Date post: | 30-May-2018 |
Category: |
Documents |
Upload: | zack-troilo |
View: | 214 times |
Download: | 0 times |
of 14
8/9/2019 Effect of RNAi knockdown of CG7786 and CG6272 on border cell migration
1/14
Effect of RNAi knockdown of CG7786 and CG6272 on
border cell migration
Zack Troilo
12/17/2009
Biol312WL fall 2009
8/9/2019 Effect of RNAi knockdown of CG7786 and CG6272 on border cell migration
2/14
Abstract:
Drosophila border cell migration currently an active area of study in modern molecular biology.
Transcription factors play a central role in the differential gene expression during border cell migration.
This migration is tightly regulated in a temporal manner (stage 9) and the Slow BorderCells (Slbo)
locus is critical in this journey. Slbo codes for a homolog of the mammalian CAAT enhancer binding
protein (C/EBP) transcription factor. Slbo regulates expression of several genes involved in the
migration of the border cell cluster including DE-cadherin, Fak, Jing, and myosin VI. Here we utilized
RNAi to knockdown expression of Slbo, CG7786, and CG6272. The knockdown of Slbo caused a
failure of the border cell cluster to reach the border. The CG7786 knockdown seemed to have no effect
on border cell migration while the knockdown of CG6272 yielded interesting results. The CG6272
knockdown failed to migrate properly. Migration occurred but it seems to be random in regards to the
direction the cluster migrated. Further biochemical and molecular studies should be done to elucidate
the mechanisms involved.
Intro:
Drosophila border cell migration is currently an active area of study in modern molecular
biology. The study of Drosophila border cell migration may have medical implications by furthering
current metastatic cancer research. Many genes and proteins involved in this migration have vertebrate
homologs as a result of conservation through evolutionary pressures. Transcription factors play a
central role in the differential gene expression during border cell migration. The migrating border cell
cluster includes 2 polar cells that are surrounded by 10-12 rosette cells (Levine et al, unpublished). At
stage 9 this cluster delaminates from the epithelium and concurrent with the follicle cell epithelium
migrates from the anterior region of the egg chamber to the nurse cell-oocyte border (Horne-Badovinac
and Bilder, 2005).
This migration is tightly regulated in a temporal manner (stage 9) and the Slow BorderCells
8/9/2019 Effect of RNAi knockdown of CG7786 and CG6272 on border cell migration
3/14
(Slbo) locus is critical in this journey. Slbo codes for a homolog of the mammalian CAAT enhancer
binding protein (C/EBP) transcription factor (Rorth, 1994). Slbo is a leucine zipper monomer which
has has two regions of activity. One region is 35 amino acids long and aids in the dimerization with
other leucine zipper monomers. This leucine zipper region is an -helix and named by the
characteristic leucine residues that are situated at every 7th position of the 5 reapeating heptads
(Montell et el, 1992). Slbo's transcription factor function is initiated when two slbo monomers
dimerize in a coiled-coil manner. The result is a dimer that geometrically correlates to the letter Y with
the zipper corresponding to the stem. The bifurcation point of the Y dimer corresponds to the second
region which is the basic region due to the conserved basic residues that reside in this region. The
basic region attaches to DNA in the major groove by the scissor-grip model (Vinson et al, 1989).
Slbo regulates expression of several genes involved in the migration of the border cell cluster.
One downstream regulated gene product is DE-cadherin. Others include Fak, Jing, and myosin VI
(Montell, 2003). Myosin VI is an actin based motor protein whose tasks are to stabilize the complex
that includes DE-cadherin and armadillo and to promote the projection of the lamellipodia (Geisbrecht,
2002; Montell, 2003). Slbo expression is therefore required for border cell migration however it is not
necessary for the border cells selective adhesion (Rorth, 2000). The selective adhesion of the cluster
seems to be because of unpairedexpression in the polar cells to stimulate Jak-Stat signaling in the
rosette cells (Montell, 2003). The cluster delamination and migration occur at a time when Cut is only
expressed in the polar cells which activates Fas2. This polarizes the cluster giving directionality to the
journey to the oocyte border (Levine et al, unpublished).
