ORIGINAL CONTRIBUTION

Effect of acute beer ingestion on the liver: studies in female mice

Giridhar Kanuri • Sabine Wagnerberger •

Marianne Landmann • Eva Prigl • Claus Hellerbrand •

Stephan C. Bischoff • Ina Bergheim

Received: 19 November 2013 / Accepted: 3 June 2014

� Springer-Verlag Berlin Heidelberg 2014

Abstract

Purpose The aim of the present study was to assess

whether the effects of acute consumption of stout or pilsner

beer on the liver differ from those of plain ethanol in a

mouse model.

Methods Seven-week-old female C57BL/6J mice

received either ethanol, stout or pilsner beer (ethanol

content: 6 g/kg body weight) or isocaloric maltodextrin

solution. Plasma alanine transaminase, markers of steato-

sis, lipogenesis, activation of the toll-like receptor-4 sig-

naling cascade as well as lipid peroxidation and

fibrogenesis in the liver were measured 12 h after acute

ethanol or beer intake.

Results Acute alcohol ingestion caused a marked *11-

fold increase in hepatic triglyceride accumulation in com-

parison to controls, whereas in mice exposed to stout and

pilsner beer, hepatic triglyceride levels were increased only

by *6.5- and *4-fold, respectively. mRNA expression of

sterol regulatory element-binding protein 1c and fatty acid

synthase in the liver did not differ between alcohol and

beer groups. In contrast, expression of myeloid differenti-

ation primary response gene 88, inducible nitric oxide

synthases, but also the concentrations of 4-hydroxynonenal

protein adducts, nuclear factor jB and plasminogen acti-

vator inhibitor-1 were induced in livers of ethanol treated

mice but not in those exposed to the two beers.

Conclusion Taken together, our results suggest that acute

ingestion of beer and herein especially of pilsner beer is

less harmful to the liver than the ingestion of plain ethanol.

Keywords Alcohol � Beer � Female sex � iNOS � Liver

Abbreviations

ALD Alcoholic liver disease

ALT Alanine aminotransferase

FAS Fatty acid synthase

4-HNE 4-Hydroxynonenal

HGF Hepatocate growth factor

iNOS Inducible nitric oxide synthase

MyD88 Myeloid differentiation primary response 88

NFjB Nuclear factor kappa B

PAI-1 Plasminogen activator inhibitor 1

ROS Reactive oxygen species

aSMA a Smooth muscle actin

SREBP-1c Sterol regulatory element-binding protein 1c

TGFb Transforming growth factor bTLR-4 Toll-like receptor 4

TNF a Tumor necrosis factor a

Giridhar Kanuri and Sabine Wagnerberger have contributed equally

to this work.

Electronic supplementary material The online version of thisarticle (doi:10.1007/s00394-014-0730-z) contains supplementarymaterial, which is available to authorized users.

G. Kanuri � M. Landmann � I. Bergheim (&)

Department of Nutritional Sciences, Model Systems

of Molecular Nutrition, Friedrich-Schiller-University Jena,

Dornburger Str. 25, 07743 Jena, Germany

e-mail: ina.bergheim@uni-jena.de

S. Wagnerberger � E. Prigl � S. C. Bischoff

Department of Nutritional Medicine (180a), University

of Hohenheim, Stuttgart, Germany

C. Hellerbrand

Department of Internal Medicine I, University Hospital

Regensburg, Regensburg, Germany

123

Eur J Nutr

DOI 10.1007/s00394-014-0730-z

Introduction

Worldwide beer is one of the most consumed alcoholic

beverages. Results of several studies suggest that mod-

erate consumption of alcoholic drinks such as beer may

reduce mortality (e.g., coronary heart disease, for over-

view see [1]); however, mechanisms involved in the

potential beneficial effect of moderate beer consumption

remain to be determined. Besides containing carbohy-

drates, amino acids and vitamins, beer is rich in non-

nutrient compounds such as phenolic acid. Indeed, some

beer constituents are even discussed to modulate car-

cinogen metabolism, to induce apoptosis and to possess

an anti-oxidative and anti-inflammatory capacity as

summarized by Gerhauser [2]. Furthermore, results of

Martinez Alvarez et al. [3] and Valls-Belles et al. [4]

suggest that alcohol-free beer may have beneficial effects

on liver and heart. In support of these findings, it has

been shown that beer constituents such as xanthohumol

may have inhibitory effects on hepatic inflammation and

fibrosis [5, 6]. However, in most of these studies, beer

constituents were either given isolated (e.g., only the hop

derived polyphenol xanthohumol) at concentrations that

could most of the time not be reached by moderate or

even elevated beer consumption or results stem from

in vitro experiments.

It has been shown that both acute and chronic alcohol

consumption can cause increased intestinal translocation

of bacterial endotoxin [7, 8], subsequently leading to an

activation of hepatic Kupffer cells and lipid accumula-

tion (for review see [9]). It further has been shown that

women have an increased susceptibility to alcoholic liver

disease compared to men (for overview see [10]). For

example, results of animal studies suggest that estrogen

may be a critical factor for the higher susceptibility of

female mice to alcohol due to an increased intestinal

permeability and subsequently higher plasma endotoxin

levels [11], but also an increased endotoxin sensitivity of

Kupffer cells in the liver [12]. If female mice respond

differently to different alcoholic beverages has not yet

been clarified.

