Endoplasmic Reticulum Stress Protein GRP78Modulates Lipid Metabolism to Control DrugSensitivity and Antitumor Immunity in BreastCancerKatherine L. Cook1,2, David R. Soto-Pantoja1, Pamela A.G. Clarke2, M. Idalia Cruz2,Alan Zwart2, Anni W€arri2, Leena Hilakivi-Clarke2, David D. Roberts3, and Robert Clarke2
Abstract
The unfolded protein response is an endoplasmic reticulumstress pathway mediated by the protein chaperone glucose regu-lated-protein 78 (GRP78). Metabolic analysis of breast cancercells shows that GRP78 silencing increases the intracellular con-centrations of essential polyunsaturated fats, including linoleicacid. Accumulation of fatty acids is due to an inhibition ofmitochondrial fatty acid transport, resulting in a reductionof fatty acid oxidation. These data suggest a novel role ofGRP78-mediating cellular metabolism. We validated the effect
of GRP78-regulated metabolite changes by treating tumor-bear-ingmicewith tamoxifen and/or linoleic acid. Tumors treatedwithlinoleic acid plus tamoxifen exhibited reduced tumor area andtumor weight. Inhibition of either GRP78 or linoleic acid treat-ment increased MCP-1 serum levels, decreased CD47 expression,and increasedmacrophage infiltration, suggesting a novel role forGRP78 in regulating innate immunity. GRP78 control of fatty acidoxidation may represent a new homeostatic function for GRP78.Cancer Res; 76(19); 5657–70. �2016 AACR.
IntroductionGlucose-regulated protein 78 (GRP78) is a protein chaper-
one that acts as a master regulator of the unfolded proteinresponse (UPR; refs. 1, 2). In the absence of stress, GRP78 isprimarily bound to the three protein effectors of each UPR arm,inositol requiring enzyme 1 (ERN1; IRE1), PKR-like endoplas-mic reticulum kinase (EIF2AK3; PERK), and activating tran-scription factor 6 (ATF6). These heterodimers remain inactivein the endoplasmic reticulum membrane until released fromGRP78. Release occurs following the accumulation of unfold-ed/misfolded proteins within the endoplasmic reticulum,allowing induction of the UPR. Stimulation of IRE1 results inthe unconventional splicing of X-box–binding protein 1(XBP1), leading to production of the active transcription factorXBP1-S and its related signaling (3). Activated PERK can phos-phorylate eIF2a, inhibiting cap-dependent protein translationand promoting the translation of activating transcription factor4 (ATF4) and DNA damage-inducible transcript 3 (DDIT3;CHOP). The release of GRP78 from ATF6 enables ATF6 to
translocate to the Golgi complex where it is cleaved by site 1and 2 proteases (S1P and S2P) to form the activated ATF6transcription factor. Activation of the UPR controls various cellsignaling pathways, including cap-dependent protein transla-tion, cell cycle, apoptosis, autophagy, transcription of proteinchaperones, antioxidant response, among other responses.Although activation of the UPR is initially prosurvival, pro-longed UPR activation can lead to cell death (1, 2).
Breast cancers exhibit increased activation of several UPRsignaling components (4–6). Furthermore, some breast cancertherapies, such as tamoxifen (TAM) and faslodex (fulvestrant, ICI)used in the management of estrogen receptor–positive (ERþ)breast cancers, stimulate UPR signaling to promote cell survivaland drug resistance (7). Antiestrogen-resistant breast cancer celllines express elevated levels of both GRP78 and XBP1, suggestingUPR activation as a driver of endocrine therapy resistance (8, 9).Treatment of ERþ breast cancer cells with antiestrogens can causethe accumulation of inactive ERa within the cell (10, 11). Abla-tion of ERa through RNAi inhibited antiestrogen therapy-medi-atedUPR activation (7). Thus, accumulation of ERa can stimulateUPR signaling. Inhibiting GRP78 using RNAi can potentiateantiestrogen responses in sensitive cells and at least partly restoresensitivity in resistant cells. We also showed that inhibition ofGRP78 prevented antiestrogen-mediated autophagy inductionthrough regulation of AMPK (8, 12), suggesting that targetingGRP78 may affect other AMPK-regulated functions such as cel-lular metabolism (13).
Using a GRP78-targeting morpholino, for the first time weshow that in vivo inhibition of GRP78 potentiates tamoxifensensitivity in ERþ breast tumors and can restore sensitivity inresistant tumors. Diverging from GRP780s canonical role in UPRsignaling, metabolomics analysis shows a novel role of GRP78 inregulating lipid metabolism. For example, we now show thatsupplementation of theGRP78-regulatedmetabolite linoleic acid
1Department of Surgery and Hypertension and Vascular ResearchCenter, Wake Forest University School of Medicine, Winston-Salem,North Carolina. 2Department of Oncology and Lombardi Comprehen-sive Cancer Center, Georgetown University Medical Center,Washing-ton, DC. 3Laboratory of Pathology, National Cancer Institute, NIH,Bethesda, Maryland.
Note: Supplementary data for this article are available at Cancer ResearchOnline (http://cancerres.aacrjournals.org/).
Corresponding Author: Katherine L. Cook, Wake Forest University, MedicalCenter Boulevard, Winston-Salem, NC 27157. Phone: 336-716-2234; Fax: 336-716-1456; E-mail: [email protected]
(LA), a polyunsaturated omega-6 fatty acid, restores endocrinetherapy sensitivity in vivo. We further show that GRP78 inhibitionprevents mitochondrial lipid transportation through a reductionof CPT1A that limits fatty acid oxidation and increases lipidaccumulation, peroxidation, and reactive oxygen species (ROS)generation. Moreover, in vivo supplementation with LA in com-bination with tamoxifen produced a greater inhibition of tumorgrowth than does treatment with tamoxifen alone. These datasuggest that LA regulation by GRP78 mediates, at least partly, theantitumor activity of the GRP78 morpholino. We also show, forthe first time, that GRP78 inhibition in BALB/c mice and inathymic tumor-bearing mice treated with human-targetingGRP78 morpholino or the GRP78-regulated metabolite (LA)supplementation, regulates CD47 expression and stimulates aninnate immune response, which includes increase macrophageinfiltration, to reduce ERþ tumor growth.
Materials and MethodsMaterials
The followingmaterials were obtained as indicated:Mouse andhuman specific targeting GRP78 morpholinos (GeneTools);Tamoxifen citrate diet (LabDiet) and 4-OH Tamoxifen (TocrisBioscience). ImprovedMinimal Essential Medium (IMEM; GibcoInvitrogen BRL); bovine calf charcoal stripped serum (CCS; Equi-tech-Bio Inc.); oil-red-O stain andN-acetyl-cysteine (NAC; Sigma-Aldrich); and crystal violet (Thermo Fisher Scientific). GRP78siRNA was obtained from Dharmacon. GRP78 pcDNA wasobtained from Origene. ACC inhibitor, TOFA was obtained fromSanta Cruz Biotechnology. Antibodies were obtained from thefollowing sources: GRP78, CPT1A, calreticulin, HMBG1, phos-pho-ACC, ACC, SCD1, FASN, phospho-AMPK, p110 alpha, phos-pho-Akt, Akt, IRE1, PERK, CHOP, XBP1-S, and MCP-1 (CellSignaling Technology); CD47 (clone 301, eBioscience); adipo-phillin (Abbiotec); b-tubulin (Sigma-Aldrich), GRP78 (for IHC),b-actin, and polyclonal and horseradish peroxidase–conjugatedsecondary antibodies (Santa Cruz Biotechnology). Linoleic acid(Tocris) was used for the in vitro studies. Linoleic acid (SigmaAldrich) and time release linoleic acid and estrogen pellets wereobtained from Innovative Research of America for the in vivostudies. The Fatty Acid Oxidation Kit was from Abcam, the LipidPeroxidation Kit was obtained from Invitrogen, and the ROSDetermination Flow Cytometry Kit was from Enzo. The kit forthe immunohistochemical determination of ROS was obtainedfrom (Millipore).
Cell cultureLCC1 and LCC9 human breast carcinoma cells, previously
derived in this laboratory (14, 15), were grown in phenol-red–free IMEM media containing 5% charcoal-treated calfserum (CCS) and defined as basal growth conditions. ZR-75-1 obtained from the ATCC, were grown in RPMI contain-ing 10% FBS. Cells were grown at 37�C in a humidified, 5%CO2:95% air atmosphere.
