Ed

JVa

b

c

a

ARA

KDHMPR

1

vd2t(cprciK

t(e4t

0d

Postharvest Biology and Technology 65 (2012) 61–68

Contents lists available at SciVerse ScienceDirect

Postharvest Biology and Technology

jou rna l h omepa g e: www.elsev ier .com/ locate /postharvbio

ffect of heat treatment on inhibition of Monilinia fructicola and induction ofisease resistance in peach fruit

ia Liua,b,1, Yuan Suia,1, Michael Wisniewskia,∗,1, Samir Drobyc, Shiping Tianb, John Norelli a,era Hershkovitzc

U.S. Department of Agriculture-Agricultural Research Service (USDA-ARS), 2217 Wiltshire Road, Kearneysville, WV 25430, USAKey Laboratory of Photosynthesis and Environmental Molecular Physiology, Institute of Botany, Chinese Academy of Sciences, Beijing 100093, ChinaAgricultural Research Organization (ARO), The Volcani Center, P.O. Box 6, Bet Dagan 50250, Israel

r t i c l e i n f o

rticle history:eceived 24 August 2011ccepted 5 November 2011

eywords:efense responseeat treatment

a b s t r a c t

Heat treatment (wet and dry) of fruit has been demonstrated as an effective approach for managingpostharvest decay. Both direct antimicrobial effects on pathogen propagules as well as induction of hostdefense mechanisms have been suggested to play a role in the observed reduction of decay. In the presentstudy, the effect of heat treatment (HT, hot water treatment at 40 ◦C for 5 and 10 min) on Monilinia fructi-cola and/or peach brown rot was investigated. HT inhibited spore germination and germ tube elongationof M. fructicola in vitro. HT also triggered the accumulation of reactive oxygen species (ROS), collapse

onilinia fructicolaeach fruitOS

of mitochondrial membrane potential and a decrease in intracellular ATP in M. fructicola. Results of thestudies on peach fruit showed that HT induced the expression of defense-related genes including chiti-nase (CHI), ˇ-1,3-glucanase (GNS) and phenylalanine ammonia lyase (PAL), as well as increased the activityof these enzymes in peach fruit. The HT used in this study did not appear to impair fruit quality. Ourresults indicate that both the direct inhibition of M. fructicola and the elicitation of defense responses in

the o

fruit by HT contribute to

. Introduction

Peach (Prunus persica (L.) Batsch) fruit has a short posthar-est life at room temperature due to its high susceptibility toecay pathogens and rapid deterioration in quality (Sasaki et al.,010). Brown rot caused by Monilinia fructicola (G. Wint.) Honey ishe major postharvest disease of peach fruit in the United StatesJanisiewicz et al., 2010; Karabulut et al., 2010). Although fungi-ides such as fludioxonil and fenhexamid are registered in USA forostharvest application to control decay of peach fruit, fungicideesistance and public concern over the potential impact of fungi-ides on the environment and human health have created interestn new strategies for the disease management (Ma et al., 2003;arabulut and Baykal, 2004; Droby et al., 2009).

Among various non-chemical approaches, exposure to highemperature, either dry (Conway et al., 2005) or with hot waterFallik, 2004), appears to be one of the most effective. Margosan

t al. (1997) reported that immersion of peach fruit in water at6 ◦C for 2.5 min reduced the incidence of decay caused by M. fruc-icola and Rhizopus stolonifer (Ehrenb.:Fr.) Vuill. Mari et al. (2007)

∗ Corresponding author. Tel.: +1 304 725 3451; fax: +1 304 728 2340.E-mail address: michael.wisniewski@ars.usda.gov (M. Wisniewski).

1 These authors contributed equally to this work.

925-5214/$ – see front matter. Published by Elsevier B.V.oi:10.1016/j.postharvbio.2011.11.002

bserved reduction of decay in peach fruit.Published by Elsevier B.V.

reported that hot water dipping (HWD) of nectarines at 40 ◦C for2 min significantly reduced decay on fruit that had one hour previ-ously been inoculated with Monilinia laxa (Aderh. et Ruhl) Honey,while Jemric et al. (2011) reported that brown rot decay of peachfruit that been inoculated for 24 h with M. laxa could be effectivelycontrolled by HWD (48 ◦C for 12 min) without affecting fruit qual-ity.

The control of postharvest decay with a heat treatment (HT)involves effects on both plant pathogen and plant host (Schirraet al., 2000; Pavoncello et al., 2001). While it is known that HTcan have a direct inhibitory effect on postharvest pathogens (Jemricet al., 2011; Zhang et al., 2008), the mode of action is not well under-stood. Fungi exposed to abiotic stress, including high temperature,will accumulate reactive oxygen species (ROS) intracellularly in aspecies-specific and dose-specific manner (Abrashev et al., 2008;Liu et al., 2011). Mitochondria are responsible for the major portionof intracellular ROS, thus the undesirable ROS level is often accom-panied by mitochondrial dysfunction, characterized by a collapse ofmitochondrial membrane potential �� m and a decrease of cellularATP (Helmerhorst et al., 1999; Prabhakaran et al., 2005).

Changes in the proteome and transcriptome of peach fruit fol-

lowing HT have been studied in relation to their effect on chillingresistance and mealiness, when fruit are stored at low temperature(Lara et al., 2009; Zhang et al., 2011), but little to no informationis available in relation to postharvest disease resistance. Disease

6 y and

rdaopAsiii

eticboai

2

2

asNwidt

2

macfST(tu

2

gtsEispotEr

2

da

2 J. Liu et al. / Postharvest Biolog

esistance responses elicited by heat treatment included the pro-uction of lignin-like materials in lemon fruit (Nafussi et al., 2001)nd the induction of pathogenesis-related genes in tomato andrange fruits (Schirra et al., 2000). However, specific responses ineach fruit in relation to disease resistance have not been studied.n additional advantage of HT is its positive effect on the quality oftored fruit (Malakou and Nanos, 2005; Lara et al., 2009). However,mproper treatment temperature and duration can have a negativempact on fruit quality. Therefore, it is necessary to take fruit qualitynto account when HT is applied to control postharvest diseases.

