and biofilm cells,” J. Microbiol. Methods, vol. 86, no. 2, pp. 266–73, Aug. 2011.

[75] G. Muyzer and K. Smalla, “Application of denaturing gradient gel electrophoresis (DGGE) and temperature gradient gel electrophoresis (TGGE) in microbial ecology,” AntonieKluwer Acad. Publ. van Leeuwenhoek, vol. 73, no. 1, pp. 127–141, Jan. 1998.

Date post:	08-Mar-2018
Category:	Documents
Upload:	ngoanh
View:	216 times
Download:	1 times

Ecological shift of oral microbiota - Universidade do Minho · PDF fileEcological shift of...

Documents