Cell proliferationHuman breast cancer cells (5� 104 cells/mL) in IMEM contain-
ing 5% CCS were plated in 24-well tissue culture plates. For someexperiments cells were transfected with control (scrambled non-targeting) or GRP78 siRNA on day of plating. On day 1 afterplating, cells were treated with varying doses of tamoxifen(10–1,000 nmol/L) and/or 100 nmol/L–100 mmol/L linoleic acid
and/or 1 mmol/L NAC (antioxidant). On day 3 or 6, mediawere aspirated and cells were stained with crystal violet, permea-bilized in citrate buffer, and absorbance was read at 480 nmusing a plate reader.
MetabolomicsMetabolite analysis was performed by Metabolon; see Supple-
mentary Experimental Procedures.
Inhibition of GRP78 in vivo xenograft mouse modelsFive-week-old ovariectomized athymic nudemice (Harlan Lab-
oratories)were injected orthotopically into themammary fat padswith a suspension of 1� 106 LCC1 or LCC9 cells inMatrigel.Micewere supplemented with subcutaneous implantation of a 17b-estradiol pellet (0.36 mg, 60-day release; Innovative Research ofAmerica). Once tumors obtained an area of 30 to 40 mm2, micewere treated every 3 days with an intraperitoneal injection of250 mL of 30 mmol/L human-specific GRP78 targeting morpho-lino (antisense code: GAGAGCTTCATCTTGCCAGCCAGTT) ormouse-specific GRP78 targeting morpholino (antisense code:GCTCAGCAGTCAGGCAGGAGTCTTA) or a combination of bothhuman- and mouse-targeting GRP78 morpholinos in saline.Where appropriate, somemicewerealsoplacedona5053PicoLabRodent Diet 20 containing 400 ppm tamoxifen citrate. Tumorswere measured weekly for 4 to 6 weeks. Mice were sacrificed andtumors were removed at necropsy, fixed in neutral bufferedformalin, and processed using routine histologic methods.
Systemic GRP78 inhibition by morpholinoFemale, 4-week-old, BALB/cmice were purchased fromHarlan.
Every 3 days, mice were injected intraperitoneally with 250 mL of30 mmol/L mouse-specific GRP78-targeting morpholino for 3weeks before being euthanized. At necropsy, serum was collectedfor cytokine analysis and mammary glands were harvested forprotein and immunohistochemical analysis.
In vivo metabolite replacement modelFive-week-oldovariectomized athymicnudemicewere injected
orthotopically into the mammary fat pads with a suspensionof 1 � 106 LCC9 cells in Matrigel. Mice were supplementedwith subcutaneous implantation of a 17b-estradiol pellet. Oncetumors obtained an area of 30 to 40mm2, mice were treated with0.25 mg/day linoleic acid, 2.5 mg/day linoleic acid and/or 400ppm tamoxifen citrate diet. Tumors were measured weekly for6weeks. At the end of the study,mice were euthanized and serum,mammary glands, and tumors were obtained for analysis.
RT-PCRRNA was extracted using TRIzol by following the manufac-
turer's protocol. cDNAwas synthesized from1 to5mgof total RNAusing Superscript first strand RT-PCR reagents as described by themanufacturer. qRT-PCR was then performed using the SYBRGreen Kit. The gene/primer sequence data is shown in the Sup-plementary Experimental Procedures.
Western blot hybridizationAs previously described, cells, tumors, and mammary glands
were harvested in RIPA lysis buffer, protein was measured using astandard BSA assay, and proteins were size fractionated by poly-acrylamide gel electrophoresis and transferred to nitrocellulosemembranes. Membranes were incubated overnight with primary
Cook et al.
Cancer Res; 76(19) October 1, 2016 Cancer Research5658
antibodies. Immunoreactive products were visualized by chemi-luminescence and quantified by densitometry using the ImageJdigital densitometry software (http://imagej.nih.gov/ij/). Proteinloadingwas visualizedby incubation of strippedmembraneswitha monoclonal antibody to b-actin (1:1,000).
Flow cytometryLCC9 cells were transfected with control (sequence-specific
scrambled oligonucleotide) or GRP78 siRNA and treated withtamoxifen (100 nmol/L) for 3 days. To measure fatty acid oxi-dation, cells were stained as described in the Fatty Acid OxidationDetection Kit (Abcam), and counted by flow cytometry (GUMCFlowCytometry Shared Resource). Tomeasure ROS generation orlipid peroxidation, cellswere stained as described in the Total ROSDetection Kit (Enzo Life Sciences) or the lipid peroxidation Kit(Invitrogen) and counted by flow cytometry (GUMC FlowCytometry Shared Resource).
Oil-red-O stainingLCC9 cells were transfected with control siRNA, GRP78 siRNA,
or treated with 10 mmol/L linoleic acid for 72 hours. Cells werefixed using 4% PFA, then stained with oil-red-O to visualize lipiddroplets.
ImmunohistochemistryTumors were fixed in 10% formalin for at least 24 hours before
embedding in paraffin. Embedded tumors were cut into 5-mmthick sections and immunostaining was performed with an anti-body to CD68 (1:100), GRP78 (1:100), adipophillin (1:100),CD47 (1:100) or a nonspecific antibody (negative control) usingthe DAB method. Stained sections were visualized and photo-graphed. ROS IHC was performed using the OxyIHC OxidativeStress Detection Kit.
Cytokine analysisSerum from mice was collected and snap frozen at the time of
necropsy. Quansys Biosciences Q-Plex Array kits were used tomeasure MCP-1 mouse cytokine levels as described previously(16).
Statistical analysisData are presented as the mean � SEM. Statistical differences
were evaluated by Student t test or ANOVA followed by Bonfer-roni post hoc tests. Criterion for statistical significance was set atP < 0.05.
ResultsIn vitro inhibition of GRP78
We first confirmed that inhibition of GRP78 by RNAi restoresendocrine therapy sensitivity in LCC9 breast cancer cells (estrogenindependent and antiestrogen cross-resistant) and also potenti-ates antiestrogen therapy responsiveness in antiestrogen sensitiveERþ ZR-75-1 breast cancer cells in vitro. Breast cancer cells weretransfected with control (untargeted) siRNA, GRP78 siRNA, orGRP78 cDNA for 24 hours then plated (1 � 104) in an ACEAxCELLigence RTCA system electronic microtiter plate (E-Plate) tomeasure cell index by electrical impedence for 72 hours in thepresence of 100 nmol/L tamoxifen (Fig. 1A and SupplementaryFig. S1A and S1B). Inhibition of GRP78 potentiated endocrine
therapy responsiveness, whereas overexpression of GRP78conferred resistance.
In vivo inhibition of GRP78We determined whether inhibiting GRP78 in vivo would be a
successful therapeutic strategy for the treatment of ERþ breastcancer. In the LCC9 (tamoxifen-resistant) xenografts, a combina-tion of human targeting GRP78 morpholinoþtamoxifen orhumanþmouse targeting GRP78 morpholinoþtamoxifen signif-icantly reduced tumor area (Fig. 1B) and tumor wet weight(Fig. 1C) when compared with either control, tamoxifen-only,or GRP78 morpholino-only–treated animals, or mouse targetingGRP78morpholinoþtamoxifen–treated animals. These data sug-gest that inhibition of GRP78 in the tumor epithelial cells, not inthe microenvironment, results in the re-sensitization of tumorsto endocrine targeted therapies. Successful targeting of GRP78 bythe morpholino was evident in the LCC9 tumor–bearing micetreated with human-targeting GRP78 morpholino-only andtamoxifenþhuman–targeting GRP78 (Fig. 1D) and resulted inthe increase of other UPR signaling component protein levels(PERK, CHOP, IRE1, and XBP1-S). Furthermore, specificity of themouse-targetingGRP78morpholinowas confirmed inmammaryglands from mice treated with human-targeting GRP78 morpho-lino or mouse targeting GRP78 morpholino (Fig. 1E) confirmingthe specificity of GRP78 targeting morpholinos. Tumor sectionsfrom treated LCC9 xenografts were immunostainedwith aGRP78antibody. Successful targeting of GRP78 by the morpholino wasevident in the GRP78 morpholino-only and TAMþGRP78 mor-pholino–treated animals (Supplementary Fig. S1C)
Tumor area was decreased in the LCC1 (tamoxifen-sensitive)xenografts treated either with tamoxifen-only or human-targetingGRP78 morpholinoþtamoxifen when compared with theuntreated andGRP78morpholino only treated control mice (Fig.1F).However, tumor areawas significantly smaller inmice treatedwith tamoxifenþhuman–targetingGRP78 morpholino whencompared with tamoxifen-only–treated mice. Mice treated withtamoxifen-only and tamoxifenþhuman–targeting GRP78 mor-pholino also showed decreased tumor weight when comparedwith their respective control tumors (Fig. 1G). Moreover, a com-bination of tamoxifenþhuman–targeting GRP78 morpholinosignificantly reduced tumor weight when compared with tumorsfrom the tamoxifen-only–treatedmice. Thus, inhibitingGRP78 incombination with antiestrogen treatment potentiated endocrinetherapy sensitivity.