Mouse models of acute alcohol ingestion have been

shown before by us [13] and others [8] to resemble many

pathological changes found in the early onset of alcoholic

liver disease, e.g., activation of nuclear factor kappa B

(NFjB), increased release of plasmin activator inhibitor

(PAI)-1, increased formation of reactive oxygen species

(ROS) but also increased translocation of bacterial endo-

toxin from the gut [14, 15]. The aim of the present study

was to test in a mouse model of acute alcohol ingestion if

the effects of an acute exposure to beer on the liver differ

from that of plain ethanol and if so, to identify underlying

mechanisms.

Materials and methods

Animals and treatments

Seven-week-old female C57BL/6J mice (Janvier S.A.S,

Le-Genest-St-Isle, France) were housed in a pathogen-free

barrier facility accredited by the Association for Assess-

ment and Accreditation of Laboratory Animal Care and

had free access to food and tap water. Procedures were

approved by the local Institutional Animal Care and Use

Committee (V277/10EM). On the day of the experiment,

mice received one single dose (oral gavage, WDT, Ger-

many) of either isocaloric and isoalcoholic (6 g ethanol/kg

body weight) ethanol solution, stout (S) or pilsner beer

(P) (both beers were generous gifts of Kulmbacher Brau-

erei AG, Germany) or isocaloric maltodextrin solution in-

tragastrically (for composition see Online Resource 1).

This dose of ethanol was based on previous work of our

group [14]. As alcohol concentration in beer was too low to

achieve concentration of 6 g/kg body weight with volumes

tolerated by mice, beers were enriched with 96 % v/v plain

ethanol so that alcohol content of beers was 20 % v/v.

Furthermore, not only plain ethanol solution but also pilsner

beer was enriched with glucose to adjust calories to those of

stout beer. With this dose of alcohol, which did not cause

mortality, mice were sluggish but conscious and regained

normal behaviour within *6 h after alcohol exposure. Dur-

ing the first 30 min after alcohol or beer exposure, behaviour

of animals was closely monitored and then at least every

30 min until mice were killed. Animals were anesthetized

with 80 mg ketamine and 6 mg xylazin/kg body weight i.p.

12 h after ethanol, beer or maltodextrin exposure and portions

of liver tissue were frozen immediately in liquid nitrogen,

while others were fixed in neutral-buffered formalin or fro-

zen-fixed in OCT mounting media (medite, Germany) for

later sectioning and mounting on microscope slides.

Cell culture and treatment

Murine RAW 264.7 macrophages cells (mouse leukemic

monocyte macrophage cell line, American Type Culture

Collection, USA), no more than 70 % confluent, were pre-

incubated with isocaloric (0.949 kcal/ml) and isoalcoholic

(1.092 %) stout, pilsner beer, ethanol or glucose enriched

culture medium (control) for 1 h. Medium was subse-

quently removed and replaced with fresh serum-free

medium containing 50 ng lipopolysaccharide (LPS)/ ml

Eur J Nutr

123

media (Sigma, Germany). Cells were incubated for 1 h in a

vapor chamber (for details see [16]) in the presence of

alcohol or beer containing media. Cells were rinsed with

phosphate buffered saline and incubated with fresh DMEM

media containing BSA for 18 h. Finally, the cells were

rinsed with phosphate buffered saline and lysed with Tri-

fast (PEQLAB, Germany) for RNA isolation.

RNA isolation and real-time RT-PCR

For the detection of fatty acid synthase (FAS), sterol regu-

latory element-binding protein (SREBP) 1c, tumor necrosis

factor (TNF) a, inducible nitric oxide synthase (iNOS),

myeloid differentiation factor 88 (MyD88) and 18S RNA

was isolated, reverse transcribed and relative mRNA

expression was quantified using an iCycler (Bio-Rad Labo-

ratories, Germany) as described previously [17]. The com-

parative CT method was used to determine the amount of the

target gene, normalized to an endogenous reference (18S)

and relative to a calibrator (2�DDCt ). For the detection of a-

smooth muscle actin (aSMA) in liver tissue, quantitative

real-time-PCR was performed applying LightCycler tech-

nology (Roche, Germany) as described [5]. Transforming

growth factor (TGF)-b mRNA expression analysis was

performed using QuantiTect Primer Assays according to the

manufacturer’s instructions (Qiagen, Germany) [5]. Ampli-

fication of cDNA derived from 18S rRNA was used for

normalization. All primer sequences are listed in Table 1.

Hepatic triglyceride determination and lipid staining

Hepatic triglycerides were isolated and measured as pre-

viously detailed [13]. Frozen sections of liver (10 lm)

were stained with Oil Red O (Sigma, Germany) for 10 min

and counter stained with hematoxylin (Sigma, Germany)

for 45 s as described previously [13]. Representative pic-

tures of the Oil Red O staining at 4009 magnification were

taken using a Zeiss microscope (Leica DM4000 B LED,

Leica, Germany).