Slbo has biological effects only when its levels are within a narrow range. Pernille Rorth in
2000 showed that slbo is regulated both in a positive and negative way. Slbo is stabilized by Ubp64
which is a presumptive ubiquitin hydrolase. Tribbles regulates Slbo negatively by ubiquinating it,
targeting Slbo for degradation as shown by higher molecular weight bands in western blots . The
border cell cluster fails to migrate when levels of Slbo are too high or too low. For proper migration it
8/9/2019 Effect of RNAi knockdown of CG7786 and CG6272 on border cell migration
4/14
is imperative that Slbo is properly expressed in the rosette cells surrounding the polar cells (Rorth,
2000).
C/EBP heterodimers are likely to be promiscuous in nature (Fassler et al, 2002) and the
biological functions with CG7786 are unknown. The CG7786 gene encodes a b-zip transcription factor
monomer (Fassler et al, 2002) that displays a b-zip motif and forms heterodimers. CG7786 monomers
form promiscuous heterodimers with C/EBP (Deppman et al, 2006). If the CG7786 b-zip transcription
factor does indeed dimerize with C/EBP, then it could have a role in delayed border cell migration.
CG6272 is also a dimerization partner of interest in this study. Here, we show that CG6272 RNAi
knockdown has a definite effect on border cell migration while CG7786 knockdown has no effect.
Results and Discussion:
In order to study possible interactions with Slbo we wanted to clone two candidate drosophila b-
zip transcription factor monomers: CG7786 and CG6272. We then knocked down their expression
with RNAi. When Slbo was expressed the RNAi to CG7262 and CG7786 was also expressed. If there
was a failure in border cell migration it may have therefore been because of a molecular mechanism
connecting the knocked down gene (CG7262 or CG7786) and Slbo expression.
Cloning of CG7786 and CG6272 and Tribbles induction
Gel electrophoresis of CG7786 and CG6272
The PCR first products produced were not of the highest quality. Since, CG7786 is 579 bp long
we expected to see a sharp distinct band around 579 on the control ladder. However, on our first trial
the control ladder was bad and this threw off our results. This is because the ladder is the standard bp
scale for measurement. The CG7786 foreward and reverse primer lane had also diffused out a bit
causing a blurry gel band. This could be caused by several or a single band diffusing out. Figure 1
shows gel for CG7786 and CG6272 clones
Cloning and diagnosis of CG7786 into bacterial vector
Our group must have had an issue with our workup because we did not get any results from our
8/9/2019 Effect of RNAi knockdown of CG7786 and CG6272 on border cell migration
5/14
plasmid cutting. We had to borrow another classmates purified plasmids, and using our restriction
enzymes and her plasmids we finally experienced results. The gel in figure 2is the resulting gel. The
signals are faint but visible bands are present. The number of bands created indicated the number of
places a restriction enzyme cut on the plasmid and in CG7786. Lanes E-G showed the clearest results.
Tribble induction
We set out to determine if we could get the TRBL gene transduced and activated in the bacterial
hosts. We succeeded in doing just that. The gene was introduced and activated as demonstrated by our
SDS-polyacrylamide protein gel (Figure 3). We did demonstrated that a dilution of 400 L SB to the
soluble and insoluble fractions yielded better results when electrophoresed at 200 volts based on the
better banding seen in the gel lanes. There were many bands that separated out.
Sequence analysis of CG7786 and CG6272
The blast data did not show any drosophila data which is wrong because when this was done
with other researchers results were obtained. Due to time constraints on the project this issue was not
resolved. However, the data from other team memebers should elucidate better BLAST data.
Developmental analysis of CG6272 and CG7786 RNAi knockdown and Xgal
Immunofluorescence
The RNAi knockdown of CG6272 resulted in a border cell cluster that was not well organized.
The rosette cells even seperated from the polar cell during one migration. The cluster also seemed to
just migrate in random directions. The cluster was seen past the nurse cell-oocyte border and also in the
lateral follicle cell epithelium. CG6272 was expressed in both the polar and rosette cells of the cluster.
See figure 4.
