ORIGINAL PAPER

Effects of antioxidants on Agrobacterium-mediated transformationand accelerated production of transgenic plants of Mexican lime(Citrus aurantifolia Swingle)

M. Dutt • M. Vasconcellos • J. W. Grosser

Received: 12 January 2011 / Accepted: 1 April 2011 / Published online: 6 May 2011

� Springer Science+Business Media B.V. 2011

Abstract Four antioxidants including glycine betaine,

glutathione, lipoic acid, and polyvinylpyrrolidone were

evaluated to improve transformation efficiency of Mexican

lime, a precocious but recalcitrant citrus cultivar to Agro-

bacterium mediated transformation. Lipoic acid substan-

tially improved the transformation efficiency of Mexican

lime by aiding in callus development and improving shoot

growth from cut ends of epicotyl segments co-cultivated

with Agrobacterium. Glycine betaine was moderately

beneficial while glutathione and polyvinylpyrrolidone did

not have the ability to improve the transformation effi-

ciency. A bi-functional gus-egfp fusion gene used in the

study enabled visual identification of transformants and

quantitative analysis of gene expression. We describe an

improved protocol that allows regenerated transgenic

plants to flower within 20–22 months after in vitro regen-

eration. This enabled the rapid evaluation of transgenic

flowers and fruits. Gene expression levels could not be

correlated to copy number as determined using Southern

blot analysis. Our improved transformation method facili-

tates the rapid production and evaluation of transgenic

plants, especially regarding the functional analysis of

transgenes in citrus.

Keywords Agrobacterium tumefaciens � Bifunctional

gene � Citrus � EGFP � Glycine Betaine � Glutathione �Lipoic acid � Mexican lime � Transformation �Polyvinylpyrrolidone

Abbreviations

BAP 6-Benzylaminopurine

EGFP Enhanced green fluorescent protein

GB Glycine betaine

GSH Glutathione

LA Lipoic acid

MS Murashige and Skoog medium

NAA Napthyleneacetic acid

PVP Polyvinylpyrrolidone

TE Transformation efficiency

YEP Yeast extract peptone

Introduction

Genetic manipulation and modification of citrus using

conventional methods remain challenging due to the time

required to obtain a suitable progeny that integrates useful

traits from either of its parents. Introgression to transfer a

single trait into citrus by conventional breeding is also

impractical due to citrus’ long generation time. The juve-

nile period can range from up to 6 years for mandarins, to

over 8 years for sweet oranges (Ligeng et al. 1995).

Genetic transformation facilitates rapid plant improvement,

especially in cases where changes through the addition of

one or more genes are necessary, while preserving cultivar

integrity.

Citrus is not considered to be a natural host for Agro-

bacterium tumefaciens (Pena et al. 2004) and has been

observed to be the least susceptible to infection in a range

of woody plants evaluated (Martin 1987). In spite of this,

T-DNA transfer and its integration into the plant genome

by Agrobacterium has become the most widely used

M. Dutt � M. Vasconcellos � J. W. Grosser (&)

University of Florida-IFAS, Citrus Research and Education

Center (CREC), 700 Experiment Station Road, Lake Alfred,

FL 33850, USA

e-mail: jgrosser@ufl.edu

123

Plant Cell Tiss Organ Cult (2011) 107:79–89

DOI 10.1007/s11240-011-9959-x

method for incorporation of specific genes into citrus.

Several reproducible protocols have been developed for

efficient transformation of citrus (Cervera et al. 1998; Dutt

and Grosser 2009; Zou et al. 2008). The fact that citrus is

easy to manipulate in vitro and amenable to most cell

culture techniques has aided in development of technolo-

gies for incorporation of transgenes into the genome

(Grosser et al. 2000).

The competence for Agrobacterium mediated transfor-

mation of citrus is cultivar dependent. Trifoliate orange

derived cultivars (Poncirus trifoliata L. Raf. and its

hybrids) are generally easier to transform, while sweet

orange (C. sinensis (L.) Osbeck) and mandarin (Citrus

reticulata Blanco) cultivars are more difficult (Dutt et al.

2009; Pena et al. 1995). This is directly related to regen-

eration capacity of an individual cultivar in vitro (via

organogenesis) since the capacity of cell proliferation and

subsequent regeneration following infection affects the

transformation efficiency (Fuentes et al. 2004; Pena et al.

2004; Sangwan et al. 1992; Villemont et al. 1997).

Therefore, cells have to be both competent for transfor-

mation and regeneration before transgenic plants can be

obtained (Potrykus 1991).

In most citrus cultivars, the long juvenile phase delays

functional analysis of incorporated genes, especially genes

related to flowering and fruiting. An early flowering trifo-

liate orange has been described to possess a short juvenile

phase of about 14 months (Tong et al. 2009). However,

availability of this cultivar for genetic transformation

experiments remains restricted. Mexican lime (Citrus

aurantifolia Swingle) is a vigorous and widely adapted

cultivar that normally flowers, when raised from seed,

within 36–48 months. Mexican lime flowers and fruits

throughout the year, providing a continuous supply of fresh

seeds used as plant material in Agrobacterium mediated

transformation experiments. This cultivar also has a high

regeneration potential. However, a low affinity for Agro-

bacterium results in low transformation efficiency (TE)

(Dutt and Grosser 2009; Pena et al. 1997).

In cultivars that possess recalcitrance to Agrobacterium

infection, the tissues or cells get stressed when excised and

inoculated with Agrobacterium. This can limit the sub-

sequent morphogenetic potential (Dan et al. 2009). Cells

produce free radicals or reactive oxygen species (ROS)

which are byproducts of metabolism, and excessive accu-

mulation of such compounds as observed in stressed cells

can result in oxidative stress (Dan et al. 2009; Perl et al.

1996) and possibly damaged cells (Dan 2008). Antioxi-

dants which function as non-enzymatic ROS scavengers

have been shown to delay or prevent oxidation of proteins,

lipids, carbohydrates, and DNA when present at low con-

centrations (Halliwell and Gutteridge 1990; Halliwell et al.

