ORIGINAL PAPER
Effects of antioxidants on Agrobacterium-mediated transformationand accelerated production of transgenic plants of Mexican lime(Citrus aurantifolia Swingle)
M. Dutt • M. Vasconcellos • J. W. Grosser
Received: 12 January 2011 / Accepted: 1 April 2011 / Published online: 6 May 2011
� Springer Science+Business Media B.V. 2011
Abstract Four antioxidants including glycine betaine,
glutathione, lipoic acid, and polyvinylpyrrolidone were
evaluated to improve transformation efficiency of Mexican
lime, a precocious but recalcitrant citrus cultivar to Agro-
bacterium mediated transformation. Lipoic acid substan-
tially improved the transformation efficiency of Mexican
lime by aiding in callus development and improving shoot
growth from cut ends of epicotyl segments co-cultivated
with Agrobacterium. Glycine betaine was moderately
beneficial while glutathione and polyvinylpyrrolidone did
not have the ability to improve the transformation effi-
ciency. A bi-functional gus-egfp fusion gene used in the
study enabled visual identification of transformants and
quantitative analysis of gene expression. We describe an
improved protocol that allows regenerated transgenic
plants to flower within 20–22 months after in vitro regen-
eration. This enabled the rapid evaluation of transgenic
flowers and fruits. Gene expression levels could not be
correlated to copy number as determined using Southern
blot analysis. Our improved transformation method facili-
tates the rapid production and evaluation of transgenic
plants, especially regarding the functional analysis of
transgenes in citrus.
Keywords Agrobacterium tumefaciens � Bifunctional
gene � Citrus � EGFP � Glycine Betaine � Glutathione �Lipoic acid � Mexican lime � Transformation �Polyvinylpyrrolidone
Abbreviations
BAP 6-Benzylaminopurine
EGFP Enhanced green fluorescent protein
GB Glycine betaine
GSH Glutathione
LA Lipoic acid
MS Murashige and Skoog medium
NAA Napthyleneacetic acid
PVP Polyvinylpyrrolidone
TE Transformation efficiency
YEP Yeast extract peptone
Introduction
Genetic manipulation and modification of citrus using
conventional methods remain challenging due to the time
required to obtain a suitable progeny that integrates useful
traits from either of its parents. Introgression to transfer a
single trait into citrus by conventional breeding is also
impractical due to citrus’ long generation time. The juve-
nile period can range from up to 6 years for mandarins, to
over 8 years for sweet oranges (Ligeng et al. 1995).
Genetic transformation facilitates rapid plant improvement,
especially in cases where changes through the addition of
one or more genes are necessary, while preserving cultivar
integrity.
Citrus is not considered to be a natural host for Agro-
bacterium tumefaciens (Pena et al. 2004) and has been
observed to be the least susceptible to infection in a range
of woody plants evaluated (Martin 1987). In spite of this,
T-DNA transfer and its integration into the plant genome
by Agrobacterium has become the most widely used
M. Dutt � M. Vasconcellos � J. W. Grosser (&)
University of Florida-IFAS, Citrus Research and Education
Center (CREC), 700 Experiment Station Road, Lake Alfred,
FL 33850, USA
e-mail: [email protected]
123
Plant Cell Tiss Organ Cult (2011) 107:79–89
DOI 10.1007/s11240-011-9959-x
method for incorporation of specific genes into citrus.
Several reproducible protocols have been developed for
efficient transformation of citrus (Cervera et al. 1998; Dutt
and Grosser 2009; Zou et al. 2008). The fact that citrus is
easy to manipulate in vitro and amenable to most cell
culture techniques has aided in development of technolo-
gies for incorporation of transgenes into the genome
(Grosser et al. 2000).
The competence for Agrobacterium mediated transfor-
mation of citrus is cultivar dependent. Trifoliate orange
derived cultivars (Poncirus trifoliata L. Raf. and its
hybrids) are generally easier to transform, while sweet
orange (C. sinensis (L.) Osbeck) and mandarin (Citrus
reticulata Blanco) cultivars are more difficult (Dutt et al.
2009; Pena et al. 1995). This is directly related to regen-
eration capacity of an individual cultivar in vitro (via
organogenesis) since the capacity of cell proliferation and
subsequent regeneration following infection affects the
transformation efficiency (Fuentes et al. 2004; Pena et al.
2004; Sangwan et al. 1992; Villemont et al. 1997).
Therefore, cells have to be both competent for transfor-
mation and regeneration before transgenic plants can be
obtained (Potrykus 1991).
In most citrus cultivars, the long juvenile phase delays
functional analysis of incorporated genes, especially genes
related to flowering and fruiting. An early flowering trifo-
liate orange has been described to possess a short juvenile
phase of about 14 months (Tong et al. 2009). However,
availability of this cultivar for genetic transformation
experiments remains restricted. Mexican lime (Citrus
aurantifolia Swingle) is a vigorous and widely adapted
cultivar that normally flowers, when raised from seed,
within 36–48 months. Mexican lime flowers and fruits
throughout the year, providing a continuous supply of fresh
seeds used as plant material in Agrobacterium mediated
transformation experiments. This cultivar also has a high
regeneration potential. However, a low affinity for Agro-
bacterium results in low transformation efficiency (TE)
(Dutt and Grosser 2009; Pena et al. 1997).
In cultivars that possess recalcitrance to Agrobacterium
infection, the tissues or cells get stressed when excised and
inoculated with Agrobacterium. This can limit the sub-
sequent morphogenetic potential (Dan et al. 2009). Cells
produce free radicals or reactive oxygen species (ROS)
which are byproducts of metabolism, and excessive accu-
mulation of such compounds as observed in stressed cells
can result in oxidative stress (Dan et al. 2009; Perl et al.
1996) and possibly damaged cells (Dan 2008). Antioxi-
dants which function as non-enzymatic ROS scavengers
have been shown to delay or prevent oxidation of proteins,
lipids, carbohydrates, and DNA when present at low con-
centrations (Halliwell and Gutteridge 1990; Halliwell et al.