XGAL
The RNAi knockdown results of CG62762 was partly consistant with the immunofluorescence
experiments. The border cell cluster migrated past the border again however the staining shows that
8/9/2019 Effect of RNAi knockdown of CG7786 and CG6272 on border cell migration
6/14
the rosette cells maintained good contact with the polar cells. See figure 5.
proposed molecular models of CG6272 action
There seemed to be a constant failure in migration with the CG6272 RNAi knockdown.
CG6272 does not seem to play a role in the initial formation of the border cell cluster but it may have a
role in activating genes involved in maintaining that cluster.
Materials and Methods:
The protocols that follow were adapted from Laboratory in Genetics, Cell and Developmental
Biology (Dobens, 2009).
Cloning of CG7786 and CG6272 and Tribbles induction
Isolating DNA
25 anesthetized curly winged flies were placed in a 1.5 mL microtube and ground in 400 L of
a buffer containing: 100 mM Tris-HCl, pH 7.5, 100 mM EDTA, pH 8, 100 mM NaCl, 0.5% sds. Then
the tube was incubated at 65o for 30 minutes. 800 L of a salt solution added and placed on ice for 10
minutes to precipitate out proteins from DNA. The salt solution contained: 1 mL KAc from 5 M stock,
2.5 mL LiCl from 6 M stock, and 1.5 mL deionized water. The microtubes were then microfuged for
15 minutes. The supernatant was then poured over to a different tube and 600 L isopropanol added
and tube mixed well. The microtubes were microfuged for 15 minutes and the supernatant again
poured off. The remaining DNA pellet was then washed in 70% ethanol and pellet allowed to air dry.
PCR Design
Two test and two control solutions were formulated with foreword and reverse primers for
CG7786 and CG6272. The primers were: 1) reverse CG6272 TTAGTCATTGTCCTTGGG 2)
foreward CG6272 - ATGCCGGCCAAAAAGAGA 3) CG7786 reverse -
TCACACCTGCCTGGCCATGGACAAC 4) CG7786 foreward -
ATGCACTCGCCCGCCCAGTGCCCCATTTTC. Tube 1 had foreword and reverse primers for
8/9/2019 Effect of RNAi knockdown of CG7786 and CG6272 on border cell migration
7/14
CG7786, tube 2 had foreword primer of CG7786, tube 3 had foreword and reverse primers for
CG6272, and tube 4 had only foreword primers for CG6272. CG7786 tubes were tests and CG6272
tubes were a control. Also in each tube was 47 mL of mastermix. The mastermix was a solution of 30
mL MgCl, 210 mL deionized water, 30 mL 10X Taq polymerase buffer, and 12 mL dNTPs.
Gel electrophoresis
A TAE gel was electrophoresed with two 20 L samples of the amplified PCR products from
both CG7786 and CG6272. 4 L of tracking buffer was added to the 20 L samples. The middle
lane was used for the exACT gene control ladder. The gel was run for 50 minutes on 75 volts. The
resulting gel was stained with ethidium bromide for 30 minutes on a slow rocking rocker. Photos were
then taken with a UV transilluminator. Another gel was run with modified TAE and a new ladder. The
resulting gel was then used for the cloning procedures, however, no results were taken down on this
gel.