Cell surface GRP78 localization was previously shown toactivate PI3K/Akt signaling (17, 18). We determined the proteinlevels of p110a, phosphorylated Akt (Ser473 and Thr308), andtotal Akt (Supplementary Fig. S1D) in LCC9 xenograft tumors.Targeting ofGRP78 by humanGRP78morpholino had nooveralleffect on PI3K/Akt signaling.
Metabolomic profile of GRP78 inhibitionTo identify the molecular mechanism of GRP78-mediated
potentiation of the tamoxifen responsiveness, given our previ-ous work suggesting GRP78 regulation of AMPK (8), metabo-lomics analysis of over 330 validated metabolites was per-formed on LCC1 and LCC9 breast cancer cells treated withtamoxifen and/or transfected with GRP78 siRNA. Inhibitionof GRP78 in the LCC1 cells significantly upregulated over 14metabolites and downregulated 39 metabolites. GRP78 knock-down in the antiestrogen-resistant LCC9 cells significantly
GRP78 Regulates Lipid Metabolism and Tumor Microenvironment
www.aacrjournals.org Cancer Res; 76(19) October 1, 2016 5659
upregulated over 30 metabolites and downregulated 13 meta-bolites. Principal component analysis (PCA) revealed a distinctseparation between LCC1 and LCC9 samples implying signif-icant differences in basal metabolism between cell types (Fig.2A). The effects of GRP78 knockdown were more subtle whencompared within, rather than between, cell lines. Desmosterolwas elevated in tamoxifen-treated samples in agreement withearlier studies (19, 20), thereby serving as an internal control ofdrug efficacy (Fig. 2B).
Metabolomic profiling when GRP78 was inhibited identified achange in lipid metabolism common to both LCC1 and LCC9breast cancer cells. The heat map for lipid metabolite levels isshown in Supplementary Fig. S2A. Six significant lipid metabo-liteswere regulated byGRP78 silencing andGRP78 knockdownþ
tamoxifen in both LCC1 and LCC9 cell lines. GRP78 silencingalone and in combination with tamoxifen treatment was accom-panied by the accumulation of cellular linoleate (18:2 n6),linolenate (18:3 n3 or n6), dihomo-linoleate (20:2 n6),dihomo-linolenate (20:3 n3 or n6), and arachidonate (20:4n6; Fig. 2C–H).
Targeting GRP78 reduces fatty acid oxidationThe increase in cellular fatty acids could reflect perturbations in
fatty acid uptake, lipid biosynthesis, or fatty acid b-oxidation. Weinvestigated the impact of GRP78 silencing on expression of thelipid/cholesterol metabolism modulator genes sterol-regulatoryelement–binding factor-1 and -2 (SREBP1 and SREBP2). Inhibi-tionofGRP78 significantly reduced SREBP1 (Fig. 3A) and SREBP2
Tum
or
wei
gh
t (g
)
Time (weeks)
Time (weeks)
Tum
or
wei
gh
t (g
)
A
D
F G
E
B C
Figure 1.
Effects of targeting GRP78. A, LCC9 or ZR-75-1 ERþ breast cancer cells were transfected with control siRNA, GRP78 siRNA, or GRP78 cDNA for 24 hours, platedin an ACEA E-plate and treated with vehicle or 4-OHT for 72 hours and cell index was then measured by electrical impedance; n ¼ 3; � , P < 0.002. B, LCC9orthotopic tumors were untreated (control) or treated with tamoxifen, human and/or mouse GRP78-targeting morpholino (GRP78M), or human and/ormouse GRP78MþTAM for 4 weeks. Tumors were measured weekly with calipers and tumor area calculated. C, average wet weight of LCC9 upon sacrifice;n ¼ 8–10; �, P < 0.03. D, protein lysates from LCC9-treated tumors were isolated and Western blot hybridization was used to confirm levels of GRP78 andother UPR signaling components. E, protein lysates from untreated (control) ormammary glands treatedwith human ormouse targeting GRP78Mwere isolated andWestern blot hybridization was used to confirm expression levels of GRP78 and other UPR signaling components. F, LCC1 orthotopic tumors were grown to25 to 30 mm2 before treatment with TAM, GRP78M, or GRP78MþTAM for 6 weeks. Tumors were measured weekly with calipers and tumor area calculated.G, LCC1 tumor weight upon completion of study; n ¼ 6–10; � , P < 0.001.
Cook et al.
Cancer Res; 76(19) October 1, 2016 Cancer Research5660
(Fig. 3B) when compared with control transfected cells. Tamox-ifen treatment resulted in a significant increase in SREBP1 in LCC1cells and SREBP2 in LCC9 cells, suggesting a differential regula-tion of these genes by tamoxifen in antiestrogen–sensitive and–resistant cells.
Several genes are controlled by SREBP1 including stearoyl-CoAdesaturase (SCD; SCD1), fatty acid synthase (FASN), and acetyl-CoA carboxylase (ACACA; ACC; ref. 21). Western blot hybridiza-tion of protein lysates from control siRNA or GRP78 siRNAtransfected LCC1, LCC9, and ZR-75-1 cells shows that GRP78-silencing inhibits SCD1 and FASN protein expression, whilemodestly increasing ACC protein levels (Fig. 3C). ACC is phos-phorylated by AMP-activated protein kinase (PRKAA1; AMPK) atSer79, inhibiting ACC activity. GRP78 knockdown reduces pACCSer79 protein levels (Fig. 3C). ACC can inhibit CPT1A throughmalonyl-CoA synthesis. Inhibition of GRP78 results in decreasedCPT1A expression (Fig. 3C), suggesting that GRP78 silencingmayinhibit fatty-acid transport into the mitochondria.
We measured the effect of GRP78 inhibition in liver tissue offemale wild-type, B6.129(Cg)-Hspa5tm1.1Alee/J (GRP78 hetero-zygous), BALB/c mice treated with GRP78-targeting morpholino,and inBALB/c-untreated controls. InhibitionofGRP78 innormal,non-cancerous tissue had no effect on SCD1 or FASN proteinlevels. However, we observed an increase in ACC protein andreduced CPT1A protein expression (Fig. 3D). These data suggest adifferential effect of GRP78 inhibition in tumors versus non-cancerous tissue, where de novo lipogenesis proteins are onlyinhibited in breast cancer cells and CPT1A/fatty acid mitochon-drial transport may be reduced systemically by GRP78 targeting.
To determine whether GRP78 specifically regulated the ACC/CPT1A signaling axis, LCC9 (Fig. 3E) and ZR-75-1 cells (Fig. 3F)were transfected with control or GRP78 siRNA�GRP78 cDNA to"rescue" the GRP78 protein levels. Overexpression of GRP78 inGRP78-silenced breast cancer cells prevented the ability ofGRP78-silencing to induce ACC and inhibit CPT1A. To confirmthe specificity of GRP78 for mediating the observed differences in
Figure 2.
Metabolomic profile of GRP78inhibition. A, PCA analysis shows adistinct separation between LCC1 andLCC9 samples. B, desmosterol levels inLCC1 and LCC9 cells treated withvehicle, TAM, GRP78 siRNA, or GRP78siRNA þ TAM that serves as an internalcontrol for tamoxifen efficacy. Relativelevels of linoleate (C), linolenate (D),dihomo-linoleate (E), dihomo-linolenate (F), arachidate (G), andarachidonate (H) in LCC1 and LCC9 cellstreated with vehicle, TAM, GRP78siRNA, or GRP78 siRNA þ TAM. n ¼ 6independent experiments; � , P < 0.05.