1995; Uchendu et al. 2010).
In this study, we investigate the effect of antioxidants in
regeneration medium on the transformation efficiency of
Mexican lime. We also describe an improved regeneration
protocol that reduces the time required for flowering and
allows transgenic plants to flower within 20–22 months
after regeneration. Our protocol could be used in produc-
tion and subsequent analysis of a large number of plants for
functional analysis of transgenes in citrus.
Materials and methods
Plasmid construction
The plasmid pBI434 (Datla et al. 1991) was used as a
template for isolation of the b-glucuronidase gene (gus or
uidA) gene. The gus coding sequence was amplified by PCR
using Ex Taq Polymerase (Takara Bio USA, Inc., WI, USA)
and gus specific oligonucleotide primers. A forward primer
(GUS-F51) 50TGGATCCCCGGGATGTTACGTCC30 was
designed to introduce a BamHI site immediately upstream
of the translation start site. A reverse primer (GUS-F32)
50CCCTGCAGTTGTTTGCCTCCCTGCT30 was designed
to remove the stop codon with added PstI restriction site
engineered into the primer (bold letters). The 1.8 kb gus
fragment was isolated, purified, and cloned into pGEM�-T
Easy plasmid (Promega Corp, WI, USA) resulting in the
plasmid pGUS-F. The gus gene was excised as a BamHI/
PstI fragment from pGUS-F. An egfp gene fragment, cloned
from pEGFP (Clontech Lab, Inc., CA, USA) into the plas-
mid pGEF (Dutt et al. 2010) was excised as a PstI/NotI
fragment. The two fragments were ligated into the unique
BamHI/NotI cloning site between a double enhanced CaMV
35S promoter (d35S) and a CaMV 35S terminator (35S-30)in a pUC18-derived plasmid pDR to form plasmid pUGG. A
3.7 kb HindIII DNA fragment containing the expression
cassette d35S-gus-egfp-35S-30 was isolated and cloned into
the unique HindIII site of pCAMBIA2300 to form the
plasmid pCAM-GG (Fig. 1). All cloning was verified first
by restriction analysis and then by DNA sequencing. The
binary plasmid was introduced into Agrobacterium tum-
efaciens strain EHA105 (Hood et al. 1993) by the freeze–
thaw method (Burow et al. 1990).
Culture media
Seed germination medium consisted of MS salts with
vitamins (Murashige and Skoog 1962) supplemented with
30 g/l sucrose and 7 g/l agar, pH 5.8. Co-cultivation
medium (CM) consisted of MS salts and vitamins supple-
mented with 13.2 lM BAP, 0.5 lM NAA and 4.5 lM 2,4-
D, 30 g/l sucrose, 0.5 g/l 2-(N-morpholino) ethanesulfonic
acid (MES), pH 5.8. Cut explants were incubated in liquid
80 Plant Cell Tiss Organ Cult (2011) 107:79–89
123
CM medium before transformation while solid CM med-
ium (CM medium containing 100 mM acetosyringone and
solidified with 8 g/l agar) was used for subsequent incu-
bation. Regeneration medium (RM) consisted of MS salts
and vitamins supplemented with 13.2 lM BAP and 2.5 lM
NAA and containing 0.5 g/l MES, 30 g/l sucrose and 8 g/l
agar. pH was adjusted to 5.8 before autoclaving. Glycine
Betaine (GB), Glutathione (GSH), and Polyvinylpyrroli-
done (PVP) were dissolved in deionized water. Lipoic acid
(LA) was dissolved in a few drops of 1 N KOH and volume
made up with deionized water. The antioxidants were filter
sterilized before addition to autoclaved medium. The
medium also contained antibiotics [kanamycin (70 mg/l)
and timentin (400 mg/l)] for selection of transgenic shoots
and preventing Agrobacterium growth, respectively.
Plant materials and Agrobacterium mediated
transformation
Mexican lime fruits were collected from a single tree
located at the Citrus Research and Education Center’s
grove. Seeds were extracted and germinated in 15 cm-long
glass culture tubes. Light green epicotyl segments as
explants were used for transformation. Epicotyl segments
were harvested and cut obliquely into 1 inch-long seg-
ments to expose the cambial ring. These segments were
incubated in liquid CM medium for 3 h before incubation
with Agrobacterium (Dutt and Grosser 2009).
Agrobacterium cells were grown as described earlier
(Dutt and Grosser 2009). The OD600 was adjusted to 0.3
with liquid CM medium before incubation. Explants were
incubated in Agrobacterium suspension for 5 min and
blotted dry on sterile paper towels. Dried explants were
subsequently placed on solid CM medium, and incubated
in the dark at 25�C for 2 days before transfer to RM sup-
plemented with different antioxidants. Explants were cul-
tured in the dark for 2 weeks at 26�C followed by
incubation in light [16 h light/8 h dark cycle using cool
white fluorescent light (75 lmol s-1 m-2)]. The transfor-
mation efficiency of putatively transgenic shoots was
evaluated as the number of GFP-positive plants compared
to total number of explants inoculated.
An Agrobacterium co-infiltration assay to evaluate
transient fusion gene expression was carried out using
young Nicotiana benthamiana Domin plants as described
by Dutt et al. (2010).
Regeneration and recovery of transgenic plants
After 2 biweekly transfer cycles onto fresh regeneration
medium containing antibiotics, transgenic shoots that
expressed stable, non-chimeric GFP-specific fluorescence
were transferred onto RMG medium (Dutt and Grosser
2009). After a month of culture in vitro on this medium,
shoots were micrografted ex vitro essentially as described
by Dutt and Grosser (2010) with minor modifications.