Activity of alanine aminotransferase (ALT) in plasma

Levels of ALT were measured in heparinized plasma using

a commercially available kit (Bioo Scientific, USA).

PAI-1, NFjB and TNFa enzyme-linked

immunosorbent assay (ELISA)

Using a commercially available ELISA kit, PAI-1 levels

were measured in whole liver lysates (Alpco Diagnostics,

USA). Nuclear factor kappa B (NFjB) levels were

determined in nuclear extracts of liver lysates using a

Trans AMTM ELISA kit (Active Motif, USA). TNFaprotein levels were determined using a mouse TNF a kit

from LOXO (LOXO GmbH, Germany).

Immunohistochemical staining for 4-hydroxynonenal

(4-HNE) protein adducts as well as MyD88 protein

and Sirius Red/Fast Green staining

4-HNE protein adducts staining as well as MyD88 pro-

tein staining were performed as previously described [18]

using a polyclonal primary antibody (AG Scientific, USA

for 4-HNE; Santa Cruz Biotechnology, Germany for

MyD88). Accumulation of extracellular matrix in liver

sections was determined by staining sections with Sirius

Red/Fast Green as described by others [19]. The extent

of staining in a liver lobule was defined as percent of the

field area within the default colour range determined by

the software using an image acquisition and analysis

system incorporated in the microscope (Leica DM4000 B

LED, Leica, Germany). Data from eight fields (2009) of

each tissue section were used to determine means. All

sections used for staining were prepared in parallel, and

sections for densitometric analyses were stained at the

same time. Furthermore, analyses were performed

simultaneously.

Table 1 Primer sequences used

for iCycler PCR and

LightCycler PCR

Forward (50–30) Reverse (50–30)

FAS GGGGGTGGGAGGACAGAGAT CACATGGGCTGACAGCTTGG

SREBP-1c ACCGGCTACTGCTGGACTGC AGAGCAAGAGGGTGCCATCG

TNFa CCAGGCGGTGCCTATGTCTC CAGCCACTCCAGCTGCTCCT

iNOS AATGGCAACATCAGGTCGGCCATCACT GCTGTGTGTCACAGAAGTCTCGAACTC

MyD88 CAAAAGTGGGGTGCCTTTGC AAATCCACAGTGCCCCCAGA

aSMA CTGACAGAGGCACCACTGAA CATCTCCCAGAGTCAGCACA

18S

(iCycler)

GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG

18S (Light

Cycler)

AAACGGCTACCACATCCAAG CCTCCAATGGATCCTCGTTA

Eur J Nutr

123

Western blot

Liver tissue was homogenized in a lysis buffer (1 M

HEPES, 1 M MgCl2, 2 M KCl, 1 M DTT) to prepare

cytosolic protein lysates. Proteins were separated in an 8 %

sodium dodecyl sulfate (SDS)-polyacrylamide gel. Proteins

were transferred onto Hybond-P polyvinylidene difluoride

membranes (Amersham Biosciences, Germany), and blots

were then probed with antibodies against aSMA, b-Actin,

pIjBa and IjB, respectively (all Cell Signaling Technol-

ogy, USA). Bands were visualized using a Super Signal

Western Dura kit (Thermo Scientific, Rockford, IL). To

ensure equal loading, all blots were stained with Ponceau

red. Protein bands were densitometrically analyzed using

the software Image Lab 5.0 (BioRad, USA).

Statistical analysis

Data are expressed as means ± SEM. One-way ANOVA with

Tukey’s post hoc test was used to determine the statistical

differences between the treatment groups. Post hoc tests were

conducted when the means were significantly different in one-

way ANOVA. A p value\0.05 was considered to be signifi-

cant. Grubbs test was used to identify outliers.

Results

Plasma alcohol levels and hepatic lipid accumulation

as well as markers of lipogenesis 12 h after acute beer

exposure

Both, acute ingestion of ethanol or the beers caused marked

signs of drunkenness in animals within *10–20 min. After

6–8 h, mice regained their normal behaviour, and after 12 h,

no differences in behaviour were observed between alcohol

and maltodextrin treated groups. Acute ingestion of ethanol

caused a significant accumulation of triglycerides (?11-

fold) in the liver in comparison to controls (Fig. 1b). In

contrast, triglyceride levels in livers of mice exposed to stout

and pilsner beer were only elevated by*6.5-fold (p \ 0.05)

and *3.9-fold (n.s), respectively, in comparison to controls.

Similar results were also found when liver sections were

stained with Oil Red O (Fig. 1a). ALT levels in plasma were

significantly higher in mice exposed to ethanol or the beers;

however, as alcohol was only given once and levels varied

considerably between groups, differences did not reach the

level of significance (Table 2). Treatment with ethanol, stout

or pilsner beer caused a significant decrease in mRNA

expression of SREBP-1c in the liver in comparison to con-

trols but did not differ between the ethanol and beer treated

groups. Similar results were also found for hepatic FAS

mRNA expression; however, as expression levels varied

considerably between animals, differences did not reach the

level of significance (Table 2).