1995; Uchendu et al. 2010).

In this study, we investigate the effect of antioxidants in

regeneration medium on the transformation efficiency of

Mexican lime. We also describe an improved regeneration

protocol that reduces the time required for flowering and

allows transgenic plants to flower within 20–22 months

after regeneration. Our protocol could be used in produc-

tion and subsequent analysis of a large number of plants for

functional analysis of transgenes in citrus.

Materials and methods

Plasmid construction

The plasmid pBI434 (Datla et al. 1991) was used as a

template for isolation of the b-glucuronidase gene (gus or

uidA) gene. The gus coding sequence was amplified by PCR

using Ex Taq Polymerase (Takara Bio USA, Inc., WI, USA)

and gus specific oligonucleotide primers. A forward primer

(GUS-F51) 50TGGATCCCCGGGATGTTACGTCC30 was

designed to introduce a BamHI site immediately upstream

of the translation start site. A reverse primer (GUS-F32)

50CCCTGCAGTTGTTTGCCTCCCTGCT30 was designed

to remove the stop codon with added PstI restriction site

engineered into the primer (bold letters). The 1.8 kb gus

fragment was isolated, purified, and cloned into pGEM�-T

Easy plasmid (Promega Corp, WI, USA) resulting in the

plasmid pGUS-F. The gus gene was excised as a BamHI/

PstI fragment from pGUS-F. An egfp gene fragment, cloned

from pEGFP (Clontech Lab, Inc., CA, USA) into the plas-

mid pGEF (Dutt et al. 2010) was excised as a PstI/NotI

fragment. The two fragments were ligated into the unique

BamHI/NotI cloning site between a double enhanced CaMV

35S promoter (d35S) and a CaMV 35S terminator (35S-30)in a pUC18-derived plasmid pDR to form plasmid pUGG. A

3.7 kb HindIII DNA fragment containing the expression

cassette d35S-gus-egfp-35S-30 was isolated and cloned into

the unique HindIII site of pCAMBIA2300 to form the

plasmid pCAM-GG (Fig. 1). All cloning was verified first

by restriction analysis and then by DNA sequencing. The

binary plasmid was introduced into Agrobacterium tum-

efaciens strain EHA105 (Hood et al. 1993) by the freeze–

thaw method (Burow et al. 1990).

Culture media

Seed germination medium consisted of MS salts with

vitamins (Murashige and Skoog 1962) supplemented with

30 g/l sucrose and 7 g/l agar, pH 5.8. Co-cultivation

medium (CM) consisted of MS salts and vitamins supple-

mented with 13.2 lM BAP, 0.5 lM NAA and 4.5 lM 2,4-

D, 30 g/l sucrose, 0.5 g/l 2-(N-morpholino) ethanesulfonic

acid (MES), pH 5.8. Cut explants were incubated in liquid

80 Plant Cell Tiss Organ Cult (2011) 107:79–89

123

CM medium before transformation while solid CM med-

ium (CM medium containing 100 mM acetosyringone and

solidified with 8 g/l agar) was used for subsequent incu-

bation. Regeneration medium (RM) consisted of MS salts

and vitamins supplemented with 13.2 lM BAP and 2.5 lM

NAA and containing 0.5 g/l MES, 30 g/l sucrose and 8 g/l

agar. pH was adjusted to 5.8 before autoclaving. Glycine

Betaine (GB), Glutathione (GSH), and Polyvinylpyrroli-

done (PVP) were dissolved in deionized water. Lipoic acid

(LA) was dissolved in a few drops of 1 N KOH and volume

made up with deionized water. The antioxidants were filter

sterilized before addition to autoclaved medium. The

medium also contained antibiotics [kanamycin (70 mg/l)

and timentin (400 mg/l)] for selection of transgenic shoots

and preventing Agrobacterium growth, respectively.

Plant materials and Agrobacterium mediated

transformation

Mexican lime fruits were collected from a single tree

located at the Citrus Research and Education Center’s

grove. Seeds were extracted and germinated in 15 cm-long

glass culture tubes. Light green epicotyl segments as

explants were used for transformation. Epicotyl segments

were harvested and cut obliquely into 1 inch-long seg-

ments to expose the cambial ring. These segments were

incubated in liquid CM medium for 3 h before incubation

with Agrobacterium (Dutt and Grosser 2009).

Agrobacterium cells were grown as described earlier

(Dutt and Grosser 2009). The OD600 was adjusted to 0.3

with liquid CM medium before incubation. Explants were

incubated in Agrobacterium suspension for 5 min and

blotted dry on sterile paper towels. Dried explants were

subsequently placed on solid CM medium, and incubated

in the dark at 25�C for 2 days before transfer to RM sup-

plemented with different antioxidants. Explants were cul-

tured in the dark for 2 weeks at 26�C followed by

incubation in light [16 h light/8 h dark cycle using cool

white fluorescent light (75 lmol s-1 m-2)]. The transfor-

mation efficiency of putatively transgenic shoots was

evaluated as the number of GFP-positive plants compared

to total number of explants inoculated.

An Agrobacterium co-infiltration assay to evaluate

transient fusion gene expression was carried out using

young Nicotiana benthamiana Domin plants as described

by Dutt et al. (2010).

Regeneration and recovery of transgenic plants

After 2 biweekly transfer cycles onto fresh regeneration

medium containing antibiotics, transgenic shoots that

expressed stable, non-chimeric GFP-specific fluorescence

were transferred onto RMG medium (Dutt and Grosser

2009). After a month of culture in vitro on this medium,

shoots were micrografted ex vitro essentially as described

by Dutt and Grosser (2010) with minor modifications.