The overall objective of the present study was to determine theffect of heat treatment on control of brown rot caused by M. fruc-icola in peach fruit and its mode of action. More specifically, wenvestigated the effect of HT on (i) in vitro growth of M. fructicola, (ii)hanges in ROS, �� m and ATP content of M. fructicola, (iii) control ofrown rot caused by M. fructicola in peach fruit, (iv) the expressionf the defense-related genes; chitinase (CHI), ˇ-1,3-glucanase (GNS)nd phenylalanine ammonia lyase (PAL) and their enzyme activityn peach fruit, and (v) fruit quality.

. Materials and methods

.1. Fruit

Peach (P. persica (L.) Batsch cv. ‘June Prince’) fruit were harvestedt commercial maturity. The average quality values of firmness,oluble solids content (SSC) and titratable acidity (TA) were 77.33, 12.17% and 0.55%, respectively. Fruit without wounds or rotere selected based on uniformity of size and absence of physical

njury or disease infection. Before treatment, fruit were surface-isinfected with 2% (v/v) sodium hypochlorite for 2 min, rinsed withap water and air-dried.

.2. Pathogen inoculum

M. fructicola (CW-1) was isolated from infected peach fruit andaintained on potato dextrose agar (PDA) (Difco, Sparks, MD, USA)

t 4 ◦C. In order to reactivate the culture and verify its ability toause decay, the pathogen was inoculated into wounds of peachruit and re-isolated onto PDA once an infection was established.pore suspension was obtained from ten-day-old cultures at 25 ◦C.he number of spores was calculated using a Cellometer VisionNexcelom Bioscience, Lawrence, MA, USA), and the spore concen-ration desired was adjusted with sterile distilled water prior tose.

.3. Measurement of spore germinability of M. fructicola

The effects of heat treatment (HT) on spore germination anderm tube elongation of M. fructicola was determined accordingo Jemric et al. (2011), with slight modification. Aliquots of 1 mLpore suspension (5 × 106 spores mL−1) were distributed in 1.7-mLppendorf tubes. The spores were then incubated for 0, 5 or 10 minn separate water baths set at 40 ◦C. After the treatments, 20 �L ofpore suspension from each tube was spread on PDA plates. Thelates were incubated at 25 ◦C for 5 h. Approximately 200 sporesf M. fructicola were measured for germination rate and germube length per treatment within each replicate under microscope.ach treatment was replicated three times and the experiment wasepeated three times.

.4. Assay of ROS accumulation

The oxidant-sensitive probe, 2′,7′-dichlorodihydrofluoresceiniacetate (H2DCFDA; Invitrogen, Eugene, OR, USA), was used tossess the intracellular ROS production in M. fructicola according

Technology 65 (2012) 61–68

to Qin et al. (2007), with a slight modification. M. fructicola sporeswere collected from samples exposed to 40 ◦C for 0, 5 or 10 min.Spores were washed with phosphate buffered saline (PBS) buffer(pH 7.0) and re-suspended in the same buffer containing 25 �MH2DCFDA (dissolved in dimethyl sulfoxide). The suspension wasincubated in the dark at 30 ◦C for 1 h. After washing twice with PBSbuffer, spores were examined under a Zeiss Axioskop microscope(Carl Zeiss, Oberkochen, Germany) equipped with a UV-light sourceusing a 485-nm excitation and 530-nm emission filter combination.Five fields of view from each slide (at least 200 spores) were ran-domly chosen, the number of spores producing visible levels of ROSin response to heat stress was counted. The ROS level was calculatedas a percentage (number of fluorescing spores divided by number ofspores present in bright field image 100×). There were three repli-cates in each treatment, and the experiment was repeated threetimes.

2.5. Determination of mitochondrial membrane potential andATP contents

Loss of the membrane potential (�� m) is a hallmark for cellularimpairment and was measured with a mitochondrial membranepotential detection kit (JC-1; Cell Technology, Minneapolis, MN,USA) which contains a cationic dye (5,5′6,6′-tetrachloro-1 to 1′,3,3′-tetraethylbenzimidazolylcarbocyanine iodide, known as JC-1) thatfluoresces red in the mitochondria of healthy cells. When the mito-chondrial membrane potential collapses, the cationic dye remainsin the cytoplasm as green fluorescence. The ratio of red fluores-cence to green fluorescence is higher in healthy cells and decreasesin impaired cells (Shah and Sylvester, 2005; Chwa et al., 2006). M.fructicola spores were resuspended in JC-1 reagent at a concen-tration of 1 × 106 spores mL−1, and then incubated for 15 min at37 ◦C. Afterwards, spores were centrifuged, and the supernatantwas removed. Cell pellets were resuspended in 1 mL assay bufferprovided by the kit, and the ratios of red (550-nm excitation and600-nm emission) to green (485-nm excitation and 535-nm emis-sion) fluorescence were detected immediately on a multi-modemicroplate reader (SynergyTM HT, BioTek Instruments, Winooski,VT, USA).

For ATP assay, M. fructicola spores (about 1 × 107 spores) wereextracted with 50 �L of 2.5% trichloroacetic acid (TCA) for 3 h at4 ◦C (Li et al., 2010). After centrifugation at 10,000 × g for 15 min,10 �L of supernatant was diluted with 115 �L of ATP-free H2O and125 �L of ATP-free Tris–acetate buffer (40 mM, pH 8.0). ATP con-tents were determined with a luciferin/luciferase kit (ENLITEN®

ATP Assay System, Promega, Madison, WI, USA) according to theprotocol of manufacturer. The luminescence emission by the reac-tion was determined with the multi-mode microplate reader. Therewere three replicates in each treatment, and the experiment wasrepeated three times.

2.6. Effect of heat treatment on control of brown rot in peach fruit

In order to investigate the action of HT on control of brown rotcaused by M. fructicola in peach fruit, we applied three treatmentmethods.