GRP78 Regulates Lipid Metabolism and Tumor Microenvironment
www.aacrjournals.org Cancer Res; 76(19) October 1, 2016 5661
lipidmetabolism, LCC9 cells were transfectedwithGRP78 siRNA,PERK siRNA, or XBP1 siRNA to inhibit each of the three UPRsignaling arms. Expression of ACC andCPT1Awas thenmeasuredby Western hybridization (Fig. 3H). Knockdown of GRP78, butneither PERK nor XBP1, increased ACCprotein levels and reducedCPT1A. LCC9 cells were transfected with control or GRP78 siRNAand treated with various doses of 5-(tetradecyloxy)-2-furoic acid(TOFA), an ACC inhibitor (Fig. 3G). Inhibition of ACC activity byTOFA prevented the GRP78-mediated reduction of CPT1Aexpression.
Fatty acid b-oxidation enzymes acyl-Coenzyme A dehydroge-nase very-long chain (ACADVL), acyl-CoA dehydrogenase, C-4 toC-12 straight chain (ACADM), and hydroxyacyl-CoA dehydroge-nase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase trifunctionalprotein alpha subunit (HADHA) were measured by flow cytome-
try. LCC9 cells expressed higher levels of ACADVL, ACADM, andHADHA when compared with their antiestrogen-sensitive paren-tal cells (LCC1). Knockdown of GRP78 inhibited ACADVL,ACADM, and HADHA in both LCC1 and LCC9 cells (Fig. 3I).Reduced levels of the carnitine conjugates butyrylcarnitine andpropionylcarnitine, generated by the oxidation of even and oddchain fatty acids respectively, were observed predominantly inGRP78 silenced/tamoxifen-treated LCC1 and LCC9 cells, suggest-ing that loss of GRP78 may sensitize resistant cells by disruptinglipid metabolism (Fig. 3J).
Inhibition of GRP78 increases cellular lipid contentTo confirm GRP78-mediated regulation of cellular lipid con-
tent, LCC9 cells were transfected with control siRNA or GRP78siRNA or treated with 10 mmol/L linoleic acid and stained with
SREB
P1 F
old
chan
gege
ne e
xpre
ssio
n
b-Actinb-Actin
b-Actin
5 mmol/L 50 mmol/L
b-Actin
b-Actin b-Actin
SREB
P2 F
old
chan
gege
ne e
xpre
ssio
nA C D
B
E
G
I J
HF
Figure 3.
Targeting GRP78 reduces fatty acid oxidation. Relative gene expression of SREBP1 (A) or SREBP2 (B) in LCC1 and LCC9 cells treatedwith vehicle, TAM, GRP78 siRNA,or GRP78 siRNA þ tamoxifen normalized with HRPT housekeeping gene expression. n ¼ 4 independent experiments in triplicate; � , P < 0.05. C, analysis ofdownstream SREBP1 regulated proteins SCD1, FASN, ACC (total), p-ACC (inactive) in LCC1, LCC9, and ZR-75-1 cells transfected with control or GRP78siRNA. D, relative protein levels of GRP78, FASN, SCD1, ACC, CPT1A in BALB/c mice livers either control (untreated) or treated with GRP78-targeting morpholinoor in 129S wild-type or GRP78 heterozygous mice. Equivalence of protein loading on gels was confirmed by measuring b-actin expression; n ¼ 4; � , P < 0.02.LCC9 (E) or ZR-75-1 (F) cells were transfected with control siRNA, GRP78 siRNA, GRP78 cDNA, or GRP78 siRNAþ GRP78 cDNA. Relative protein levels of GRP78,ACC, CPT1A, and p-AMPK were measured by Western blot hybridization. G, LCC9 cells transfected with control or GRP78 siRNA were treated with TOFA[5-(tetradecyloxy)-2-furoic acid], an ACC inhibitor, for 72 hours. Protein levels of GRP78, ACC, CPT1A, and b-actin were measured by Western blot hybridization.H, LCC9 cells were transfected with control siRNA, GRP78 siRNA, PERK siRNA, or XBP1 siRNA for 72 hours. Relative protein levels of GRP78, PERK, XBP1-S, ACC,CPT1A, and b-actin were measured by Western blot hybridization. I, levels of fatty acid oxidation enzymes ACADVL, ACADM, and HADHA were measuredby flow cytometry in LCC1 and LCC9 cells transfected with control or GRP78 siRNA; n ¼ 3; �, P < 0.04. J, butyrylcarnitine and propionylcarnitine metabolitelevels in LCC1 and LCC9 cells transfected with control or GRP78 siRNA � TAM; n ¼ 6; � , P < 0.05.
Cook et al.
Cancer Res; 76(19) October 1, 2016 Cancer Research5662
oil-red-O (Fig. 4A). Inhibition of GRP78 or treatment of cellswith linoleic acid resulted in an overall increase in cellular lipidcontent. LCC9 xenograft sections were immunostained withAdipose differentiation related-protein (adipophilin), a markerof intracellular lipid droplets in metabolically active cells (Fig.4B). Adipophilin expression was increased in human-targetingGRP78 morpholino-only and tamoxifenþhuman–targetingGRP78 morpholino–treated mice. The elevated levels of lipiddroplets and cellular lipid content are consistent with GRP78knockdown increasing cellular fatty acid concentrations. WhenLCC9 (Fig. 4C) or ZR-75-1 (Fig. 4D) were transfected withcontrol or GRP78 siRNA in vitro, knockdown of GRP78 in bothERþ breast cancer cell lines increased adipophilin protein levels.
Combination of GRP78 silencing and endocrine therapyincreases ROS and cell death
Knockdown of GRP78þTAM in LCC9 cells significantlyincreased lipid oxidation (Fig. 5A). Interestingly, only a combina-
tion of GRP78 knockdown and endocrine-targeted therapyincreased ROS in both LCC9 cells (Fig. 5B) and xenografts (Fig.5C). LCC9 xenografts were stained with TUNEL to measure apo-ptosis. Aswepreviously observed in vitro in LCC9 cultured cells (8),only simultaneous knockdown of GRP78 with tamoxifen treat-ment resulted in a stimulation of cell death in vivo in LCC9xenograft tumors (Fig. 5D). Thus, the increased cellular lipidcontent resulting from GRP78 inhibition in the presence of endo-crine-targeted therapy induces lipid oxidation and ROS produc-tion. Increased ROS generated by GRP78-mediated lipid oxidationpromotes tamoxifen-mediated cell death. We have previouslyshown increased cellular concentrations of ROS promotes celldeath in these cell lines (7). We then treated LCC9 and ZR-75-1 cells that were transfected with control or GRP78 siRNAwith 1 mmol/L NAC and/or tamoxifen for 72 hours and mea-sured relative cell density by crystal violet assay (Fig. 5E).Inhibition of ROS by NAC partially rescued GRP78 knockdownre-sensitization (LCC9) or potentiation (ZR-75-1) of endocrine
Figure 4.
Inhibition of GRP78 increases cellularlipid content. A, oil-red-O staining ofLCC9 cells transfected with controlor GRP78 siRNA or treated with10 mmol/L LA. Cells werepermeabilized and stained;absorbance was read at 490 nm tomeasure cellular lipid content; n ¼ 3;� , P < 0.02. B, LCC9 tumor sectionswere stained using an adipophilinantibody and visualized at �40. LCC9(C) or ZR-75-1 (D) human breastcancer cells were transfected withcontrol or GRP78 siRNA for 96 hoursand adipophilin was measured byWestern blot hybridization.
