Neuroscience 227 (2012) 80–89

ENHANCED SCN7A/NAX EXPRESSION CONTRIBUTES TO BONECANCER PAIN BY INCREASING EXCITABILITY OF NEURONS INDORSAL ROOT GANGLION

C. B. KE, a,b W. S. HE, a C. J. LI, a D. SHI, a F. GAO a ANDY. K. TIAN a*

aDepartment of Anesthesiology, Tongji Hospital, Tongji

Medical College, Huazhong University of Science and

Technology, Wuhan 430030, China

bDepartment of Anesthesiology, Taihe Hospital, Hubei University of

Medicine, Shiyan City 442000, Hubei Province, China

Abstract—Bone pain is one of the most common complica-

tions in cancer patients with bone metastases, and has the

most significant impact on quality of life for patients.

Patients with bone cancer pain may be difficult to treat due

to the poor understanding of the mechanisms; therefore,

the mechanisms of bone cancer pain required elucidation

for developing new therapeutics. Recent studies show that

SCN7A/Nax channel serves as a sodium-level sensor of

the body fluid that controls the Na-intake behavior by chang-

ing the excitability of neurons. In the current study, the

expression of SCN7A/Nax and the excitability of primary

sensory neurons in bone cancer pain rats were examined.

The analgesic effects of knockdown SCN7A/Nax channel

using RNAi lentivirus intrathecal treatment were evaluated

with a behavioral test. The results showed that implantation

of sarcoma induced ongoing and movement-evoked pain

behaviors, whereas SCN7A/Nax knockdown prevented the

onset of these hyperalgesia. Immunohistochemistry

showed that SCN7A/Nax was located in the medium- to

large-sized neurons in dorsal root ganglions (DRGs). The

proportion of SCN7A/Nax-positive cells was significantly

increased in DRGs ipsilateral to sarcoma implantation.

Immunostaining results were further confirmed by Western

blot and real time-polymerase chain reaction (RT-PCR) anal-

yses. Recording from primary sensory neurons in excised

rat dorsal root ganglias, we found that most of SCN7A/

Nax-positive neurons exhibited subthreshold oscillations,

depolarized resting membrane potential and more negative

threshold of action potential. These electrophysiological

changes of neurons increased ectopic spike discharge

which was thought to be an important generator of chronic

pain, however, the hyperexcitability was completely

reversed by SCN7A/Nax knockdown. These results demon-

strate that enhanced expression of SCN7A/Nax channel

within distinct subpopulation of DRG neurons contributes

0306-4522/12 $36.00 � 2012 IBRO. Published by Elsevier Ltd. All rights reservehttp://dx.doi.org/10.1016/j.neuroscience.2012.09.046

*Corresponding author. Tel: +86-(27)-83663173; fax: +86-(27)-83662853.

E-mail address: yktian@tjh.tjmu.edu.cn (Y. K. Tian).Abbreviations: BCP, bone cancer pain; DRG, dorsal root ganglion;EDTA, ethylenediamine tetraacetic acid; EGTA, ethylene glycoltetraacetic acid; HEPES, 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid; NC-LV, negative control lentivirus;PBS, phosphate-buffered saline; RNAi-LV, SCN7A siRNA lentivirus;RT-PCR, real time-polymerase chain reaction.

80

to bone cancer pain by increasing the excitability of these

neurons. These findings may lead to novel strategies for

the treatment of bone cancer pain. � 2012 IBRO. Published

by Elsevier Ltd. All rights reserved.

Key words: bone cancer, pain, SCN7A, sodium channels,

dorsal root ganglion, nociceptor.

INTRODUCTION

Bone cancer occurs in patients with primary bone tumors

(sarcomas and hematopoietic malignancies) and more

commonly in patients with bone cancers that have

metastasized from distant sites such as breast, prostate,

or lung (Luger et al., 2001). The majority of patients with

metastatic bone disease experience moderate to severe

pain and bone pain is one of the most common types of

chronic pain in these patients. With the progression

of tumor-induced bone destruction, intermittent episodes

of extreme pain can occur spontaneously (spontaneous

breakthrough pain), or more frequently after weight-

bearing or movement of the affected limb (movement-

evoked break through pain) (Peters et al., 2005) that

significantly compromises the overall quality of patients’

lives. Bone cancer pain (BCP) is usually progressive and

is particularly difficult to treat (Clohisy and Mantyh,

2004). In previous studies, experimental models of

BCP were developed and provided seminal insight

in understanding the pathophysiology of BCP

(Schweizerhof et al., 2009), but the cellular and

molecular mechanisms underlying the development and

maintenance of cancer-evoked pain are not well

understood (Clohisy and Mantyh, 2003). Recently, it has

been suggested that the hypersensitivity of nociceptors

may play a role on the induction of BCP (Miao et al., 2010).

The function of primary afferent sensory neurons, the

nociceptors in dorsal root ganglia (DRG), is to convert

sensory information from peripheral tissues into

electronic signals (action potential) and transmit these

signals to the brain. Following harmful noxious

stimulation, primary sensory neurons can become

hyperexcitable and can give rise to unprovoked

spontaneous action potential activity or pathological

bursting which contributes to chronic pain (Raouf et al.,

2010). The major determinant of the intensity of pain is

the rate of action potential firing in nociceptors (Emery

et al., 2011). The excitability of nociceptors is closely

related to the electrophysiological properties of sodium

d.

C. B. Ke et al. / Neuroscience 227 (2012) 80–89 81

channels. Several sodium channel subtypes are essential

in modulating the excitability of nociceptors (Ahmad et al.,

2007), and significant changes in the expression of these

channels can induce spontaneously ectopic discharge

and hence the generation of chronic pain (Nassar et al.,

2004; Cox et al., 2006; Schmalhofer et al., 2008).

Although hypersensitivity of nociceptors is involved in

the development of BCP, the exact mechanism is not

well understood.

The SCN7A/Nax gene encodes an atypical sodium

channel, named ‘Nax’ that is considered to be a

descendant of the voltage-gated sodium channel

(Akopian et al., 1997; Garcia-Villegas et al., 2009;

Widmark et al., 2011), although it is not regulated by the

membrane’s voltage as in the other channels of the

sodium channel family (Goldin et al., 2000; Yu and

Catterall, 2003). This channel was originally thought to

be a glial sodium channel, however, in situ studies

revealed that SCN7A/Nax is expressed in lung, uterus,

heart, neurons and nonmyelinating Schwann cells in the

peripheral nervous system (Garcia-Villegas et al., 2009).