Method I: HT of M. fructicola followed by fruit inoculation.Three wounds (4 mm deep × 3 mm wide) were made on the equa-tor of each fruit with a sterile nail. One mL of a spore suspension(5 × 104 spores mL−1) in a 1.7 mL Eppendorf tube was incubated foreither 5 or 10 min in a water bath at 40 ◦C, and 10 �L of HT spore sus-pension were administered into each wound. A non-HT M. fructicola

spore suspension was used as a control.

Method II: HT was applied to fruit followed by inoculation ofwounds with non-HT spore suspension of M. fructicola. Fruit wererandomly grouped into three lots. Two lots of fruit were subjected

J. Liu et al. / Postharvest Biology and Technology 65 (2012) 61–68 63

Table 1Primers used in semi-quantitative RT-PCR analysis for defense gene expression.

Gene name NCBI accession no. Primer sequence Annealing temperature (◦C) Product size (bp)

Chitinase AF206635 F: GTGGAAAAGCAATAGGGGAG 53 244R: TTCCAGCCCTTACCACAT

ˇ-1,3-Glucanase U49454 F: ATTTCTCTTGCTGGTCTTG 50 528R: CTCTGGGGTCTTTCTATTCT

Phenylalanine ammonia lyase AF206634 F: TTGACCGCGAGTACGTTTT 53 244R: CTGTTTGGGGTTGCTGATT

CCAGTCCACC

tAfwdsM

ofelTgwmtf

tsfmttm

2

fiowFCMabdmetw

2d

a(iww

Tubulin-˛ DY650410 F: CAGATGCR: ACCAGTA

o a hot water immersion treatment of 40 ◦C for either 5 or 10 min.fter HT treatment, fruit were immediately cooled to 25 ◦C using

orced-air and then air-dried for 2 h. A third lot of fruit immersed inater (25 ◦C for 10 min) served as a control. Three wounds (4 mmeep × 3 mm wide) were made on the equator of each fruit with aterile nail and each wound was inoculated with 10 �L of a non-HT. fructicola suspension (5 × 104 spores mL−1).

Method III: Inoculation of fruit with a non-HT spore suspensionf M. fructicola followed by the application of a HT to the inoculatedruit. Three wounds (4 mm deep × 3 mm wide) were made on thequator of each fruit with a sterile nail and each wound was inocu-ated with 10 �L of a M. fructicola suspension (5 × 104 spores mL−1).he fruit were air-dried for 2 h. Subsequently, fruit were randomlyrouped into three lots. Two lots of fruit were subjected to hotater immersion at 40 ◦C for either 5 or 10 min. After HT treat-ent, fruit were immediately cooled to 25 ◦C using forced-air and

hen air-dried. The third lot of fruit was immersed in water at 25 ◦Cor 10 min and served as a control.

After each treatment, fruit were placed in a covered plastic foodray, and each tray was enclosed with a polyethylene bag andtored at 25 ◦C. Disease incidence and lesion diameter of peachruit caused by M. fructicola were determined after 3 d. Each treat-

ent contained three replicates with ten fruit per replicate, andhe experiment was repeated three times. Incidence representedhe percentage of fruit displaying rot, while lesion diameter was

easured only on those wounds that were infected.

.7. Determination of fruit quality

In order to determine the effect of HT on peach fruit quality,rmness, soluble solids content (SSC), and titratable acidity (TA)f peach samples (control without HT, HT-5 min, and HT-10 min)ere measured daily from 1 to 3 d according to Jemric et al. (2011).

ruit firmness was determined with Drill Press Stand (model 25921,raftsman, Chicago, IL, USA) fitted with a 10-mm diameter plunger.easurements were taken at four equatorial positions on each fruit

t 90◦. Fruit juice was extracted by homogenizing fruit flesh in alender. SSC values of the juice were measured in each fruit with aigital refractometer (Atago, PR-100, Tokyo, Japan). TA was deter-ined by titrating 10 mL of juice with 0.1 M NaOH up to pH 8.2, and

xpressed as a percentage of malic acid. Each treatment containedhree replicates with ten fruit per replicate, and the experimentas repeated three times.

.8. RNA isolation and semi-quantitative RT-PCR analysis ofefense gene expression

Total RNA from peach samples at each time points (0, 1, 2 and 3 dfter inoculation) was isolated using ConcertTM Plant RNA Reagent

Invitrogen, Carlsbad, CA, USA) according to the manufacturer’snstructions (Wisniewski et al., 2011). Extracted RNA was treated

ith TURBOTM DNase (Ambion, Austin, TX, USA) and purified againith RNeasy Mini Kit (Qiagen Science, Germantown, MD, USA).

GATGCCTCAG 60 336ACCAACAGC

Aliquots of 1 �g total RNA were used for first strand cDNA synthesisin 20 �L reaction volume with 100 units of M-MLV reverse tran-scriptase (Ambion, Austin, TX, USA). Transcript levels of tubulin-˛served as an internal control gene (Li et al., 2009). Cycling param-eters for each gene amplification were 95 ◦C for 5 min; 25 cycles of95 ◦C for 30 s, specific annealing temperature for 30 s, and 72 ◦C for30 s; and finally 72 ◦C for 10 min. The primers of the defense genesof CHI, GNS and PAL, and annealing temperatures were shown inTable 1. PCR products were cloned and sequenced to verify theidentity. Quantification of transcript expression level was basedon the band intensity on an ethidium-bromide-stained gel usingScion Image Software (Scion Corp., Frederick, MD, USA) according toVinagre et al. (2006). There were three replicates in each treatment,and the experiment was repeated three times.

2.9. Assay of enzyme activities in peach fruit

Peach samples were obtained from 20 fruit stored at 25 ◦C con-taining the pericarp and flesh at 0, 1, 2 and 3 d after treatment (DAT).Each treatment consisted of three replicates and the experimentwas repeated three times.

