Edinburgh Research Explorer

Estrogen-related receptor beta interacts with Oct4 to positivelyregulate Nanog gene expression

Citation for published version:van den Berg, DLC, Zhang, W, Yates, A, Engelen, E, Takacs, K, Bezstarosti, K, Demmers, J, Chambers, I &Poot, RA 2008, 'Estrogen-related receptor beta interacts with Oct4 to positively regulate Nanog geneexpression', Molecular and Cellular Biology, vol. 28, no. 19, pp. 5986-5995.https://doi.org/10.1128/MCB.00301-08

Digital Object Identifier (DOI):10.1128/MCB.00301-08

Link:Link to publication record in Edinburgh Research Explorer

Document Version:Publisher's PDF, also known as Version of record

Published In:Molecular and Cellular Biology

Publisher Rights Statement:RoMEO blue

General rightsCopyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s)and / or other copyright owners and it is a condition of accessing these publications that users recognise andabide by the legal requirements associated with these rights.

Take down policyThe University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorercontent complies with UK legislation. If you believe that the public display of this file breaches copyright pleasecontact openaccess@ed.ac.uk providing details, and we will remove access to the work immediately andinvestigate your claim.

Download date: 02. Feb. 2021

MOLECULAR AND CELLULAR BIOLOGY, Oct. 2008, p. 5986–5995 Vol. 28, No. 190270-7306/08/$08.00�0 doi:10.1128/MCB.00301-08Copyright © 2008, American Society for Microbiology. All Rights Reserved.

Estrogen-Related Receptor Beta Interacts with Oct4 To PositivelyRegulate Nanog Gene Expression�

Debbie L. C. van den Berg,1 Wensheng Zhang,2 Adam Yates,2 Erik Engelen,1 Katalin Takacs,3Karel Bezstarosti,4 Jeroen Demmers,4 Ian Chambers,2 and Raymond A. Poot1*

Department of Cell Biology, Erasmus MC, Dr. Molewaterplein 50, 3015GE Rotterdam, The Netherlands1; MRC Centre forRegenerative Medicine, Institute for Stem Cell Research, School of Biological Sciences, University of Edinburgh,

King’s Buildings, West Mains Road, Edinburgh EH9 3JQ, Scotland2; MRC Clinical Sciences Centre,Du Cane Road, London W12 0NN, United Kingdom3; and Proteomics Center,

Erasmus MC, Rotterdam, The Netherlands4

Received 22 February 2008/Returned for modification 15 April 2008/Accepted 14 July 2008

Embryonic stem (ES) cell self-renewal is regulated by transcription factors, including Oct4, Sox2, andNanog. A number of additional transcriptional regulators of ES cell self-renewal have recently been identified,including the orphan nuclear receptor estrogen-related receptor beta (Esrrb). However, the mode of action ofEsrrb in ES cells is unknown. Here, using an Oct4 affinity screen, we identify Esrrb as an Oct4 partner protein.Esrrb can interact with Oct4 independently of DNA. Esrrb is recruited near the Oct-Sox element in the Nanogproximal promoter, where it positively regulates Nanog expression. Esrrb recruitment to the Nanog promoterrequires both the presence of Oct4 and a degenerate estrogen-related receptor DNA element. Consistent withits role in Nanog regulation, expression of the Esrrb protein within the Oct4-positive ES cell population ismosaic and correlates with the mosaic expression of the Nanog protein. Together with previous reports thatNanog may regulate Esrrb gene expression, our results suggest that Esrrb and Nanog act as part of a feedbackregulatory circuit that modulates the fluctuating self-renewal capacity of ES cell populations.

The self-renewal of mouse ES cells is regulated by a networkof transcription factors that includes Oct4, Nanog, and Sox2(22). The expression level of Oct4 protein needs to be keptwithin a tight range in order to maintain ES cell self-renewal(23). Decreasing Oct4 levels below 50% induces differentiationinto the trophectoderm, whereas a twofold increase causesdifferentiation into cells expressing markers of the endodermand mesoderm (23). In contrast, overexpression of Nanog al-lows mouse embryonic stem (ES) cells to remain undifferen-tiated in the absence of the otherwise requisite stimulation byleukemia inhibitory factor and bone morphogenetic protein (5,19, 34). Oct4 is thought to act together with Sox2 by binding toadjacent cognate DNA sequences in many genes (1), includingNanog (14, 26). Genome-wide chromatin immunoprecipitation(ChIP) studies have suggested that composite Oct-Sox motifsregulate the expression of many genes in mouse and human EScells (2, 16). Recent evidence has shown that the critical role ofSox2 in maintaining ES cell self-renewal is regulating Oct4expression, suggesting that the secondary role of gene regula-tion via Oct-Sox motifs is performed redundantly with Sox4,Sox11, and Sox15 (18).

Recent reports have expanded the list of factors that con-tribute to ES cell self-renewal. Wang et al. (30) reported aproteomic analysis of interactors of Oct4 and Nanog andsuggested that some Nanog interactors may assist in Nanog-mediated gene regulation. A separate study using an RNAinterference (RNAi) screen found that depletion of estrogen-

related receptor beta (Esrrb), Tbx3, or Tcl1 resulted in ES celldifferentiation but that this differentiation could be attenuatedby overexpression of Nanog (13). However, it is unclear howany of these novel regulatory factors mediate their function.Here we use an unbiased analysis of Oct4 binding proteins toidentify Esrrb as an Oct4-interacting partner protein. We showthat Esrrb is recruited to the Oct4 responsive element withinthe proximal Nanog promoter where it is responsible for me-diating the positive regulatory effect of Oct4.

MATERIALS AND METHODS

Plasmids and cell culture. RNAi constructs pSuper-Esrrb-sh1 and pSuper-Esrrb-sh2 were constructed by cloning Esrrb RNAi1 and RNAi2 (16) intopSuper-puro (Oligoengine). pSuper-control contains an oligonucleotide withoutcomplementarity to any known mammalian sequence (Dharmacon). Mouse EScell lines 46C (35) and ZHBTc4 (23) and derivatives of ZHBTc4 were grown ongelatin-coated dishes without feeders on Glasgow minimal essential mediumsupplemented with leukemia inhibitory factor, 15% fetal bovine serum, 0.25%sodium bicarbonate, 1 mM glutamine, 1 mM sodium pyruvate, nonessentialamino acids, 50 �M beta-mercaptoethanol, and penicillin-streptomycin.