Briefly, tender shoots containing the apical meristem were
micrografted onto 1 year-old Carrizo citrange rootstock (C.
sinensis Osb. 9 P. trifoliata L. Raf.) whose growth had
been restricted in D40 Deepots (6.4 cm cell diame-
ter 9 25 cm cell depth; Stuewe & Sons, Inc., OR, USA).
The rootstock was decapitated 20–24 cm above the soil
level and a cut made in the center of the stem through the
pith. A tapering cut was made on the transgenic stem and a
wedge graft union was established. To stabilize the graft
union, a thin strip of Nescofilm� was used to wrap around
the wedge and finally the plant was ‘capped’ with a 1 ml
pipette tip.
Micrografted transgenic plants were transferred into a
Percival Scientific growth chamber (Model E-36L; Percival
Scientific, Inc., IA, USA) on a 34�C/28�C temperature and
18 h/6 h day/night illumination regimen. The light inten-
sity was approximately 550 lmol/m2/s. Plants were main-
tained in the incubator for 2 months and fertilized weekly
with 20-10-20 Peat-Lite fertilizer (The Scotts Company,
OH, USA) at a 50 ppm nitrogen rate. Subsequently, plants
were transferred into 10 cm 9 10 cm 9 32 cm citri-pots in
a peat-based commercial potting medium (Metromix 500,
Sun Gro Horticulture, WA, USA) and acclimated to
greenhouse conditions. Five grams of Harrell’s 18-5-10, a
12 month nursery polyon (Harrell’s LLC, FL, USA) was
incorporated into the potting mix before planting. Plants
were fertilized once every 2 weeks with the 20-10-20 Peat-
Lite fertilizer and the greenhouse was maintained at a
constant 32�C/22�C day/night temperature regime. Trans-
genic plants were girdled after 16 months of growth in order
to induce flowering.
Evaluation of GUS and GFP expression
Leaves were histochemically stained for GUS activity as
described by Jefferson (1989) with the following minor
modifications. Explants were vacuum infiltrated for 5 min
Fig. 1 Schematic representation of T-DNA region of the pCAMBIA2300 based pCAM-GG binary vector containing nptII as a selectable marker
gene. The T-DNA also contained a bifunctional gus-egfp gene driven by a d35S promoter. Arrow indicates the unique EcoRI site
Plant Cell Tiss Organ Cult (2011) 107:79–89 81
123
in a phosphate buffer solution [200 mM NaH2P04, pH. 7.0;
10 mM EDTA and 0.2% triton X-100]. Subsequently,
X-Gluc (5-bromo-4-cloro-3 indolyl-b-D-glucuronide) dis-
solved in DMSO was added at a final concentration of
1 mg/ml. The explants were incubated in the dark at 37�C
for 12 h. After incubation, the explants were destained in
ethanol:acetic acid (3:1) for 12 h to eliminate background
chlorophylls and other pigments present in stained tissues.
A quantitative fluorometric GUS assay was performed as
outlined in the FluorAce b-Glucuronidase Reporter Assay
Kit (Bio-Rad Laboratories, CA, USA). Briefly, 20–40 lg
of total protein was added to 500 ll of assay buffer.
Samples were incubated in a 37�C water bath for 30 min
before the reaction was terminated by the addition of 19
Stop buffer. Samples were measured in a VersaFluor
Fluorometer (Bio-Rad Laboratories, CA, USA). The total
soluble protein of each sample was determined using the
Coomassie (Bradford) Protein Assay Kit (Thermo Fisher
Scientific Inc., IL, USA). The relative GUS activity was
expressed as p mol MU/mg protein/min.
GFP fluorescence in co-infiltrated N. benthamiana
leaves was visualized by using a 100 W, hand-held, long-
wave ultraviolet lamp (Blak-Ray B-100AP, Ultraviolet
Products, CA, USA) 4 days after infiltration. GFP-specific
fluorescence in transgenic Mexican lime was evaluated
using a Zeiss SV11 epi-fluorescence stereomicroscope
equipped with a light source consisting of a 100Wmercury
bulb and a FITC/GFP filter set with a 480 nm excitation
filter and a 515 nm longpass emission filter producing a
blue light (Chroma Technology Corp., VT, USA).
Reverse transcriptase PCR (RT PCR)
RNA was isolated from 100 mg of transgenic and non-
transgenic leaf tissue using an RNeasy Mini Kit (Qiagen
Inc., CA, USA). Five hundred ng total RNA was used in
Reverse Transcriptase PCR (RT PCR) using gus gene
specific primers [GUS-FRT, 50CAACAGGTGGTTGCAA
CTGGACAA30 and GUS-RRT, 50TTCAGCGTAAGGG
TAATGCGAGGT30] and egfp gene specific primers
[EG-FRT, 50TGACCCTGAAGTTCATCTGCACCA30 and
EG-RRT, 50CACCTTGATGCCGTTCTTCTGCTT30]. A
Qiagen OneStep RT–PCR kit was used for amplification.
Amplified DNA fragments were electrophoresed on a 1%
agarose gel containing GelRedTM Nucleic Acid Gel Stain
(Biotium, Inc., CA, USA) and visualized under UV light.
Polymerase chain reaction (PCR) and Southern blot
hybridization
Polymerase Chain Reaction (PCR) was performed with
genomic DNA isolated using a Qiagen DNeasy Plant Maxi
Kit (Qiagen Inc., CA, USA) as a template. GoTaq� Green
Master PCR Mix (Promega Corp, WI, USA) with gus-egfp
specific oligonucleotide primers (GUS-F51 and EG-32,
50CTTGTACAGCTCGTCCATGCCGAGA30) were used
for PCR. Amplified DNA fragments were visualized as
mentioned earlier. Fifteen lg of Eco RI digested genomic
DNA was used to detect copy number of individual
transgenic plants. Southern blot protocol was as described
by Dutt and Grosser (2010).