Expression of MyD88 and iNOS, concentration of

4-HNE protein adducts, and NFjB activity as well

as TNFa protein in the liver 12 h after acute beer exposure

Acute ingestion of ethanol was associated with an *2.9-

fold induction of MyD88 mRNA expression in the liver in

comparison to controls (Fig. 2b). Similar results were also

Fig. 1 Effect of acute ethanol (EtOH), stout (S) or pilsner beer

(P) ingestion on hepatic lipid accumulation. a Representative pho-

tomicrographs of Oil Red O staining of liver sections (9400).

b Quantification of hepatic triglyceride content. Data are expressed as

mean ± SEM (n = 4–6 per group). ap \ 0.05 compared with mice

exposed to maltodextrin solution (C). bp \ 0.05 compared with mice

exposed to pilsner beer

Eur J Nutr

123

found when staining liver sections for MyD88 protein

(Fig. 2a, c). This was also associated with significantly

higher levels of 4-HNE protein adducts (*3.2-fold,

p \ 0.001; Fig. 2a, d), iNOS mRNA expression (*3.4-

fold, p \ 0.05; Fig. 3a), and NFjB activity (*2.8-fold,

p \ 0.05; Fig. 3b) in livers of ethanol treated mice com-

pared to controls. In contrast, in livers of mice treated with

stout or pilsner beer, expression of MyD88, formation of

4-HNE protein adducts (Fig. 2a–e) and iNOS mRNA

expression as well as NFjB activity (Fig. 3a, b) were

almost at the level of control animals. Levels of pIjBa did

not differ between groups; however, data varied consider-

ably between groups (Online Resource 3). In contrast,

TNFa protein concentration was significantly higher in

livers of mice exposed to pilsner in comparison to control

mice and those exposed to plain ethanol (Fig. 3c).

Protein concentration of active PAI-1 and expression

of markers of fibrogenesis in liver 12 h after beer

ingestion

Acute ingestion of ethanol led to an *1.6-fold increase of

active PAI-1 protein in the liver in comparison to control

animals (p \ 0.05; Fig. 3d). A similar effect was not found

when determining PAI-1 protein concentration in livers of

mice treated with stout or pilsner beer.

To evaluate if the acute intake of ethanol or the two

beers had an effect on markers of hepatic fibrogenesis,

mRNA and protein levels of aSMA, as well as mRNA

expression of TGFb but also extracellular matrix accu-

mulation were determined in livers of ethanol or beer

treated mice. Protein levels and mRNA of aSMA did not

differ between groups (Table 2 and Online Resource 2c).

Similar results were also found for mRNA expression of

TGFb and when staining extracellular matrix with Sirius

Red (Table 2 and Online Resource 2a and b).

Effect of ethanol or beer on RAW 264.7 cells

stimulated with lipopolysaccharides (LPS)

To further delineate if the effects found in vivo on the liver

may have resulted from a protection of Kupffer cells

against the LPS-induced activation of the toll-like receptor

(TLR)-4- and MyD88-dependent signaling pathways,

RAW 264.7 cells, a cell line repeatedly been used as a

model of Kupffer cells by us and other groups [13, 20],

were stimulated with LPS in the presence or absence of

ethanol, stout or pilsner beer. As expected, in RAW 264.7

cells challenged with LPS alone, mRNA expression of

MyD88, iNOS, and TNFa was markedly induced when

compared to untreated cells (Fig. 4). The concomitant

treatment of cells with ethanol and LPS enhanced the

effects found for treatment with LPS alone and led to a

more pronounced induction of MyD88 (?*2.2-fold,

p \ 0.001), iNOS (?*4.5-fold, p \ 0.05) and TNFa(?*2.9-fold, n.s.) mRNA expression in comparison to

cells only incubated with glucose (Fig. 4). Interestingly,

treatment with pilsner beer almost completely attenuated

the effects of LPS on cells with expression of MyD88,

iNOS and TNFa almost being at the level of controls in

these cells. In contrast, a similar protective effect was not

found in cells treated with stout beer. Specifically, the

expression of MyD88, iNOS and TNFa in these cells was

at the levels of those cells treated with LPS ± ethanol.

Discussion

Results from animal and in vitro studies suggest that beer

and secondary plant compounds (e.g., xanthohumol) may

have beneficial effects on the development of several dis-

eases [2, 5, 21]. However, in most studies, investigating the

effects of beer and its compounds either concentrations that

cannot be reached with a ‘‘normal’’ beer intake were

administrated, beer was given chronically or alcohol-free

beer was used. Therefore, to date, if the intake of plain

ethanol or different kinds of beer (e.g., pilsner vs. stout

beer) has a different impact on the liver has not yet been

clarified. In the present study, a mouse model of an acute

alcohol binge consisting of one single dose of plain etha-

nol, stout or pilsner beer (6 g alcohol/kg body weight, oral

gavage), respectively, was used to investigate if differences

in the pathogenesis of hepatic steatosis after acute ethanol

and beer ingestion exist. Studies have shown that acute

ingestion of a binge of ethanol can lead to endotoxemia and

induction of PAI-1 in the liver of rodents similar to what is

Table 2 Effect of acute ethanol or beer ingestion on plasma ALT

levels and markers of lipid metabolism and fibrogenesis in the liver

Control Ethanol Stout Pilsner

ALT (U/L) 6.6 ± 0.6 10.5 ± 2.3 10.6 ± 2.3 8.1 ± 0.9

SREBP-1c

(-fold

induction)