The functional properties of this channel, however, are

not clearly understood. Recent experimental data

indicate that the channel serves as a sodium-level

sensor of the body fluid (Hiyama et al., 2002; Shimizu

et al., 2007) that controls the Na-intake behavior

(Watanabe et al., 2000; Hiyama et al., 2004; Noda,

2006, 2007; Hiyama et al., 2010) by changing the

excitability of neurons (Grob et al., 2004). In a large-

scale gene-expression study in a rat model of temporal

lobe epilepsy, a persistent increased SCN7A/Nax

expression in neuron and reactive astroglia was

revealed, which supported the possible involvement of

this channel in the epileptogenic process (Gorter et al.,

2010). In the present study, implantation of cancer cells

into tibia induced bone cancer-related pain behaviors

and led to an overexpression of SCN7A/Nax in medium-

to large-sized DRG neurons.

Knockdown of SCN7A/Nax by RNAi lentivirus

significantly alleviated the cancer-induced bone pain.

Enhanced expression of SCN7A/Nax contributed to

depolarization of the resting membrane potential,

facilitated the generation of subthreshold oscillation and

consequently increased excitability of DRG neurons.

These results suggested that upregulation of SCN7A/

Nax in medium- to large-sized DRG neurons increased

the excitability of these neurons which consequently

contributed to BCP. Thus, inhibition of SCN7A/Nax or

suppression the excitability of DRG neurons maybe

leads to novel approaches for BCP treatment.

EXPERIMENTAL PROCEDURES

Animals

The experimental protocols were approved by the Animal Care

and Use Committee of the Huazhong University of Science &

Technology in accordance with the Guide for the Care and Use

of Laboratory Animals published by the US National Institutes

of Health (NIH Publication No. 85-23, revised 1996) and the

International Association for the Study of Pain guidelines.

Female Wistar rats were supplied by the Animal Center, Tongji

Medical College, Huazhong University of Science and

Technology. Animals were kept under controlled conditions

(24 ± 0.5 �C, 12 h alternating light–dark cycle, with ad libitumaccess to water and food).

Construction of recombined SCN7A-RNAi lentivirus

For SCN7A/Nax siRNA experiment, the sequences of rat

SCN7A/Nax siRNA lentivirus (RNAi-LV) were designed and

synthesized as following: SCN7A/Nax sense oligonucleotide,

50-GCCCTTGGAAGATGTGGAT-30; antisense oligonucleotide,

50-ATCCACATCTTCCAAGGGCTC-30. Lentivirus vector

backbone was U6-vshRNA-UBI-GFP. The same vector

backbone but carrying GFP protein was used as negative

control lentivirus (NC-LV). Lentivirus vector construction and

production were completed by Shanghai Jikai Gene Chem Co.

Ltd. (Shanghai, China). The viral titer of the viral stocks was

1.0 � 109 TU/ml.

Intrathecal catheters and microinjections of virus

Lumbosacral intrathecal catheter was constructed and implanted

by lumbar approach under isoflurane anesthesia (3% induction,

2% maintenance) as described previously (Milligan et al., 1999,

2005; Zhuang et al., 2006; Meunier et al., 2007; Liu et al.,

2010). The indwelling catheter was used to microinject

lentivirus into the CSF space surrounding the lumbosacral

spinal cord. Intrathecal microinjection was performed using a

10 ll void volume to ensure complete drug delivery 3 days

post-intrathecal catheterization. All catheter placements were

verified at death by visual inspection. Data were only analyzed

from animals with catheters verified as having the catheter tip

within the CSF space at the L4–5 DRG location.

Preparation of Walker 256 carcinoma cells

Walker 256 rat mammary gland carcinoma cells (107 cells,

0.5 ml) were injected into the abdominal cavity of a female

Wistar rat (Brigatte et al., 2007). After 6–7 days, cells were

harvested from 5-ml ascitic fluid of the above rat. Briefly, cells

were pelleted by centrifugation (3 min at 200g), rinsed with 2 ml

of phosphate-buffered saline (PBS, pH 7.4) and further

centrifuged in the same conditions. The pellet was

re-suspended in 1 ml PBS, and cells were counted with a

hemocytometer. Cells were diluted to achieve a final

concentration (106 cells/ml) for injection and maintained on ice

prior to surgery. In the sham group, rinsed cells were prepared

in the same final concentrations and boiled for 20 min.

Bone cancer pain model

A rat BCP model was established on 3-day post-virus injection

using female Wistar rats with Walker 256 rat mammary gland

carcinoma cells in a manner similar to that in a previous report

(Mao-Ying et al., 2006; Tong et al., 2010). All animals were

anesthetized with isoflurane (3% induction, 2% maintenance).

Then superficial incision was made in the skin overlying the

right patella after disinfection with 75% v/v ethanol. The tibia

was carefully exposed and a 23-gauge needle was inserted

into the intramedullary canal of the bone, then it was removed

and replaced with a long thin blunt needle attached to a 10 llsyringe containing carcinoma cells. A volume of 10 llcontaining Walker 256 cells (104 cells), or boiled cells was

injected into the bone cavity. Following injection, the entry site

on the bone was sealed with bone wax and the skin was closed.

82 C. B. Ke et al. / Neuroscience 227 (2012) 80–89

Behavioral studies

In all behavioral tests, the examiner was blind to the genotype of

the rats. Cancer-induced pain behaviors were analyzed as

described previously (Honore et al., 2000; Sabino et al., 2002).

Rats were allowed to habituate for a period of 30 min, and

behavioral tests used to measure ongoing and movement-

evoked pain were performed. Quantification of spontaneous

flinches was used to measure ongoing pain, limb use during

normal ambulation in an open field and guarding during forced

ambulation were used as indications of movement-evoked pain.

Bone histology

Rats were euthanized and right tibia bones were removed. The

bones were fixed in 4% paraformaldehyde for 72 h, decalcified

in 10% EDTA (pH 7.4) for 2–3 weeks, then decalcified in

decalcifying solution for 24 h. Tibias were rinsed, dehydrated,

and then embedded in paraffin, cut into 3-lm cross-sections

using a rotary microtome. Sections were stained with

hematoxylin and eosin to visualize the extent of tumor

infiltration and bone destruction.

Immunohistochemistry

Rats were deeply anesthetized and perfused intracardially with

4% paraformaldehyde. Ipsilateral L4–5 DRGs were removed

and postfixed with 4% paraformaldehyde for 2 h at room

temperature, then placed in 30% sucrose solution for 24 h at

4 �C. The DRG sections (10 lm) were incubated in a blocking

solution for 10 min at room temperature and then with anti-

SCN7A/Nax rabbit monoclonal antibody (1:200, Abcam,

Cambridge, UK) and anti-Neun (a marker of neuron) goat

monoclonal antibody (1:200, Abcam, Cambridge, UK) at 4 �Covernight. Following incubation, the sections were incubated

with anti-rabbit immunoglobulin G-labeled with CY3 (1:500,

Abcam, Cambridge, UK) and anti-goat immunoglobulin

G-labeled with CY5 (1:500, Abcam, Cambridge, UK). The

sections were analyzed with a fluorescence microscope

(DM5000B, Leica, Germany) and images were captured with a

CCD Spot camera.