GRP78 Regulates Lipid Metabolism and Tumor Microenvironment
www.aacrjournals.org Cancer Res; 76(19) October 1, 2016 5663
Combination of GRP78 silencing and endocrine therapy increases ROS and cell death. A, lipid peroxidation was measured by flow cytometry in LCC9 cellstreated with cumene hydroperoxide (positive control), vehicle, TAM, GRP78 siRNA, or GRP78 siRNA þ TAM. n ¼ 4; � , P < 0.001. B, ROS was measured by flowcytometry in LCC9 cells treated with 100 mmol/L pyocyanin (positive control), vehicle, TAM, GRP78 siRNA, or GRP78 siRNA þ TAM. n ¼ 3; � , P < 0.001. C, LCC9tumor sections were stained using OxyIHC kit to measure ROS and visualized at �10 magnification. D, LCC9 tumor sections were stained with TUNEL to measureapoptosis and visualized at �20. E, LCC9 and ZR-75-1 human breast cancer cells were transfected with control or GRP78 siRNA and treated with 1 mmol/L NACand various doses of 4-OHT (tamoxifen) for 72 hours; relative cell density was measured by crystal violet; n ¼ 3; � , P < 0.05. F, LCC9 and ZR-75-1 breastcancer cells were transfected with control or GRP78 siRNA and treated with 1 mmol/L NAC for 48 hours and MCP-1 protein levels were measured by Western blothybridization.
Cook et al.
Cancer Res; 76(19) October 1, 2016 Cancer Research5664
therapy responsiveness, suggesting a key role of ROS in medi-ating this phenotype. Furthermore, inhibition of ROS by NACtreatment prevented GRP78-mediated MCP-1 induction inGRP78-silenced breast cancer cells (Fig. 5F), suggesting thattargeting GRP78 may affect the tumor microenvironmentthrough ROS regulation.
Antiestrogen-resistant LCC9 breast cancer cells were treatedwith escalating doses of linoleic acid and tamoxifen in vitro.Co-treatmentwith theGRP78-regulatedmetabolite (linoleic acid;LA) and tamoxifen resulted in a modest resensitization of theresistant LCC9 breast cancer cells to tamoxifen (Fig. 6A). LAconcentrations that successfully potentiated antiestrogen sensi-tivity significantly reduced GRP78 protein expression (Fig. 6B),suggesting a reciprocal relationship between GRP78 and GRP78-regulated metabolites.
LCC9 xenografts were grown in the mammary fat pad regionsof female athymic mice and mice treated with various doses ofLA and/or tamoxifen for 6 weeks. Combination treatment withLAþTAM reduced both tumor area (Fig. 6C) and tumor weight(Fig. 6D). Importantly, this combination was as effective as thecombination of GRP78 targeting and tamoxifen treatment,suggesting that the GRP78-regulated metabolite (LA) couldmediate GRP78 morpholino antitumor activity. Furthermore,independent of tamoxifen exposure, LA treatment inhibitedGRP78 protein expression in LCC9 breast tumors (Fig. 6E),supporting the feedback interaction observed in vitro. In vivosupplementation with LA (Fig. 6C) resulted in a more effectiveinhibition of growth than was observed in vitro (Fig. 6A). These
data suggest an important role for the tumor microenviron-ment in mediating GRP78-regulated metabolite breast tumorgrowth inhibition.
GRP78 inhibition and GRP78-mediated metabolites affectinnate immunity
Serumwas extracted from LCC9 xenograft bearingmice treatedwith vehicle (control), TAM, LA, or LAþTAM and was used todetermine circulating levels of MCP-1 by ELISA (Fig. 7A). Sup-plementation with the GRP78-regulated metabolite LA signifi-cantly increased serum levels of monocyte chemotactic protein1 (CCL2; MCP-1) when compared with vehicle (control) ortamoxifen-treated mice. Female BALB/c mice (no mammarytumors) were injected with control or a mouse targeting GRP78morpholino for 3 weeks to systemically reduce overall GRP78protein levels. Serum from BALB/c mice treated with morpholinoexpressed higher levels of circulatingMCP-1when comparedwithserum isolated from control injected BALB/cmice (Fig. 7A). Thus,systemic inhibition of GRP78 or supplementation with LA, aGRP78-regulated metabolite, produce similar effects on circulat-ing MCP-1 levels.
Westernblothybridizationofprotein lysates isolated fromLCC9xenograft control or treated tumorswithTAM, LA, or LAþTAM(Fig.7B) or human-targetingGRP78morpholino� tamoxifen (Fig. 7C)were used to measure relative protein levels of "eat me/don't eatme" protein signals including calreticulin (CALR), high mobilitygroup box 1 (HMGB1), and CD47. Only GRP78M�TAM orLAþTAM–treated tumors have increasedmultiple "eat me" signal-ing proteins, including HMGB1 and calreticulin. LCC9 tumorstreated with either GRP78M �TAM or LA�TAM have decreasedCD47 expression, a potent "don't eatme" signal. Thesedata suggest
AB
E
DC
1.25 Control 1 mmol/L LA 10 mmol/L LA 100 mmol/L LA
Supplementation with LA, a GRP78-regulated cellular metabolite, inhibitstumor growth. A, LCC9 cells weretreated with 1 to 100 mmol/L LA, and/orvarious concentrations of tamoxifen(vehicle, 10, 100, and 1,000 nmol/L) for6 days. Relative cell density wasdetermined by crystal violet assay;n ¼ 4; � , P < 0.02. B, LCC9 cells weretreated with 1 to 100 mmol/L LA for72 hours. Western blot hybridizationwas used to confirm levels of GRP78;n ¼ 4; � , P < 0.003. C, LCC9 orthotopictumors were untreated (control) ortreated with tamoxifen, 0.25 mg/dayLA, 2.5 mg/day LA, 0.25 mg/day LAþTAM, or 2.5 mg/day LAþTAM for6weeks. Tumorsweremeasuredweeklywith calipers and tumor areas werecalculated from the lengths on the twolongest perpendicular measurements.D, average wet weight of LCC9 tumorsupon sacrifice; n ¼ 6–9; � , P < 0.001.E, LCC9 tumor sections were stainedusing GRP78 antibodies andvisualized at �40.
GRP78 Regulates Lipid Metabolism and Tumor Microenvironment
www.aacrjournals.org Cancer Res; 76(19) October 1, 2016 5665
Inhibition of GRP78- and GRP78-regulated cellular metabolites affect innate immunity. A, serum from LCC9 xenograft-bearing female aythmic miceuntreated (control) and treated TAM, LA, LAþTAM, and serum from untreated or GRP78 morpholino–treated female BALB/c mice were analyzed by ELISAfor circulating systemic levels of MCP-1; n¼ 4; � , P < 0.001. B, protein lysates from LCC9 tumors (control, TAM, LA, or LAþTAM) were analyzed using Western blothybridization for calreticulin, HMGB1, and self-recognition identifier CD47. C, protein lysates from LCC9 tumors (control, tamoxifen, human targeting GRP78M, orhuman targetingGRP78MþTAM)were analyzedusingWestern blot hybridization for calreticulin, HMGB1, and self-recognition identifierCD47.E,protein lysates frommammary glands extracted from untreated or GRP78M-treated female BALB/c mice were analyzed for calreticulin and CD47. Gel loading was confirmed bymeasuring b-actin expression. Treated LCC9 tumor sections (D) ormammary glands (F) fromuntreated or GRP78morpholino (GRP78M)–treated BALB/cmicewerestained using CD68 antibody to determine macrophage infiltration and visualized at �40 magnification.
Cook et al.
Cancer Res; 76(19) October 1, 2016 Cancer Research5666
that either supplementationwith LA or targetingGRP78 stimulatesa switch in immunosurveillance signaling.
Expression of the calreticulin and CD47 proteins was mea-sured in protein lysates from mammary glands from BALB/cmice treated with control or mouse-targeting GRP78 morpho-lino by Western blot hybridization (Fig. 7E). Reduction ofGRP78 in the mammary glands of BALB/c mice increasedcalreticulin levels, similar to the effects of human-targetingGRP78M treatment in xenografts. Unlike breast tumor tissue,inhibiting GRP78 in normal mammary tissue increased expres-sion of the CD47 "don't eat me" signal. These data suggest adifferential role of GRP78 in regulating CD47 signaling inneoplastic versus normal tissues. LCC9 xenografts (Fig. 7D)and BALB/c mammary glands (Fig. 7F) were stained for CD68to determine macrophage infiltration. Both knockdown ofGRP78 by morpholino and supplementation with its regulatedmetabolite LA, increased macrophage infiltration in targettissues. Thus, either inhibition of GRP78 or treatment with LAcan potentiate an antitumoral immune response.