Results and discussion
Transient gene expression using Agrobacterium co-
infiltration assay
Our results demonstrated that the gus-egfp fusion gene was
functional in N. benthamiana, and visual GFP expression
was observed in leaves infiltrated with a mixture of pCAM-
GG and pHCPRO in a 1:1 ratio (Fig. 2). We used the
pHCPRO RNA silencing suppressor to prevent post-tran-
scriptional gene silencing (PTGS) (Voinnet et al. 2003).
Silencing suppressors reverse RNA silencing and thereby
Fig. 2 The green fluorescence image of a co-infiltrated Nicotianabenthamiana leaf, infiltrated with equal volumes of an AgrobacteriumEHA105 culture containing pCAM-GG together with an Agrobacte-rium EHA105 culture containing the HCPRO construct (left side).
The right side of the leaf was infiltrated with only HCPRO. GFP
expression on the leaves was photographed 4 days post-infiltration.
The leaf was visualized under a 100 W, hand-held, longwave UV
lamp. Inset shows histochemically stained GUS expressing leaf cells.
RT–PCR of total RNA from leaves 4 days post-infiltration is also
shown
82 Plant Cell Tiss Organ Cult (2011) 107:79–89
123
effectively aid transgene expression (Brigneti et al. 1998).
Histochemical staining of leaves demonstrated gus gene
activity. RT–PCR results demonstrated similar levels of
gus and egfp mRNA.
Effect of antioxidants on plant regeneration
Mexican lime is considered to be recalcitrant to Agrobac-
terium mediated transformation (Dutt et al. 2009). Seeds
produce thin epicotyls which are the primary source of
explants for Agrobacterium mediated transformation. It has
been observed that following co-cultivation, a majority of
target cells in cut explants fail to divide and subsequently
produce callus. Production of transformed callus, arising
from the cambial ring, is required for subsequent indirect
organogenesis and production of transgenic shoots (Pena
et al. 2004), as efficient Agrobacterium infection occurs in
actively dividing cells (Akama et al. 1992). Therefore, the
recalcitrance to transformation as observed in Mexican
lime explants treated with Agrobacterium could be asso-
ciated with the timing of cell division at the wound site
(Braun and Mandle 1948). Tissues or cells can also be
stressed following inoculation with Agrobacterium. This
limits the growth potential of Agrobacterium treated cells
in tissue culture media (Dan et al. 2009). Antioxidants
function to protect cells from stress inducing compounds
that can result in free radical induced cell damage. Anti-
oxidants can minimize cell damage following transforma-
tion (Dan et al. 2009), as they are known for scavenging
free radicals (Navari-Izzo et al. 2002).
We used the antioxidants LA, GB, GSH, and PVP to
evaluate their effect on TE by supplementing them into the
RM shoot regeneration medium. TE was highest when
explants were placed in medium supplemented with 50 lM
LA. The results indicated a fivefold increase in TE over
control explants (Fig. 3). The 100 lM treatment also sig-
nificantly improved the TE but was not statistically sig-
nificant over the 50 lM treatment. TE further decreased
with the 200 lM treatment. However, LA at 400 lM was
detrimental for regeneration and reduced TE to less than
the control (results not shown). LA was the only antioxi-
dant in our study that resulted in a fivefold increase in
efficiency over the control explants. Improved callus
development at cut ends of epicotyl segments incubated
with Agrobacterium and improved shoot growth were
observed. Reduced browning of Agrobacterium-treated
tissues was also observed when epicotyl segments were
placed in LA containing medium. Reduced browning fol-
lowing application of LA has also been observed in other
species such as soybean and tomato (Dan et al. 2009). LA
functions by reducing the degree of tissue necrosis and
oxidation of phenolic compounds. It can also permeate
Fig. 3 Transformation
efficiency of Mexican lime after
Agrobacterium mediated
transformation using pCAM-
GG. After a 2 days co-
cultivation period, treated
explants were placed in various
levels of antioxidants
incorporated into RM shoot
regeneration medium. Data was
collected after 6 weeks in
culture. LA Lipoic Acid, GBGlycine Betaine, GSHGlutathione, PVPPolyvinylpyrrolidone. Verticallines represent standard errors.
Means within treatments
followed by the same letter were
not different at a = 0.05 using
Tukey’s test
Plant Cell Tiss Organ Cult (2011) 107:79–89 83
123
easily through cell walls (Packer and Tritschler 1996) and
has been reported to significantly improve the rate of
transformation of several cultivars of tomato, potato, soy-
bean, wheat, and cotton that were considered to be recal-
citrant (Dan et al. 2004; Dan 2008).
The addition of GB to RM had a beneficial effect on TE
although it was not as significant as LA. Amongst the
treatments, statistically significant improvement in TE over
control was observed with 200 lM and 400 lM of the
antioxidant in RM. However, both these treatments were
not statistically different from each other. Improved TE
was observed when 100 lM GSH was added to the med-
ium. However, there was no statistical difference between
this and other treatments. GB and GSH both protects shoots
against abiotic stresses (Wang and Deng 2004; Chen and
Murata 2008). GB also maintains membrane integrity
(Jolivet et al. 1982). Exogenous application of GB can
result in improved stress tolerance (Agboma et al. 1997;
Gorham and Jokinen 1998; He et al. 2010). Similarly, GSH
is a redox-active molecule that has been observed to take
part in a variety of antioxidant reactions (Appenzeller-
Herzog 2011). It also functions as a cellular protectant
(Kumar et al. 2009) and enhances cell division (Wei et al.
2010). However, in this study, application of GB or GSH to
regeneration medium was not as effective as LA to ame-
liorate the stressful conditions that can occur after Agro-
bacterium mediated transformation.
PVP prevents oxidative browning in wounded tissues
(Saxena and Gill 1986) and can adsorb phenol-like sub-
stances exuding from the cut tissues (Ko et al. 2009). This
has been observed to be via a hydrogen bonding mecha-
nism (Figueiredo et al. 2001). In our experiments, none of
the PVP treatments was effective in improving the TE of
Mexican lime. Overall, higher levels of antioxidant incor-
poration to RM were detrimental and reduced the trans-
formation efficiency. It is possible that high levels of
antioxidants affected the electron transport system, thus
disturbing energy metabolism/allocation (Malabadi and
Van Staden 2005).