Real-time reverse transcription-PCR

Total RNA of ipsilateral L4–5 DRGs was extracted using the

RNeasy mini kit (Invitrogen, USA). Samples were quantified

using a spectrophotometer (Gene Quant II, Pharmacia Biotech,

UK) and reverse transcribed with AMV-reverse transcriptase

(Roche, Germany), Reaction conditions were 37�C for 15 min,

and 85�C for 15 min. Quantitative PCR was performed using

the Lightcycler system (Roche, Germany) utilizing SYBR green

to detect amplification. The PCR conditions were an initial

incubation at 95�C for 1 min and followed by 40 cycles at 95�Cfor 10 s and at 60�C for 30 s. All reactions were performed in

triplicate. The threshold cycle (CT), which correlates inversely

with the levels of target mRNA, was measured as the number

of cycles at which the reporter fluorescence emission exceeds

the preset threshold level. The amplified transcripts were

quantified using the comparative CT method with the formula

for relative fold change = 2�DDCT. The primers were designed

using http://www.ncbi.nlm.nih.gov/tools/primer-blast/index.cgi?

LINK_LOC=BlastHomeAd. Experiments were performed in

triplicate and data were normalized to GAPDH levels. The

following sequences from 50 to 30 were used for SCN7A:

TCTGAGTGCAGCACGGTTGA (forward) and GACTTGGCCA

GCTGAAGATTTG (reverse), Nav1.6: TCTTCGGCTCCTTC

TTCA (forward) and CTTCTTCTGTTCCTCTGTCA (reverse),

Nav1.7: GACTTCTTCCACTCCTTCC (forward) and GCTGC

CATAACCACTGAT (reverse), Nav1.8: GCCATCATCGTCTT

CATCT (forward) and CAGCACCATCACAGTCAA (reverse),

Nav1.9: GAACCGAAGCCAATGTAAC (forward) and AGAAG

GAGCCGAAGATGA (reverse), GAPDH: AGTGGCCACCAG

TAACATGCAA (forward) and GGACTCAAGGTCGCAGGTCAA

(reverse).

Western blot analysis

Total proteins from rat L4–5 DRGs were extracted by

homogenization in ice-cold RIPA lysis buffer. Protein

concentrations were determined by a BCA protein assay kit

(Thermo Scientific, Rockford, IL, USA). Samples were heated

for 10 min at 95 �C with SDS–PAGE sample buffer. Same

amounts of proteins (20 mg) were separated by 6% SDS–PAGE

separation gels, and were subsequently electrotransferred onto

nitrocellulose membranes (Bio-Rad, Hercules, CA, USA). The

membranes were saturated in blocking solution (5% non-fat dry

milk, 0.1% Tween 20 in PBS 1�) for 1 h at room temperature

and then incubated (overnight, 4 �C) with primary antibodies

directed against SCN7A/Nax (1:500, Abcam, Cambridge, UK) or

GAPDH (1:500, Abcam, Cambridge, UK) in the blocking

solution. After rinsing in blocking solution, blots were incubated

(40 min at room temperature) with horseradish peroxidase-

linked secondary antibodies (1:1000, Abcam, Cambridge, UK).

Blots were finally washed in PBS containing 0.1% Tween 20,

and then in PBS. Membranes were processed with the ECL

Plus kit and exposed to MP-ECL film. The protein expression

was normalized to GAPDH.

Electrophysiology

Acutely dissociated DRG cells. Dissociation of DRG neurons

was performed as described previously (Lolignier et al., 2011).

Briefly, lumbar L4–5 DRGs ipsilateral to operation were

dissected and incubated in Hank’s balanced salt solution

containing collagenase IA (2 mg/ml, Sigma) for 45 min at 37�C.DRGs were then triturated using a fired polished Pasteur

pipette and cells were cultured in Dulbecco’s-modified Eagle’s

medium (DMEM, Invitrogen) supplemented with heat-

inactivated fetal calf serum (10%), L-glutamine (2 mM), Nerve

Growth Factor (25 ng/ml, Gibco) and Glial-derived Neurotrophic

Factor (2 ng/ml, Gibco). Cells were maintained in a humidified

atmosphere (5% CO2, 37 �C) for 3–6 h before recording.

Whole cell patch clamp recordings. Whole cell patch-clamp

recordings were obtained after plating at room temperature

(20–24 �C) using an Multiclamp 700B amplifier (Axon

Instruments, USA), filtered at 1 kHz and digitally sampled at

10 kHz using PCLAMP 9.2 software (Axon Instruments, USA).

Patch pipettes contained (in mM): K-gluconate 135, MgCl2 2,

EGTA 1.1, HEPES 10, MgATP 5, NaGTP 0.5 (pH 7.3,

305 mOsm/l). Bath solution contained (in mM): NaCl 150, KCl

3.5, CaCl2 1.5, MgCl2 1, HEPES 10, D-glucose 10 (pH 7.4,

305 mOsm/l). Patch electrodes fabricated with P-97 Puller

(Narishige, Japan) had resistances of 3–5 MX. Tight seals of

1–2 GX were established and whole-cell recordings were

performed in either current-clamp or voltage-clamp mode.

Medium- to large-sized neurons that showed resting membrane

potentials below �50 mV along with overshooting action

potentials were selected for further study. Action potentials

were elicited by delivering depolarizing step pulses of 1- or

50-ms duration. Ramp depolarization pulses of 4-s duration

from the resting membrane potential to �20 mV were applied

manually to detect subthreshold oscillations and firing. The

current threshold for evoking a single spike using a

depolarizing pulse (1 ms) and the frequency of evoking spikes

using a rectangular constant-current depolarizing pulse

(300 pA, 1 ms) were measured.

C. B. Ke et al. / Neuroscience 227 (2012) 80–89 83

Statistical analyses

All data are presented as means ± SEM. The statistical

significance of difference between values was determined by

analysis of variance (ANOVA). For all analyses, significance

was set at P< 0.05.

RESULTS

H&E staining to further define and confirm thepresence of tumor cells within the tibiaintramedullary space and to visualize bonedestruction

To investigate whether we had established a bone cancer

model. The H&E staining was used to visualize the

presence of sarcoma and bone destruction. The

micrograms of tibias in sham rats showed healthy

structures, which is observed by a clear separation of

mineralized bone and bone marrow cells filling the

intramedullary space (Fig. 1A). At day 7 post-sarcoma

injection, carcinoma cells filled nearly the entire

intramedullary space, and bone marrow cells had been

largely replaced by tumor cells. The bone was slightly

destroyed (Fig. 1B). At day 14 and 21, bone invasion of

tumor cells and clear bone destruction in tumor-bearing

tibia, and heavy signs of degradation in the trabecular

spongy bone were observed (Fig. 1C, D). The bone

stain confirmed the presence of tumor cells within the

tibia intramedullary space. All data in the present study

were only analyzed from the animals with cancer cells in

tibia intramedullary space.