Cells from the c6 cell line, called F-Oct4 ES cells from here onwards, werecreated by electroporating ZHBTc4 cells with linearized pPyCAG (FLAG)3

Oct4IP, a plasmid in which the Oct4 open reading frame was placed between theN-terminal triple FLAG tag and the internal ribosome entry site (IRES)-puro-mycin resistance cassette of pPyCAG (FLAG)3IP (20). Electroporated cells wereplated in ES cell medium, and after 24 h, 1 �g/ml puromycin and 1 �g/mldoxycycline were added. After 12 days of selection, puromycin-resistant colonieswere picked and tested for FLAG-Oct4 expression by anti-FLAG Western blotanalysis. TNG cells have been described previously (6) Puromycin-sensitiveTNG-PS cells were derived from TNG cells by excision of the frt-IRES-pac-frtcassette by transient expression of FLPe. Bright field pictures of ES cell cultureswere taken using the IX70 inverted microscope (Olympus).

Oct4 purification and mass spectrometry. F-Oct4 ES cells and control cells(ZHBTc4) were expanded to 50 14-cm dishes, plates were washed once withphosphate-buffered saline, cells were scraped off, and nuclear extracts wereprepared (8) and dialyzed to 100 mM KCl (8). A total of 100 �l of anti-FLAGM2 agarose beads (Sigma), equilibrated in buffer C-100 (20 mM HEPES, pH 7.6,

* Corresponding author. Mailing address: Department of Cell Biol-ogy, Erasmus MC, Dr. Molewaterplein 50, 3015GE Rotterdam, TheNetherlands. Phone: 31-10-7043352. Fax: 31-10-7044743. E-mail: r.poot@erasmusmc.nl.

� Published ahead of print on 28 July 2008.

5986

10% glycerol, 100 mM KCl, 1.5 mM MgCl2, 0.2 mM EDTA, 1� completeEDTA-free protease inhibitor; Roche), was added to 10 ml of nuclear extract,incubated for 3 h at 4°C, transferred into an Eppendorf tube, and washed fivetimes with 1 ml of C-100 buffer plus 0.02% NP-40 (C-100*) and eluted four timeswith C-100* containing 0.2 mg/ml FLAG tripeptide (Sigma) for 15 min at 4°C.Fractions were loaded onto a 10% sodium dodecyl sulfate (SDS)-phosphono-acetic acid (PAA) gel and silver stained. Elutions 1 and 2, containing the majorityof FLAG-Oct4 in purification from the F-Oct4 extract, were concentrated bySpeedVac condensation, loaded onto a 10% SDS-PAA gel, and stained withcolloidal Coomassie blue. Gel lanes were cut and subjected to in-gel digestionwith trypsin (Promega), essentially as described previously (31). Nanoflow liquidchromatography-tandem mass spectrometry was performed on a 1100 seriescapillary liquid chromatography system (Agilent Technologies) coupled to anLTQ-Orbitrap mass spectrometer (Thermo), as described previously (27). Da-tabase searches to assign proteins to the found peptide fragmentation spectrawere performed using Mascot, as described previously (27).

IP. For immunoprecipitation (IP), 2.5 �g of Oct4 antibody (N19; Santa CruzBiotechnology) or Esrrb antibody (R&D Systems) was added to 200 �l of 46C EScell nuclear extract and incubated under rotation for 2 h at 4°C. A total of 1 UBenzonase (Novagen) or 25 �g/ml ethidium bromide was added where indicated.The antibody-extract mixture was added to 20 �l of protein G-Sepharose beads(Amersham) blocked with 1% fish skin gelatin (Sigma) and 0.2 mg/ml chickenegg albumin (Sigma) and rotated for another 90 min. Beads were washed fourtimes with 100 �l of C-100* buffer and boiled in SDS loading dye.

RNAi and assays for Nanog expression. 46C ES cells were transfected withpSuper-Esrrb-sh1, pSuper-Esrrb-sh2, or pSuper-control using Lipofectamine2000 transfection reagent (Invitrogen). To measure the effect of Esrrb RNAi onthe endogenous mRNA and protein levels of Nanog, Oct4, and Esrrb, trans-fected cells were selected with 1 �g/ml puromycin for 48 h, starting at 24 hposttransfection. RNA was isolated from these samples using Trizol (Invitrogen),and mRNA levels were measured by performing real-time quantitative PCR(qPCR) on an Opticon real-time PCR machine. Protein levels were measured byWestern blot analyses using antibodies against Nanog (6), Oct4, Esrrb, and laminB1 (Santa Cruz Biotechnology).

TNG-PS cells were transfected with pSuper-Esrrb-sh1, pSuper-Esrrb-sh2, orpSuper-control, and transfected cells were selected with puromycin for 48 h,starting at 24 h posttransfection. Green fluorescent protein (GFP) fluorescenceof the TNG cells was measured by using a FACSCalibur flow cytometer (BectonDickinson), as described previously (6).

For measuring the effect of Esrrb RNAi on expression from the Nanog pro-moter, pNanog-Luc containing a Nanog promoter fragment from �2.5 kb to �50bp (11) and pRenilla-TK (Promega) were cotransfected with the pSuper con-structs. Renilla luciferase assays were done 48 h posttransfection using the dualluciferase reporter system (Promega). The pNanog-Luc mutated Oct binding site(mOS) and its control were described previously (26). pNanog-Luc constructswith a mutant estrogen-related receptor response element (ERRE) containedthe mutation GGT to AAC in the ERRE sequence TCTGGGTCA in the Nanogproximal promoter from �230 to �106, compared to the Nanog transcriptionalstart, and were tested 24 h posttransfection.

ChIP. ChIP using formaldehyde cross-linking and Oct4 antibodies (sc-8628;Santa Cruz Biotechnology) or Esrrb antibodies (R&D Systems) was done on 46CES cells, as described previously (2). Dual cross-linking ChIP using formaldehydeand di(N-succinimidyl) glutarate (DSG) was performed on 46C and ZBHTc4 EScells, as described previously (24). qPCR analysis was performed using DNAEngine Opticon 2. Relative enrichments were calculated by comparing the ChIPefficiency of the region of interest to that of an unrelated region (Amylase).Primers used to amplify the Nanog genomic region are as follows: 5� (�550 to�462), CACAGGCTCTTTCTTCAGACTTG and TCTTGCTTGCTCTTCACATTGG; Oct-Sox (�215 to �60), TCCCTCCCTCCCAGTCTG and CCTCCTACCCTACCCACCC; and 3� (�929 to �988), GGTAGAACCAAGAGGCTGCT and CATCACAACACGCACCTGA. Primers used for Zfp42 are asfollows: �283 to �117, TGCATCCTCTGCTTGTGTAA and CAGAGCTGTCCCCTTGTCT; Rest (�3216 to �3071), CTCCCCTGGACAATAGCTTC andCGTCCTTCATTTCCTCAGTG; Dppa3 (�1770 to �1550), GATCCAGCTGGTCTGAGCTA and GTGCAGGGATCATAGGAGTG; and Lefty1 (�1264 to�1060), AAGCTGCAGACTTCATTCCA and CGGGGGATAGATGAAGAAAC (21). Primers used for Amylase are as follows: CTCCTTGTACGGGTTGGT and AATGATGTGCACAGCTGAA.