40.4 ± 7.0 9.8 ± 3.9a 8.2 ± 2.0a 2.6 ± 1.1a

FAS (-fold

induction)

15.9 ± 6.2 5.4 ± 1.1 6.1 ± 1.9 2.1 ± 0.3

aSMA (-fold

induction)

1.0 ± 0.3 5.5 ± 2.9 3.9 ± 1.6 1.5 ± 0.8

TGFb (-fold

induction)

1.0 ± 0.1 1.5 ± 0.2 2.1 ± 0.5 1.2 ± 0.1

ALT levels were measured in heparinized plasma. Relative mRNA

expression of SREBP-1c, FAS, aSMA and TGFb normalized to the

housekeeping gen 18S. Values represent mean ± SEM (n = 4–6 per

group)a p \ 0.05 compared with control mice fed with maltose-dextrin

solution

Eur J Nutr

123

Eur J Nutr

123

found in models of chronic ethanol ingestion [8, 14, 15]

indicating that both acute and chronic ALD may at least in

part originate from similar molecular alterations (e.g.,

increased translocation of bacterial endotoxin from the gut,

activation of TLR-4-dependent signaling cascades in the

liver and induction of proinflammatory cytokines). Models

of acute alcohol exposure by no means resemble all effects

of chronic alcohol consumption on the liver; however,

acute alcohol exposure models can be used to test possible

therapeutic interventions [13, 14].

As expected, 12 h after acute ethanol exposure a sig-

nificant accumulation of lipids and triglycerides in livers as

well as a higher ALT activity in plasma were found in mice

exposed to ethanol only. In contrast, steatosis was mark-

edly less prominent in livers of mice exposed to stout and

pilsner beer although the ingested amounts of ethanol and

total calories did not differ between ethanol and beer

treated mice 12 h after acute exposure. Furthermore, we

observed no differences in behaviour following ethanol or

beer exposure between groups, suggesting that ethanol

absorption and metabolism was similar between ethanol

and beer treated groups. The less damaging effects of beer

on the liver were less prominent in animals exposed to

stout and were associated with a marked protection against

the induction of PAI-1, an acute phase protein shown

before to be involved through HGF/c-Met-dependent

Fig. 3 Effect of acute ethanol

(EtOH), stout (S) or pilsner beer

(P) ingestion on the hepatic

mRNA expression of the

inducible nitrogen oxide

synthase (iNOS), nuclear factor

kappa B (NFjB) activity, tumor

necrosis factor (TNF)aexpression and plasminogen

activator inhibitor (PAI)-1

protein levels. a Hepatic iNOS

mRNA expression normalized

to 18S mRNA expression, and

b NFjB p65 activity. c TNFaprotein expression and d PAI-1

protein levels in the liver. Data

are expressed as means ± SEM

(n = 4–6 per group). ap \ 0.05

compared with mice exposed to

maltodextrin (C). bp \ 0.05

compared with mice exposed to

pilsner beer

b Fig. 2 Effect of acute ethanol (EtOH), stout (S) or pilsner beer

(P) ingestion on hepatic myeloid differentiation factor 88 (MyD88)

and 4-hydroxynonenal (4-HNE) protein adducts panel a shows

representative photos of MyD88 protein as well as 4-HNE protein

adduct staining in the liver and quantitative analysis of the staining

c for MyD88 and d for 4-HNE protein adducts. b Hepatic MyD88

mRNA expression normalized to 18S mRNA expression. Data are

expressed as mean ± SEM (n = 5–6 per group). ap \ 0.05 compared

with mice exposed to maltodextrin solution (C). bp \ 0.05 compared

with mice exposed to pilsner beer. cp \ 0.05 compared with mice

exposed to stout

Eur J Nutr

123

pathways in the regulation of hepatic triglyceride export

[14, 22, 23]. However, no marked effects of the different

alcoholic beverages were found on markers of fibrosis.

Taken together, these data suggest that the acute ingestion

of beer and herein especially pilsner beer may have a less

harmful effect on the development of liver damage than

plain ethanol. These data, however, by no means preclude

that the long-term chronic ingestion of beer may lead,

similar to hard spirits, to the development of end stage liver

disease. As only behaviour and not blood alcohol levels

were monitored, it cannot be ruled out, that the different

alcoholic beverages might have had an effect on gastric

emptying subsequently leading to differences in the blood

alcohol content and fat accumulation in the liver; this will

have to be addressed in future studies. However, animals of

the different alcohol groups appeared similarly drunk.