For chitinase (CHI) and �-1,3-glucanase (GNS), enzymes wereextracted according to Cao and Jiang (2006). Fruit tissue samples(5 g) were homogenized in 20 mL of ice-cold sodium acetate buffer(100 mM, pH 5.0) containing 5 mM �-mercaptoethanol and 1 mMethylenediaminetetraacetic acid (EDTA) at 4 ◦C. The homogenatewas centrifuged at 13,000 × g for 20 min at 4 ◦C, and the resultingsupernatant was collected for the enzyme assay. CHI activity wasdetermined with chitin azure (Sigma–Aldrich, St. Louis, MO, USA)as the substrate, according to the method of Xu and Du (2011). �-1,3-Glucanase activity was assayed with laminarin as the substrate,following the method described by Ippolito et al. (2000). Reactionproduction were measured spectrophotometrically at 550 nm (forCHI) or 500 nm (for GNS) using the multi-mode microplate reader.The specific activity of CHI was expressed as U kg−1 of protein,where one unit was defined as the amount of the enzyme pro-ducing 1 �mol of azure per second. The specific activity of GNSwas expressed as U kg−1 of protein, where one unit was definedas the production of 1 �mol of glucose equivalent per second. Forphenylalanine ammonia lyase (PAL) was extracted by the methodof Jin et al. (2009). Tissue sample (5 g) was homogenized with20 mL of ice-cold sodium borate buffer (100 mM, pH 8.7) contain-ing 5 mM �-mercaptoethanol and 4% (w/v) polyvinylpyrrolidone(PVP) at 4 ◦C. The homogenate was centrifuged at 10,000 × g for20 min at 4 ◦C, and the resulting supernatant was collected for theenzyme assay. Enzyme extract (0.1 mL) was incubated with 0.2 mLof sodium borate buffer and 0.1 mL of l-phenylalanine (20 mM) for60 min at 37 ◦C. The reaction was stopped with 0.1 mL of 1 mol L−1

HCl. PAL activity was determined by the production of cinnamate,with the absorbance change at 290 nm (Assis et al., 2001). The blankwas the crude enzyme preparation mixed with l-phenylalaninewith zero time incubation. The specific enzyme activity was defined

6 y and Technology 65 (2012) 61–68

U1

(M

2

(ArDre

3

3

atfgL(toifron

3c

tttsHlamMd1

3q

swwat4dwei

Fig. 1. Effect of heat treatment (40 ◦C) on in vitro growth of M. fructicola. (A) Sporegermination rate; (B) germ tube length; (C) microscope images of M. fructicola.Aliquots of 1 mL spore suspension (5 × 106 spores mL−1) in 1.7-mL Eppendorf tubeswere incubated in water bath (40 ◦C, 5 or 10 min). After the treatments, 20 �L ofspore suspension from each tube was spread on PDA plates. The plates were incu-bated at 25 ◦C for 5 h, and observed for spore germination and germ tube elongation.Data presented are the means of three independent experiments where each exper-iment consisted of three biological replicates for a total of n = 9. Two hundred spores

4 J. Liu et al. / Postharvest Biolog

kg−1 of protein, where one unit was defined as the production of nmol of cinnamic acid per second.

Protein content was measured using the Bradford assayBradford, 1976). Bovine serum albumin (Sigma–Aldrich, St. Louis,

O, USA) was used as a standard.

.10. Data analysis

All statistical analyses were performed with SPSS version 13.0SPSS Inc., Chicago, IL, USA). Data were analyzed by one-wayNOVA. Mean separations were performed by Duncan’s multipleange tests. Differences at P < 0.05 were considered to be significant.ata presented in this paper were pooled across three independent

epeated experiments, as the interaction between treatment andxperiment variables was not significant.

. Results

.1. Effect of heat treatment on spore germination of M. fructicola

Fig. 1 illustrates the inhibitory effect of HT on spore germinationnd germ tube elongation of M. fructicola. After 5 h of incuba-ion on PDA at 25 ◦C, the heat-treated (40 ◦C for 5 or 10 min) M.ructicola spores exhibited a significantly (P < 0.05) lower level ofermination, as compared to the non-heat-treated control (Fig. 1A).ikewise, a similar pattern was observed for germ tube elongationFig. 1B). The inhibitory effect of HT (40 ◦C) was enhanced when thereatment time increased from 5 to 10 min. Importantly, after 18 hf incubation of PDA at 25 ◦C, there was no significant differencen the level of spore germination between control and HT (40 ◦Cor 5 or 10 min) spores. The germination rates in all the treatmentseached 95% (data not shown), indicating that the HT (40 ◦C for 5r 10 min) only retarded the growth of M. fructicola spores and wasot lethal.

.2. Effect of heat treatment on ROS accumulation, �� m and ATPontent of M. fructicola

At time 0, prior to the heat treatment, the percentage of M. fruc-icola spores exhibiting a visible ROS level, as determined by use ofhe fluorescent dye H2DCFDA, was less than 10% (Fig. 2). However,he percentage significantly (P < 0.05) increased with time of expo-ure to 40 ◦C. After 10 min, the percentage of spores stained with2DCFDA reached 45%. To investigate whether or not the increased

evels of ROS in M. fructicola spores under heat stress were associ-ted with mitochondrial dysfunction, �� m and ATP content wereeasured (Fig. 3). Data indicated that the level of �� m and ATP in. fructicola spores were similar. Both of them markedly (P < 0.05)

ecreased with treatment time, and showed the lowest levels after0 min at 40 ◦C.

