Date post: | 27-Apr-2015 |
Category: |
Documents |
Upload: | walid-fouad |
View: | 262 times |
Download: | 0 times |
DNA PolymerasesDNA Polymerases
• DNA Polymerase I (or Pol I) is an enzyme that participates in the process of DNA replication in prokaryotes.
• . Discovered by Arthur Kornberg in 1956
• it was the first known DNA polymerase
• It was initially characterized in E. coli, although it is ubiquitous in prokaryotes.
DNA Polymerase IDNA Polymerase I
• Pol I possesses three enzymatic activities:• A 5' -> 3' (forward) DNA polymerase activity,
requiring a 3' primer site and a template strand
• A 3' -> 5' (reverse) exonuclease activity that mediates proofreading
• A 5' -> 3' (forward) exonuclease activity mediating nick translation during DNA repair.
DNA Polymerase IDNA Polymerase I
• The 3' -> 5' exonuclease activity of DNA polymerase is not simply due to the catalysis of the reverse polymerase reaction but is a separate and distinct enzymatic activity that has been mapped to its own active site in the enzyme.
DNA Polymerase IDNA Polymerase I
• The function of the 3' -> 5' exonuclease activity is that of PROOF-READING.
• Any nucleotides that are incorrectly incorporated are excised by this activity.
Substrate requirements for Substrate requirements for synthesis of new DNAsynthesis of new DNA
• DNA polymerase I catalyzes the addition of a complementary dNTP to the 3'OH end of a polydeoxynucleotide chain.
• There are FOUR essential requirements for the activity of DNA polymerase I:
TEMPLATE There must be a template strand to be copied.
PRIMER DNA polymerase I (and every other known DNA polymerase) cannot initiate DNA synthesis by itself. It can only extend a pre-existing DNA chain.
3'OH END The reaction mechanism requires that the primer must have a free 3'OH end for synthesis to continue.
deoxynucleoside triphosphates dNTPs must be present - usually as the Mg++ salt.
DNA Polymerase IDNA Polymerase I
KlenowKlenow fragment fragment,,
• DNA polymerase I obtained from E. coli is used extensively for molecular biology research. However, the 5' -> 3' exonuclease activity makes it unsuitable for many applications.
• This undesirable enzymatic activity can be removed from the holoenzyme to leave the Klenow fragment, widely used in molecular biology.
• Exposure of DNA polymerase I to the protease subtilisin cleaves the molecule into a smaller fragment, which retains only the DNA polymerase and proofreading activities
KlenowKlenow fragment fragment
Klenow fragmentKlenow fragment
• Synthesis of double-stranded DNA from single-stranded templates
Klenow fragmentKlenow fragment
• Filling in recessed 3' ends of DNA fragments
.
Klenow fragmentKlenow fragment
•Digesting away protruding 3' overhangs
Klenow fragmentKlenow fragment
•Preparation of radioactive DNA probes
exo- Klenow fragmentexo- Klenow fragment
• In some situations, the 3' -> 5' exonuclease activity of Klenow fragment is either undesirable or not necessary.
• By introducing mutations in the gene that encodes Klenow, forms of the enzyme can be expressed that retain polymerase activity, but lack any exonuclease activity.
• These forms are the enzyme are usually called exo- Klenow fragment.
T4 DNA PolymeraseT4 DNA Polymerase
• Description: T4 DNA Polymerase catalyzes the synthesis of DNA in the 5´→ 3´ direction and requires the presence of template and primer.
• This enzyme has a 3´→ 5´ exonuclease activity which is much more active than that found in DNA Polymerase I.
• Unlike E. coli DNA Polymerase I, T4 DNA Polymerase does not have a 5´→ 3´ exonuclease function.
T4 DNA PolymeraseT4 DNA Polymerase
• Source:Purified from a strain of E. coli that carries a T4 DNA Polymerase overproducing plasmid.Or T4 infected E.coli
T4 DNA PolymeraseT4 DNA Polymerase
• The activities of T4 DNA polymerase are very similar to Klenow fragment of DNA polymerase I –
• it has a 5' -> 3' DNA polymerase
• 3' -> 5' exonuclease
• Does not have 5' -> 3' exonuclease activity.