SREBP-1c is known to be a transcription factor that

controls biosynthesis of fatty acids and triglycerides in the

liver. Overproduction of SREBP-1c may cause an up-reg-

ulation of the expression of lipogenic enzymes such as FAS

subsequently leading to the development of fatty liver (for

overview see [24]). Indeed, in a mouse model of chronic

ethanol ingestion, it has been shown that ethanol exposure

leads to an increase of the mature form of SREBP-1c

protein and expression of its target lipogenic genes [25]. In

a study performed by Ji et al. [26], SREBP-1c null mice fed

with ethanol by intragastric infusion for 4 weeks had lower

hepatic triglyceride concentrations than wild-type mice,

further suggesting that SREBP-1c may be critical in the

pathogenesis of chronic alcohol-induced liver steatosis.

Somewhat contrary to the results of others, in the present

study, acute ingestion of alcohol (beer or plain ethanol) led

to a decrease in mRNA expression of SREBP-1c and FAS

in the liver. Differences between the results of others [25,

26] and the present study may have resulted from the dif-

ferent models of alcohol exposure (chronic vs. acute eth-

anol ingestion). However, our findings are in line with

those of Wada et al. [27] who also found a decrease of

SREBP-1c and FAS expression in the liver 12 h after the

exposure to ethanol. Furthermore, in earlier studies of our

own group [14], we also found no changes in livers of mice

exposed acutely to ethanol in SREBP-1c protein levels in

nuclear extracts. Taken together, our data suggest that

cFig. 4 Effect of ethanol (EtOH), stout (S) or pilsner beer (P) on

RAW 264.7 cells stimulated with lipopolysaccharide (LPS). a Relative

mRNA expression (% of control) of MyD88, b iNOS and c TNF a in

RAW 264.7 cells, normalized to 18S mRNA expression. Values

represent means ± SEM (experiments were repeated 5–6 times).ap \ 0.05 compared with control cells treated with glucose (C).bp \ 0.05 compared with cells concomitantly treated with pilsner

beer and LPS

Eur J Nutr

123

alterations at the level of SREBP-1c and FAS may not have

been involved in the less harmful effect of beer ingestion

on the liver found in the present study.

Earlier studies of our own and other groups suggest that

an increased gut permeability [28, 29], translocation of

intestinal bacterial endotoxin [30], and an activation of

TLR-4-dependent signaling cascades (e.g., MyD88-depen-

dent) [13] are involved in the development of acute and

even more so chronic alcohol-induced liver damage [31].

Indeed, results of Kanuri et al. [13] and McKim et al. [32]

suggest that MyD88 and iNOS are key mediators in alcohol-

induced liver steatosis. In the present study, 12 h after acute

alcohol or beer exposure, protein and mRNA levels of

MyD88 and iNOS mRNA in the liver were significantly

induced in ethanol treated mice, whereas a similar effect

was not found in livers of mice exposed to stout or pilsner

beer. Furthermore, in line with these findings but also those

of other groups using models of chronic ALD (for overview

see [9]), levels of 4-HNE protein adducts being a marker of

lipid peroxidation, were also found to be significantly

induced in livers of animals exposed to plain ethanol but not

in those exposed to the beers. An antioxidative effect of

beer has been reported before by Martinez Alvarez [3], who

used alcohol-free beer in their studies. It has been suggested

by the results of Yin et al. [33] using an enteral ethanol

feeding model that an activation of the redox-sensitive

NFjB is also critical in the development of ALD. In the

present study, the ethanol induced translocation of NFjB

into the nucleus was significantly attenuated in mice

exposed to pilsner beer and to a lesser extent also in livers of

mice exposed to stout beer. As levels varied considerably

between groups, a similar effect was not found for pIjB

being the inhibitor of NFjB. Somewhat contrary to the

results found when measuring NFjB, TNFa protein levels

were only markedly higher in livers of mice exposed to

pilsner. The lack of induction of TNFa in livers of mice

exposed to plain ethanol might have resulted from the time-

dependent regulation of TNFa showed before in in vitro

experiments by others [34, 35]. Mechanisms but also sub-

sequent effects of the induction of TNFa in livers of mice

challenged with pilsner beer need to be determined in future

studies. In line with these findings of the in vivo studies,

LPS-induced mRNA expression of MyD88, iNOS and

TNFa in RAW 264.7 cells was markedly attenuated in cells

treated with pilsner beer. When interpreting the results of

the in vitro studies, despite being in line with those found

in vivo, it has to be kept in mind, that in the present study a

model of Kupffer cells, e.g., RAW264.7 cells was used.

Furthermore, under physiological conditions, liver cells are

not exposed to ‘‘whole’’ beer, as beer needs to pass the

intestine and intestinal barrier first. Nevertheless, these data

suggest that compounds found in beer, be it hops compo-

nents or others, may affect the inflammatory responses in

macrophages after an LPS challenge. Somewhat surpris-

ingly, similar effects were not found for stout beer in our

in vitro experiments suggesting that the molecular mecha-

nisms involved in the ‘‘protective’’ effects of the two beers

against the development of acute alcohol-induced liver

steatosis may differ. Further studies will have to determine

(1) the compounds in pilsner beer responsible for the pro-

tection against LPS-induced RAW 264.7 cell activation but

liver steatosis found in mice, (e.g., whether its compounds

derived from hops, barley or even yeast) and (2) molecular

mechanisms involved in the protective or less damaging

effects of stout. Nevertheless, these data suggest that in an

acute setting of alcohol exposure, ingestion of beer is not

associated with a marked activation of TLR-4- and NFjB-

dependent pathways in the liver.