.3. Efficacy of heat treatment on control of brown rot and fruituality

Three different methods of heat treatment were employed: (I)pores were heated and inoculated in wounds of unheated fruit; (II)ounded fruit were heated and unheated spores were applied toounds; and (III) unheated spores were inoculated in fruit wounds

nd then the fruit were heated. In all three different experimentalreatments, HT (40 ◦C for 10 min) showed better control effect than0 ◦C for 5 min. This was true for both diseases incidence and lesion

iameter (Fig. 4). Among the HT treatments, Method III, where fruitere inoculated and then heated, gave the best level of control

ffect with the greatest impact being on lesion diameter. Diseasencidence reached 100% after 3 days in the control fruit. At that

were counted on each replicate. Error bars indicate standard deviations of the mean.Columns with different letters indicate significant differences according to Duncan’smultiple range test (P < 0.05).

time, incidence for the three treatments (I, II, and III) was 85, 92, and75%, respectively, when heat had been applied for 10 min (Fig. 4B).While lesion diameter was significantly reduced by HT for 5 and10 min in all HT methods, the largest reduction was obtained byHT (40 ◦C for 10 min) in Method III (Fig. 4C). Regarding fruit qual-ity, no visual symptoms of heat damage were observed during theduration of the experiment. Moreover, heat-treated fruit had nosignificant differences (P > 0.05) in fruit firmness, SSC and TA, com-pared to untreated control fruit during the 3-d period in which theheat treatment experiment was conducted (Table 2).

3.4. Effect of heat treatment on induction of defensive geneexpression in peach fruit

The transcript level of the three defensive genes chitinase (CHI),ˇ-1,3-glucanase (GNS) and phenylalanine ammonia lyase (PAL) wasincreased by HT (5 and 10 min) (Fig. 5). CHI expression in controlfruit increased slightly during the experimental period (three days).

J. Liu et al. / Postharvest Biology and Technology 65 (2012) 61–68 65

Table 2The quality parameters of peach fruit stored at 25 ◦C for 3 d.

Days after treatment Heat treatment (min) Quality indexes

Firmness (N) SSC (%) TA (%)

Day 10 31.33 ± 3.25a 12.86 ± 0.47a 0.50 ± 0.03a5 34.36 ± 2.64a 12.25 ± 0.32a 0.53 ± 0.04a

10 30.76 ± 3.18a 12.43 ± 0.23a 0.49 ± 0.03a

Day 20 22.67 ± 2.08a 13.23 ± 0.29a 0.46 ± 0.04a5 25.12 ± 3.56a 12.98 ± 0.32a 0.48 ± 0.02a

10 24.85 ± 2.67a 13.41 ± 0.41a 0.47 ± 0.03a

Day 30 17.67 ± 2.53a 13.71 ± 0.28a 0.41 ± 0.03a5 15.89 ± 1.89a 14.02 ± 0.26a 0.42 ± 0.01a

10 16.06 ± 3.14a 13.95 ± 0.31a 0.44 ± 0.02a

V wed by the same letter at each day are not significantly different according to Duncan’sm

Iegbhsdi

3

tip

Ftiombre(

a

b

3

4

5

ed to

gre

en fl

uore

scen

ce)

A

alues are the means of pooled data ± standard deviations (n = 9). The values folloultiple range test (P > 0.05).

n contrast, HT for both 5 and 10 min substantially increased CHIxpression. Compared to HT for 5 min, HT for 10 min showed areater increase compared to the HT 5 min treatment as evidencedy the band density values. Both 5 min and 10 min HT induced aigher GNS expression than that in control fruit, and GNS expres-ion was induced to the highest level by 10 min HT on all threeays. PAL gene expression was the least affected by the HT but did

ncrease over the three-day period.

.5. Effect of heat treatment on enzyme activity in peach fruit

Corresponding to the pattern of gene expression observed forhe three defense related genes examined, HT (5 and 10 min) alsoncreased the activity of chitinase (CHI), �-1,3-glucanase (GNS) andhenylalanine ammonia lyase (PAL) enzymes in peach fruit stored

ig. 2. Effect of heat treatment (40 ◦C) on intracellular ROS accumulation of M. fruc-icola. (A) Microscope images of M. fructicola spore under bright field; (B) microscopemages of M. fructicola spore stained with the fluoroprobe H2DCFDA; (C) percentagef M. fructicola spores exhibiting visible ROS accumulation. Data presented are theeans of three independent experiments where each experiment consisted of three

iological replicates for a total of n = 9. Two hundred spores were counted on eacheplicate. Error bars indicate standard deviations of the mean. Columns with differ-nt letters indicate significant differences according to Duncan’s multiple range testP < 0.05).

c

0

1

2

1050

ΔΨm

(rat

io o

f r

a

b

c

0

20

40

60

80

100

1050

Treatment time (min)

AT

P pe

r 10

8 cel

ls, p

mol

B

Fig. 3. Effect of heat treatment (40 ◦C) on mitochondrial membrane potential (�� m)(A) and ATP content (B) of M. fructicola. Data presented are the means of three inde-pendent experiments where each experiment consisted of three biological replicatesfor a total of n = 9. Error bars indicate standard deviations of the mean. Columnswith different letters indicate significant differences according to Duncan’s multiplerange test (P < 0.05).

66 J. Liu et al. / Postharvest Biology and

Fig. 4. Effect of heat treatment (40 ◦C) on control of brown rot caused by M. fruc-ticola in peach fruit stored at 25 ◦C. Disease incidence and lesion diameter weremeasured 3 d after inoculation with M. fructicola. Inoculation I: heat treatmentof M. fructicola followed by wound inoculation of fruit; Inoculation II: heat treat-ment of fruit followed by inoculation with non-HT suspension of M. fructicola;Inoculation III: inoculation of fruit with non-HT spore suspension of M. fructicolafollowed by heat treatment of the inoculated fruit. (A) A representative pictureshowing disease symptom of brown rot in peach fruit following Inoculation III;(B) disease incidence and (C) lesion diameter in peach fruit following the threetreatment methods. Data presented are the means of nine pooled replicates. Errorbars indicate standard deviations of the mean. Within methods columns with dif-ferent letters indicate significant differences according to Duncan’s multiple rangetest (P < 0.05).

Technology 65 (2012) 61–68

at 25 ◦C (Fig. 6). The highest level of enzyme activity was observedin fruit that received the HT (10 min). The activity of CHI in thecontrol fruit kept relatively low. The pattern of enzyme activityboth in 5 min- and 10 min-HT fruit were similar. CHI activity inboth treated fruit reached its highest level at 3 DAT (Fig. 6A). Dur-ing the storage period, 10 min-HT fruit showed significantly higherGNS activity than the control, while 5 min-HT fruit had significantlyhigher activity at 2 and 3 DAT (Fig. 6B). PAL activity was stimulatedby HT treatment, increasing rapidly at 1 DAT and reaching a max-imum at 3 DAT. PAL activity increased in both HT treated fruit ascompared to the control during the entire storage period, but PALactivity in 10-min HT fruit were higher than that in 5-min HT fruit(Fig. 6C).