EMSAs. 293T cells were transfected with pPyCAGIP derivatives (20) express-ing the cDNAs of FLAG-Esrrb, Oct4, or Sox2. After 24 h, cells were washed andharvested in phosphate-buffered saline, resuspended in lysis buffer (50 mMHEPES, pH 7.9, 150 mM NaCl, 1 mM EDTA, 0.5% NP-40, 1� completeEDTA-free protease inhibitor; Roche) and rotated at 4°C for 20 min. After being

microcentrifuged at 13,000 rpm for 10 min, supernatants were divided intoaliquots and stored at �80°C. The electrophoretic mobility shift assay (EMSA)was carried out as described previously (7). The antibodies for the supershiftwere added after the initial incubation for a further 10 min as follows: 2 �g ofanti-Oct4 (sc-9081), 2 �g of anti-Sox2 (sc-17320), or 1 �g of FLAG M2 antibody(Sigma).

Immunofluorescence. 46C ES cells were grown on coverslips coated with 0.1%gelatin and stained with antibodies using a standard protocol. In short, cells werefixed in 4% paraformaldehyde and incubated with antibodies against Nanog (6),Oct4 (N19; Santa Cruz Biotechnology), and Esrrb (R&D Systems). Secondaryantibodies are from Dako (fluorescein isothiocyanate swine anti-rabbit anti-body), Molecular Probes (Alexa Fluor 594 goat anti-mouse antibody) and Jack-son ImmunoResearch Laboratories (fluorescein isothiocyanate rabbit anti-goatantibody). Images were taken with an Axio Imager (Zeiss).

RESULTS

The Oct4 protein interacts with Esrrb. To identify the in-teraction partners of the Oct4 protein in ES cells, we con-structed an ES cell line where, under self-renewing conditions,all Oct4 in the cell has an N-terminal triple FLAG tag (FLAG-Oct4). The parental ZHBTc4 ES cell line (23) has both Oct4alleles disrupted, and the only Oct4 protein in the cell is tran-scribed from a doxycycline-suppressible transgene (Fig. 1A).ZHBTc4 cells were transfected with a construct in which theconstitutive expression of FLAG-Oct4 is linked through anIRES to puromycin resistance. Simultaneously, doxycyclinewas added to the medium to repress the inducible Oct4 trans-gene expression (23). After 12 days of growth, colonies werepicked and expanded into cell lines. All cell lines expressed aprotein of the same relative molecular weight that reacted withan anti-FLAG antibody on Western blots (data not shown). Asthe Oct4 level must be tightly regulated to allow continuedself-renewal (23), the survival of puromycin-resistant coloniesindicates that the FLAG-Oct4 protein is functional. Two ofthese lines were further tested for their response to doxycyclinetreatment, and both underwent efficient differentiation atclonal density (Fig. 1B and C). The c6 cell line (F-Oct4 EScells) was taken forward for biochemical analysis.

F-Oct4 ES cells were expanded, nuclear extracts were pre-pared, and the FLAG-Oct4 protein was purified using FLAG-affinity technology (see Materials and Methods). Silver stainanalysis of a polyacrylamide gel containing the proteins puri-fied from F-Oct4 extracts identified a major band and a minorband running just above the 54,000-molecular-weight marker(Fig. 2A). Both bands are recognized by a FLAG antibody andare not present in purifications from control extracts, suggest-ing that they represent the FLAG-Oct4 protein (Fig. 2B). Noother major bands were observed, indicating that Oct4 doesnot purify as part of a major stoichiometric complex, despitethe mild purification conditions used. Mass spectrometry anal-ysis of two independent purifications identified the presence ofOct4 (10 unique peptides) and Esrrb (5 unique peptides) inF-Oct4 samples but not in control samples. Indeed, Esrrbcould be detected by Western blot analysis in the F-Oct4 sam-ple but not in the control (Fig. 2C). The interaction betweenEsrrb and Oct4 was independently verified by co-IP from ex-tracts of a different ES cell line, 46C, using antibodies againstendogenous Oct4 and Esrrb (Fig. 2D and E). Treatment of theextract with Benzonase nuclease or ethidium bromide did notaffect the interaction (Fig. 2D and E), indicating that it is notindirectly mediated through DNA.

VOL. 28, 2008 Esrrb REGULATES Nanog EXPRESSION 5987

Moreover, the ability of bacterially expressed GST-Oct4 topull down FLAG-Esrrb from transfected ES cells (Fig. 2F)indicates that posttranslational modification of Oct4 is notrequired for interaction between Oct4 and Esrrb.

Esrrb regulates expression of the Oct4 target gene Nanog.Oct4 regulates expression of a cohort of target genes in EScells, often acting in concert with Sox proteins (16). To deter-mine whether the binding of Esrrb to Oct4 affected the regu-lation of gene expression by Oct4, we first examined expressionof the Oct4 target gene Nanog. We depleted Esrrb by RNAiusing two vectors that express different, previously reportedEsrrb short hairpin RNAs (shRNAs) (16) and harbor a puro-mycin selection marker. After 2 days of puromycin selection,the levels of Nanog mRNA (Fig. 3A) and Nanog protein (Fig.3B) were reduced in the 46C ES cells treated with either EsrrbshRNA vector compared to the levels of the control. Impor-tantly, this specific depletion of Nanog occurred prior to anyreduction in Oct4 expression (Fig. 3A and B) and prior to anymorphological evidence of ES cell differentiation (Fig. 3C).This indicates that Esrrb shRNA-induced Nanog depletion isnot a consequence of differentiation but occurs prior to differ-entiation. We also tested the effect of Esrrb depletion onTNG-PS ES cells which have the GFP open reading frameinserted at the start codon of one of the endogenous Nanogalleles (6). Transfection of either Esrrb shRNA vector de-creased the mean GFP fluorescence of the population (Fig.3D) after 2 days of puromycin selection, suggesting that de-pletion of Esrrb reduces transcription from the Nanog locus.To determine whether Esrrb affects the activity of the Nanogpromoter, similar shRNA experiments were performed using aluciferase reporter under the control of a Nanog promoterfragment extending from �2.5 kb to �50 bp compared to thetranscription start site. Esrrb shRNA vectors were cotrans-fected with the luciferase reporters, and luciferase activity wasmeasured 2 days posttransfection. Figure 3E shows that Nanogpromoter activity is strongly reduced with either Esrrb shRNAvector compared to activity with a control shRNA vector.