Briefly, tender shoots containing the apical meristem were

micrografted onto 1 year-old Carrizo citrange rootstock (C.

sinensis Osb. 9 P. trifoliata L. Raf.) whose growth had

been restricted in D40 Deepots (6.4 cm cell diame-

ter 9 25 cm cell depth; Stuewe & Sons, Inc., OR, USA).

The rootstock was decapitated 20–24 cm above the soil

level and a cut made in the center of the stem through the

pith. A tapering cut was made on the transgenic stem and a

wedge graft union was established. To stabilize the graft

union, a thin strip of Nescofilm� was used to wrap around

the wedge and finally the plant was ‘capped’ with a 1 ml

pipette tip.

Micrografted transgenic plants were transferred into a

Percival Scientific growth chamber (Model E-36L; Percival

Scientific, Inc., IA, USA) on a 34�C/28�C temperature and

18 h/6 h day/night illumination regimen. The light inten-

sity was approximately 550 lmol/m2/s. Plants were main-

tained in the incubator for 2 months and fertilized weekly

with 20-10-20 Peat-Lite fertilizer (The Scotts Company,

OH, USA) at a 50 ppm nitrogen rate. Subsequently, plants

were transferred into 10 cm 9 10 cm 9 32 cm citri-pots in

a peat-based commercial potting medium (Metromix 500,

Sun Gro Horticulture, WA, USA) and acclimated to

greenhouse conditions. Five grams of Harrell’s 18-5-10, a

12 month nursery polyon (Harrell’s LLC, FL, USA) was

incorporated into the potting mix before planting. Plants

were fertilized once every 2 weeks with the 20-10-20 Peat-

Lite fertilizer and the greenhouse was maintained at a

constant 32�C/22�C day/night temperature regime. Trans-

genic plants were girdled after 16 months of growth in order

to induce flowering.

Evaluation of GUS and GFP expression

Leaves were histochemically stained for GUS activity as

described by Jefferson (1989) with the following minor

modifications. Explants were vacuum infiltrated for 5 min

Fig. 1 Schematic representation of T-DNA region of the pCAMBIA2300 based pCAM-GG binary vector containing nptII as a selectable marker

gene. The T-DNA also contained a bifunctional gus-egfp gene driven by a d35S promoter. Arrow indicates the unique EcoRI site

Plant Cell Tiss Organ Cult (2011) 107:79–89 81

123

in a phosphate buffer solution [200 mM NaH2P04, pH. 7.0;

10 mM EDTA and 0.2% triton X-100]. Subsequently,

X-Gluc (5-bromo-4-cloro-3 indolyl-b-D-glucuronide) dis-

solved in DMSO was added at a final concentration of

1 mg/ml. The explants were incubated in the dark at 37�C

for 12 h. After incubation, the explants were destained in

ethanol:acetic acid (3:1) for 12 h to eliminate background

chlorophylls and other pigments present in stained tissues.

A quantitative fluorometric GUS assay was performed as

outlined in the FluorAce b-Glucuronidase Reporter Assay

Kit (Bio-Rad Laboratories, CA, USA). Briefly, 20–40 lg

of total protein was added to 500 ll of assay buffer.

Samples were incubated in a 37�C water bath for 30 min

before the reaction was terminated by the addition of 19

Stop buffer. Samples were measured in a VersaFluor

Fluorometer (Bio-Rad Laboratories, CA, USA). The total

soluble protein of each sample was determined using the

Coomassie (Bradford) Protein Assay Kit (Thermo Fisher

Scientific Inc., IL, USA). The relative GUS activity was

expressed as p mol MU/mg protein/min.

GFP fluorescence in co-infiltrated N. benthamiana

leaves was visualized by using a 100 W, hand-held, long-

wave ultraviolet lamp (Blak-Ray B-100AP, Ultraviolet

Products, CA, USA) 4 days after infiltration. GFP-specific

fluorescence in transgenic Mexican lime was evaluated

using a Zeiss SV11 epi-fluorescence stereomicroscope

equipped with a light source consisting of a 100Wmercury

bulb and a FITC/GFP filter set with a 480 nm excitation

filter and a 515 nm longpass emission filter producing a

blue light (Chroma Technology Corp., VT, USA).

Reverse transcriptase PCR (RT PCR)

RNA was isolated from 100 mg of transgenic and non-

transgenic leaf tissue using an RNeasy Mini Kit (Qiagen

Inc., CA, USA). Five hundred ng total RNA was used in

Reverse Transcriptase PCR (RT PCR) using gus gene

specific primers [GUS-FRT, 50CAACAGGTGGTTGCAA

CTGGACAA30 and GUS-RRT, 50TTCAGCGTAAGGG

TAATGCGAGGT30] and egfp gene specific primers

[EG-FRT, 50TGACCCTGAAGTTCATCTGCACCA30 and

EG-RRT, 50CACCTTGATGCCGTTCTTCTGCTT30]. A

Qiagen OneStep RT–PCR kit was used for amplification.

Amplified DNA fragments were electrophoresed on a 1%

agarose gel containing GelRedTM Nucleic Acid Gel Stain

(Biotium, Inc., CA, USA) and visualized under UV light.

Polymerase chain reaction (PCR) and Southern blot

hybridization

Polymerase Chain Reaction (PCR) was performed with

genomic DNA isolated using a Qiagen DNeasy Plant Maxi

Kit (Qiagen Inc., CA, USA) as a template. GoTaq� Green

Master PCR Mix (Promega Corp, WI, USA) with gus-egfp

specific oligonucleotide primers (GUS-F51 and EG-32,

50CTTGTACAGCTCGTCCATGCCGAGA30) were used

for PCR. Amplified DNA fragments were visualized as

mentioned earlier. Fifteen lg of Eco RI digested genomic

DNA was used to detect copy number of individual

transgenic plants. Southern blot protocol was as described

by Dutt and Grosser (2010).