Knockdown of SCN7A/Nax was effective in reducingbone-cancer-related pain behaviors

To test whether SCN7A/Nax contributes to the

development of BCP, we performed a local injection of

carcinoma cells directly into the tibia of rat to mimic

clinical BCP and intrathecal injection of RNAi-LV to

knockdown SCN7A/Nax expression. mRNA of SCN7A/

Nax and Nav1.6–1.9 were examined using RT-PCR to

identify the efficiency and specificity of RNAi-LV to

SCN7A/Nax. We showed that RNAi-LV significantly

reduced mRNA level of SCN7A while leaving other

channels unaffected (data not shown). These results

indicated that RNAi-mediated downregulation SCN7A

expression was specific and efficient.

Fig. 1. Hematoxylin and eosin staining showed a progressive tibia destruction

the sham surgery group showing healthy bone structures. (B, C and D) Micr

injection, respectively. Note a progressive degradation and unstructured arch

densely packed in the marrow cavity, largely replaced bone marrow cells. S

All rats were tested for cancer-induced pain behaviors

before and at 3, 6, 9, 12, 15, 18, and 21 days after

carcinoma cells implantation. The number of

spontaneous flinches during a 2-min period was

examined as ongoing pain. Limb use and activity-related

guarding behavior were measurements of movement-

evoked pain.

Day 12 sarcoma-injected animals exhibited 9 ± 2

flinches, at day 21 the flinches were increased to

15 ± 3 (P< 0.05 versus respective sham), RNAi-LV

treatment significantly reduced the number of

spontaneous flinches by 35% (6 ± 1) on day 12, and by

55% (7 ± 1) on day 21. Compared with cancer-bearing

rats, neither of the flinches changed in NC-LV-treated

animals from day 12 to 21 (P> 0.05) (Fig. 2A).

Limb use score was reduced by 1.6 ± 0.3 at day 12,

and more pronounced (0.7 ± 0.1) at day 21 in cancer-

bearing animals as compared with respective sham

animals (P< 0.05). RNAi-LV-treated cancer-bearing

rats resulted in a significant increase in limb use from

day 12 (2.8 ± 0.4) to 21 (2.4 ± 0.3), compared with

results in sarcoma-injected, control virus-treated rats

(P< 0.05) (Fig. 2B).

Activity-related guarding mirrors the clinical

observation of guarding of the tumor-bearing limb while

bone cancer patients ambulate. Similarly, cancer-

bearing animals had a mean activity-related guarding

score of 2.8 ± 0.2 at day 12, and increased to

4.5 ± 0.3 at day 21 (P< 0.05 versus respective sham).

The mean score for RNAi-LV-treated cancer-bearing

animals had decreased by 1.5 ± 0.1 at day 12 and by

2.1 ± 0.3 at day 21 (P< 0.05 versus respective

cancer-bearing animals). Throughout the experiments,

there were no significant differences in the guarding

scores between NC-LV-treated and cancer-bearing rats

(P> 0.05) (Fig. 2C).

SCN7A/Nax was elevated in medium- to large-sizedDRG neurons of cancer-bearing rats

Following the establishment of BCP, we examined the

expression and the localizations of SCN7A/Nax by

double immunofluorescent labeling with the antibodies

anti- SCN7A/Nax and anti-Neun. We found that SCN7A/

Nax was located in somatic neurons (Fig. 3A). SCN7A/

Nax-positive cells in medium- to large-sized and small-

sized cells were analyzed respectively. Quantitative

analyses revealed that there was a persistent increase

induced by sarcoma injection. (A) Photomicrograph representative of

ograms from tumor-bearing tibias at days 7, 14 and 21 post-sarcoma

itecture of trabecular spongy bone, a cluster of tumor cells that were

cale bar = 200 lm.

Fig. 2. Knockdown of SCN7A/Nax reduced both ongoing and movement-evoked pain-related behaviors in cancer-bearing animals. Ongoing pain

was evaluated as the number of spontaneous flinches (A) and movement-evoked pain was measured with limb use score (B), and activity-related

guarding (C) in sham (n= 12), cancer-bearing animals (n= 24) and that received either RNAi (n= 20) or control virus treatment rats (n= 18).

Note that cancer-bearing animals receiving RNAi-LV treatment had a significantly reduced number of spontaneous flinches and activity-related

guarding, increased limb use score. Values represent the mean ± SEM. ⁄P< 0.05.

84 C. B. Ke et al. / Neuroscience 227 (2012) 80–89

in the number of SCN7A/Nax-positive cells in medium- to

large-sized neurons of cancer-bearing rats in a time-

dependent fashion (7 day, 42.5%± 6.1%; 14 day

64.3%± 6.5%; 21 day, 83.1 ± 7.2%, P< 0.05).

RNAi-LV treatment, but not NC-LV, significantly

decreased the number of SCN7A/Nax-positive cells

(P< 0.05) (Fig. 3B). Only few SCN7A/Nax-positive cells

were observed in small-sized neurons of cancer-bearing

rats throughout the experiments, and there were no

significant differences of SCN7A/Nax-positive cells in

small-sized neurons between sham and cancer-bearing

rats (data not shown). The results indicated that

sarcoma implantation induced a prominent increase of

SCN7A/Nax expression on medium- to large-sized

neurons.

RNAi-LV knocked down SCN7A/Nax expression inDRGs

To quantitatively analyze the time course of SCN7A/Nax

expression during BCP development, we further

detected the mRNA and protein expression of SCN7A/

Nax by RT-PCR and Western blot, respectively. The

results showed that both the protein and mRNA of

SCN7A/Nax in DRG significantly increased from day 7

to day 21 post-sarcoma implantation which were

inhibited by SCN7A/Nax knockdown (Fig. 4A, B).

SCN7A/Nax increased the excitability of DRGneurons

In a previous study, SCN7A/Nax channel served as a

sodium-level sensor of the body fluid that controls the

Na-intake behavior by changing the excitability of

neurons (Grob et al., 2004). In the current study, to

investigate whether SCN7A/Nax channel might

contribute to sensory neuron hyperexcitability, whole-cell

patch clamp recording was performed only on medium-

to large-sized neurons, since SCN7A/Nax was

predominantly expressed on these neurons. TTX

(0.5 lM) was used to distinguish the sodium current of

TTX sensitivity or resistance. Resting membrane

potential was measured on initial electrode penetration.