DiscussionBreast cancer is the most frequently diagnosed cancer among
women. Over 230,000 new cases of invasive breast cancer arediagnosed annually, with 70% of all breast cancers expressingthe ERa (22). These cancers are often treated with ERa-targetedtherapies such as receptor antagonists (antiestrogens), includ-ing tamoxifen. However, many initially responsive tumorsdevelop resistance to these endocrine therapies and, overall,more women die from ERþ breast cancer than from any othersubtype of breast cancer (23). Our previous work reportedelevated GRP78 protein levels in all molecular subtypes ofbreast cancer when compared with the normal surroundingbreast tissue (8). Furthermore, endocrine therapy resistantbreast cancer cell lines overexpress GRP78, suggesting GRP78as a mediator of breast cancer resistance (8, 24). Althoughothers have proposed GRP78 as a general target for therapy(25), our current study highlights the importance of targetingGRP78 as a specific therapeutic strategy for ERþ breast cancer(26). We show, for the first time, that antisense morpholino cansuccessful target GRP78 protein expression in vivo to potentiateendocrine sensitivity in ERþ breast tumors. Combining tamox-ifen with the GRP78-targeting morpholino restored sensitivityin resistant ERþ tumors (Fig. 1B and C) and increased tamox-ifen responsiveness in antiestrogen sensitive ERþ breast tumors(Fig. 1F and G).
These studies expand the role of GRP78 from a proteinchaperone controlling the unfolded protein response toinclude an important function in regulating lipid metabolism.Knockdown of GRP78 resulted in the accumulation of cellularessential fatty acids (Fig. 2), suggesting that GRP78 regulatestheir uptake and/or catabolism. We show that inhibitingGRP78 reduces SREBP-1 transcript levels and decreases theexpression of some SREBP-1 target genes (Fig. 3A and C).SREBP1 is a basic helix-loop-helix-leucine zipper transcriptionfactor that is maintained as an inactive precursor when locatedwithin the endoplasmic reticulum lumen (21). Activation ofSREBP1 involves its translocation to the Golgi complex bySREBP cleavage-activating protein (SCAP) and proteolyticcleavage by site 1 (S1) and site 2 (S2) proteases. It is notsurprising that GRP78 regulates SREBP, given the similarity in
activation of SREBP to the activation of the ATF6 UPR arm.Integration of UPR and SREBP regulation is intuitively rational.Accumulation of unusable unfolded proteins within theendoplasmic reticulum should trigger a mechanism to inhibitconcurrently protein production to help relieve endoplasmicreticulum stress. Integration of UPR signaling and lipid metab-olism is likely needed to address the problems with theunfolded protein components of lipoproteins being managedby the UPR in the presence of endoplasmic reticulum stress.
Previous studies have suggested a possible role of UPRsignaling in lipid metabolism. GRP78 heterozygous mice areresistant to obesity when placed on a high fat diet, suggesting arole of GRP78 in modulating lipid metabolism (27). Otherstudies in a hepatic steatosis model showed increased UPRsignaling components and endoplasmic reticulum stress in theliver of obese mice (28, 29). Overexpression of GRP78 reducedUPR signaling and prevented insulin-mediated SREBP1c cleav-age (30). The authors proposed that GRP78 binds to the SREBPcomplex preventing SCAP translocation to the Golgi complexand activation. Although these data seemingly contradict someof our findings, we observed that GRP78 knockdown reducedcellular SCAP protein levels, thereby preventing SREBP trans-location and activation by S1P/S2P (Supplementary Fig. S3E).Therefore, both GRP78 overexpression and GRP78 depletionmay inhibit SREBP through two distinct mechanisms: SREBP1binding and SCAP inhibition.
Other UPR signaling arms are implicated in promotinglipogenesis (28). In an ATF6 knock-out mouse model, endo-plasmic reticulum stress led to liver steatosis resulting fromimpaired b-oxidation mediated by reduced C/EBP transcrip-tional activity (29). IRE1 knockout mice also developed liversteatosis and lipid accumulation (31). The mechanism medi-ating hepatic lipid accumulation in IRE1 deficient mice isunclear but may be mediated in part by loss of XBP1 activity(31, 32). PERK inhibition can reduce SCD1 and FASN expres-sion, also implicating this UPR signaling arm in lipogenesis(33). In support of these data, we show that inhibition of eitherXBP1 or PERK in LCC9 breast cancer cells has no overall effecton ACC and CPT1A signaling (Fig. 3H). Since we previouslyshowed that GRP78 silencing results in a significant increase inall three arms of UPR, our observed results may represent novelactions of GRP78 that occur independent of some UPR signal-ing components.
GRP78 inhibition led to a modest increase in ACC, suggest-ing differential regulation of SREBP1 controlled genes. We alsoobserved a significant decrease in the inactivated phosphory-lated-ACC Ser79; hence, GRP78 knockdown results in ACCactivation. ACC is inactivated when phosphorylated on Ser79by AMPK. We have previously shown that GRP78 overexpres-sion increases autophagic signaling by stimulating AMPK (8,12). Knockdown of GRP78 prevents TSC2/AMPK signalingactivation (8). Activation of ACC leads to increased malonyl-CoA synthesis, resulting in the inhibition of CPT1A (34).CPT1A is localized in the outer mitochondrial membrane andcatalyzes the primary regulated step in overall mitochondrialfatty acid oxidation (35). We observed decreased levels ofboth the mitochondrial fatty acid transporter protein, CPT1A,(Fig. 3C and D) and b-oxidation enzyme activities and bypro-ducts (Fig. 3I and J). Furthermore, treatment of LCC9 cellstransfected with GRP78 siRNA with TOFA (an ACC inhibitor),prevented GRP78-targeting reduction of CPT1A (Fig. 3G).
GRP78 Regulates Lipid Metabolism and Tumor Microenvironment
www.aacrjournals.org Cancer Res; 76(19) October 1, 2016 5667
Taken together, these data suggest that the increased cellularconcentration of lipids observed with GRP78 silencing is due toan overall inhibition of fatty acid oxidation.
Metabolomic analysis also identified elevated levels of oleicand palmitoyl ethanolamide in GRP78-inhibited cells (Supple-mentary Fig. S2B). Co-treatment with oleic ethanolamide andtamoxifen restores tamoxifen sensitivity in antiestrogen resistantLCC9breast cancer cells (Supplementary Fig. S2C). Thus, the lipidaccumulation that accompanies GRP78 inhibition increases theproduction of other antigrowth lipid metabolite bioproducts.Oleic and palmitoyl ethanolamide can also inhibit the expressionof fatty acid hydrolase, reflecting their key roles in lipid metab-olism (36). Furthermore, mice treated with oleic ethanolamidehad reduced body weight gain when fed a high-fat diet (37),perhaps explaining the obesity-resistant phenotype observed inGRP78 heterozygous mice (27).
Inhibition of GRP78 led to increased cellular lipid content (Fig.2; Fig. 4). Increases in fatty acid accumulationwithin non-adiposetissue can lead to cellular dysfunction and death, a phenomenoncalled lipid toxicity (38). Lipid toxicitymaypromote the cell deathmediated by GRP78 targeting; others have reported a role forPUFAs in cancer cell death in vitro (39). For example, PUFA-induced cytotoxicity can be mediated by lipid peroxidation (40).Inhibition of GRP78 in LCC9 breast cancer cells increased lipidperoxidation (Fig. 5A). Furthermore, morpholino-mediatedGRP78 silencing in combination with tamoxifen in vivo resultedin a significant increase in ROS generation and cell death (Fig. 5Cand D). Blockade of ROS generation by treatment with NACpartially rescuedGRP78-silencing re-sensitization of LCC9 cells toendocrine therapy (Fig. 5E), further supporting the critical role ofUPR-mediated ROS generation. Treatment of LCC9 breast cancercells with increasing concentrations of the GRP78-regulatedmetabolite LA showed a modest increase in tamoxifen sensitivityin vitro (Fig. 6A). However, in vivo supplementation of LA resultedin a clear resensitization of ERþ-resistant breast tumors to tamox-ifen (Fig. 6C). These data suggest that, while the effect of LA maypartly reflect stimulation of lipid peroxidation in the tumorepithelial cells, the tumor microenvironment plays a vital rolein mediating GRP78-regulated metabolite tumor cytotoxicity.