Results and discussion

Transient gene expression using Agrobacterium co-

infiltration assay

Our results demonstrated that the gus-egfp fusion gene was

functional in N. benthamiana, and visual GFP expression

was observed in leaves infiltrated with a mixture of pCAM-

GG and pHCPRO in a 1:1 ratio (Fig. 2). We used the

pHCPRO RNA silencing suppressor to prevent post-tran-

scriptional gene silencing (PTGS) (Voinnet et al. 2003).

Silencing suppressors reverse RNA silencing and thereby

Fig. 2 The green fluorescence image of a co-infiltrated Nicotianabenthamiana leaf, infiltrated with equal volumes of an AgrobacteriumEHA105 culture containing pCAM-GG together with an Agrobacte-rium EHA105 culture containing the HCPRO construct (left side).

The right side of the leaf was infiltrated with only HCPRO. GFP

expression on the leaves was photographed 4 days post-infiltration.

The leaf was visualized under a 100 W, hand-held, longwave UV

lamp. Inset shows histochemically stained GUS expressing leaf cells.

RT–PCR of total RNA from leaves 4 days post-infiltration is also

shown

82 Plant Cell Tiss Organ Cult (2011) 107:79–89

123

effectively aid transgene expression (Brigneti et al. 1998).

Histochemical staining of leaves demonstrated gus gene

activity. RT–PCR results demonstrated similar levels of

gus and egfp mRNA.

Effect of antioxidants on plant regeneration

Mexican lime is considered to be recalcitrant to Agrobac-

terium mediated transformation (Dutt et al. 2009). Seeds

produce thin epicotyls which are the primary source of

explants for Agrobacterium mediated transformation. It has

been observed that following co-cultivation, a majority of

target cells in cut explants fail to divide and subsequently

produce callus. Production of transformed callus, arising

from the cambial ring, is required for subsequent indirect

organogenesis and production of transgenic shoots (Pena

et al. 2004), as efficient Agrobacterium infection occurs in

actively dividing cells (Akama et al. 1992). Therefore, the

recalcitrance to transformation as observed in Mexican

lime explants treated with Agrobacterium could be asso-

ciated with the timing of cell division at the wound site

(Braun and Mandle 1948). Tissues or cells can also be

stressed following inoculation with Agrobacterium. This

limits the growth potential of Agrobacterium treated cells

in tissue culture media (Dan et al. 2009). Antioxidants

function to protect cells from stress inducing compounds

that can result in free radical induced cell damage. Anti-

oxidants can minimize cell damage following transforma-

tion (Dan et al. 2009), as they are known for scavenging

free radicals (Navari-Izzo et al. 2002).

We used the antioxidants LA, GB, GSH, and PVP to

evaluate their effect on TE by supplementing them into the

RM shoot regeneration medium. TE was highest when

explants were placed in medium supplemented with 50 lM

LA. The results indicated a fivefold increase in TE over

control explants (Fig. 3). The 100 lM treatment also sig-

nificantly improved the TE but was not statistically sig-

nificant over the 50 lM treatment. TE further decreased

with the 200 lM treatment. However, LA at 400 lM was

detrimental for regeneration and reduced TE to less than

the control (results not shown). LA was the only antioxi-

dant in our study that resulted in a fivefold increase in

efficiency over the control explants. Improved callus

development at cut ends of epicotyl segments incubated

with Agrobacterium and improved shoot growth were

observed. Reduced browning of Agrobacterium-treated

tissues was also observed when epicotyl segments were

placed in LA containing medium. Reduced browning fol-

lowing application of LA has also been observed in other

species such as soybean and tomato (Dan et al. 2009). LA

functions by reducing the degree of tissue necrosis and

oxidation of phenolic compounds. It can also permeate

Fig. 3 Transformation

efficiency of Mexican lime after

Agrobacterium mediated

transformation using pCAM-

GG. After a 2 days co-

cultivation period, treated

explants were placed in various

levels of antioxidants

incorporated into RM shoot

regeneration medium. Data was

collected after 6 weeks in

culture. LA Lipoic Acid, GBGlycine Betaine, GSHGlutathione, PVPPolyvinylpyrrolidone. Verticallines represent standard errors.

Means within treatments

followed by the same letter were

not different at a = 0.05 using

Tukey’s test

Plant Cell Tiss Organ Cult (2011) 107:79–89 83

123

easily through cell walls (Packer and Tritschler 1996) and

has been reported to significantly improve the rate of

transformation of several cultivars of tomato, potato, soy-

bean, wheat, and cotton that were considered to be recal-

citrant (Dan et al. 2004; Dan 2008).

The addition of GB to RM had a beneficial effect on TE

although it was not as significant as LA. Amongst the

treatments, statistically significant improvement in TE over

control was observed with 200 lM and 400 lM of the

antioxidant in RM. However, both these treatments were

not statistically different from each other. Improved TE

was observed when 100 lM GSH was added to the med-

ium. However, there was no statistical difference between

this and other treatments. GB and GSH both protects shoots

against abiotic stresses (Wang and Deng 2004; Chen and

Murata 2008). GB also maintains membrane integrity

(Jolivet et al. 1982). Exogenous application of GB can

result in improved stress tolerance (Agboma et al. 1997;

Gorham and Jokinen 1998; He et al. 2010). Similarly, GSH

is a redox-active molecule that has been observed to take

part in a variety of antioxidant reactions (Appenzeller-

Herzog 2011). It also functions as a cellular protectant

(Kumar et al. 2009) and enhances cell division (Wei et al.

2010). However, in this study, application of GB or GSH to

regeneration medium was not as effective as LA to ame-

liorate the stressful conditions that can occur after Agro-

bacterium mediated transformation.

PVP prevents oxidative browning in wounded tissues

(Saxena and Gill 1986) and can adsorb phenol-like sub-

stances exuding from the cut tissues (Ko et al. 2009). This

has been observed to be via a hydrogen bonding mecha-

nism (Figueiredo et al. 2001). In our experiments, none of

the PVP treatments was effective in improving the TE of

Mexican lime. Overall, higher levels of antioxidant incor-

poration to RM were detrimental and reduced the trans-

formation efficiency. It is possible that high levels of

antioxidants affected the electron transport system, thus

disturbing energy metabolism/allocation (Malabadi and

Van Staden 2005).