The resting membrane potential was more depolarized

in cancer-bearing rats than that of sham rats

(�51.4 ± 3.5 mV versus �60.8 ± 2.3 mV, P< 0.05),

but the change was reversed by RNAi-LV treatment

(�59.6 ± 1.5 mV, as compared to the cancer-bearing

rats, P< 0.05) (Fig. 5A). These results indicated that

overexpression of SCN7A/Nax channel resulted in

depolarization of resting membrane potential. Because

hyperpolarization of the threshold potential at which an

action potential was elicited would increase the

excitability of the neuron, we elicited the action potential

using a depolarizing step pulse to determine whether

SCN7A/Nax channel hyperpolarized the threshold

potential. The threshold of action potential was

substantially more negative in cancer-bearing rats than

in sham animals (�37 ± 2.1 mV versus �29 ± 1.8 mV,

P< 0.05). These effects were reversed completely by

TTX (�30 ± 2.8 mV, P< 0.05), but not by RNAi-LV

(Fig. 5B). Since the sodium current of SCN7A/Nax was

TTX resistance, the results suggested that SCN7A/Nax

channel was not involved in hyperpolarization of action

potential threshold, but a TTX-sensitive sodium channel

contributed to these effects. Oscillations of membrane

potential were a necessary condition for the sustained

spiking of neurons (Amir et al., 1999) and contributed to

chronic pain (Liu et al., 2000; Amir et al., 2002). To

determine whether the overexpression of SCN7A/Nax

channel resulted in membrane oscillation, we routinely

shifted the membrane potential in the depolarizing

direction until the appearance of oscillations, or until the

membrane potential reached �20 mV. The results

showed that 76.7 ± 5.8% of neurons from cancer-

bearing rats exhibited high-frequency (�90 Hz)

subthreshold oscillations with an oscillation amplitude

peak of 3–6 mV compared with 9.3 ± 1.8% of sham

rats (P< 0.05). The number of neurons exhibiting

oscillations was approximately in agreement with the

number of SCN7A/Nax-positive neurons (about 83%).

Knockdown of SCN7A/Nax decreased the number of

oscillation cells (19.1 ± 1.8%, P< 0.05), while TTX

completely abolished the oscillation (Fig. 5C). Because

Fig. 3. Upregulation of SCN7A/Nax in medium- to large-sized DRG neurons post-sarcoma inoculation. (A) Double immunofluorescence showed

that SCN7A (red) was colocalized with neuron marker Neun (blue) in DRGs. Scale bar = 20 lm. (B) Histograms indicated the relative mean

SCN7A/Nax-positive cells in medium- to large-size DRG neurons at days 7, 14, 21 post-implantation of sarcoma (three slices per sample from four

rats at each time point, respectively, about 60 cells of each slice were analyzed). The error bars represent standard error of the mean (SEM),⁄P< 0.05. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

C. B. Ke et al. / Neuroscience 227 (2012) 80–89 85

TTX should not affect the current generated by SCN7A/

Nax channel, these results indicated that SCN7A/Nax

channel did not mediate the subthreshold oscillation, but

facilitated its generation. We further detected the current

threshold for evoking a single spike and the frequency

of spikes evoked by depolarizing pulses. The current

threshold was lower in cancer-bearing rats than in sham

rats (1.4 ± 0.3 nA, versus 3.4 ± 0.4 nA, P< 0.05).

These responses were reversed by RNAi-LV treatment

(3.2 ± 0.3 nA, P< 0.05) (Fig. 5D). The frequency of

spikes evoked was significantly higher in cancer-bearing

rats than that of sham rats (31.4 ± 6.6 versus 6.2 ± 1.1

spikes/s, P< 0.05). RNAi-LV treatment decreased the

spikes (9.5 ± 1.2 spikes/s, P< 0.05) (Fig. 5E). Taken

together, these results indicated that SCN7A/Nax

channel contributed to depolarization of the resting

membrane potential, facilitated the generation of

subthreshold oscillation and consequently increased

excitability of DRG neurons.

DISCUSSION

In the current study, cancer cells inoculation induced

mimic clinical bone cancer-related pain behaviors and

led to a functionally relevant overexpression of SCN7A/

Nax channel in medium- to large-sized DRG neurons.

The cancer-induced bone pain was alleviated by

knockdown of SCN7A/Nax channel. Upregulation of

SCN7A/Nax channel in DRG neurons resulted in

depolarization of resting membrane and subthreshold

oscillations which facilitated the generation of sustained

ectopic spontaneous spike discharge. Knockdown of

SCN7A/Nax in these neurons reversed the

electrophysiological changes induced by cancer cells

Fig. 4. Persistent increase of SCN7A/Nax in DRG post-sarcoma inoculation. (A) Protein and (B) mRNA levels of SCN7A/Nax at days 7, 14 and 21

post-sarcoma implantation. An example of the blot was shown below, the relative protein and mRNA levels were respectively shown in the

histogram (n= 4 at each time point). Data represent the SCN7A/Nax expression normalized to the reference genes. The error bars represented

standard error of the mean (SEM), ⁄P< 0.05.

86 C. B. Ke et al. / Neuroscience 227 (2012) 80–89

implantation. The results indicate SCN7A/Nax channel

increases the excitability of DRG neurons and

consequently contributes to the development of bone

cancer pain.

The rat model mirrors advanced lytic bone cancer inhumans

The rat model mimics the tumor-induced bone destruction

and tumor-induced pain in patients with lytic bone cancer.

Histological evidence of initial bone destruction was

observed at 7 days post-injection of the sarcoma cells

into the intramedullary space of the murine tibia, and

bone destruction continued to progress, so that

advanced bone destruction was observed on day 14. By

21 days post- injection of sarcoma, fracture of the distal

femur was frequently present. The pattern of bone

destruction in the model could be described as having a

moth-eaten appearance on the endosteal surface of

both the distal and proximal regions of the tibia, which

was similar to that commonly observed in humans with

osteosarcoma. Thus, histological features in murine

models of advanced bone cancer are similar to what is

observed clinically in humans with advanced bone

cancer.

Pain is the most frequent symptom of primary bone

cancer and/or bony metastasis. Significant ongoing pain

is the major impetus for individuals to see a physician.

Thus, particularly in the case of relapse, patients

frequently present when significant bone destruction has

already occurred. In patients with bone cancer, the

associated pain can be divided into ongoing and

breakthrough pain. In the murine model of BCP, tumor-

bearing animals also exhibited ongoing pain and pain

exacerbated by movement, thus mirroring humans with

BCP. In the murine model, ongoing pain was measured

by quantifying the number of spontaneous flinches while

stationary. Limb use score and activity-related guarding

were measured to assess movement-evoked pain.

These behaviors positively correlate with tumor-induced

bone destruction.