In summary, the results of the present study suggest that

in mice acute ingestion of beer, and herein especially of

pilsner beer, may be less harmful on the liver than the

ingestion of plain ethanol. Our data further suggest that the

less damaging effect of beer may results from an attenua-

tion of the alcohol-dependent induction of TLR4-depen-

dent signaling pathways in the liver. However, further

studies will be needed to identify the beer constituents

responsible for the less harmful effect of beer on the

development of acute alcohol-induced liver steatosis and to

determine whether similar effects are also found in humans

and under chronic conditions.

Acknowledgments Supported by ‘‘Wissenschaftsforderung der

Deutschen Brauwirtschaft e.V. (B101)’’. Beer was kindly provided by

Kulmbacher Brauerei AG, Germany.

Conflict of interest The authors declare that they have no conflict

of interest.

References

1. Rimm EB, Klatsky A, Grobbee D, Stampfer MJ (1996) Review of

moderate alcohol consumption and reduced risk of coronary heart

disease: is the effect due to beer, wine, or spirits. BMJ

312:731–736

2. Gerhauser C (2005) Beer constituents as potential cancer che-

mopreventive agents. Eur J Cancer 41:1941–1954

3. Martinez Alvarez JR, Belles VV, Lopez-Jaen AB, Marin AV,

Codoner-Franch P (2009) Effects of alcohol-free beer on lipid

profile and parameters of oxidative stress and inflammation in

elderly women. Nutrition 25:182–187

4. Valls-Belles V, Torres MC, Boix L, Muniz P, Gonzalez-Sanjose

ML, Codoner-Franch P (2008) alpha-Tocopherol, MDA–HNE

and 8-OHdG levels in liver and heart mitochondria of adriamy-

cin-treated rats fed with alcohol-free beer. Toxicology

249:97–101

5. Dorn C, Kraus B, Motyl M, Weiss TS, Gehrig M, Scholmerich J,

Heilmann J, Hellerbrand C (2010) Xanthohumol, a chalcon

derived from hops, inhibits hepatic inflammation and fibrosis.

Mol Nutr Food Res 54(Suppl 2):S205–S213

Eur J Nutr

123

6. Saugspier M, Dorn C, Thasler WE, Gehrig M, Heilmann J,

Hellerbrand C (2012) Hop bitter acids exhibit anti-fibrogenic

effects on hepatic stellate cells in vitro. Exp Mol Pathol

92:222–228

7. Mathurin P, Deng QG, Keshavarzian A, Choudhary S, Holmes

EW, Tsukamoto H (2000) Exacerbation of alcoholic liver injury

by enteral endotoxin in rats. Hepatology 32:1008–1017

8. Rivera CA, Bradford BU, Seabra V, Thurman RG (1998) Role of

endotoxin in the hypermetabolic state after acute ethanol expo-

sure. Am J Physiol 275:G1252–G1258

9. Arteel GE (2003) Oxidants and antioxidants in alcohol-induced

liver disease. Gastroenterology 124:778–790

10. Eagon PK (2010) Alcoholic liver injury: influence of gender and

hormones. World J Gastroenterol 16:1377–1384

11. Yin M, Ikejima K, Wheeler MD, Bradford BU, Seabra V, Forman

DT, Sato N, Thurman RG (2000) Estrogen is involved in early

alcohol-induced liver injury in a rat enteral feeding model.

Hepatology 31:117–123

12. Ikejima K, Enomoto N, Iimuro Y, Ikejima A, Fang D, Xu J,

Forman DT, Brenner DA, Thurman RG (1998) Estrogen increa-

ses sensitivity of hepatic Kupffer cells to endotoxin. Am J Physiol

274:G669–G676

13. Kanuri G, Weber S, Volynets V, Spruss A, Bischoff SC, Berg-

heim I (2009) Cinnamon extract protects against acute alcohol-

induced liver steatosis in mice. J Nutr 139:482–487

14. Bergheim I, Guo L, Davis MA, Lambert JC, Beier JI, Duveau I,

Luyendyk JP, Roth RA, Arteel GE (2006) Metformin prevents

alcohol-induced liver injury in the mouse: critical role of plas-

minogen activator inhibitor-1. Gastroenterology 130:2099–2112

15. Enomoto N, Ikejima K, Bradford B, Rivera C, Kono H, Brenner

DA, Thurman RG (1998) Alcohol causes both tolerance and

sensitization of rat Kupffer cells via mechanisms dependent on

endotoxin. Gastroenterology 115:443–451

16. Rodriguez FD, Simonsson P, Alling C (1992) A method for

maintaining constant ethanol concentrations in cell culture media.