Visualization of GFP expression in putative transgenic
plants
Following transformation and regeneration of plants,
transgene expression was monitored by observing green
fluorescence protein (GFP) expression in the leaves. GFP
expression allowed us to easily discriminate between
transgenic plants and escapes. Two main patterns of GFP
expression were observed when regenerated transgenic
plants were visualized under an epi-fluorescence stereo-
microscope. In the first, homogeneous pattern of green
fluorescence in all parts of the plantlet was observed. In the
second, the leaf cuticles and stomatal cells were bright
green while it was difficult to observe GFP expression in
the remainder of the leaf (data not shown). PCR on trans-
genic plants regenerated following identification based on
GFP expression confirmed the presence of the fusion gus-
egfp gene in the plant’s genome. An expected 2,570 bp
fragment was observed from each transgenic line (Fig. 4).
Rapid production of transgenic Mexican lime plants
Numerous transgenic shoots were observed to grow from
the explants following Agrobacterium mediated transfor-
mation. GFP positive shoots were transferred onto RMG
medium (Dutt and Grosser 2009) for growth and elongation
before being micrografted ex vitro. Micrografting of
transgenic plants was carried out on juvenile rootstock
plants that were kept root bound. Root growth restriction
allowed us to control the size and growth of plants for a
year after transplant into D40 Deepots. Root growth
restrictions have also been reported to accelerate phase
change (Zimmerman 1972). Micrografted plants could be
rapidly grown under controlled temperature and light
conditions. Plants when transplanted into citri-pots devel-
oped rapidly following removal of root growth restrictions.
Also, applications of low levels of liquid fertilization
(50 ppm nitrogen) at every third watering prevented root
damage. Incorporation of controlled release fertilizers
Fig. 4 Amplification products obtained from PCR of genomic DNA
of transgenic citrus plants with gus-egfp specific oligonucleotide
primers (GUS-F51 and EG-32) which successfully amplified the
expected 2,570 bp fragment (arrow). M, 1 kb marker; 1–10 are 10
individual transgenic lines; NC, negative control using DNA from
non-transgenic leaf; PC, positive control using pCAM-GG plasmid
DNA as a template
84 Plant Cell Tiss Organ Cult (2011) 107:79–89
123
allowed greater nutrient uptake efficiency with lower
leaching losses (Shoji and Gandeza 1992) and allowed
greater N uptake and seedling growth (Dou and Alva
1998).
Carbohydrate levels in the plant is one of the limiting
factors for flower formation in citrus (Goldschmidt and
Golomb 1982; Ogaki et al. 1963). It is thought that
reproductive organs benefit from the higher concentration
of assimilate available to them following girdling (Li et al.
2003). In order to increase the assimilate levels transgenic
plants were girdled after 16 months of growth. Girdling
was done to prevent downward movement of photosynth-
ates and metabolites through the phloem (Goren et al.
2003). Citrus trees flower in spring and girdling during
October–November in the northern hemisphere allows
flower development in February–March (Goldschmidt
et al. 1985). Mexican lime however will produce flowers
repeatedly throughout warm months of the year, so fruit in
various stages of development are found on a tree at the
same time. Therefore, girdling in this cultivar can be per-
formed at any time of the year. We girdled 8 individual
transgenic lines, of which 6 flowered within 4 months of
girdling. Our protocol allowed trees to flower within
20–22 months of regeneration. Trees produced normal
flowers and mature fruits were harvested for analysis after
6 months of growth. There was no difference in flowering
time of plants regenerated from the different antioxidant
treatments.
Transgene expression in Mexican lime
Gene expression (egfp) in both juvenile (Fig. 5) and mature
plant (Fig. 6) was evaluated by relative RT PCR. A com-
parison of the results revealed variable gene expression in
different plants as well as tissue types. We evaluated six
transgenic lines, all of which were observed to be pheno-
typically normal. The conserved cytochrome oxidase
(COX) gene was chosen as an internal control. egfp mRNA
expression patterns in juvenile leaves were generally uni-
form in all lines except for line 5, where the gene was
significantly down regulated. In the juvenile stem, 4 of 6
transgenic lines exhibited uniform expression while the
gene was significantly down regulated in lines 4 and 5
(Fig. 5).
Levels of egfp mRNA expression in mature tissues
could not be fully correlated with juvenile tissues (Fig. 6).
In transgenic leaves, egfp mRNA was significantly down
regulated in lines 4 and 5, while the other lines had high
levels of expression. Gene expression in the stem was
significantly down regulated as the plants progressed from
the juvenile to the mature phase. Line 6 was the only line in
which gene expression remained constant. In addition, we
evaluated gene expression in flowers and fruits of these
transgenic lines. Lines 4 and 5 had down regulated mRNA
expression in flowers Although mRNA expression was
down regulated in lines 3–6 in fruits (Fig. 6), egfp activity
could be visually detected in all parts of the flower and fruit
(Fig. 7).
Fig. 5 Reverse Transcriptase PCR of egfp mRNA from total RNA of
6 juvenile transgenic lines (L1 to L6, leaf; S1 to S6, stem). CON is
RNA obtained from a non-transgenic plant. RNA was obtained after 3
months of ex vitro growth. To examine the accuracy of the RTPCR
process, the conserved cytochrome oxidase (COX) gene was used as
control
Fig. 6 Reverse Transcriptase PCR of egfp mRNA from total RNA of
6 mature transgenic lines (L1 to L6, leaf; S1 to S6, stem; FL1 to FL6;
flower and FR1 to FR6; fruit). CON is RNA obtained from a non-
transgenic plant. RNA was obtained at the time of fruit harvest. To
examine the accuracy of the RTPCR process, the conserved
cytochrome oxidase (COX) gene was used as control
Plant Cell Tiss Organ Cult (2011) 107:79–89 85
123
The GUS protein is very stable under physiological
conditions and is commonly used in both histochemical
localization as well as fluorometric analysis of promoter
activity (Jefferson 1989). Juvenile and mature transgenic
leaves were assayed for GUS activity by the fluorometric
method. Our results demonstrated a pattern similar to that
observed for egfp expression using RTPCR (Fig. 8).