4. Discussion

Heat treatment (HT) of fruit has been reported to be an effectivemethod of managing postharvest diseases by both its inhibitory orgermicidal effect on decay pathogens and eliciting defense mecha-nisms in plant host (Schirra et al., 2000; Fallik, 2004). In the presentstudy, it was found that HT directly inhibited both spore germi-nation and germ tube elongation (Fig. 1). The results confirmedprevious findings about the effect of HT on M. fructicola and M. laxareported by Margosan et al. (1997) and Jemric et al. (2011). Whenfungi are exposed to severe abiotic stresses including heat stress,large amounts of intracellular ROS are generated (Singh et al., 2011).Abrashev et al. (2008) reported that heat stress of 40 ◦C significantlyincreased the levels of ROS in Aspergillus niger van Tieghem andcaused cellular oxidative damage. We also observed intracellularROS in M. fructicola when exposed to 40 ◦C (Fig. 2). The number ofcells exhibiting intracellular ROS accumulation increased signifi-cantly with exposure time.

Levels of mitochondrial dysfunction closely followed intracel-lular ROS accumulation (Helmerhorst et al., 2001; Herrera et al.,2001). Impairment of mitochondria would result in decreased lev-els of ATP (Heazlewood et al., 2004). In the present study, oxidativestress in M. fructicola, as evidenced by an increase in intracellu-lar ROS resulted in a collapse of mitochondria membrane potential(�� m) and decreased levels of ATP (Fig. 3), resulting in delayedgrowth. This is in agreement with a recent study by Qin et al. (2011)on the effects of hydrogen peroxide on Penicillium expansum. The

ATP decrease in M. fructicola spores may explain why heat-treatedM. fructicola grew more slowly than unheated controls.

In order to investigate whether the mode of action of HT on con-trol of brown rot involved an effect on both the pathogen and the

Fig. 5. Effect of heat treatment (40 ◦C) on gene expression of chitinase (CHI), ˇ-1,3-glucanase (GNS) and phenylalanine ammonia lyase (PAL) in peach fruit. The tubulingene was used as a control for normalizing mRNA quantity. The level of target geneexpression relative to the sample at Day 0 is shown above each band. Data pre-sented are the means of nine pooled replicates. Abbreviations: C, control; H5, heattreatment (40 ◦C for 5 min); H10, heat treatment (40 ◦C for 10 min).

J. Liu et al. / Postharvest Biology and

Fig. 6. Effect of heat treatment (40 ◦C) on enzyme activity of chitinase (CHI), �-1p

pitbeaHtinmCnah

,3-glucanase (GNS) and phenylalanine ammonia lyase (PAL) in peach fruit. Dataresented are the means of nine pooled replicates.

each, we used three different methods of heat treatment. Datandicated that heat-treating the fruit after it was inoculated withhe pathogen provided the best control and that HT of 10 min wasetter than an HT of 5 min (Fig. 4). This suggests that the controlffect was due to a direct effect of the heat on both the pathogennd the host. Our data indicate that the direct inhibitory effect ofT on M. fructicola was associated with intracellular ROS accumula-

ion, mitochondrial dysfunction and a decrease in ATP. Additionally,t was evident that HT was able to induce host defense mecha-isms in the fruit itself. The ability of HT to induce host defenseechanisms has been previously postulated (Schirra et al., 2000).

hitinase (CHI), �-1,3-glucanase (GNS) and phenylalanine ammo-ia lyase (PAL) have been suggested to play a crucial role in defensegainst fungal infection (Ferreira et al., 2007). CHI catalyses theydrolysis of �-1-4-linkage of the N-acetylglucosamine polymer

Technology 65 (2012) 61–68 67

of chitin which is an essential cell wall component of many fun-gal pathogens, and GNS is one of the most fully characterizedpathogenesis-related (PR) proteins that act directly by degradingcell walls of pathogens or indirectly by releasing oligosaccharideand eliciting defense reactions (Lee et al., 2006). Additionally, PALis the first enzyme in the phenylpropanoid pathway and is involvedin the biosynthesis of phenolics, phytoalexins and lignins (Dixonet al., 2002). All these processes are potential defense mechanismagainst fungal infection (Tian et al., 2007). The results of the presentstudy indicated that HT markedly induced gene expression of CHI,GNS and PAL (Fig. 5), and their enzyme activities (Fig. 6). More-over, the 10-min HT showed better inductive effect than the 5-minone, which corresponded well to the control effect of brown rot(Fig. 4). Similar inductive effects of HT have been reported on otherfruits. Benitez et al. (2006) reported that hot water dipping treat-ment at 55 ◦C for 5 min induced resistance in mature green stagemango fruit against Colletotrichum gloeosporioides (Penz) Penz &Sac. by enhancing the activity of GNS and PAL. Pavoncello et al.(2001) observed that hot water brushing treatment at 62 ◦C for20 s promoted the accumulation of CHI and GNS proteins in grape-fruit and an increase in resistance to Penicillium digitatum Sacc.The present report, however, is the first report demonstrating theinductive effect of HT on defensive enzymes at both the transcriptand enzyme activity level in peach fruit.

In conclusion, we found that heat treatment could have a signifi-cant impact on brown rot control in peach fruit when both the fruitand pathogen were exposed to the treatment. The control effectwas associated with the inhibition of M. fructicola germination andgrowth, intracellular ROS accumulation, mitochondrial impairmentleading to a reduction in ATP, and the induction of defense-relatedenzymes in peach fruit.

Acknowledgements

This research was partially supported by a grant (IS-4268-09)from the U.S.-Israel Binational Agricultural Research and Develop-ment (BARD) Fund to S.D. and M.W., and a grant (31030051) fromthe National Natural Science Foundation of China (NNSFC) to S.T.