T4 DNA polymerase & Klenow T4 DNA polymerase & Klenow fragmentfragment
• The 3' -> 5' exonuclease activity of T4 DNA polymerase is roughly 200 times that of Klenow fragment, making it preferred for blunting DNAs with 3' overhangs
• Klenow fragment displace downstream oligonucleotides(primers) as it polymerizes, T4 DNA polymerase will not.
T4 infected E.coliT4 infected E.coli
T7 DNA PolymeraseT7 DNA Polymerase
• The DNA polymerase of T7 bacteriophage has DNA polymerase and 3' -> 5' exonuclease activities, but lacks a 5' -> 3' exonuclease domain. It is thus very similar in activity to Klenow fragment and T4 DNA polymerase.
T7 DNA PolymeraseT7 DNA Polymerase
• The 3' -> 5' exonuclease activity of T4 DNA polymerase is roughly 200 times that of Klenow fragment, preferred for blunting DNAs with 3' overhangs
T4 DNA PolymeraseT4 DNA Polymerase
• Applications:
• 3´ overhang removal to form blunt ends
• 5´overhang fill-in to form blunt ends
• Probe labeling using replacement synthesis
T7 DNA PolymeraseT7 DNA Polymerase
• The claim to fame for T7 DNA polymerase is it's processivity. That is to say, the average length of DNA synthesized before the enzyme dissociates from the template is considerably greater than for other enzymes.
• Due to this talent, the principle use of T7 DNA polymerase is in DNA sequencing by the chain termination technique.
T7 DNA PolymeraseT7 DNA Polymerase
• T7 DNA polymerase can be chemically-treated or genetically engineered to abolish it's 3' -> 5' exonuclease activity.
• These forms of the enzyme are marketed under the name Sequenase and Sequenase 2.0, and are widely used for DNA sequencing reactions
Taq polymeraseTaq polymerase
• Taq polymerase is a thermostable DNA polymerase named after the thermophilic bacterium Thermus aquaticus from which it was originally isolated
• Taq's temperature optimum for activity is 75-80°C, with a halflife of 9 minutes at 97.5°C, and can replicate a 1000 base pair strand of DNA in less than 10 seconds at 72°C
ThermusThermus aquaticusaquaticus isolated from isolated from hot springhot spring
ThermusThermus aquaticusaquaticus
• One of Taq's drawbacks is its relatively low replication fidelity.
• It lacks a 3' to 5' exonuclease proofreading activity, and has an error rate measured at about 1 in 9,000 nucleotides.
• Its 5' to 3' exonuclease activity of Taq has been exploited in the TaqMan real-time PCR method.
55 ' 'to 3' exonuclease activity of Taqto 3' exonuclease activity of Taq
TaqTaq DNA Polymerase DNA Polymerase
• HasTerminal transferase activity. Taq DNA Polymerase has terminal transferase activity which results in the addition of a single nucleotide (adenosine) at 3" end of the extension product
• . This may be useful in , whereby a cloning vector (such as a plasmid) is used which has a T (Thymine) 3' overhang, which complements with the A overhang of the PCR product, thus enabling ligation of the PCR product into the plasmid vector.
•
TaqTaq DNA Polymerase DNA Polymerase
• Applications: Taq DNA Polymerase can be used in most applications including the following:
• PCR*. • 3"A-tailing of blunt ends. • Primer extension • DNA sequencing. •
OtherThermostable DNA PolymerasesOtherThermostable DNA Polymerases
• Pfu • has 3'->5' Exonuclease• from Pyrococcus furiosus. Appears to have the
lowest error rate of known thermophilic DNA polymerases
• Vent • has 3'->5' Exonuclease• From Thermococcus litoralis; also known as Tli
polymerase. Halflife at 95 C is approximately 7 hours
Reverse TranscriptasesReverse Transcriptases
• Reverse transcriptase is a common name for an enzyme that functions as a RNA-dependent DNA polymerase. They are encoded by retroviruses, where they copy the viral RNA genome into DNA prior to its integration into host cells
Reverse TranscriptasesReverse Transcriptases
• Reverse transcriptase was discovered by Howard Temin, and independently by David Baltimore in 1970. The two shared the 1975 Nobel Prize in Physiology or Medicine
Reverse TranscriptasesReverse Transcriptases
• Reverse transcriptases have two activities: • DNA polymerase activity: it will transcribe both single-
stranded RNA and single-stranded DNA templates with essentially equivalent efficiency. In both cases, an RNA or DNA primer is required to initiate synthesis.