Leaves from transgenic Mexican lime plants demonstrated
a variable expression pattern and generally younger leaves
demonstrated a higher specific GUS activity than older
leaves. The rate of mRNA transcription and/or mRNA
stability determined the amplification observed using
RTPCR. In our study, we observed egfp gene expression to
be developmentally regulated and varied from plant to
plant and tissue types. The usefulness of GFP is limited in
plants due to autofluorescence in various plant organs and
calli. A GUS fusion provides sensitivity needed for plant
screening. An advantage of fusing gus with egfp is that
both GUS and GFP can tolerate N-terminal as well as
C-terminal protein fusions, allowing the fusion in either
orientation (gus-egfp or egfp-gus) (Cubitt et al. 1995;
Quaedvlieg et al. 1998). Fusion marker genes also aid to
reduce undesirable interactions among neighboring pro-
moters since it results in reduction of number of promoters
required for expression of multiple genes (Li et al. 2001).
We used the 35S promoter since it drives high levels of
gene expression in dicot plants in a constitutive manner
(Jefferson 1989; Odell et al. 1985). However, any promoter
can be used to drive this fusion gene. We did not analyze
gene activity in roots as our transgenic plants had been
grafted onto non-transgenic rootstocks. It is possible to root
transgenic Mexican lime in RMM medium (Dutt and
Grosser 2009). However, such plants are slower in growth
when compared to grafted plants (unpublished).
Fig. 7 Transgenic Mexican
lime expressing GFP as
visualized under an
epifluorescent microscope.
a Apical meristem; b Leaf;
c Unopened flower bud; d Fully
open flower; e Pistil; f Stamens;
g Juice vesicle, and h Cross
section of a fruit. The scale barrepresents 1 mm for all figures
Fig. 8 Fluorometric assay for
GUS activity in transgenic
leaves. JUV; Juvenile leaves
sampled after 3 months of ex
vitro growth. MAT; Mature
leaves sampled at the time of
fruit harvest. Vertical linesrepresent standard errors. Means
within treatments followed by
the same letter were not
different at a = 0.05 using
Tukey’s test
86 Plant Cell Tiss Organ Cult (2011) 107:79–89
123
The integration site of the fusion transgene in genomic
DNA from the six independent transformation events was
compared. The EcoRI site (arrow, Fig. 1) is present as a
single restriction site. This ensured that any hybridization
fragments corresponded to the number of integrated
T-DNA sequences. Southern blot results showed that the
transgene was stably integrated into the citrus genome.
Among the six transgenic plants analyzed, two independent
lines (lines 4 and 6) were single copy; three lines (lines 1,
2, and 3) had two, and one line (line 5) had 3 copies of the
transgene stably incorporated into the genome (Fig. 9).
Variation in gene expression in transgenic lines has been
well documented. This can be due to integration of the
transgene near cis-elements or the interaction between
trans-factors and cis-elements of the incorporated DNA and
differences in integration sites of the transgene in the
genome (Benfey and Chua 1989; Sanders et al. 1987).
Based on the number of integration events, we can con-
clude that gene expression in the plants evaluated was not
dependent on the copy number, and an increase or decrease
of the copy number in individual plants did not affect the
gene expression.
Conclusion
The use of antioxidant supplements in RM substantially
improved the transformation efficiency of Mexican lime, a
precocious citrus cultivar that has been observed to be
recalcitrant to Agrobacterium mediated transformation.
Additionally, improved cultural techniques, post regener-
ation resulted in flowering of transgenic lines within
20–22 months from regeneration in the tissue culture
medium. The bi-functional gus-egfp gene can be used for
rapid visual identification of transformants using GFP as
well as quantitative analysis of gene expression by mea-
suring the GUS protein levels. Our protocol is a significant
improvement since reduction in time between transforma-
tion and flowering has not been reported previously in
citrus when juvenile epicotyls are used as explants.
Acknowledgments We thank Dr. E. Etxeberria for providing us
facilities to conduct GUS fluorometric analysis. This work was par-
tially supported by funds provided by the Florida Citrus Production
Advisory Council (FCPRAC).
References
Agboma M, Jones MGK, Peltonen-Sainio P, Rita H, Pehu E (1997)
Exogenous glycine betaine enhances grain yield of maize,
sorghum and wheat grown under two supplementary watering
regimes. J Agron Crop Sci 178:29–37
Akama K, Shiraishi H, Ohta S, Nakamura K, Okada K, Shimura Y
(1992) Efficient transformation of Arabidopsis thaliana: com-
parison of the efficiencies with various organs, plant ecotypes
and Agrobacterium strains. Plant Cell Rep 12:7–11
Appenzeller-Herzog C (2011) Glutathione- and non-glutathione-
based oxidant control in the endoplasmic reticulum. J Cell Sci
124:847–855
Benfey PN, Chua NH (1989) The CaMV 35S enhancer contains at
least two domains which can confer different developmental and
tissue-specific expression patterns. EMBO J 8:2195–2202
Braun AC, Mandle RJ (1948) Studies on the inactivation of the
tumour inducing principle in crown gall. Growth 12(4):255–269
Brigneti G, Voinnet O, Li WX, Ji LH, Ding SW, Baulcombe DC
(1998) Viral pathogenicity determinants are suppressors of
transgene silencing in Nicotiana benthamiana. EMBO J
17:6739–6746
Burow M, Chlan C, Sen P, Lisca A, Murai N (1990) High-frequency
generation of transgenic tobacco plants after modified leaf disk
cocultivation with Agrobacterium tumefaciens. Plant Mol Biol
Rep 8:124–139
Cervera M, Juarez J, Navarro A, Pina JA, Duran-Vila N, Navarro L,
Pena L (1998) Genetic transformation and regeneration of
mature tissues of woody fruit plants bypassing the juvenile stage.