CG7786 PCR products were recovered from the modified TAE gel utilizing the Ultrafree-DA
kit. A small slice from the CG7786 band was cut out and placed in the nebulizer and spun in the
microfuged for 10 minutes. For the ligation, 4 L of PCR products placed in an eppendorf tube with 1
L AccepTorTM vector, 5 L ClonablesTM 2X ligation premix. For the transformation, two tubes
were prepared, one for the test and one for the control. A tube of NovaBlue SinglesTM Competent
Cells was taken out of freezer and thawed on ice. In the test tube 1 L of ligation product added with 1
L of cells. In a second tube 1 L of test plasmid placed in with cells. Both tubes placed on ice for 5
minutes. Both tubes then placed in water at 42o
C for exactly 30 seconds and then placed back on ice
for 2 minutes. 125 L SOC medium added to the tubes and tubes allowed to shake for 30 minutes to
promote outgrowth of bacteria. 50 L from each tube were then placed on the LB agar and spread over
the plate. After the incubation 6 tubes were made with 5 mL of LB solution. 6 different CFUs from
the ligation plate were then inoculated in the 6 LB tubes. For the purification of the plasmids, 1.5 mL
8/9/2019 Effect of RNAi knockdown of CG7786 and CG6272 on border cell migration
8/14
of LB solution were added to 6 eppendorf tubes and spun in microfuged until the max speed was
reached. The pellets then dried. 100 L of solution A was added and then vortexed to resuspend the
pellet. Solution A contained 10 mL total: 2 mg/ml lysozyme, 10 mg of crystal, 50 mM glucose, 0.25
mL of 1M, 10 mM EDTA, and 0.1 mL of 0.5M. The tubes were then placed on ice for 30 minutes. 200
L of solution B then added and tubes inverted several times by hand to mix and then placed on ice for
5 minutes. Solution B contains: 0.2N NaOH and 1% SDS. 150 L of solution C added to tubes, the
tubes were inverted by hand to mix, and then placed on ice for 30 minutes. Solution C contains: 3 M
NaAc pH 5.2. The 6 tubes were then microfuged for 10 minutes. 1 mL of 100% ethanol added and and
tubes microfuged for 5 minutes. The ethanol was then poured off and pellet dried. 200 L of solution
D added and then tube vortexed. Solution D contains: 55 mM Tris pH 8 buffer and 0.3 M NaAc. 60
L of ethanol added and tubes microfuged for 5 minutes. This solution was poured off and pellet dried.
The pellet was then re-suspended in 100 L of water.
Diagnosis of CG7786 insertion into vector
When the gel was run for the diagnosis of insertion of CG7786 with our purified plasmids
nothing happened. In a second round of workup we used Susans purified plasmids from her labeled
microtubes 5 and 50. The NEBcutter website was used to determine the best restriction endonucleases
to use to splice out CG7786 from the vector if transformation was successful. The 3 restriction
enzymes used were ClaI, SacI, and HinfI.
In the second workup we used 6 tubes, tubes 1-3 utilized Susans #5 and 4-6 utilized Susans
#50 from Susans tube 50. Tube 1 had 9 L DNA, 2 L nuclease buffer at 10X, 0.5 L of ClaI, 8.5
L water, and 10 L loading buffer. Tube 2 had 9 L DNA, 2 L nuclease buffer at 10X, 0.5 L of
HinfI, 8.5 L water, and 10 L loading buffer. Tube 3 had 9 L DNA, 2 L nuclease buffer at 10X,
0.5 L of SacI, 8.5 L water, and 10 L loading buffer. Tube 4 had 9 L DNA, 2 L nuclease
buffer at 10X, 0.5 L of ClaI, 8.5 L water, and 10 L loading buffer. Tube 3 had 9 L DNA, 2 L
8/9/2019 Effect of RNAi knockdown of CG7786 and CG6272 on border cell migration
9/14
nuclease buffer at 10X, 0.5 L of HinfI, 8.5 L water, and 10 L loading buffer Tube 2 had 9 L
DNA, 2 L nuclease buffer at 10X, 0.5 L of SacI, 8.5 L water, and 10 L loading buffer. The
Loading buffer was added after 15 minutes of cutting. A gel was then run.
TRBLinduction
A 50 mL uninduced culture was induced with IPTG to a 1 mM and placed on the shaker. Two 1
mL aliquots were taken out before the induction and then in 30 minute intervals from the intitial time to
the 2 hour mark. After each 1 mL aliquot was taken out it was immediately centrifuged at max speed
for 1 minute. The supernatant was then removed and the pellet tap dried. The pellets were then
resuspended in 100 L of 1X PBS. 100 L of the 2X sample buffer was then added and sonicated.
For the sonication settings contact Dr. Dobens. The tubes then were heated for 3 minutes in a water
bath at 70oC and then stored in the freezer.