Upregulation SCN7A/Nax contributes to cancer-induced bone pain in rat with advanced bone cancer

The function of SCN7A/Nax is illustrated in the central

nervous system (Hiyama et al., 2002, 2004; Watanabe

et al., 2003; Noda, 2007; Shimizu et al., 2007). In the

peripheral nervous system, SCN7A/Nax channel

expresses in trigeminal, dorsal root ganglia and

nonmyelinating Schwann cells (Garcia-Villegas et al.,

2009), but its physiological role remains unclear. In the

current study, inoculation of cancer cells results in a

persistent overexpression of SCN7A/Nax in somatic

medium- to large-diameter DRG neurons during the

development of cancer-induced bone pain. Special

knockdown of SCN7A/Nax reverses ongoing and

movement-evoked cancer pain-related behaviors. These

findings suggest that upregulation of SCN7A/Nax in

medium- to large-sized DRG neurons is requisite to the

generating and maintaining of BCP.

On the basis of the diameter, neurons in DRG can be

divided into three main categories: small-diameter

unmyelinated C sensory fibers, medium-diameter

myelinated Ad fibers and large-diameter myelinated Abfibers. C and Ad fibers are sensory neurons known as

nociceptors that detect a wide range of stimulus

modalities, including those of a physical or chemical

Fig. 5. Whole-cell patch clamp recordings of acute dissociated DRG neurons. (A) Inoculation of sarcoma caused depolarization of resting potential

which was reversed by SCN7A/Nax knockdown. (B) The action potential threshold was more negative in cancer-bearing rats than in sham rats and

this response was abolished by TTX, but not by SCN7A knockdown. A sample of action potential graph showed on the top (left). (C) Cancer cell

inoculation increased the number of cells with subthreshold oscillations. RNAi-LV treatment suppressed the subthreshold oscillations of most cells.

Subthreshold oscillation samples showed on the top (right). (D) The current strength was decreased in cancer-bearing rats for evoking a single

spike, these responses were reversed by RNAi-LV treatment. (E) The number of spikes evoked by a depolarizing pulse increased significantly in

cancer-bearing rats, RNAi-LV decreased the spikes. Cluster spikes graph shown on right (n= 46 cells from four sham rats, n= 53 cells from five

cancer-bearing rats and n= 46 cells from four RNAi-LV-treated rats). All data are presented as mean ± SEM, ⁄P< 0.05 and ns means ‘‘not

significant’’.

C. B. Ke et al. / Neuroscience 227 (2012) 80–89 87

nature. Ab fibers are known as the sensor of

proprioceptive information from innervating skin, joints

and muscles that conduct non-noxious stimuli including

fine touch and vibration (Mantyh, 2006). However,

evidences show that Ab fibers are involved in the

central sensitization of allodynia and spontaneous pain

following peripheral nerve injury (Andersen et al., 1995;

Lekan et al., 1996; Baba et al., 1999; Zhu and Henry,

2012). Damage of nociceptive Ad-fibers results in

paroxysmal pain and abnormal sensations or

spontaneous constant pain (Truini et al., 2009). In the

present study, we identify that both medium diameters

of Ad fibers and large-sized Ab fibers that are SCN7A/

Nax-positive contribute to the development of BCP.

SCN7A/Nax increases the excitability of neurons

Afferent discharge in DRG neurons plays a role in normal

sensation and pain perception (Amir et al., 2002). The

discharge is critically dependent on subthreshold

membrane potential oscillations. Oscillations give rise to

action potentials and lead to sensation when they reach

the threshold. Indeed, the presence of oscillations

proves to be a necessary condition for sustained spiking

88 C. B. Ke et al. / Neuroscience 227 (2012) 80–89

both at resting membrane potential and on depolarization;

neurons without them are incapable of sustained

discharge even on deep depolarization (Amir et al.,

1999). The depolarization of resting membrane potential

facilitates the generation of subthreshold membrane

potential oscillations. A more negative action potential

threshold will lead the oscillations potential closer to

threshold and facilitate the generation of ectopic spike

discharge. In the current study, carcinoma cells

inoculated into tibia leads to depolarization of DRG

neurons and hence increases the proportion of neurons

with subthreshold oscillations. Implantation of carcinoma

also decreases the current threshold for evoking a

single spike and increases the frequency of spikes

triggered by a depolarizing pulse in these neurons. The

results indicate that sarcoma implantation into rat tibia

results in hyperexcitability of DRG neurons which may

be involved in the development of BCP, however, the

oscillatory and ectopic spiking responses are reversed

by SCN7A/Nax knockdown. These results suggest that

SCN7A/Nax channel contributes to hypersensitivity of

DRG neurons. Since hyperexcitability of DRG neurons

triggered by subthreshold oscillations results in

neuropathic pain (Liu et al., 2000; Kovalsky et al., 2009;

Zhu and Henry, 2012), these results demonstrate that

SCN7A/Nax channel increases primary sensory neurons

excitability and contributes to BCP.

Fluctuations in extracellular Na+ directly affect the

excitability of neurons by a background Na+

permeability activity at the resting membrane potential

via SCN7A/Nax channel (Grob et al., 2004). This leak

Na+ current appears sufficient to depolarize neurons to

generate ectopic spiking which leads to central

sensitization of chronic pain. The level of ectopic

discharge is generally well correlated with the degree of

pain behavior in neuropathic animals (Sheen and

Chung, 1993; Waxman et al., 1999; Xie et al., 2011). A

slight reduction of the leak Na+ current contributes to

hyperpolarization of neurons and decreases excitability.

Thus, it is plausible to consider that upregulation of

SCN7A/Nax channel in medium- to large-sized DRG

neurons increases leak of Na+ permeability influx

which results in hyperexcitability of neurons and

contributes to hyperalgesia induced by cancer

metastasis to bone. Indeed, in the present study,

SCN7A/Nax-positive neurons are hyperexcitable and

knockdown of SCN7A/Nax decreases the excitability of

the neurons. These may be the electrophysiological

basis of SCN7A/Nax channel that contributes to BCP.

Because the specific blockers of SCN7A/Nax

channels are not available for electrophysiological

experiments, the present study cannot confirm whether

the changes of electrophysiological properties in DRG

neurons are induced directly or indirectly by SCN7A/Nax

channel. Further overexpression and loss of function

studies in vitro and in animal models are needed to

explore the functional role of SCN7A/Nax in cancer-

induced bone pain.

Acknowledgments—Author contributions: C.B. Ke and W.S. He

contributed equally to this work. C.B. Ke assisted in experimental

design, and wrote the paper; W.S. He assisted in experimental

design, performed the electrophysiology and behavior studies;

C.J. Li performed immunohistochemistry, Western blot and

RT-PCR; D. Shi cultured cells; F. Gao and Y.K. Tian designed

the experiments and performed data analysis. This work was

supported by 2010 Clinical Key Disciplines Construction Grant

from the Ministry of Health of the People’s Republic of China

and projections (No.81070890 and No.30872441) of National

Natural Science Foundation of China. All authors declare that

they have no conflicts of interest with respect to this report.