Esrrb regulates Nanog expression using contacts with bothOct4 and a degenerate ERRE. Oct4 contributes to the regula-tion of Nanog by binding to an Oct-Sox site (14, 26), located166 to 180 bp upstream of the mapped transcription start siteof the Nanog gene (4, 32). To investigate the relationshipbetween the regulation of Nanog by Esrrb and that by Oct4, weperformed ChIP experiments with antibodies for Oct4 andEsrrb in 46C ES cells and examined the precipitates for thepresence of the Nanog promoter. A standard ChIP protocolusing only formaldehyde as a cross-linking agent confirms thatOct4 binds in the vicinity of the Oct-Sox site (Fig. 4B). Usingstandard ChIP, we found no enrichment of Esrrb at the Nanogpromoter (Fig. 4B), although the Esrrb protein is immunopre-cipitated during the ChIP procedure (data not shown). Con-ventional formaldehyde-based ChIP methods efficiently detectprotein-DNA interactions but may not detect the binding ofEsrrb to the Nanog promoter if it is stabilized by protein-protein interactions. We therefore used a dual cross-linkingChIP method (XX-ChIP) that uses DSG prior to formalde-hyde cross-linking (24). DSG has a longer spacer arm thanformaldehyde and has been used to cross-link transcriptionfactor protein-protein interactions on DNA (15). XX-ChIPindeed detects Esrrb at the Oct-Sox site within the proximal

FIG. 1. Construction and characterization of F-Oct ES cell lines.(A) In ZHBTc4 ES cells, both the Oct4 alleles have been replaced andOct4 expression is directed from a doxycycline-suppressible transgene.F-Oct ES cell lines were derived from ZHBTc4 cells by transfectionwith linearized pPyCAG (FLAG)3 Oct4IP and the concomitant addi-tion of doxycycline. (B) Clonal assays on two clones demonstrate thatfollowing the withdrawal of doxycycline, Oct4-induced differentiationoccurs efficiently in representative F-Oct cell lines. Cells were plated at600 cells per 10-cm dish in the presence or absence of 1 mM doxycy-cline, cultured for 6 days, and stained for alkaline phosphatase activity,and the differentiation status was determined. (C) Examples of colonymorphologies in the presence (�Dx) and absence (�Dx) of doxycy-cline are shown.

5988 VAN DEN BERG ET AL. MOL. CELL. BIOL.

Nanog promoter (Fig. 4C). XX-ChIP using the Oct4 antibodyalso gives a specific enrichment of Oct4 at the Oct-Sox motif(Fig. 4C). Oct4 and Esrrb were also specifically enriched on theOct-Sox site compared to the input and an immunoglobulin Gcontrol (data not shown). We conclude that Esrrb binds to theNanog promoter in the vicinity of the Oct-Sox motif.

To assess whether Esrrb binding to the Nanog promoter isdependent on Oct4, we made use of the ES cell line ZHBTc4in which the endogenous Oct4 alleles are disrupted and inwhich Oct4 is expressed from a doxycycline-suppressible pro-moter (23). The addition of doxycycline for 12 h removes allOct4 protein from the cell (Fig. 4D). At this time point, thelevel of Esrrb is unaffected (Fig. 4D). Esrrb XX-ChIP showsthat Esrrb is no longer enriched at the Nanog promoter in theabsence of Oct4 (Fig. 4E). To functionally test whether themaintenance of Nanog promoter activity by Esrrb is via Oct4,we tested Nanog promoter-luciferase constructs where theOct4 binding site is mutated (Nanog mOS) (26). As expected,the Nanog mOS reporter is less active than the wild-type (wt)construct, although still clearly above the background (26)(Fig. 4F). Depletion of Esrrb does not further reduce theactivity of Nanog mOS (Fig. 4F), suggesting that the effect ofEsrrb on Nanog expression requires Oct4 binding to the Oct-Sox site in the Nanog promoter.

Estrogen-related receptors are thought to act via an ERRE.A consensus ERRE of tcaaGGttca (invariant positions in up-percase) was determined by SELEX and confirmed by in vivostudies (9, 29). Visual inspection of the Nanog promoter iden-

tified a degenerate ERRE (sequence TCTGGGTCA) 12 bpupstream of the Oct-Sox motif (Fig. 5A). This sequence islargely conserved in many mammalian species (26). To test thecontribution of this putative ERRE to Nanog promoter activ-ity, we mutated the core GGT in this motif into AAC (Fig. 5A)in the context of a Nanog promoter-luciferase construct. Nu-clear magnetic resonance structural analysis of the Esrrb DNAbinding domain in complex with DNA shows that these basesmake a major contribution to DNA binding by Esrrb (10). Thismutation strongly reduced Nanog promoter activity (Fig. 5B).Moreover, in contrast to the situation with the unmutatedconstruct, the activity of this mutant could not be further re-duced by Esrrb shRNA expression (Fig. 5B).

EMSA was employed to investigate the potential binding ofEsrrb to the Nanog promoter. A 57-mer oligonucleotide cor-responding to the sequence of the Nanog promoter that in-cludes the putative ERRE and the Oct-Sox site was used.Lysate prepared from 293T cells that were cotransfected withFLAG-Esrrb, Oct4, and Sox2 expression plasmids caused ashift in migration of the probe into two complexes (Fig. 5C,left). The faster migrating complex could be supershifted byantibodies against Oct4 and Sox2 but not by an anti-FLAGantibody. In contrast, the slower migrating band was super-shifted by all three antibodies, suggesting that the slower mi-grating complex is formed by binding of Esrrb, Sox2, and Oct4(Fig. 5C, left, lanes 2 to 4). Using a second 57-mer oligonucle-otide that has the GGT-to-AAC mutation in the putative

FIG. 2. Oct4 interacts with Esrrb. (A) Silver-stained SDS-PAA gel of peptide-eluted FLAG-Oct4 versus control purification. The proteinmarker is shown as molecular weight (MW) in thousands. The band representing FLAG-Oct4 is indicated by the arrow. (B) Western blot analysiswith anti-FLAG antibody on input, supernatant (sup), and elution of FLAG-Oct4 purification. (C) Western blot analysis with anti-Esrrb antibodyon the eluted FLAG-Oct4 or control sample. (D, E) Co-IP experiments using antibodies against Oct4, Esrrb, or control immunoglobulin G (IgG)confirm the Oct4-Esrrb interaction. DNA independency of the interaction is shown by its insensitivity to Benzonase (benzo) or ethidium bromide(EtBr). (F) GST pulldown experiment using extracts from FLAG-Esrrb-transfected ES cells.