References

Abrashev, R.I., Pashova, S.B., Stefanova, L.N., Vassilev, S.V., Dolashka-Angelova, P.A.,Angelova, M.B., 2008. Heat-shock-induced oxidative stress and antioxidantresponse in Aspergillus niger 26. Can. J. Microbiol. 54, 977–983.

Assis, J.S., Maldonado, R., Munoz, T., Escribano, M.I., Merodio, C., 2001. Effect of highcarbon dioxide concentration on PAL activity and phenolic contents in ripeningcherimoya fruit. Postharvest Biol. Technol. 23, 33–39.

Benitez, M.M., Acedo Jr., A.L., Jitareerat, P., Kanlavanarat, S., 2006. Induction of diseaseresistance in mango fruit by postharvest heat. Acta Hort. 712, 785–792.

Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of micro-gram quantities of protein utilizing the principle of protein–dye binding. Anal.Biochem. 72, 248–254.

Cao, J., Jiang, W., 2006. Induction of resistance in Yali pear (Pyrus bretschneideri Rehd.)fruit against postharvest diseases by acibenzolar-S-methyl sprays on trees dur-ing fruit growth. Sci. Hortic. 110, 181–186.

Conway, W.S., Leverentz, B., Janisiewicz, W.J., Saftner, R.A., Camp, M.J., 2005. Improv-ing biocontrol using antagonist mixtures with heat and/or sodium bicarbonateto control postharvest decay of apple fruit. Postharvest Biol. Technol. 36,235–244.

Chwa, M., Atilano, S.R., Reddy, V., Jordan, N., Kim, D.W., Kenney, M.C., 2006. Increasedstress-induced generation of reactive oxygen species and apoptosis in humankeratoconus fibroblasts. Invest. Ophth. Vis. Sci. 47, 1902–1910.

Dixon, R.A., Achnin, L., Kota, P., Liu, C.J., Srinivasa, M.S., Wang, L., 2002. The phenyl-propanoid pathway and plant defence – a genomics perspective. Mol. PlantPathol. 3, 371–390.

Droby, S., Wisniewski, M., Macarisin, D., Wilson, C., 2009. Twenty years of posthar-vest biocontrol research: Is it time for a new paradigm? Postharvest Biol.Technol. 52, 137–145.

Fallik, E., 2004. Prestorage hot water treatments (immersion, rinsing and brushing).Postharvest Biol. Technol. 32, 125–134.

Ferreira, R.B., Monteiro, S., Freitas, R., Santos, C.N., Chen, Z., Batista, L.M., Duarte,J., Borges, A., Teixeira, A.R., 2007. The role of plant defence proteins in fungalpathogenesis. Mol. Plant Pathol. 8, 677–700.

6 y and

H

H

H

H

I

J

J

J

K

K

L

L

L

L

L

M

M

8 J. Liu et al. / Postharvest Biolog

eazlewood, J.L., Tonti-Filippini, J.S., Gout, A.M., Day, D.A., Whelan, J., Millar, A.H.,2004. Experimental analysis of the Arabidopsis mitochondrial proteome high-lights signaling and regulatory components, provides assessment of targetingprediction programs, and indicates plant-specific mitochondrial proteins. PlantCell 16, 241–256.

elmerhorst, E.J., Breeuwer, P., van’t Hof, W., Walgreen-Weterings, E., Oomen,L.C.J.M., Veerman, E.C.I., Amerongen, A.V.N., Abee, T., 1999. The cellular targetof histatin 5 on Candida albicans is the energized mitochondrion. J. Biol. Chem.274, 7286–7291.

elmerhorst, E.J., Troxler, R.F., Oppenheim, F.G., 2001. The human salivary peptidehistatin 5 exerts its antifungal activity through the formation of reactive oxygenspecies. Proc. Natl. Acad. Sci. U.S.A. 98, 14637–14642.

errera, B., Alvarez, A.M., Sánchez, A., Fernández, M., Roncero, C., Benito, M.,Fabregat, I., 2001. Reactive oxygen species (ROS) mediates the mitochondrial-dependent apoptosis induced by transforming growth factor (beta) in fetalhepatocytes. FASEB J. 15, 741–751.

ppolito, A., El-Ghaouth, A., Wilson, C.L., Wisniewski, M., 2000. Control of posthar-vest decay of apple fruit by Aureobasidium pullulans and induction of defenseresponses. Postharvest Biol. Technol. 19, 265–272.

anisiewicz, W.J., Kurtzman, C.P., Buyer, J.S., 2010. Yeasts associated with nectarinesand their potential for biological control of brown rot. Yeast 27, 389–398.

emric, T., Ivic, D., Fruk, G., Matijas, H.S., Cvjetkovic, B., Bupic, M., Pavkovic, B., 2011.Reduction of postharvest decay of peach and nectarine caused by Monilinia laxausing hot water dipping. Food Bioprocess Technol. 4, 149–154.

in, P., Zheng, Y., Tang, S., Rui, H., Wang, C.Y., 2009. Enhancing disease resistance inpeach fruit with methyl jasmonate. J. Sci. Food Agric. 89, 802–808.

arabulut, O.A., Baykal, N., 2004. Integrated control of postharvest diseases ofpeaches with a yeast antagonist, hot water and modified atmosphere packaging.Crop Prot. 23, 431–435.

arabulut, O.A., Smilanick, J.L., Crisosto, C.H., Palou, L., 2010. Control of brown rotof stone fruits by brief heated water immersion treatments. Crop Prot. 29,903–906.

ara, M.V., Borsani, J., Budde, C.O., Lauxmann, M.A., Lombardo, V.A., Murray, R.,Andreo, C.S., Drincovich, M.F., 2009. Biochemical and proteomic analysis of ‘Dixi-land’ peach fruit (Prunus persica) upon heat treatment. J. Exp. Bot. 60, 4315–4333.