Because the UPR can be prosurvival or prodeath, UPR-drivensignaling must be able to regulate the recognition and elimi-nation of cells by the immune system. Systemic reduction ofGRP78, or supplementation with LA, increased both circulatinglevels of MCP-1 (Fig. 7A) and macrophage recruitment in themammary tumors and glands (Fig. 7D and F). Treatment ofmice bearing LCC9 xenografts with human GRP78-targetingmorpholino increased macrophage infiltration as indicated byCD68 immunoreactivity (Fig. 7D). Previous reports showedthat endoplasmic reticulum stress induced MCP-1 expression inthe kidneys of db/db mice through induction of XBP1, linkingUPR signaling to MCP-1 chemokine regulation (6). Moreover,LA treatment of endothelial cells also stimulated MCP-1 pro-duction through an oxidative mechanism (41). Treatment withNAC (a ROS inhibitor) prevented GRP78-silencing mediatedMCP-1 induction (Fig. 5F). Thus, the primary effect of lipidperoxidation and ROS generation mediated by either GRP78inhibition or dosing with LA appears to be the stimulation ofMCP-1 expression and macrophage recruitment.
CD47 is a widely expressed cell surface receptor that servesto regulate innate and adaptive immune system responses (42).Clinical data indicate that CD47 is often upregulated in breast
cancer and is associated with poor survival (43). We show, forthe first time, that GRP78 is a modulator of "self-recognition"through differential regulation of CD47 (Fig. 7B, C and E).Supplementing mice bearing LCC9 xenografts with LA signifi-cantly reduced CD47 expression in tumor cells, an effect expectedto increase their immune recognition and susceptibility to T-celland/or macrophage-mediated cytotoxicity. Treatment of micebearing LCC9 xenografts with a human GRP78-targeting mor-pholino � tamoxifen decreased CD47 expression (Fig. 7Cand Supplementary Fig. S4). Interestingly, tamoxifen treatmentsignificantly increased CD47 protein levels in both breast cancercell lines and xenograft tumors; CD47 may be a critical compo-nent mediating endocrine resistance. Moreover, tamoxifen wasshown to significantly upregulate CD47 expression in the humanendometrium, suggesting a role ofCD47 inpromoting tamoxfien-induced endometrial cancer (44). In normal mammary tissue,systemic GRP78 protein reduction increased macrophage infil-tration (Fig. 7F). Although GRP78 inhibition may negativelyimpact normal tissue, the GRP78-targeting morpholino signifi-cantly increased mammary gland expression of CD47 (Fig. 7E),thereby protecting normal tissue from the cytolytic activities ofmacrophages.
Many normal tissues increase cellular fatty acid levels throughuptake of circulating fatty acids (28). Unlike normal tissue, tomeet their increased metabolic needs malignant cancer cellsoften upregulate de novo fatty acid synthesis enzymes, perhaps tosupplement reduced access to exogenous fatty acids from poorperfusion within the tumor microenvironment. This phenom-enon is characteristic of the metabolic-switch often observed incancer cells (45). We show, for the first time, that targetingGRP78 specifically inhibits de novo fatty acid synthesis proteinsin breast cancer cells and reduces mitochondrial b-oxidationthrough CPT1A inhibition. Thus, GRP78 inhibition increasedcellular lipid content, and promoted both lipid peroxidationand ROS generation. GRP78 knockdown increased lipid toxicityand breast cancer cell death. Increased ROS generation, byGRP78 knockdown, increases circulating chemokine MCP-1and recruits macrophages into the tumor microenvironment.GRP78 differentially regulates CD47-dependent immune sur-veillance signaling in mammary tumor and normal cells toprotect normal tissue and sensitize breast tumors to macro-phage cytolytic activities. Taken together, these data establish anovel role for GRP78 in mediating lipid metabolism andexplain why targeting GRP78 could be an effective therapeuticoption for the treatment of breast cancer, and particularlyendocrine-resistant disease.
Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.
Authors' ContributionsConception and design: K.L. Cook, R. ClarkeDevelopment of methodology: K.L. Cook, D.R. Soto-Pantoja, L. Hilakivi-ClarkeAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): K.L. Cook, D.R. Soto-Pantoja, P.A.G. Clarke,M.I. Cruz, A. Zwart, A. W€arriAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): K.L. Cook, P.A.G. Clarke, L. Hilakivi-Clarke,R. ClarkeWriting, review, and/or revision of the manuscript: K.L. Cook, D.R. Soto-Pantoja, L. Hilakivi-Clarke, D.D. Roberts, R. Clarke
Cook et al.
Cancer Res; 76(19) October 1, 2016 Cancer Research5668
Administrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): M.I. CruzStudy supervision: K.L. Cook, R. Clarke
Grant SupportK.L. Cook is supported by a DOD Breast Cancer Research Program
Postdoctoral Fellowship (BC112023). D.R. Soto-Pantoja is supported by
the NCI Career Transition Award (1K22CA181274-01A1). The work wassupported by awards from the US Department of Health and HumanServices (R01-CA131465, U01-CA184902 and U54-CA149147 to R.Clarke). D.D. Roberts was supported by the Intramural Research Programof the NIH, National Cancer Institute, Center for Cancer Research.
Received October 5, 2015; revised May 31, 2016; accepted June 3, 2016;published online October 1, 2016.
References1. Clarke R, Shajahan AN, Wang Y, Tyson J, Riggins RB, Weiner LM, et al.
Endoplasmic Reticulum stress, the unfolded protein response, and genenetwork modeling in antiestrogen resistant breast cancer. Horm Mol BiolClin Investig 2011;5:35–44.
2. Clarke R, Cook KL, Hu R, Facey CO, Tavassoly I, Schwartz JL, et al.Endoplasmic reticulum stress, the unfolded protein response, autophagy,and the integrated regulation of breast cancer cell fate. Cancer Res2012;72:1321–31.
3. Hu R, Warri A, Jin L, Zwart A, Riggins RB, Fang HB, et al. NF-kappaBsignaling is required for XBP1 (unspliced and spliced)-mediated effects onantiestrogen responsiveness and cell fate decisions in breast cancer. MolCell Biol 2015;35:379–90.
4. Fernandez PM, Tabbara SO, Jacobs LK, Manning FC, Tsangaris TN,Schwartz AM, et al. Overexpression of the glucose-regulated stress geneGRP78 in malignant but not benign human breast lesions. Breast CancerRes Treat 2000;59:15–26.
5. Davies MP, BarracloughDL, Stewart C, Joyce KA, Eccles RM, Barraclough R,et al. Expression and splicing of the unfolded protein response gene XBP-1are significantly associated with clinical outcome of endocrine-treatedbreast cancer. Int J Cancer 2008;123:85–8.
6. Chen J,GuoY, ZengW,HuangL, PangQ,Nie L, et al. ER stress triggersMCP-1 expression through SET7/9-induced histone methylation in the kidneysof db/db mice. Am J Physiol Renal Physiol 2014;306:F916–25.
7. Cook KL, Clarke PA, Parmar J, Hu R, Schwartz-Roberts JL, Abu-Asab M,et al. Knockdown of estrogen receptor-alpha induces autophagy andinhibits antiestrogen-mediated unfolded protein response activation,promotingROS-induced breast cancer cell death. FASEB J 2014;28:3891–905.
8. Cook KL, Shajahan AN, Warri A, Jin L, Hilakivi-Clarke LA, Clarke R.Glucose-regulated protein 78 controls cross-talk between apoptosis andautophagy to determine antiestrogen responsiveness. Cancer Res 2012;72:3337–49.
9. Gomez BP, Riggins RB, Shajahan AN, Klimach U, Wang A, Crawford AC,et al. Human X-box binding protein-1 confers both estrogen independenceand antiestrogen resistance in breast cancer cell lines. FASEB J 2007;21:4013–27.
10. Cook KL, Clarke R. Estrogen receptor-a signaling and localization regulatesautophagy and unfolded protein response activation in ERþbreast cancer.Receptors Clin Investig 2014;1:e316.
11. Ishii Y, Papa L, Bahadur U, Yue Z, Aguirre-Ghiso J, Shioda T,et al. Bortezomib enhances the efficacy of fulvestrant by ampli-fying the aggregation of the estrogen receptor, which leads to aproapoptotic unfolded protein response. Clin Cancer Res 2011;17:2292–300.