REFERENCES

Ahmad S, Dahllund L, Eriksson AB, Hellgren D, Karlsson U, Lund PE,

Meijer IA, Meury L, Mills T, Moody A, Morinville A, Morten J,

O’Donnell D, Raynoschek C, Salter H, Rouleau GA, Krupp JJ

(2007) A stop codon mutation in SCN9A causes lack of pain

sensation. Hum Mol Genet 16:2114–2121.

Akopian AN, Souslova V, Sivilotti L, Wood JN (1997) Structure and

distribution of a broadly expressed atypical sodium channel.

FEBS Lett 400:183–187.

Amir R, Michaelis M, Devor M (1999) Membrane potential oscillations

in dorsal root ganglion neurons: role in normal electrogenesis and

neuropathic pain. J Neurosci 19:8589–8596.

Amir R, Michaelis M, Devor M (2002) Burst discharge in primary

sensory neurons: triggered by subthreshold oscillations,

maintained by depolarizing afterpotentials. J Neurosci

22:1187–1198.

Andersen OK, Gracely RH, Arendt-Nielsen L (1995) Facilitation of the

human nociceptive reflex by stimulation of A beta-fibres in a

secondary hyperalgesic area sustained by nociceptive input from

the primary hyperalgesic area. Acta Physiol Scand 155:87–97.

Baba H, Doubell TP, Woolf CJ (1999) Peripheral inflammation

facilitates Abeta fiber-mediated synaptic input to the substantia

gelatinosa of the adult rat spinal cord. J Neurosci 19:859–867.

Brigatte P, Sampaio SC, Gutierrez VP, Guerra JL, Sinhorini IL, Curi

R, Cury Y (2007) Walker 256 tumor-bearing rats as a model to

study cancer pain. J Pain 8:412–421.

Clohisy DR, Mantyh PW (2003) Bone cancer pain. Cancer

97:866–873.

Clohisy DR, Mantyh PW (2004) Bone cancer pain and the role of

RANKL/OPG. J Musculoskelet Neuronal Interact 4:293–300.

Cox JJ, Reimann F, Nicholas AK, Thornton G, Roberts E, Springell K,

Karbani G, Jafri H, Mannan J, Raashid Y, Al-Gazali L, Hamamy H,

Valente EM, Gorman S, Williams R, McHale DP, Wood JN,

Gribble FM, Woods CG (2006) An SCN9A channelopathy causes

congenital inability to experience pain. Nature 444:894–898.

Emery EC, Young GT, Berrocoso EM, Chen L, McNaughton PA

(2011) HCN2 ion channels play a central role in inflammatory and

neuropathic pain. Science 333:1462–1466.

Garcia-Villegas R, Lopez-Alvarez LE, Arni S, Rosenbaum T, Morales

MA (2009) Identification and functional characterization of the

promoter of the mouse sodium-activated sodium channel Na(x)

gene (Scn7a). J Neurosci Res 87:2509–2519.

Goldin AL, Barchi RL, Caldwell JH, Hofmann F, Howe JR, Hunter JC,

Kallen RG, Mandel G, Meisler MH, Netter YB, Noda M, Tamkun

MM, Waxman SG, Wood JN, Catterall WA (2000) Nomenclature

of voltage-gated sodium channels. Neuron 28:365–368.

Gorter JA, Zurolo E, Iyer A, Fluiter K, Van Vliet EA, Baayen JC,

Aronica E (2010) Induction of sodium channel Nax (SCN7A)

expression in rat and human hippocampus in temporal lobe

epilepsy. Epilepsia 51:1791–1800.

Grob M, Drolet G, Mouginot D (2004) Specific Na+ sensors are

functionally expressed in a neuronal population of the median

preoptic nucleus of the rat. J Neurosci 24:3974–3984.

Hiyama TY, Matsuda S, Fujikawa A, Matsumoto M, Watanabe E,

Kajiwara H, Niimura F, Noda M (2010) Autoimmunity to the

sodium-level sensor in the brain causes essential hypernatremia.

Neuron 66:508–522.

C. B. Ke et al. / Neuroscience 227 (2012) 80–89 89

Hiyama TY, Watanabe E, Okado H, Noda M (2004) The subfornical

organ is the primary locus of sodium-level sensing by Na(x)

sodium channels for the control of salt-intake behavior. J Neurosci

24:9276–9281.

Hiyama TY, Watanabe E, Ono K, Inenaga K, Tamkun MM, Yoshida

S, Noda M (2002) Na(x) channel involved in CNS sodium-level

sensing. Nat Neurosci 5:511–512.

Honore P, Luger NM, Sabino MAC, Schwei MJ, Rogers SD, Mach

DB, O’Keefe PF, Ramnaraine ML, Clohisy DR, Mantyh PW (2000)

Osteoprotegerin blocks bone cancer-induced skeletal destruction,

skeletal pain and pain-related neurochemical reorganization of the

spinal cord. Nat Med 6:521–528.

Kovalsky Y, Amir R, Devor M (2009) Simulation in sensory neurons

reveals a key role for delayed Na+ current in subthreshold

oscillations and ectopic discharge: implications for neuropathic

pain. J Neurophysiol 102:1430–1442.

Lekan HA, Carlton SM, Coggeshall RE (1996) Sprouting of A beta

fibers into lamina II of the rat dorsal horn in peripheral neuropathy.

Neurosci Lett 208:147–150.

Liu CN, Michaelis M, Amir R, Devor M (2000) Spinal nerve injury

enhances subthreshold membrane potential oscillations in DRG

neurons: relation to neuropathic pain. J Neurophysiol

84:205–215.

Liu S, Yang J, Wang L, Jiang M, Qiu Q, Ma Z, Liu L, Li C, Ren C,

Zhou J, Li W (2010) Tibia tumor-induced cancer pain involves

spinal p38 mitogen-activated protein kinase activation via TLR4-

dependent mechanisms. Brain Res 1346:213–223.

Lolignier S, Amsalem M, Maingret F, Padilla F, Gabriac M, Chapuy E,

Eschalier A, Delmas P, Busserolles J (2011) Nav1.9 channel

contributes to mechanical and heat pain hypersensitivity induced

by subacute and chronic inflammation. PLoS One 6:e23083.

Luger NM, Honore P, Sabino MA, Schwei MJ, Rogers SD, Mach DB,

Clohisy DR, Mantyh PW (2001) Osteoprotegerin diminishes

advanced bone cancer pain. Cancer Res 61:4038–4047.

Mantyh PW (2006) Cancer pain and its impact on diagnosis, survival

and quality of life. Nat Rev Neurosci 7:797–809.