Visualization of GFP expression in putative transgenic

plants

Following transformation and regeneration of plants,

transgene expression was monitored by observing green

fluorescence protein (GFP) expression in the leaves. GFP

expression allowed us to easily discriminate between

transgenic plants and escapes. Two main patterns of GFP

expression were observed when regenerated transgenic

plants were visualized under an epi-fluorescence stereo-

microscope. In the first, homogeneous pattern of green

fluorescence in all parts of the plantlet was observed. In the

second, the leaf cuticles and stomatal cells were bright

green while it was difficult to observe GFP expression in

the remainder of the leaf (data not shown). PCR on trans-

genic plants regenerated following identification based on

GFP expression confirmed the presence of the fusion gus-

egfp gene in the plant’s genome. An expected 2,570 bp

fragment was observed from each transgenic line (Fig. 4).

Rapid production of transgenic Mexican lime plants

Numerous transgenic shoots were observed to grow from

the explants following Agrobacterium mediated transfor-

mation. GFP positive shoots were transferred onto RMG

medium (Dutt and Grosser 2009) for growth and elongation

before being micrografted ex vitro. Micrografting of

transgenic plants was carried out on juvenile rootstock

plants that were kept root bound. Root growth restriction

allowed us to control the size and growth of plants for a

year after transplant into D40 Deepots. Root growth

restrictions have also been reported to accelerate phase

change (Zimmerman 1972). Micrografted plants could be

rapidly grown under controlled temperature and light

conditions. Plants when transplanted into citri-pots devel-

oped rapidly following removal of root growth restrictions.

Also, applications of low levels of liquid fertilization

(50 ppm nitrogen) at every third watering prevented root

damage. Incorporation of controlled release fertilizers

Fig. 4 Amplification products obtained from PCR of genomic DNA

of transgenic citrus plants with gus-egfp specific oligonucleotide

primers (GUS-F51 and EG-32) which successfully amplified the

expected 2,570 bp fragment (arrow). M, 1 kb marker; 1–10 are 10

individual transgenic lines; NC, negative control using DNA from

non-transgenic leaf; PC, positive control using pCAM-GG plasmid

DNA as a template

84 Plant Cell Tiss Organ Cult (2011) 107:79–89

123

allowed greater nutrient uptake efficiency with lower

leaching losses (Shoji and Gandeza 1992) and allowed

greater N uptake and seedling growth (Dou and Alva

1998).

Carbohydrate levels in the plant is one of the limiting

factors for flower formation in citrus (Goldschmidt and

Golomb 1982; Ogaki et al. 1963). It is thought that

reproductive organs benefit from the higher concentration

of assimilate available to them following girdling (Li et al.

2003). In order to increase the assimilate levels transgenic

plants were girdled after 16 months of growth. Girdling

was done to prevent downward movement of photosynth-

ates and metabolites through the phloem (Goren et al.

2003). Citrus trees flower in spring and girdling during

October–November in the northern hemisphere allows

flower development in February–March (Goldschmidt

et al. 1985). Mexican lime however will produce flowers

repeatedly throughout warm months of the year, so fruit in

various stages of development are found on a tree at the

same time. Therefore, girdling in this cultivar can be per-

formed at any time of the year. We girdled 8 individual

transgenic lines, of which 6 flowered within 4 months of

girdling. Our protocol allowed trees to flower within

20–22 months of regeneration. Trees produced normal

flowers and mature fruits were harvested for analysis after

6 months of growth. There was no difference in flowering

time of plants regenerated from the different antioxidant

treatments.

Transgene expression in Mexican lime

Gene expression (egfp) in both juvenile (Fig. 5) and mature

plant (Fig. 6) was evaluated by relative RT PCR. A com-

parison of the results revealed variable gene expression in

different plants as well as tissue types. We evaluated six

transgenic lines, all of which were observed to be pheno-

typically normal. The conserved cytochrome oxidase

(COX) gene was chosen as an internal control. egfp mRNA

expression patterns in juvenile leaves were generally uni-

form in all lines except for line 5, where the gene was

significantly down regulated. In the juvenile stem, 4 of 6

transgenic lines exhibited uniform expression while the

gene was significantly down regulated in lines 4 and 5

(Fig. 5).

Levels of egfp mRNA expression in mature tissues

could not be fully correlated with juvenile tissues (Fig. 6).

In transgenic leaves, egfp mRNA was significantly down

regulated in lines 4 and 5, while the other lines had high

levels of expression. Gene expression in the stem was

significantly down regulated as the plants progressed from

the juvenile to the mature phase. Line 6 was the only line in

which gene expression remained constant. In addition, we

evaluated gene expression in flowers and fruits of these

transgenic lines. Lines 4 and 5 had down regulated mRNA

expression in flowers Although mRNA expression was

down regulated in lines 3–6 in fruits (Fig. 6), egfp activity

could be visually detected in all parts of the flower and fruit

(Fig. 7).

Fig. 5 Reverse Transcriptase PCR of egfp mRNA from total RNA of

6 juvenile transgenic lines (L1 to L6, leaf; S1 to S6, stem). CON is

RNA obtained from a non-transgenic plant. RNA was obtained after 3

months of ex vitro growth. To examine the accuracy of the RTPCR

process, the conserved cytochrome oxidase (COX) gene was used as

control

Fig. 6 Reverse Transcriptase PCR of egfp mRNA from total RNA of

6 mature transgenic lines (L1 to L6, leaf; S1 to S6, stem; FL1 to FL6;

flower and FR1 to FR6; fruit). CON is RNA obtained from a non-

transgenic plant. RNA was obtained at the time of fruit harvest. To

examine the accuracy of the RTPCR process, the conserved

cytochrome oxidase (COX) gene was used as control

Plant Cell Tiss Organ Cult (2011) 107:79–89 85

123

The GUS protein is very stable under physiological

conditions and is commonly used in both histochemical

localization as well as fluorometric analysis of promoter

activity (Jefferson 1989). Juvenile and mature transgenic

leaves were assayed for GUS activity by the fluorometric

method. Our results demonstrated a pattern similar to that

observed for egfp expression using RTPCR (Fig. 8).