12. Cook KL, Clarke R. Heat shock 70 kDa protein 5/glucose-regulated protein78 "AMP"ing up autophagy. Autophagy 2012;8:1827–9.
13. Hardie DG, Ross FA, Hawley SA. AMPK: a nutrient and energy sensor thatmaintains energy homeostasis. Nat Rev Mol Cell Biol 2012;13:251–62.
14. Brunner N, Boulay V, Fojo A, Freter CE, LippmanME, Clarke R. Acquisitionof hormone-independent growth in MCF-7 cells is accompanied byincreased expression of estrogen-regulated genes but without detectableDNA amplifications. Cancer Res 1993;53:283–90.
15. Brunner N, Boysen B, Jirus S, Skaar TC, Holst-Hansen C, Lippman J, et al.MCF7/LCC9: an antiestrogen-resistant MCF-7 variant in which acquiredresistance to the steroidal antiestrogen ICI 182,780 confers an early cross-resistance to the nonsteroidal antiestrogen tamoxifen. Cancer Res1997;57:3486–93.
16. Cook KL, Warri A, Soto-Pantoja DR, Clarke PA, Cruz MI, Zwart A,et al. Hydroxychloroquine inhibits autophagy to potentiate antiestro-
gen responsiveness in ERþbreast cancer. Clin Cancer Res 2014;20:3222–32.
17. Zhang Y, Tseng CC, Tsai YL, Fu X, Schiff R, Lee AS. Cancer cells resistant totherapy promote cell surface relocalization of GRP78 which complexeswith PI3K and enhances PI(3,4,5)P3 production. PLoS ONE 2013;8:e80071.
18. Liu R, Li X, Gao W, Zhou Y, Wey S, Mitra SK, et al. Monoclonal antibodyagainst cell surface GRP78 as a novel agent in suppressing PI3K/AKTsignaling, tumor growth, and metastasis. Clin Cancer Res 2013;19:6802–11.
19. Gylling H, Pyrhonen S, Mantyla E, Maenpaa H, Kangas L, Miettinen TA.Tamoxifen and toremifene lower serum cholesterol by inhibition of delta8-cholesterol conversion to lathosterol in womenwith breast cancer. J ClinOncol 1995;13:2900–5.
20. Poirot M, Silvente-Poirot S, Weichselbaum RR. Cholesterol metabolismand resistance to tamoxifen. Curr Opin Pharmacol 2012;12:683–9.
21. Horton JD, Goldstein JL, Brown MS. SREBPs: activators of the completeprogram of cholesterol and fatty acid synthesis in the liver. J Clin Invest2002;109:1125–31.
22. Siegel R, Ma J, Zou Z, Jemal A. Cancer statistics, 2014. CA Cancer J Clin2014;64:9–29.
23. Riggins RB, Bouton AH, Liu MC, Clarke R. Antiestrogens, aromataseinhibitors, and apoptosis in breast cancer. Vitam Horm 2005;71:201–37.
24. Fu Y, Li J, Lee AS. GRP78/BiP inhibits endoplasmic reticulum BIK andprotects human breast cancer cells against estrogen starvation-inducedapoptosis. Cancer Res 2007;67:3734–40.
25. Booth L, Roberts JL, Cash DR, Tavallai S, Jean S, Fidanza A, et al. GRP78/BiP/HSPA5/DnaK is a universal therapeutic target for humandisease. J CellPhysiol 2015;230:1661–76.
26. Cook KL, Clarke PA, Clarke R. Targeting GRP78 and antiestrogen resistancein breast cancer. Future Med Chem 2013;5:1047–57.
27. Ye R, Jung DY, Jun JY, Li J, Luo S, Ko HJ, et al. Grp78 heterozygositypromotes adaptive unfolded protein response and attenuates diet-inducedobesity and insulin resistance. Diabetes 2010;59:6–16.
28. Baumann J, Sevinsky C, Conklin DS. Lipid biology of breast cancer.Biochim Biophys Acta 2013;1831:1509–17.
29. Rutkowski DT, Wu J, Back SH, Callaghan MU, Ferris SP, Iqbal J, et al. UPRpathways combine to prevent hepatic steatosis caused by ER stress-medi-ated suppression of transcriptional master regulators. Dev Cell 2008;15:829–40.
30. KammounHL,ChabanonH,Hainault I, Luquet S,MagnanC,Koike T, et al.GRP78 expression inhibits insulin and ER stress-induced SREBP-1c acti-vation and reduces hepatic steatosis in mice. J Clin Invest 2009;119:1201–15.
31. Sha H, He Y, Chen H, Wang C, Zenno A, Shi H, et al. The IRE1alpha-XBP1pathway of the unfolded protein response is required for adipogenesis. CellMetab 2009;9:556–64.
32. Lee AH, Scapa EF, Cohen DE, Glimcher LH. Regulation of hepatic lipo-genesis by the transcription factor XBP1. Science 2008;320:1492–6.
33. Bobrovnikova-Marjon E, Hatzivassiliou G, Grigoriadou C, Romero M,Cavener DR, Thompson CB, et al. PERK-dependent regulation of lipogen-esis during mouse mammary gland development and adipocyte differen-tiation. Proc Natl Acad Sci U S A 2008;105:16314–9.
34. Carracedo A, Cantley LC, Pandolfi PP. Cancer metabolism: fatty acidoxidation in the limelight. Nat Rev Cancer 2013;13:227–32.
35. Lee K, Kerner J, Hoppel CL. Mitochondrial carnitine palmitoyltransferase1a (CPT1a) is part of an outer membrane fatty acid transfer complex. J BiolChem 2011;286:25655–62.
www.aacrjournals.org Cancer Res; 76(19) October 1, 2016 5669
GRP78 Regulates Lipid Metabolism and Tumor Microenvironment
36. Liu J, Cinar R, Xiong K, Godlewski G, Jourdan T, Lin Y, et al. Monounsat-urated fatty acids generated via stearoyl CoA desaturase-1 are endogenousinhibitors of fatty acid amide hydrolase. Proc Natl Acad Sci U S A2013;110:18832–7.
37. Lo Verme J, Gaetani S, Fu J, Oveisi F, Burton K, Piomelli D. Regulationof food intake by oleoylethanolamide. Cell Mol Life Sci 2005;62:708–16.
38. Lelliott C, Vidal-Puig AJ. Lipotoxicity, an imbalance between lipogenesis denovo and fatty acid oxidation. Int JObes RelatMetabDisord 2004;28Suppl4:S22–8.
39. Begin ME, Ells G, Das UN, Horrobin DF. Differential killing of humancarcinoma cells supplemented with n-3 and n-6 polyunsaturated fattyacids. J Natl Cancer Inst 1986;77:1053–62.
40. Begin ME, Ells G, Horrobin DF. Polyunsaturated fatty acid-induced cyto-toxicity against tumor cells and its relationship to lipid peroxidation. J NatlCancer Inst 1988;80:188–94.
41. Woo Lee Y, Joo Park H, Hennig B, ToborekM. Linoleic acid inducesMCP-1gene expression in human microvascular endothelial cells through anoxidative mechanism. J Nutr Biochem 2001;12:648–54.
42. Soto-Pantoja DR, Terabe M, Ghosh A, Ridnour LA, DeGraff WG, WinkDA, et al. CD47 in the tumor microenvironment limits cooperationbetween antitumor T-cell immunity and radiotherapy. Cancer Res2014;74:6771–83.
43. Willingham SB, Volkmer JP, Gentles AJ, SahooD,Dalerba P,Mitra SS, et al.The CD47-signal regulatory protein alpha (SIRPa) interaction is a thera-peutic target for human solid tumors. Proc Natl Acad Sci U S A2012;109:6662–7.
44. GielenSC,KuhneLC,EwingPC,BlokLJ, BurgerCW.Tamoxifen treatment forbreast cancer enforces a distinct gene-expression profile on the humanendometrium: an exploratory study. Endocr Relat Cancer 2005;12:1037–49.
2016;76:5657-5670. Cancer Res Katherine L. Cook, David R. Soto-Pantoja, Pamela A.G. Clarke, et al. Breast CancerMetabolism to Control Drug Sensitivity and Antitumor Immunity in Endoplasmic Reticulum Stress Protein GRP78 Modulates Lipid