Alcohol Alcohol 27:309–313

17. Wagnerberger S, Spruss A, Kanuri G, Volynets V, Stahl C,

Bischoff SC, Bergheim I (2012) Toll-like receptors 1–9 are ele-

vated in livers with fructose-induced hepatic steatosis. Br J Nutr

107:1727–1738

18. Spruss A, Kanuri G, Wagnerberger S, Haub S, Bischoff SC,

Bergheim I (2009) Toll-like receptor 4 is involved in the devel-

opment of fructose-induced hepatic steatosis in mice. Hepatology

50:1094–1104

19. Lopez-De LA, Rojkind M (1985) A simple micromethod for

collagen and total protein determination in formalin-fixed paraf-

fin-embedded sections. J Histochem Cytochem 33:737–743

20. Park SY, Baik YH, Cho JH, Kim S, Lee KS, Han JS (2008)

Inhibition of lipopolysaccharide-induced nitric oxide synthesis by

nicotine through S6K1-p42/44 MAPK pathway and STAT3 (Ser

727) phosphorylation in Raw 264.7 cells. Cytokine 44:126–134

21. Stevens JF, Page JE (2004) Xanthohumol and related prenylfl-

avonoids from hops and beer: to your good health! Phytochem-

istry 65:1317–1330

22. Sugimoto T, Yamashita S, Ishigami M, Sakai N, Hirano K, Ta-

hara M, Matsumoto K, Nakamura T, Matsuzawa Y (2002)

Decreased microsomal triglyceride transfer protein activity

contributes to initiation of alcoholic liver steatosis in rats.

J Hepatol 36:157–162

23. Tomita K, Azuma T, Kitamura N, Nishida J, Tamiya G, Oka A,

Inokuchi S, Nishimura T, Suematsu M, Ishii H (2004) Pioglit-

azone prevents alcohol-induced fatty liver in rats through up-

regulation of c-Met. Gastroenterology 126:873–885

24. Shimano H (2007) SREBP-1c and TFE3, energy transcription

factors that regulate hepatic insulin signaling. J Mol Med (Berl)

85:437–444

25. You M, Fischer M, Deeg MA, Crabb DW (2002) Ethanol induces

fatty acid synthesis pathways by activation of sterol regulatory

element-binding protein (SREBP). J Biol Chem 277:

29342–29347

26. Ji C, Chan C, Kaplowitz N (2006) Predominant role of sterol

response element binding proteins (SREBP) lipogenic pathways

in hepatic steatosis in the murine intragastric ethanol feeding

model. J Hepatol 45:717–724

27. Wada S, Yamazaki T, Kawano Y, Miura S, Ezaki O (2008) Fish

oil fed prior to ethanol administration prevents acute ethanol-

induced fatty liver in mice. J Hepatol 49:441–450

28. Bode C, Vollmer E, Hug J, Bode JC (1991) Increased perme-

ability of the gut to polyethylene glycol and dextran in rats fed

alcohol. Ann N Y Acad Sci 625:837–840

29. Parlesak A, Schafer C, Schutz T, Bode JC, Bode C (2000)

Increased intestinal permeability to macromolecules and endo-

toxemia in patients with chronic alcohol abuse in different stages

of alcohol-induced liver disease. J Hepatol 32:742–747

30. Bode C, Kugler V, Bode JC (1987) Endotoxemia in patients with

alcoholic and non-alcoholic cirrhosis and in subjects with no

evidence of chronic liver disease following acute alcohol excess.

J Hepatol 4:8–14

31. Mandal P, Roychowdhury S, Park PH, Pratt BT, Roger T, Nagy

LE (2010) Adiponectin and heme oxygenase-1 suppress TLR4/

MyD88-independent signaling in rat Kupffer cells and in mice

after chronic ethanol exposure. J Immunol 185:4928–4937

32. McKim SE, Gabele E, Isayama F, Lambert JC, Tucker LM,

Wheeler MD, Connor HD, Mason RP, Doll MA, Hein DW, Ar-

teel GE (2003) Inducible nitric oxide synthase is required in

alcohol-induced liver injury: studies with knockout mice. Gas-

troenterology 125:1834–1844

33. Yin M, Bradford BU, Wheeler MD, Uesugi T, Froh M, Goyert

SM, Thurman RG (2001) Reduced early alcohol-induced liver

injury in CD14-deficient mice. J Immunol 166:4737–4742

34. Maraslioglu M, Oppermann E, Blattner C, Weber R, Henrich D,

Jobin C, Schleucher E, Marzi I, Lehnert M (2014) Chronic eth-

anol feeding modulates inflammatory mediators, activation of

nuclear factor-kappaB, and responsiveness to endotoxin in mur-

ine Kupffer cells and circulating leukocytes. Mediators Inflamm

2014:808695

35. Spencer NY, Zhou W, Li Q, Zhang Y, Luo M, Yan Z, Lynch TJ,

Abbott D, Banfi B, Engelhardt JF (2013) Hepatocytes produce

TNF-alpha following hypoxia-reoxygenation and liver ischemia-

reperfusion in a NADPH oxidase- and c-Src-dependent manner.

Am J Physiol Gastrointest Liver Physiol 305:G84–G94

Eur J Nutr

123