Transgenic Res 7:51–59
Chen HHT, Murata N (2008) Glycine betaine: an effective protectant
against abiotic stress in plants. Trends Plant Sci 13:499–505
Cubitt AB, Heim R, Adams SR, Boyd AE, Gross LA, Tsien RY
(1995) Understanding, improving and using green fluorescent
proteins. Trends Biochem Sci 20:448–455
Dan Y (2008) Biological functions of antioxidants in plant transfor-
mation. In Vitro Cell Dev Biol Plant 44:149–161
Dan Y, Munyikawa TRI, Kimberly AR, Rommens CMT (2004) Use
of lipoic acid in plant culture media. US Patent Pub. No.: US
2004/0133938A1
Dan Y, Armstrong C, Dong J, Feng X, Fry J, Keithly G, Martinell B,
Roberts G, Smith L, Tan L, Duncan D (2009) Lipoic acid—an
unique plant transformation enhancer. In Vitro Cell Dev Biol
Plant 45:630–638
Datla RSS, Hammerlindl JK, Pelcher LE, Crosby WL, Selvaraj G
(1991) A bifunctional fusion between beta-glucuronidase and
neomycin phosphotransferase: a broad-spectrum marker enzyme
for plants. Gene 101:239–246
Dou H, Alva AK (1998) Nitrogen uptake and growth of two citrus
rootstock seedlings in a sandy soil receiving different controlled-
release fertilizer sources. Biol Fertil Soils 26:169–172
Dutt M, Grosser JW (2009) Evaluation of parameters affecting
Agrobacterium-mediated transformation of citrus. Plant Cell
Tissue Organ Cult 98:331–340
Dutt M, Grosser JW (2010) An embryogenic suspension cell culture
system for Agrobacterium-mediated transformation of citrus.
Plant Cell Rep 29:1251–1260
Dutt M, Orbovic V, Grosser JW (2009) Cultivar dependent gene
transfer into citrus using Agrobacterium. Proc Florida State
Hortic Soc 122:85–89
Fig. 9 Southern hybridization analysis of total DNA from leaf tissue
of six transgenic Mexican lime plants (lanes 1–6) and a non-
transgenic plant (CON)
Plant Cell Tiss Organ Cult (2011) 107:79–89 87
123
Dutt M, Lee D, Grosser JW (2010) Bifunctional selection–reporter
systems for genetic transformation of citrus: mannose- and
kanamycin-based systems. In Vitro Cell Dev Biol Plant 46:
467–476
Figueiredo SFL, Albarello N, Viana VRC (2001) Micropropagation
of Rollinia mucosa (Jacq) Baill. In Vitro Cell Dev Biol Plant
37:471–475
Fuentes A, Ramos PL, Ayra C, Rodrıguez M, Ramırez N, Pujol M
(2004) Development of a highly efficient system for assessing
recombinant gene expression in plant cell suspensions via
Agrobacterium tumefaciens transformation. Biotechnol Appl
Biochem 39:355–361
Goldschmidt EE, Golomb A (1982) The carbohydrate balance of
alternate-bearing citrus trees and the significance of reserves for
flowering and fruiting. J Am Soc Hortic Sci 107:206–208
Goldschmidt EE, Aschkenazi N, Herzano Y, Schaffer AA, Monselise
SP (1985) A role for carbohydrate levels in the control of
flowering in citrus. Sci Hortic 26:159–166
Goren R, Huberman M, Goldschmidt EE (2003) Girdling: physio-
logical and horticultural aspects. Horticultural reviews, vol 30.
John Wiley and Sons, Inc. NJ
Gorham J, Jokinen K (1998) Glycine betaine treatment improves
cotton yields in field trials in Pakistan. Abstracts. World cotton
research conference II, Athens, Greece
Grosser J, Ollitrault P, Olivares-Fuster O (2000) Somatic hybridiza-
tion in citrus: an effective tool to facilitate variety improvement.
In Vitro Cell Dev Biol Plant 36:434–449
Halliwell B, Gutteridge JMC (1990) Role of free radicals and
catalytic metal ions in human disease: an overview. Meth
Enzymol 86:1–85
Halliwell B, Aeschbach R, Loliger J, Aruoma OI (1995) The
characterization of antioxidants. Food Chem Toxicol 33:
601–617
He C, Yang A, Zhang W, Gao Q, Zhang J (2010) Improved salt
tolerance of transgenic wheat by introducing betA gene for
glycine betaine synthesis. Plant Cell Tissue Organ Cult
101:65–78
Hood EE, Gelvin SB, Melchers S, Hoekema A (1993) New
Agrobacterium helper plasmids for gene transfer to plants
(EHA105). Trans Res 2:208–218
Jefferson RA (1989) The GUS reporter gene system. Nature 342:
837–838
Jolivet Y, Larher F, Hamelin J (1982) Osmoregulation in halophytic
higher plants: the protective effect of glycinebetaine against the
heat destabilization of membranes. Plant Sci Lett 25:193–201
Ko W, Su C, Chen C, Chao C (2009) Control of lethal browning of
tissue culture plantlets of Cavendish banana cv. Formosana with
ascorbic acid. Plant Cell Tissue Organ Cult 96:137–141
Kumar A, Chakraborty A, Ghanta S, Chattopadhyay S (2009)
Agrobacterium- mediated genetic transformation of mint with
E. coli glutathione synthetase gene. Plant Cell Tissue Organ Cult
96:117–126
Li Z, Jayasankar S, Gray DJ (2001) Expression of a bifunctional green
fluorescent protein (GFP) fusion marker under the control of
three constitutive promoters and enhanced derivatives in trans-
genic grape (Vitis vinifera). Plant Sci 160:877–887
Li CY, Weiss D, Goldschmidt EE (2003) Girdling affects carbohy-
drate-related gene expression in leaves, bark and roots of
alternate-bearing citrus trees. Ann Bot 92:137–143
Ligeng C, Keling C, Guangyan Z (1995) Genetic study and artificial
regulation of juvenile period of citrus seedling. Acta Hortic
403:205–210
Malabadi RB, Staden JV (2005) Role of antioxidants and amino acids
on somatic embryogenesis of Pinus patuia. In Vitro Cell Dev
Biol Plant 41:181–186
Martin L (1987) Genetic transformation and foreign gene expression
in tissue of different woody species. M.Sc. Thesis, University of
California, Davis, CA
Murashige T, Skoog F (1962) A revised medium for rapid growth and
bioassays with tobacco tissue cultures. Physiol Plant 15:473–497
Navari-Izzo F, Quartacci MF, Sgherri C (2002) Lipoic acid: a unique
antioxidant in the detoxification of activated oxygen species.