The remaining 40 mL induced culture was spun in microfuged for 5 minutes. A resuspension in
4 mL cold 20 mM Tris 7.5 was made. The solution was transferred to 15 mL tube and capped with 0.4
mL of 10mg/mL lysozyme and incubated for 15 minutes on ice and then sonicated. 1.5 mL was then
transferred to 2 tubes and microfuged for 10 minutes creating pellets. The supernatant was then
transferred to a fresh tube and 200 L of 2X sample buffer was added. The tube was then heated for 3
minutes in a water bath at 70oC to denature and stored in the freezer. The pellets that were formed
were washed in 750 L of 20 mM Tris 7.5 and centrifuged for 5 minutes. A resuspension was then
made in 1.5 mL of 1% SDS by sonication. A 200 L sample was transferred to a separate tube and
200 L SB added and heated at 70oC for 3 minutes and placed in the freezer.
Protein analysis by SDS-polyacrylamide gels
We obtained a preformed polyacrylamide gel and assembled the electrophoresis machine. 125 mL
8/9/2019 Effect of RNAi knockdown of CG7786 and CG6272 on border cell migration
10/14
solution of Tris/glycine/SDS running buffer was added to the inner core until the inner glass plate was
covered. Buffer was then added until it touched the gel. The 6 tubes from the TRBL induction prep
were spun for 2 minutes and heated at 75oC for 90 seconds. The tubes were then diluted with 400 L
of SB. 3 ML were added to the lanes and the gel was ran at 200 volts for about 30 minutes. When the
gel was dried it cracked into pieces as shown in
Sequence analysis of CG7786 and CG6272
A nucleotide BLAST was run with both CG7786 and CG6272 primers: 1) reverse CG6272
TTAGTCATTGTCCTTGGG 2) foreward CG6272 - ATGCCGGCCAAAAAGAGA 3) CG7786
reverse - TCACACCTGCCTGGCCATGGACAAC 4) CG7786 foreward -
ATGCACTCGCCCGCCCAGTGCCCCATTTTC . All the default settings were used in the BLAST.
Preparations of CG6272 and CG7786 knockdown ovaries
Xgal staining
Anesthetized flies were separated out and their ovaries dissected out and placed in premixed
solution of 400 L PBS and BSA. Once collected, the ovaries were washed in 400 L 1X PBS in a
1.5 mL microtube. The PBS was pipetted out and ovaries fixed with a solution 400 L of 4%
paraformaldehyde and PBS for 15 minutes. The fix was removed and the ovaries washed 3 times in
400 L PBS for 5 minutes. The wash was removed and 400 L of embryo stain solution with Xgal.
The solution was then incubated overnight. The next day the stain solution was removed and the
ovaries were washed 3 times in PBT. The egg chambers were released from the ovaries by pipetting
them several times. The egg chambers were then washed in a solution of 50% glycerol in PBS. The
eggs were then mounted in 50% glycerol in PBS on a slide and analyzed by light microscopy. For any
solution contents please contact Dr. Dobens.
Immunofluorescence
Anesthetized flies were separated out and their ovaries dissected out and placed in premixed solution of
8/9/2019 Effect of RNAi knockdown of CG7786 and CG6272 on border cell migration
11/14
400 L PBS and BSA. Once collected, the ovaries were washed in 400 L 1X PBS in a 1.5 mL
microtube. The PBS was pipetted out and ovaries fixed with a solution 400 L of 4%
paraformaldehyde and PBS for 15 minutes. The fix was removed and the ovaries washed twice in 400
L
NPS. The wash was removed and blocked with 250 L
and 150 L
of NPS overnight. The block
solution was removed and the ovaries washed two times in 400 L of NPS at 5 minutes per wash. The
egg chambers were released from the ovaries by pipetting them several times. 1:50 NPS:Drosophila E-
cadherin antisera was added by the lead researcher (Dr. Dobens). Then he removed the excess primary
stain and washed 2 times in NPS. A secondary antisera protocol was then done by Dr. Dobens. We
then removed this secondary stain and washed 3 times in NPS. The final wash was done in 1X 50%
glycerol in PBS for 5 minutes. The eggs were then mounted in 50% glycerol in PBS on a slide and
analyzed by confocal microscopy.