Leaves from transgenic Mexican lime plants demonstrated

a variable expression pattern and generally younger leaves

demonstrated a higher specific GUS activity than older

leaves. The rate of mRNA transcription and/or mRNA

stability determined the amplification observed using

RTPCR. In our study, we observed egfp gene expression to

be developmentally regulated and varied from plant to

plant and tissue types. The usefulness of GFP is limited in

plants due to autofluorescence in various plant organs and

calli. A GUS fusion provides sensitivity needed for plant

screening. An advantage of fusing gus with egfp is that

both GUS and GFP can tolerate N-terminal as well as

C-terminal protein fusions, allowing the fusion in either

orientation (gus-egfp or egfp-gus) (Cubitt et al. 1995;

Quaedvlieg et al. 1998). Fusion marker genes also aid to

reduce undesirable interactions among neighboring pro-

moters since it results in reduction of number of promoters

required for expression of multiple genes (Li et al. 2001).

We used the 35S promoter since it drives high levels of

gene expression in dicot plants in a constitutive manner

(Jefferson 1989; Odell et al. 1985). However, any promoter

can be used to drive this fusion gene. We did not analyze

gene activity in roots as our transgenic plants had been

grafted onto non-transgenic rootstocks. It is possible to root

transgenic Mexican lime in RMM medium (Dutt and

Grosser 2009). However, such plants are slower in growth

when compared to grafted plants (unpublished).

Fig. 7 Transgenic Mexican

lime expressing GFP as

visualized under an

epifluorescent microscope.

a Apical meristem; b Leaf;

c Unopened flower bud; d Fully

open flower; e Pistil; f Stamens;

g Juice vesicle, and h Cross

section of a fruit. The scale barrepresents 1 mm for all figures

Fig. 8 Fluorometric assay for

GUS activity in transgenic

leaves. JUV; Juvenile leaves

sampled after 3 months of ex

vitro growth. MAT; Mature

leaves sampled at the time of

fruit harvest. Vertical linesrepresent standard errors. Means

within treatments followed by

the same letter were not

different at a = 0.05 using

Tukey’s test

86 Plant Cell Tiss Organ Cult (2011) 107:79–89

123

The integration site of the fusion transgene in genomic

DNA from the six independent transformation events was

compared. The EcoRI site (arrow, Fig. 1) is present as a

single restriction site. This ensured that any hybridization

fragments corresponded to the number of integrated

T-DNA sequences. Southern blot results showed that the

transgene was stably integrated into the citrus genome.

Among the six transgenic plants analyzed, two independent

lines (lines 4 and 6) were single copy; three lines (lines 1,

2, and 3) had two, and one line (line 5) had 3 copies of the

transgene stably incorporated into the genome (Fig. 9).

Variation in gene expression in transgenic lines has been

well documented. This can be due to integration of the

transgene near cis-elements or the interaction between

trans-factors and cis-elements of the incorporated DNA and

differences in integration sites of the transgene in the

genome (Benfey and Chua 1989; Sanders et al. 1987).

Based on the number of integration events, we can con-

clude that gene expression in the plants evaluated was not

dependent on the copy number, and an increase or decrease

of the copy number in individual plants did not affect the

gene expression.

Conclusion

The use of antioxidant supplements in RM substantially

improved the transformation efficiency of Mexican lime, a

precocious citrus cultivar that has been observed to be

recalcitrant to Agrobacterium mediated transformation.

Additionally, improved cultural techniques, post regener-

ation resulted in flowering of transgenic lines within

20–22 months from regeneration in the tissue culture

medium. The bi-functional gus-egfp gene can be used for

rapid visual identification of transformants using GFP as

well as quantitative analysis of gene expression by mea-

suring the GUS protein levels. Our protocol is a significant

improvement since reduction in time between transforma-

tion and flowering has not been reported previously in

citrus when juvenile epicotyls are used as explants.

Acknowledgments We thank Dr. E. Etxeberria for providing us

facilities to conduct GUS fluorometric analysis. This work was par-

tially supported by funds provided by the Florida Citrus Production

Advisory Council (FCPRAC).

References

Agboma M, Jones MGK, Peltonen-Sainio P, Rita H, Pehu E (1997)

Exogenous glycine betaine enhances grain yield of maize,

sorghum and wheat grown under two supplementary watering

regimes. J Agron Crop Sci 178:29–37

Akama K, Shiraishi H, Ohta S, Nakamura K, Okada K, Shimura Y

(1992) Efficient transformation of Arabidopsis thaliana: com-

parison of the efficiencies with various organs, plant ecotypes

and Agrobacterium strains. Plant Cell Rep 12:7–11

Appenzeller-Herzog C (2011) Glutathione- and non-glutathione-

based oxidant control in the endoplasmic reticulum. J Cell Sci

124:847–855

Benfey PN, Chua NH (1989) The CaMV 35S enhancer contains at

least two domains which can confer different developmental and

tissue-specific expression patterns. EMBO J 8:2195–2202

Braun AC, Mandle RJ (1948) Studies on the inactivation of the

tumour inducing principle in crown gall. Growth 12(4):255–269

Brigneti G, Voinnet O, Li WX, Ji LH, Ding SW, Baulcombe DC

(1998) Viral pathogenicity determinants are suppressors of

transgene silencing in Nicotiana benthamiana. EMBO J

17:6739–6746

Burow M, Chlan C, Sen P, Lisca A, Murai N (1990) High-frequency

generation of transgenic tobacco plants after modified leaf disk

cocultivation with Agrobacterium tumefaciens. Plant Mol Biol

Rep 8:124–139

Cervera M, Juarez J, Navarro A, Pina JA, Duran-Vila N, Navarro L,

Pena L (1998) Genetic transformation and regeneration of

mature tissues of woody fruit plants bypassing the juvenile stage.