VOL. 28, 2008 Esrrb REGULATES Nanog EXPRESSION 5989

ERRE, only the faster of the two complexes was observed, andthis could be shifted by antibodies against Oct4 and Sox2 butnot by anti-FLAG antibody (Fig. 5C, right). Therefore, weconclude that there is an ERRE upstream of the Oct-Sox site

in the Nanog promoter that is essential for Esrrb binding andoptimal Nanog promoter activity.

To determine whether binding of Esrrb to the Nanog pro-moter in vitro is dependent upon binding of Oct4-Sox2,

FIG. 3. Esrrb regulates Nanog expression. (A) Real-time qPCR analysis shows downregulation of the mRNA levels of Nanog but not Oct4, followingthe shRNA-mediated knockdown of Esrrb in 46C ES cells by transfection of pSUPER plasmids expressing Esrrb shRNA1 or Esrrb shRNA2. RNA levelsare compared to cells transfected with pSUPER expressing a control shRNA. Error bars represent the standard error of the mean (SEM) of threeindependent experiments. (B) Western blot analysis on total cell lysates confirms depletion at the protein level of Esrrb and Nanog, but not Oct4, uponshRNA-mediated knockdown of Esrrb. One of two independent experiments is shown. Lamin B1 is used as loading control. (C) Phase-contrast imagesof live 46C ES cell cultures 3 days after transfection of the indicated shRNA constructs. Scale bars represent 200 �m. (D) Fluorescence-activated cellsorter profiles of TNG-PS ES cells, in which the GFP open reading frame has been placed at the Nanog start codon. Knockdown of Esrrb with eitherof two shRNA constructs reduces GFP expression compared to that of the control construct. E14/T is an ES cell line lacking a GFP gene. One of twoindependent experiments is shown. (E) Luciferase reporter assays with a Nanog-promoter construct. The luciferase activity of the Nanog promoter (�2.5kb to �50 bp), cotransfected with control shRNA plasmid, is arbitrarily set at 10 and compared to the luciferase activities in the presence of either oftwo Esrrb shRNA plasmids or of the pGL-Basic control vector. Error bars represent the SEM of three independent experiments.

5990 VAN DEN BERG ET AL. MOL. CELL. BIOL.

EMSAs were performed by mixing cell lysates prepared fromindividual transfections of Oct4, Sox2, and Esrrb into 293Tcells. The addition of the Esrrb lysate caused a weak probeshift (Fig. 5D, lanes 2 and 3), showing that Esrrb alone canbind the Nanog promoter probe. However, in the presence ofOct4 and Sox2, DNA complex formation by Esrrb was en-hanced compared to DNA complex formation by Esrrb alone(Fig. 5D, compare lanes 2 and 3 to lanes 6 and 7). This effectwas greatest with both Oct4 and Sox2 present, suggesting thatan Oct4-Sox2 complex is required for this cooperative effect.Using different combinations of Esrrb, Oct4, and Sox2 lysates

leads to the same conclusions (Fig. 5D, bottom). These data,together with the Esrrb ChIP experiments (Fig. 4C and E),suggest a model (Fig. 5E) in which the presence of the Oct4-Sox2 complex bound to the Oct-Sox site in the Nanog promoterstrongly enhances the intrinsic capacity of Esrrb to bind to anERRE located upstream of the Oct-Sox site.

Esrrb binds and regulates other Oct4 target genes. To de-termine the generality of the association of Esrrb with Oct4 onOct4 target genes, we investigate a number of Oct4 targetgenes with a characterized Oct-Sox DNA element (Fig. 6A),using the ES cell line ZHBTc4. These genes all had a putative

FIG. 4. Esrrb binds to the Nanog promoter in an Oct4-dependent manner. (A) Outline of the Nanog genomic contig showing the amplicons(5�, Oct-Sox, and 3�) used in ChIP analysis and size markers in base pairs. (B) ChIP analysis of formaldehyde cross-linked 46C ES cells usingantibodies against Oct4 and Esrrb. Relative enrichments of the Nanog amplicons are depicted as enrichments over that at an unrelated region(Amylase). Oct4 binds to the Oct-Sox element, but no significant enrichment for Esrrb can be detected at this region. Error bars represent thestandard error of the mean (SEM) of two independent experiments. (C) ChIP analysis of dual cross-linked 46C ES cell chromatin showsenrichment of both Oct4 and Esrrb on the Oct-Sox element of the Nanog promoter. Error bars for Esrrb enrichments represent the SEM of twoindependent experiments. (D) Western blot analysis showing the complete depletion of Oct4 protein in ZHBTc4 ES cells after a 12-h treatmentwith 1 �g/ml doxycycline compared to that in untreated cells. Levels of Esrrb are not affected. Lamin B1 is used as a loading control. (E) Dualcross-linked chromatin from ZHBTc4 ES cells that were untreated (�Dox) or treated for 12 h with 1 �g/ml doxycycline (�Dox). Binding of Esrrbto the Oct-Sox element is no longer detected when Oct4 is absent. Error bars represent the standard error of the mean (SEM) of two independentexperiments. (F) Luciferase assays with the wt Nanog promoter construct (Nanog-wt), with the mutated Oct binding site (Nanog-mOS) or with theempty vector pGL-Basic. Cotransfected shRNA plasmids are indicated. Error bars represent the SEM of three independent experiments.

VOL. 28, 2008 Esrrb REGULATES Nanog EXPRESSION 5991

ERRE at different distances from the Oct-Sox site and indifferent orientations (Fig. 6A). XX-ChIP analysis showed thatEsrrb binds near the Oct-Sox element in the promoters ofZfp42 (Rex1) and Rest but not near the Oct-Sox site of Dppa3and Lefty1 (Fig. 6B). Interestingly, removing Oct4 from the

promoters by doxycycline treatment (Fig. 4D) prevented thedetection of Esrrb at the Rest promoter, whereas Esrrb bindingto the Zfp42 promoter was unaffected.

We next determined the contribution of Esrrb to the expres-sion of Zfp42 and Rest by Esrrb knockdown. Expression of

FIG. 5. A degenerate ERRE binds Esrrb and is important for Nanog promoter activity. (A) Representation of the degenerate ERRE upstreamof the Oct-Sox site in the Nanog promoter. The generated mutation is indicated. (B) Luciferase reporter assays with a wt Nanog promoter construct(wt ERRE) or mutated ERRE promoter construct (mut ERRE). Cotransfected shRNA plasmids are indicated. Error bars represent the standarderror of the mean of three independent experiments. (C) Cell lysates from 293T cells cotransfected with FLAG-Esrrb, Oct4, and Sox2 expressionplasmids were used in an EMSA with a 57-nucleotide Nanog promoter probe containing the Oct-Sox site sequence and a wt or mutated ERRE.Antibodies were added as indicated. The complex of Esrrb-Oct4-Sox2 (E-O-S) is indicated. (D) Cell lysates from 293T cells transfected withFLAG-Esrrb, Oct4, or Sox2 expression plasmids were subjected to EMSA using the wt Nanog promoter probe. (E) Model showing theenhancement of Esrrb binding to the Nanog promoter by Oct4 and Sox2 which positively affects Nanog promoter activity.