Mao-Ying QL, Zhao J, Dong ZQ, Wang J, Yu J, Yan MF, Zhang YQ,

Wu GC, Wang YQ (2006) A rat model of bone cancer pain

induced by intra-tibia inoculation of Walker 256 mammary gland

carcinoma cells. Biochem Biophys Res Commun 345:1292–1298.

Meunier A, Latremoliere A, Dominguez E, Mauborgne A, Philippe S,

Hamon M, Mallet J, Benoliel JJ, Pohl M (2007) Lentiviral-mediated

targeted NF-kappaB blockade in dorsal spinal cord glia attenuates

sciatic nerve injury-induced neuropathic pain in the rat. Mol Ther

15:687–697.

Miao XR, Gao XF, Wu JX, Lu ZJ, Huang ZX, Li XQ, He C, Yu WF

(2010) Bilateral downregulation of Nav1.8 in dorsal root ganglia of

rats with bone cancer pain induced by inoculation with Walker 256

breast tumor cells. BMC Cancer 10:216.

Milligan ED, Hinde JL, Mehmert KK, Maier SF, Watkins LR (1999) A

method for increasing the viability of the external portion of lumbar

catheters placed in the spinal subarachnoid space of rats. J

Neurosci Methods 90:81–86.

Milligan ED, Langer SJ, Sloane EM, He L, Wieseler-Frank J,

O’Connor K, Martin D, Forsayeth JR, Maier SF, Johnson K,

et al (2005) Controlling pathological pain by adenovirally driven

spinal production of the anti-inflammatory cytokine, interleukin-10.

Eur J Neurosci 21:2136–2148.

Nassar MA, Stirling LC, Forlani G, Baker MD, Matthews EA,

Dickenson AH, Wood JN (2004) Nociceptor-specific gene

deletion reveals a major role for Nav1.7 (PN1) in acute and

inflammatory pain. Proc Natl Acad Sci USA 101:12706–12711.

Noda M (2006) The subfornical organ, a specialized sodium channel,

and the sensing of sodium levels in the brain. Neuroscientist

12:80–91.

Noda M (2007) Hydromineral neuroendocrinology: mechanism of

sensing sodium levels in the mammalian brain. Exp Physiol

92:513–522.

Peters CM, Ghilardi JR, Keyser CP, Kubota K, Lindsay TH, Luger

NM, Mach DB, Schwei MJ, Sevcik MA, Mantyh PW (2005) Tumor-

induced injury of primary afferent sensory nerve fibers in bone

cancer pain. Exp Neurol 193:85–100.

Raouf R, Quick K, Wood JN (2010) Pain as a channelopathy. J Clin

Invest 120:3745.

Sabino MA, Ghilardi JR, Jongen JL, Keyser CP, Luger NM, Mach DB,

Peters CM, Rogers SD, Schwei MJ, de Felipe C, Mantyh PW

(2002) Simultaneous reduction in cancer pain, bone destruction,

and tumor growth by selective inhibition of cyclooxygenase-2.

Cancer Res 62:7343–7349.

Schmalhofer WA, Calhoun J, Burrows R, Bailey T, Kohler MG,

Weinglass AB, Kaczorowski GJ, Garcia ML, Koltzenburg M,

Priest BT (2008) ProTx-II, a selective inhibitor of NaV1.7 sodium

channels, blocks action potential propagation in nociceptors. Mol

Pharmacol 74:1476–1484.

Schweizerhof M, Stosser S, Kurejova M, Njoo C, Gangadharan V,

Agarwal N, Schmelz M, Bali KK, Michalski CW, Brugger S,

Dickenson A, Simone DA, Kuner R (2009) Hematopoietic colony-

stimulating factors mediate tumor–nerve interactions and bone

cancer pain. Nat Med 15:802–807.

Sheen K, Chung JM (1993) Signs of neuropathic pain depend on

signals from injured nerve fibers in a rat model. Brain Res

610:62–68.

Shimizu H, Watanabe E, Hiyama TY, Nagakura A, Fujikawa A,

Okado H, Yanagawa Y, Obata K, Noda M (2007) Glial Nax

channels control lactate signaling to neurons for brain [Na+]

sensing. Neuron 54:59–72.

Tong Z, Luo W, Wang Y, Yang F, Han Y, Li H, Luo H, Duan B, Xu T,

Maoying Q, Tan H, Wang J, Zhao H, Liu F, Wan Y (2010) Tumor

tissue-derived formaldehyde and acidic microenvironment

synergistically induce bone cancer pain. PLoS One 5:e10234.

Truini A, Padua L, Biasiotta A, Caliandro P, Pazzaglia C, Galeotti F,

Inghilleri M, Cruccu G (2009) Differential involvement of A-delta

and A-beta fibres in neuropathic pain related to carpal tunnel

syndrome. Pain 145:105–109.

Watanabe E, Fujikawa A, Matsunaga H, Yasoshima Y, Sako N,

Yamamoto T, Saegusa C, Noda M (2000) Nav2/NaG channel is

involved in control of salt-intake behavior in the CNS. J Neurosci

20:7743–7751.

Watanabe U, Shimura T, Sako N, Kitagawa J, Shingai T, Watanabe

E, Noda M, Yamamoto T (2003) A comparison of voluntary salt-

intake behavior in Nax-gene deficient and wild-type mice with

reference to peripheral taste inputs. Brain Res 967:247–256.

Waxman SG, Cummins TR, Dib-Hajj S, Fjell J, Black JA (1999)

Sodium channels, excitability of primary sensory neurons, and the

molecular basis of pain. Muscle Nerve 22:1177–1187.

Widmark J, Sundstrom G, Ocampo DD, Larhammar D (2011)

Differential evolution of voltage-gated sodium channels in

tetrapods and teleost fishes. Mol Biol Evol 28:859–871.

Xie RG, Zheng DW, Xing JL, Zhang XJ, Song Y, Xie YB, Kuang F,

Dong H, You SW, Xu H, Hu SJ (2011) Blockade of persistent

sodium currents contributes to the riluzole-induced inhibition of

spontaneous activity and oscillations in injured DRG neurons.

PLoS One 6:e18681.

Yu FH, Catterall WA (2003) Overview of the voltage-gated sodium

channel family. Genome Biol 4:207.

Zhu YF, Henry JL (2012) Excitability of Abeta sensory neurons is

altered in an animal model of peripheral neuropathy. BMC

Neurosci 13:15.

Zhuang ZY, Wen YR, Zhang DR, Borsello T, Bonny C, Strichartz GR,

Decosterd I, Ji RR (2006) A peptide c-Jun N-terminal kinase

(JNK) inhibitor blocks mechanical allodynia after spinal nerve

ligation: respective roles of JNK activation in primary sensory

neurons and spinal astrocytes for neuropathic pain development

and maintenance. J Neurosci 26:3551–3560.

(Accepted 20 September 2012)(Available online 28 September 2012)