ee, J., Bricker, T.M., Lefevre, M., Pinson, S.R.M., Oard, J.H., 2006. Proteomic andgenetic approaches to identifying defence-related proteins in rice challengedwith the fungal pathogen Rhizoctonia solani. Mol. Plant Pathol. 7, 405–416.

i, B., Lai, T., Qin, G., Tian, S., 2010. Ambient pH stress inhibits spore germination ofPenicillium expansum by impairing protein synthesis and folding: a proteomic-based study. J. Proteome Res. 9, 298–307.

i, Z., Reighard, G.L., Abbott, A.G., Bielenberg, D.G., 2009. Dormancy-associated MADSgenes from the EVG locus of peach [Prunus persica (L.) Batsch] have distinctseasonal and photoperiodic expression patterns. J. Exp. Bot. 60, 3521–3530.

iu, J., Wisniewski, M., Droby, S., Tian, S., Hershkovitz, V., Tworkoski, T., 2011.Effect of heat shock treatment on stress tolerance and biocontrol efficacy ofMetschnikowia fructicola. FEMS Microbiol. Ecol. 76, 145–155.

a, Z., Yoshimura, M.A., Michailides, T.J., 2003. Identification and characterization

of benzimidazole resistance in Monilinia fructicola from stone fruit orchards inCalifornia. Appl. Environ. Microbiol. 69, 7145–7152.

alakou, A., Nanos, D.G., 2005. A combination of hot water treatment and modifiedatmosphere packaging maintains quality of advanced maturity ‘Caldesi 2000’nectarines and ‘Royal Glory’ peaches. Postharvest Biol. Technol. 38, 106–114.

Technology 65 (2012) 61–68

Margosan, D.A., Smilanick, J.L., Simmons, G.F., Henson, D.J., 1997. Combination ofhot water and ethanol to control postharvest decay of peaches and nectarines.Plant Dis. 81, 1405–1409.

Mari, M., Torres, R., Casalini, L., Lamarca, N., Mandrin, J.F., Lichou, J., Larena, I., DeCal, M.A., Melgarejo, P., Usall, J., 2007. Control of post-harvest brown rot onnectarine by Epicoccum nigrum and physico-chemical treatments. J. Sci. FoodAgric. 87, 1271–1277.

Nafussi, B., Ben-Yehoshua, B., Rodov, V., Peretz, J., Ozer, B.K., D’Hallewin, G., 2001.Mode of action of hot-water dip in reducing decay of lemon fruit. J. Agric. FoodChem. 49, 107–113.

Pavoncello, D., Lurie, S., Droby, S., Porat, R., 2001. A hot water treatment inducesresistance to Penicillium digitatum and promotes the accumulation of heat shockand pathogenesis-related proteins in grapefruit flavedo. Physiol. Plantarum 111,17–22.

Prabhakaran, K., Li, L., Mills, E.M., Borowitz, J.L., Isom, G.E., 2005. Up-regulation ofuncoupling protein 2 by cyanide is linked with cytotoxicity in mesencephaliccells. J. Pharmacol. Exp. Ther. 314, 1338–1345.

Qin, G., Liu, J., Cao, B., Li, B., Tian, S., 2011. Hydrogen peroxide acts on sensitive mito-chondrial proteins to induce death of a fungal pathogen revealed by proteomicanalysis. PLoS One 6, e21945.

Qin, G., Tian, S., Chan, Z., Li, B., 2007. Crucial role of antioxidant proteins andhydrolytic enzymes in pathogenicity of Penicillium expansum: analysis basedon proteomics approach. Mol. Cell. Proteomics 6, 425–438.

Sasaki, F.F., Cerqueira, T.S., Sestari, I., del, A.R.A., Kluge, J.S., 2010. Woolliness controland pectin solubilization of ‘Douradão’ peach after heat shock treatment. ActaHort. 877, 539–542.

Schirra, M., D’hallewin, G., Ben-Yehoshua, S., Fallik, E., 2000. Host–pathogen inter-actions modulated by heat treatment. Postharvest Biol. Technol. 21, 71–85.

Shah, S.J., Sylvester, P.W., 2005. Tocotrienol-induced cytotoxicity is unrelated tomitochondrial stress apoptotic signaling in neoplastic mammary epithelial cells.Biochem. Cell Biol. 83, 86–95.

Singh, L.P., Gill, S.S., Tuteja, N., 2011. Unraveling the role of fungal symbionts in plantabiotic stress tolerance. Plant Signal Behav. 6, 175–191.

Tian, S.P., Yao, H.J., Deng, X., Xu, X.B., Qin, G.Z., Chan, Z.L., 2007. Characterization andexpression of �-1,3-glucanase genes in jujube fruit induced by the microbialbiocontrol agent Cryptococcus laurentii. Phytopathology 97, 260–268.

Vinagre, F., Vargas, C., Schwarcz, K., Cavalcante, J., Nogueira, E.M., Baldani, J.I.,Ferreira, P.C.G., Hemerly, A.S., 2006. SHR5: a novel plant receptor kinaseinvolved in plant–N2-fixing endophytic bacteria association. J. Exp. Bot.57, 559–569.

Wisniewski, M., Norelli, J., Bassett, C., Artlip, T., Macarisin, D., 2011. Ectopicexpression of a novel peach (Prunus persica) CBF transcription factor in apple(Malus × domestica) results in short-day induced dormancy and increased coldhardiness. Planta 233, 917–983.

Xu, L., Du, Y., 2011. Effects of yeast antagonist in combination with UV-C treatmenton postharvest diseases of pear fruit. BioControl, doi:10.1007/s10526-011-9400-8.

Zhang, H., Wang, S., Huang, X., Dong, Y., Zheng, X., 2008. Integrated control of

postharvest blue mold decay of pears with hot water treatment and Rhodotorulaglutinis. Postharvest Biol. Technol. 49, 308–313.

Zhang, L., Yu, Z., Jiang, L., Jiang, J., Luo, H., Fu, L., 2011. Effect of post-harvest heattreatment on proteome change of peach fruit during ripening. J. Proteomics 74,1135–1149.