5992 VAN DEN BERG ET AL. MOL. CELL. BIOL.

Esrrb shRNAs caused a reduction in Zfp42 mRNA expression,whereas Rest mRNA expression was unaffected (Fig. 6C). Weconclude that Esrrb binds near the Oct-Sox sites of two otherOct4 targets, Zfp42 and Rest, but that only in the case of Zfp42does this binding contribute to its expression in ES cells.

Esrrb protein levels correlate with Nanog levels in ES cellcolonies. Oct4-positive (Oct4�) ES cell colonies express Nanogin a mosaic fashion (6, 12, 28). The cellular expression of Esrrbwas examined by immunostaining ES cells with antibodiesagainst Nanog or Esrrb. Interestingly, 46C ES cell coloniesshow a mosaic pattern of Esrrb expression within the Oct4�

population (Fig. 7A and B). Moreover, when cells are classifiedaccording to their relative high, medium, or low levels of Esrrbstaining within ES cell colonies (Fig. 7A), there is a goodcorrelation between the levels of expression of Nanog andthose of Esrrb (Fig. 7C). This correlation between the cellularlevels of Esrrb and Nanog, in combination with our Nanoggene regulation data, suggests that high Nanog expression inthe cell may be facilitated by high Esrrb expression.

DISCUSSION

Using an Oct4 protein affinity strategy, we have identifiedEsrrb as a binding partner of the Oct4 protein. A previousreport identified a number of other putative Oct4 interactingproteins but did not detect Esrrb (30). Our approach alsoidentified a number of the reported interactors in our Oct4

sample, but these were often also present in the control sam-ple. Our milder purification conditions may account for boththe reproducible and verified identification of Esrrb as a spe-cific Oct4 binding partner and the nonspecific binding of otherreported interactors. Indeed, we find that Oct4-Esrrb interac-tion is sensitive to conditions with higher levels of salt (data notshown).

Members of the estrogen-related receptor family can bind tothe palindromic 12-bp estrogen response element (25) or tothe “extended half-site” 9-bp ERRE (9, 29). Either elementcan support Esrrb-mediated transcription (17, 33). Esrrb wasalso suggested to activate targets genes independently of aDNA element by binding to transcription factors, such as Sp1(3). We show here, using ChIP and EMSAs, that Esrrb recruit-ment to the Nanog promoter requires both a degenerate, butconserved, ERRE and binding of Oct4 to the downstreamOct-Sox element. EMSAs (Fig. 5) confirm the previously re-ported synergistic binding of Oct4 and Sox2 to the Oct-Sox site(14), but also indicate that binding of Esrrb to the Nanogpromoter oligonucleotides occurs cooperatively with bindingof Oct4 and Sox2. This effect required binding of both Oct4and Sox2.

We also provide evidence that recruitment of Esrrb to theNanog promoter by Oct4 and the ERRE positively regulatesNanog expression. Depletion of Esrrb with shRNAs causedtranscriptional downregulation of the endogenous Nanog geneand a Nanog promoter-reporter. Mutation of the ERRE also

FIG. 6. Esrrb binds and regulates other Oct4 target genes. (A) The sequences surrounding the Oct-Sox motifs in the regulatory elements ofthe Nanog, Zfp42, Rest, Dppa3, and Lefty1 genes are shown with the position and orientation of the putative ERREs indicated. The distance fromthe 3� nucleotide of the shown Oct motif to the transcription start site is indicated. (B) ChIP with anti-Oct4 or anti-Esrrb antibodies on dualcross-linked chromatin isolated from ZHBTc4 cells that were either untreated (�Dx) or treated for 12 h with 1 �g/ml doxycycline (�Dx) todownregulate Oct4 expression. Enrichments over that at a negative control region (Amylase) are depicted; error bars represent standard error ofthe mean (SEM) of two independent experiments. (C) qPCR analysis of transcript levels in cells transfected with control or Esrrb shRNA. Errorbars represent SEM of two independent experiments.

VOL. 28, 2008 Esrrb REGULATES Nanog EXPRESSION 5993

had a negative effect on reporter expression, underscoring theimportance of the ERRE for the functional recruitment ofEsrrb to the Nanog promoter.

Based upon the effect of mutations within the compositeOct-Sox site upon reporter gene expression directed by theproximal Nanog promoter, Oct4 has been suggested to beimportant for maintaining Nanog expression in ES cells (14,26). However, Oct4 is not required to initiate Nanog expressionin the preimplantation embryo, since Nanog transcripts (5) arepresent in Oct4�/� morulae and early blastocysts. This appar-ent discrepancy could be due, in part, to different requirementsfor establishment versus maintenance of Nanog expression.Our data on the Esrrb requirement for Nanog expression in EScells suggest that one function of Oct4 binding to the Oct-Soxmotif is that it facilitates Esrrb binding to the Nanog promoter,which in turn promotes Nanog transcription in ES cells.

Transcriptional regulation via transcription factor interac-tions in ES cell self-renewal. Here we have provided evidenceof a stem cell factor, Oct4, directing its physical interactor,Esrrb, to a target gene, Nanog, to positively regulate transcrip-tion. Gene regulation facilitated by complexes of individualtranscription factors, like the Oct4-Esrrb complex, may bewidespread in ES cells. Visual inspection of the sequencesaround the Oct-Sox sites of a number of Oct-Sox target genes

for homology to the ERRE identified several potential Esrrbtargets that were tested for regulation by Esrrb. Of these, ChIPanalysis showed Esrrb to be detectable on Zfp42 and Rest butnot Lefty1 or Dppa3. The Oct4-independent binding of Esrrbto the Zfp42 promoter may be due to the high match of theZfp42 ERRE sequence to the consensus (8/9) (Fig. 6A), whichmay provide sufficient DNA binding affinity. The extreme prox-imity of the ERRE and Oct sites in Rest coupled with the lowmatch to the ERRE consensus (6/9) could underlie the Oct4-dependent ChIP of Esrrb at Rest. However, the ERRE inNanog is further removed from the Oct-Sox site and is a bettermatch to the consensus (7/9) than that in Rest, so there is noobvious common feature that can explain the Oct4-dependentbinding of Esrrb to each of these sequences. There is also noclear reason why the remaining two Oct-Sox targets do notbind Esrrb. A low match to the consensus could explain thelack of binding to Dppa3 (6/9). However, the consensus matchfor Lefty1 is the same as that for Nanog (7/9), suggesting thatrelative spatial disposition and/or distance could play a role.Further experimentation will be required to more deeply un-derstand the relationship of Oct4 and Esrrb binding to DNAand how this affects gene regulation.