Plant Physiol Biochem 40:463–470
Odell JT, Nagy F, Chua NH (1985) Identification of DNA sequences
required for activity of the cauliflower mosaic virus 35S
promoter. Nature 313:810–812
Ogaki C, Fujita K, Ito H (1963) Investigations on the cause and
control of alternate bearing in Unshiu orange trees. IV. Nitrogen
and carbohydrate contents in the shoots as related to blossoming
and fruiting. J Jpn Soc Hortic Sci 32:157–167
Packer L, Tritschler HJ (1996) Alpha-lipoic acid: the metabolic
antioxidant. Free Radic Biol Med 20:625–626
Pena L, Cervera M, Juarez J, Ortega C, Pina J, Duran-Vila N, Navarro
L (1995) High efficiency Agrobacterium-mediated transforma-
tion and regeneration of citrus. Plant Sci 104:183–191
Pena L, Cervera M, Juarez J, Navarro A, Pina JA, Navarro L (1997)
Genetic transformation of lime (Citrus aurantifolia Swing.):
factors affecting transformation and regeneration. Plant Cell Rep
16:731–737
Pena L, Perez RM, Cervera M, Juarez JA, Navarro L (2004) Early
events in Agrobacterium-mediated genetic transformation of
citrus explants. Ann Bot 94:67–74
Perl A, Lotan O, Abu-Abied M, Holland D (1996) Establishment of
an Agrobacterium-mediated transformation system for grape
(Vitis vinifera L.): the role of antioxidants during grape-
Agrobacterium interactions. Nat Biotech 14:624–628
Potrykus I (1991) Gene transfer to plants: assessment of published
approaches and results. Annu Rev Plant Physiol Plant Mol Biol
42:205–225
Quaedvlieg NEM, Schlaman HRM, Admiraal PC, Wijting SE,
Stougaard J, Spaink HP (1998) Fusions between green fluores-
cent protein and b-glucuronidase as sensitive and vital bifunc-
tional reporters in plants. Plant Mol Biol 38:861–873
Sanders PR, Winter JA, Zarnason AR, Rogers SG, Fraley RT (1987)
Comparison of cauliflower mosaic virus 35S and nopaline
synthase promoters in transgenic plants. Nucleic Acids Res
15:1543–1558
Sangwan RS, Bourgeois Y, Brown S, Vasseur G, Sangwan-Norreel B
(1992) Characterization of competent cells and early events of
Agrobacterium-mediated genetic transformation in Arabidopsisthaliana. Planta 188:439–456
Saxena PK, Gill R (1986) Removal of browning and growth
enhancement by polyvinylpolypyrrolidone in protoplast cultures
of Cyamopsis tetragonoloba L. Biol Plantarum 28:313–315
Shoji S, Gandeza AT (1992) Controlled release fertilizers with
polyolefin resin coating. Konno Printing Co., Ltd., Sendai, Japan
Tong Z, Tan B, Zhang J, Hu Z, Guo W, Deng X (2009) Using
precocious trifoliate orange (Poncirus trifoliata [L.] Raf.) to
establish a short juvenile transformation platform for citrus. Sci
Hortic 119:335–338
Uchendu E, Muminova M, Gupta S, Reed B (2010) Antioxidant and
anti-stress compounds improve regrowth of cryopreserved Rubus
shoot tips. In Vitro Cell Dev Biol Plant 46:386–393
Villemont E, Dubois F, Sangwan RS, Vasseur G, Bourgeois Y,
Sangwan-Norreel BS (1997) Role of the host cell cycle in the
Agrobacterium-mediated genetic transformation of Petunia:
evidence of an S-phase control mechanism for T-DNA transfer.
Planta 201:160–172
Voinnet O, Rivas S, Mestre P, Baulcombe D (2003) An enhanced
transient expression system in plants based on suppression of
88 Plant Cell Tiss Organ Cult (2011) 107:79–89
123
gene silencing by the p19 protein of tomato bushy stunt virus.
Plant J 33:949–956
Wang Z, Deng X (2004) Cryopreservation of shoot-tips of citrus
using vitrification: effect of reduced form of glutathione.
CryoLett 25:43–50
Wei M, Wei S-H, Yang C-Y (2010) Effect of putrescine on the
conversion of protocorm-like bodies of Dendrobium officinale to
shoots. Plant Cell Tissue Organ Cult 102:145–151
Zimmerman RH (1972) Juvenility and flowering in woody plants: a
review. Hort Sci 7:447–455
Zou X, Li D, Luo X, Luo K, Pei Y (2008) An improved procedure for
Agrobacterium-mediated transformation of trifoliate orange
(Poncirus trifoliata L. Raf.) via indirect organogenesis.
In Vitro Cell Dev Biol Plant 44:169–177
Plant Cell Tiss Organ Cult (2011) 107:79–89 89
123