Fly strains
The ovaries came from flies that were the results of the cross between SLBO GAL4, UAS-GFP
x UAS-SLBO and SLBO GAL4, UAS-GFP/Cyo x 10709 (SLBO RNAi). Other researchers prepared
the lines for the CG6272 and CG7786 knockdowns
----------------------------------------------------------------------------------------------------------------------------
----------------------------------------------------------------------------------------------------------------------------
8/9/2019 Effect of RNAi knockdown of CG7786 and CG6272 on border cell migration
12/14
Figure 1. TAE and 1.5% agarose gel with a poor control ladder in the middle lane. The ladder should have 10 bands
instead of the 3 that cam out.. One the very bottom lane there is a blurred area around the assumed 579 bp region. In the
second to lowest lane was a string of bands which should not have been there. On the very top lane is CG6272. This bandshows the same diffuse bands as CG7786
Figure 2. Plasmid gel. A) lane for the ladder B) 5, ClaI C) 5, HinfI D) 5, SacI E) 50, ClaI F) 50, HinfI G) 50, SacI
Figure 3. The solutions of the soluble fraction and insoluble fractions that were diluted with 1X SB ran better at 200 voltsA) Kaleidoscope ladder B) 0 minutes C) 30 minutes D) 60 minutes E) 120 minutes F) soluble fraction G) insoluble fraction
H) soluble fraction diluted with 400 ML solution of 1X SB I) insoluble fraction diluted with 400 ML solution of 1X SB
8/9/2019 Effect of RNAi knockdown of CG7786 and CG6272 on border cell migration
13/14
Figure 4. (1) RNAi knockdown of CG7786 had no effect (2-4) RNAi knockdown of CG6272 displays random migration
with slides 2 and 3 showing disorganized border cell clusters. In slide 2 a rosette cell totally dissociates from the cluster.
Figure 5. (2) RNAi knockdown of CG7786 resulted in a weak failure of the border cells to migrate in. (1) shows that the
border cells have made it to the border. (3) RNAi knockdown of CG6272 resulted in no failure of migration. The border
cell cluster maintained its integrity as a migrating cluster. (4) Border cell cluster did maintain its integrity, however, thecluster overshot the border and looks to have migrated into the oocyte.
8/9/2019 Effect of RNAi knockdown of CG7786 and CG6272 on border cell migration
14/14
Sources
Christopher Deppmann, Rebecca Alvania, and Elizabeth Taparowsky. 2006.Cross-Species Annotation
of Basic Leucine Zipper Factor Interactions: Insight into the Evolution of Closed Interaction Networks.Mol. Biol. Evol. 23(8): 1480-1492
Sally Horn-Badovinac and David Bilder. 2005. Mass Transit: Epithelial Morphogenesis in theDrosophila Egg Chamber.Dev. Dyn. 232: 559-574
Jan Fassler, David Landsman, Asha Acharya, et al. 2002. B-ZIP Proteins Encoded by the Drosophila
Genome: Evaluation of Potential Dimerization Partners. Genome Res. 12:1190-1200.
Denise J. Montell. 2003. Border Cell Migration: the Race is on.Nature Reviews. 4: 13-24.
Benjamin Levine, Jennifer F. Hackney, Andrew Bergen, Leonard Dobens III, Angela Truesdale and
Leonard Dobens. Unpublished. Opposing interactions between Drosophila Cut and the C/EBP encoded
by Slow Border Cells direct apical constriction and epithelial invagination. Unpublished data
Denise Montell, Pernille Rorth, and Allan Spradling. 1992. Slow Border Cells, a Locus Required for a
Developmentally Regulated Cell Migration during Oogenesis, Encodes Drosophila C/EBP. Cell71: 51-62.
Pernille Rorth. 1994. Specification of C/EBP Function During Drosophila Development by the BZIP
Basic Region. Science 266: 1878-1881.
Pernille Rorth, Kornelia Szabo, and Gemma Texido. 2000. The level of C/EBP Protein is Critical for
Cell Migration during Drosophila Oogenesis and is Tightly Controlled by Regulated Degradation.Molecular Cell. 6: 23-30.
Erika R. Geisbrecht and Denise J. Montell. 2002. Myosin VI is required for E-cadherin-mediatedborder cell migration.Nature Cell Biology. 4:616 - 620
Charles Vinson, Paul Sigler, and Steven McKnight. 1989. Scissors-Grip Model for DNA Recognition
by a Family of Leucine Zipper Proteins. Science 246: 911-916