Nanog is expressed mosaically within the Oct4� populationsin ES cell cultures (6, 12, 28). Moreover, Nanog levels fluctuate

FIG. 7. Esrrb protein levels in cells cofluctuate with Nanog protein levels. (A) Staining of ES cells with Esrrb antibody and Nanog antibody.Antibodies and DAPI staining are as indicated. Arrows point to cells that were assigned to have high (H), medium (M), or low (L) levels of Esrrbor Nanog. (B) Staining of ES cells with Esrrb antibody and Oct4 antibody. Antibodies and DAPI staining are as indicated. (C) Quantification ofthe percentage of cells that have high, medium, or low levels of Nanog or Esrrb. Error bars indicate the standard error of the mean of twoindependent experiments, in which 350 and 400 cells were assessed, respectively.

5994 VAN DEN BERG ET AL. MOL. CELL. BIOL.

in ES cell cultures such that cells expressing a low level or noNanog can reexpress a high level of Nanog. However, loweredNanog expression predisposes cells toward differentiation,without marking a commitment event (6). Here we show thatthe mosaic patterns of Esrrb and Nanog expression in ES cellcolonies largely overlap. We also show that Esrrb positivelyregulates Nanog expression. As Nanog has been reported topositively regulate Esrrb expression (16), Esrrb and Nanogmay both act to reinforce expression of the reciprocal genethrough a positive feedback loop. How this leads to mosaic andcofluctuating levels of both proteins remains to be determined.Oct4 is not obviously mosaic and appears not to fluctuate,suggesting that it is not a determining factor of fluctuations inNanog and Esrrb in ES cells. As Nanog levels and, by impli-cation, Esrrb levels regulate the self-renewal efficiency of EScells, unraveling this regulatory mechanism will be importantfor a fuller understanding of ES cell self-renewal and the main-tenance of pluripotency.

ACKNOWLEDGMENTS

We thank Hitoshi Niwa for ZHBTc4 cells, Austin Cooney for the2.5-kb Nanog promoter-luciferase construct, Paul Robson for theNanog mOS luciferase and control Nanog luciferase constructs, AustinSmith for 46C ES cells, Rodrigo Osorno for technical assistance, andFrank Grosveld for critically reading the manuscript and for helpfulsuggestions.

This work was supported by an NWO Vidi grant to the R.P. labo-ratory and by the Medical Research Council and the Biotechnologicaland Biological Sciences Research Councils of the United Kingdom,the Wellcome Trust, and the Juvenile Diabetes Research Foundation.

REFERENCES

1. Ambrosetti, D. C., C. Basilico, and L. Dailey. 1997. Synergistic activation ofthe fibroblast growth factor 4 enhancer by Sox2 and Oct-3 depends onprotein-protein interactions facilitated by a specific spatial arrangement offactor binding sites. Mol. Cell. Biol. 17:6321–6329.

2. Boyer, L. A., T. I. Lee, M. F. Cole, S. E. Johnstone, S. S. Levine, J. P. Zucker,M. G. Guenther, R. M. Kumar, H. L. Murray, R. G. Jenner, D. K. Gifford,D. A. Melton, R. Jaenisch, and R. A. Young. 2005. Core transcriptionalregulatory circuitry in human embryonic stem cells. Cell 122:947–956.

3. Castet, A., A. Herledan, S. Bonnet, S. Jalaguier, J. M. Vanacker, and V.Cavailles. 2006. Receptor-interacting protein 140 differentially regulates es-trogen receptor-related receptor transactivation depending on target genes.Mol. Endocrinol. 20:1035–1047.

4. Chambers, I. 2005. Mechanisms and factors in embryonic stem cell renewal.Rend. Fis. Acc. Lincei 16:83–97.

5. Chambers, I., D. Colby, M. Robertson, J. Nichols, S. Lee, S. Tweedie, and A.Smith. 2003. Functional expression cloning of Nanog, a pluripotency sus-taining factor in embryonic stem cells. Cell 113:643–655.

6. Chambers, I., J. Silva, D. Colby, J. Nichols, B. Nijmeijer, M. Robertson, J.Vrana, K. Jones, L. Grotewold, and A. Smith. 2007. Nanog safeguardspluripotency and mediates germline development. Nature 450:1230–1234.

7. Chew, J.-L., Y.-H. Loh, W. Zhang, X. Chen, W.-L. Tam, L.-S. Yeap, P. Li,Y.-S. Ang, B. Lim, P. Robson, and H.-H. Ng. 2005. Reciprocal transcriptionalregulation of Pou5f1 and Sox2 via the Oct4/Sox2 complex in embryonic stemcells. Mol. Cell. Biol. 25:6031–6046.

8. Dignam, J. D., R. M. Lebovitz, and R. G. Roeder. 1983. Accurate transcrip-tion initiation by RNA polymerase II in a soluble extract from isolatedmammalian nuclei. Nucleic Acids Res. 11:1475–1489.

9. Dufour, C. R., B. J. Wilson, J. M. Huss, D. P. Kelly, W. A. Alaynick, M.Downes, R. M. Evans, M. Blanchette, and V. Giguere. 2007. Genome-wideorchestration of cardiac functions by the orphan nuclear receptors ERR�and �. Cell Metab. 5:345–356.

10. Gearhart, M. D., S. M. Holmbeck, R. M. Evans, H. J. Dyson, and P. E.Wright. 2003. Monomeric complex of human orphan estrogen related re-ceptor-2 with DNA: a pseudo-dimer interface mediates extended half-siterecognition. J. Mol. Biol. 327:819–832.

11. Gu, P., D. LeMenuet, A. C.-K. Chung, M. Mancini, D. A. Wheeler, and A. J.Cooney. 2005. Orphan nuclear receptor GCNF is required for the repressionof pluripotency genes during retinoic acid-induced embryonic stem cell dif-ferentiation. Mol. Cell. Biol. 25:8507–8519.

12. Hatano, S. Y., M. Tada, H. Kimura, S. Yamaguchi, T. Kono, T. Nakano, H.

Suemori, N. Nakatsuji, and T. Tada. 2005. Pluripotential competence of cellsassociated with Nanog activity. Mech. Dev. 122:67–79.