Transgenic Res 7:51–59

Chen HHT, Murata N (2008) Glycine betaine: an effective protectant

against abiotic stress in plants. Trends Plant Sci 13:499–505

Cubitt AB, Heim R, Adams SR, Boyd AE, Gross LA, Tsien RY

(1995) Understanding, improving and using green fluorescent

proteins. Trends Biochem Sci 20:448–455

Dan Y (2008) Biological functions of antioxidants in plant transfor-

mation. In Vitro Cell Dev Biol Plant 44:149–161

Dan Y, Munyikawa TRI, Kimberly AR, Rommens CMT (2004) Use

of lipoic acid in plant culture media. US Patent Pub. No.: US

2004/0133938A1

Dan Y, Armstrong C, Dong J, Feng X, Fry J, Keithly G, Martinell B,

Roberts G, Smith L, Tan L, Duncan D (2009) Lipoic acid—an

unique plant transformation enhancer. In Vitro Cell Dev Biol

Plant 45:630–638

Datla RSS, Hammerlindl JK, Pelcher LE, Crosby WL, Selvaraj G

(1991) A bifunctional fusion between beta-glucuronidase and

neomycin phosphotransferase: a broad-spectrum marker enzyme

for plants. Gene 101:239–246

Dou H, Alva AK (1998) Nitrogen uptake and growth of two citrus

rootstock seedlings in a sandy soil receiving different controlled-

release fertilizer sources. Biol Fertil Soils 26:169–172

Dutt M, Grosser JW (2009) Evaluation of parameters affecting

Agrobacterium-mediated transformation of citrus. Plant Cell

Tissue Organ Cult 98:331–340

Dutt M, Grosser JW (2010) An embryogenic suspension cell culture

system for Agrobacterium-mediated transformation of citrus.

Plant Cell Rep 29:1251–1260

Dutt M, Orbovic V, Grosser JW (2009) Cultivar dependent gene

transfer into citrus using Agrobacterium. Proc Florida State

Hortic Soc 122:85–89

Fig. 9 Southern hybridization analysis of total DNA from leaf tissue

of six transgenic Mexican lime plants (lanes 1–6) and a non-

transgenic plant (CON)

Plant Cell Tiss Organ Cult (2011) 107:79–89 87

123

Dutt M, Lee D, Grosser JW (2010) Bifunctional selection–reporter

systems for genetic transformation of citrus: mannose- and

kanamycin-based systems. In Vitro Cell Dev Biol Plant 46:

467–476

Figueiredo SFL, Albarello N, Viana VRC (2001) Micropropagation

of Rollinia mucosa (Jacq) Baill. In Vitro Cell Dev Biol Plant

37:471–475

Fuentes A, Ramos PL, Ayra C, Rodrıguez M, Ramırez N, Pujol M

(2004) Development of a highly efficient system for assessing

recombinant gene expression in plant cell suspensions via

Agrobacterium tumefaciens transformation. Biotechnol Appl

Biochem 39:355–361

Goldschmidt EE, Golomb A (1982) The carbohydrate balance of

alternate-bearing citrus trees and the significance of reserves for

flowering and fruiting. J Am Soc Hortic Sci 107:206–208

Goldschmidt EE, Aschkenazi N, Herzano Y, Schaffer AA, Monselise

SP (1985) A role for carbohydrate levels in the control of

flowering in citrus. Sci Hortic 26:159–166

Goren R, Huberman M, Goldschmidt EE (2003) Girdling: physio-

logical and horticultural aspects. Horticultural reviews, vol 30.

John Wiley and Sons, Inc. NJ

Gorham J, Jokinen K (1998) Glycine betaine treatment improves

cotton yields in field trials in Pakistan. Abstracts. World cotton

research conference II, Athens, Greece

Grosser J, Ollitrault P, Olivares-Fuster O (2000) Somatic hybridiza-

tion in citrus: an effective tool to facilitate variety improvement.

In Vitro Cell Dev Biol Plant 36:434–449

Halliwell B, Gutteridge JMC (1990) Role of free radicals and

catalytic metal ions in human disease: an overview. Meth

Enzymol 86:1–85

Halliwell B, Aeschbach R, Loliger J, Aruoma OI (1995) The

characterization of antioxidants. Food Chem Toxicol 33:

601–617

He C, Yang A, Zhang W, Gao Q, Zhang J (2010) Improved salt

tolerance of transgenic wheat by introducing betA gene for

glycine betaine synthesis. Plant Cell Tissue Organ Cult

101:65–78

Hood EE, Gelvin SB, Melchers S, Hoekema A (1993) New

Agrobacterium helper plasmids for gene transfer to plants

(EHA105). Trans Res 2:208–218

Jefferson RA (1989) The GUS reporter gene system. Nature 342:

837–838

Jolivet Y, Larher F, Hamelin J (1982) Osmoregulation in halophytic

higher plants: the protective effect of glycinebetaine against the

heat destabilization of membranes. Plant Sci Lett 25:193–201

Ko W, Su C, Chen C, Chao C (2009) Control of lethal browning of

tissue culture plantlets of Cavendish banana cv. Formosana with

ascorbic acid. Plant Cell Tissue Organ Cult 96:137–141

Kumar A, Chakraborty A, Ghanta S, Chattopadhyay S (2009)