13. Ivanova, N., R. Dobrin, R. Lu, I. Kotenko, J. Levorse, C. DeCoste, X.Schafer, Y. Lun, and I. R. Lemischka. 2006. Dissecting self-renewal in stemcells with RNA interference. Nature 442:533–538.

14. Kuroda, T., M. Tada, H. Kubota, H. Kimura, S.-Y. Hatano, H. Suemori, N.Nakatsuji, and T. Tada. 2005. Octamer and Sox elements are required fortranscriptional cis regulation of Nanog gene expression. Mol. Cell. Biol.25:2475–2485.

15. Liu, T., A. E. Tee, A. Porro, S. A. Smith, T. Dwarte, P. Y. Liu, N. Iraci, E.Sekyere, M. Haber, M. D. Norris, D. Diolaiti, G. Della Valle, G. Perini, andG. M. Marshall. 2007. Activation of tissue transglutaminase transcription byhistone deacetylase inhibition as a therapeutic approach for Myc oncogen-esis. Proc. Natl. Acad. Sci. USA. 104:18682–18687.

16. Loh, Y. H., Q. Wu, J. L. Chew, V. B. Vega, W. Zhang, X. Chen, G. Bourque,J. George, B. Leong, J. Liu, K. Y. Wong, K. W. Sung, C. W. Lee, X. D. Zhao,K. P. Chiu, L. Lipovich, V. A. Kuznetsov, P. Robson, L. W. Stanton, C. L.Wei, Y. Ruan, B. Lim, and H. H. Ng. 2006. The Oct4 and Nanog transcriptionnetwork regulates pluripotency in mouse embryonic stem cells. Nat. Genet.38:431–440.

17. Lu, D., Y. Kiriyama, K. Y. Lee, and V. Giguere. 2001. Transcriptional regu-lation of the estrogen-inducible pS2 breast cancer marker gene by the ERRfamily of orphan nuclear receptors. Cancer Res. 61:6755–6761.

18. Masui, S., Y. Nakatake, Y. Toyooka, D. Shimosato, R. Yagi, K. Takahashi, H.Okochi, A. Okuda, R. Matoba, A. A. Sharov, M. S. Ko, and H. Niwa. 2007.Pluripotency governed by Sox2 via regulation of Oct3/4 expression in mouseembryonic stem cells. Nat. Cell Biol. 9:625–635.

19. Mitsui, K., Y. Tokuzawa, H. Itoh, K. Segawa, M. Murakami, K. Takahashi,M. Maruyama, M. Maeda, and S. Yamanaka. 2003. The homeoproteinNanog is required for maintenance of pluripotency in mouse epiblast and EScells. Cell 113:631–642.

20. Mullin, N. P., A. Yates, A. J. Rowe, B. Nijmeijer, D. Colby, P. N. Barlow,M. D. Walkinshaw, and I. Chambers. 2008. The pluripotency rheostat Nanogfunctions as a dimer. Biochem. J. 411:227–231.

21. Nakatake, Y., N. Fukui, Y. Iwamatsu, S. Masui, K. Takahashi, R. Yagi, K.Yagi, J.-I. Miyazaki, R. Matoba, M. S. H. Ko, and H. Niwa. 2006. Klf4cooperates with Oct3/4 and Sox2 to activate the Lefty1 core promoter inembryonic stem cells. Mol. Cell. Biol. 26:7772–7782.

22. Niwa, H. 2007. How is pluripotency determined and maintained? Develop-ment 134:635–646.

23. Niwa, H., J. Miyazaki, and A. G. Smith. 2000. Quantitative expression ofOct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells.Nat. Genet. 24:372–376.

24. Nowak, D. E., B. Tian, and A. R. Brasier. 2005. Two-step cross-linkingmethod for identification of NF-kappaB gene network by chromatin immu-noprecipitation. BioTechniques 39:715–725.

25. Pettersson, K., K. Svensson, R. Mattsson, B. Carlsson, R. Ohlsson, and A.Berkenstam. 1996. Expression of a novel member of estrogen responseelement-binding nuclear receptors is restricted to the early stages of chorionformation during mouse embryogenesis. Mech. Dev. 54:211–223.

26. Rodda, D. J., J.-L. Chew, L.-H. Lim, Y.-H. Loh, B. Wang, H.-H. Ng, and P.Robson. 2005. Transcriptional regulation of Nanog by OCT4 and SOX2.J. Biol. Chem. 280:24731–24737.

27. Sanchez, C., I. Sanchez, J. A. Demmers, P. Rodriguez, J. Strouboulis, and M.Vidal. 2007. Proteomics analysis of Ring1B/Rnf2 interactors identifies anovel complex with the Fbxl10/Jhdm1B histone demethylase and the Bcl6interacting corepressor. Mol. Cell. Proteomics 6:820–834.

28. Singh, A. M., T. Hamazaki, K. E. Hankowski, and N. Terada. 2007. Aheterogeneous expression pattern for Nanog in embryonic stem cells. StemCells 25:2534–2542.

29. Sladek, R., J.-A. Bader, and V. Giguere. 1997. The orphan nuclear receptorestrogen-related receptor � is a transcriptional regulator of the human me-dium-chain acyl coenzyme A dehydrogenase gene. Mol. Cell. Biol. 17:5400–5409.

30. Wang, J., S. Rao, J. Chu, X. Shen, D. N. Levasseur, T. W. Theunissen, andS. H. Orkin. 2006. A protein interaction network for pluripotency of embry-onic stem cells. Nature 444:364–368.

31. Wilm, M., A. Shevchenko, T. Houthaeve, S. Breit, L. Schweigerer, T. Fotsis,and M. Mann. 1996. Femtomole sequencing of proteins from polyacrylamidegels by nano-electrospray mass spectrometry. Nature 379:466–469.

32. Wu, D. Y., and Z. Yao. 2005. Isolation and characterization of the murineNanog gene promoter. Cell Res. 15:317–324.

33. Xie, W., H. Hong, N. N. Yang, R. J. Lin, C. M. Simon, M. R. Stallcup, andR. M. Evans. 1999. Constitutive activation of transcription and binding ofcoactivator by estrogen-related receptors 1 and 2. Mol. Endocrinol. 13:2151–2162.

34. Ying, Q. L., J. Nichols, I. Chambers, and A. Smith. 2003. BMP induction ofId proteins suppresses differentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3. Cell 115:281–292.

35. Ying, Q. L., M. Stavridis, D. Griffiths, M. Li, and A. Smith. 2003. Conversionof embryonic stem cells into neuroectodermal precursors in adherent mo-noculture. Nat. Biotechnol. 21:183–186.

VOL. 28, 2008 Esrrb REGULATES Nanog EXPRESSION 5995