Agrobacterium- mediated genetic transformation of mint with

E. coli glutathione synthetase gene. Plant Cell Tissue Organ Cult

96:117–126

Li Z, Jayasankar S, Gray DJ (2001) Expression of a bifunctional green

fluorescent protein (GFP) fusion marker under the control of

three constitutive promoters and enhanced derivatives in trans-

genic grape (Vitis vinifera). Plant Sci 160:877–887

Li CY, Weiss D, Goldschmidt EE (2003) Girdling affects carbohy-

drate-related gene expression in leaves, bark and roots of

alternate-bearing citrus trees. Ann Bot 92:137–143

Ligeng C, Keling C, Guangyan Z (1995) Genetic study and artificial

regulation of juvenile period of citrus seedling. Acta Hortic

403:205–210

Malabadi RB, Staden JV (2005) Role of antioxidants and amino acids

on somatic embryogenesis of Pinus patuia. In Vitro Cell Dev

Biol Plant 41:181–186

Martin L (1987) Genetic transformation and foreign gene expression

in tissue of different woody species. M.Sc. Thesis, University of

California, Davis, CA

Murashige T, Skoog F (1962) A revised medium for rapid growth and

bioassays with tobacco tissue cultures. Physiol Plant 15:473–497

Navari-Izzo F, Quartacci MF, Sgherri C (2002) Lipoic acid: a unique

antioxidant in the detoxification of activated oxygen species.

Plant Physiol Biochem 40:463–470

Odell JT, Nagy F, Chua NH (1985) Identification of DNA sequences

required for activity of the cauliflower mosaic virus 35S

promoter. Nature 313:810–812

Ogaki C, Fujita K, Ito H (1963) Investigations on the cause and

control of alternate bearing in Unshiu orange trees. IV. Nitrogen

and carbohydrate contents in the shoots as related to blossoming

and fruiting. J Jpn Soc Hortic Sci 32:157–167

Packer L, Tritschler HJ (1996) Alpha-lipoic acid: the metabolic

antioxidant. Free Radic Biol Med 20:625–626

Pena L, Cervera M, Juarez J, Ortega C, Pina J, Duran-Vila N, Navarro

L (1995) High efficiency Agrobacterium-mediated transforma-

tion and regeneration of citrus. Plant Sci 104:183–191

Pena L, Cervera M, Juarez J, Navarro A, Pina JA, Navarro L (1997)

Genetic transformation of lime (Citrus aurantifolia Swing.):

factors affecting transformation and regeneration. Plant Cell Rep

16:731–737

Pena L, Perez RM, Cervera M, Juarez JA, Navarro L (2004) Early

events in Agrobacterium-mediated genetic transformation of

citrus explants. Ann Bot 94:67–74

Perl A, Lotan O, Abu-Abied M, Holland D (1996) Establishment of

an Agrobacterium-mediated transformation system for grape

(Vitis vinifera L.): the role of antioxidants during grape-

Agrobacterium interactions. Nat Biotech 14:624–628

Potrykus I (1991) Gene transfer to plants: assessment of published

approaches and results. Annu Rev Plant Physiol Plant Mol Biol

42:205–225

Quaedvlieg NEM, Schlaman HRM, Admiraal PC, Wijting SE,

Stougaard J, Spaink HP (1998) Fusions between green fluores-

cent protein and b-glucuronidase as sensitive and vital bifunc-

tional reporters in plants. Plant Mol Biol 38:861–873

Sanders PR, Winter JA, Zarnason AR, Rogers SG, Fraley RT (1987)

Comparison of cauliflower mosaic virus 35S and nopaline

synthase promoters in transgenic plants. Nucleic Acids Res

15:1543–1558

Sangwan RS, Bourgeois Y, Brown S, Vasseur G, Sangwan-Norreel B

(1992) Characterization of competent cells and early events of

Agrobacterium-mediated genetic transformation in Arabidopsisthaliana. Planta 188:439–456

Saxena PK, Gill R (1986) Removal of browning and growth

enhancement by polyvinylpolypyrrolidone in protoplast cultures

of Cyamopsis tetragonoloba L. Biol Plantarum 28:313–315

Shoji S, Gandeza AT (1992) Controlled release fertilizers with

polyolefin resin coating. Konno Printing Co., Ltd., Sendai, Japan

Tong Z, Tan B, Zhang J, Hu Z, Guo W, Deng X (2009) Using

precocious trifoliate orange (Poncirus trifoliata [L.] Raf.) to

establish a short juvenile transformation platform for citrus. Sci

Hortic 119:335–338

Uchendu E, Muminova M, Gupta S, Reed B (2010) Antioxidant and

anti-stress compounds improve regrowth of cryopreserved Rubus

shoot tips. In Vitro Cell Dev Biol Plant 46:386–393

Villemont E, Dubois F, Sangwan RS, Vasseur G, Bourgeois Y,

Sangwan-Norreel BS (1997) Role of the host cell cycle in the

Agrobacterium-mediated genetic transformation of Petunia:

evidence of an S-phase control mechanism for T-DNA transfer.

Planta 201:160–172

Voinnet O, Rivas S, Mestre P, Baulcombe D (2003) An enhanced

transient expression system in plants based on suppression of

88 Plant Cell Tiss Organ Cult (2011) 107:79–89

123

gene silencing by the p19 protein of tomato bushy stunt virus.

Plant J 33:949–956

Wang Z, Deng X (2004) Cryopreservation of shoot-tips of citrus

using vitrification: effect of reduced form of glutathione.

CryoLett 25:43–50

Wei M, Wei S-H, Yang C-Y (2010) Effect of putrescine on the

conversion of protocorm-like bodies of Dendrobium officinale to

shoots. Plant Cell Tissue Organ Cult 102:145–151

Zimmerman RH (1972) Juvenility and flowering in woody plants: a

review. Hort Sci 7:447–455

Zou X, Li D, Luo X, Luo K, Pei Y (2008) An improved procedure for

Agrobacterium-mediated transformation of trifoliate orange

(Poncirus trifoliata L. Raf.) via indirect organogenesis.

In Vitro Cell Dev Biol Plant 44:169–177

Plant Cell Tiss Organ Cult (2011) 107:79–89 89

123