• RNase H activity: RNase H is a ribonuclease that degrades the RNA from RNA-DNA hybrids, such as are formed during reverse transcription of an RNA template. This enzyme functions as both an endonuclease and exonuclease in hydrolyzing its target.
Reverse TranscriptasesReverse Transcriptases
• Moloney murine leukemia virus: a single polypeptide
• Avian myeloblastosis virus: composed of two peptide chains
• the murine leukemia virus enzyme has very weak RNase H activity compared to the avian myeloblastosis enzyme
Reverse TranscriptasesReverse Transcriptases
• Reverse transcriptase is used,, to copy RNA into DNA.
• This task is integral to cloning complementary DNAs (cDNAs), which are DNA copies of mature messenger RNAs. by mixing short (12-18 base) polymers of thymidine (oligo dT) with messenger RNA such that they anneal to the RNA's polyadenylate tail. Reverse transcriptase is then added and uses the oligo dT as a primer to synthesize so-called first-strand cDNA.
Reverse TranscriptasesReverse Transcriptases
• Another common use for reverse transcriptase is to generate DNA copies of RNAs prior to amplifying that DNA by polymerase chain reaction (PCR). Reverse transcription PCR, usually called simply RT-PCR
Terminal transferaseTerminal transferase
• It is a mammalian enzyme expressed in lymphocytes.( commercially used expression of bovine gene in E. coli)
• Terminal transferase catalyzes the addition of nucleotides to the 3' terminus of DNA.
• it works on single-stranded DNA, including 3' overhangs of double-stranded DNA,
• It is an example of a DNA polymerase that does not require a primer.
• It can also add homopolymers of ribonucleotides to the 3' end of DNA.
Terminal transferaseTerminal transferase
• Labeling the 3' ends of DNA
.
Terminal transferaseTerminal transferase
• Adding complementary homopolymeric tails to DNA:
E coli RNA PolymeraseE coli RNA Polymerase
• DNA-dependent RNA polymerase able to recognize a variety of promoter sequences related to the E coli consensus
Applications of E coli RNA Applications of E coli RNA PolymerasePolymerase
• In vitro transcription of genes with suitable promoters
• Synthesis of labeled RNA
Bacteriophage RNA PolymerasesBacteriophage RNA Polymerases
• Phage-encoded DNA-dependent RNA polymerases are used for in vitro transcription to generate defined RNAs
Uses of RNA PolymerasesUses of RNA Polymerases
• the reaction utilizes labeled ribonucleotides, and the resulting labeled RNA is used as a probe for hybridization.
• Other applications of in vitro transcription of RNAs is to study RNA structure and function
BacteriophageBacteriophage RNA polymerasesRNA polymerases• T7 RNA polymerase• Host of Encoding Phage :E. coli• Promoter Sequence:TAATACGACTCACTATAGGG
• T3 RNA polymerase• Host of Encoding Phage E. coli• Promoter Sequence: ATTAACCCTCACTAAAGGG
• SP6 RNA polymerase• Host of Encoding Phage :Salmonella typhimurium• Promoter SequenceAATTTAGGTGACACTATAGAA
BacteriophageBacteriophage RNA polymerasesRNA polymerases
• Many of the plasmids used for carrying cloned DNA incorporate promoters for bacteriophage RNA polymerases adjacent to the cloning site.
• This allows one to readily obtain either mRNA-sense or antisense transcripts from the inserted DNA
BacteriophageBacteriophage RNA polymerasesRNA polymerases
BacteriophageBacteriophage RNA polymerasesRNA polymerases
• most plasmids used for in vitro transcription have two different phage polymerase promoters flanking the insertion site, which allows transcription of sense RNA with one polymerase and antisense with the other.
RNA polymerase IIRNA polymerase II
• Source : wheat germ • The eukaryotic gene responsible for
transcribing most protein- coding genes .• DNA-dependent RNA polymerase able to
recognize a variety of promoter sequences.• Works at 25 C• Applications :eukaryotic transcription
studies
DNA LigaseDNA Ligase
• DNA ligases catalyze formation of a phosphodiester bond between the 5' phosphate of one strand of DNA and the 3' hydroxyl of the another
• the reaction involves ligating a fragment of DNA into a plasmid vector, which is a fundamental technique in recombinant DNA work.
•
DNA ligasesDNA ligases
• The most widely used DNA ligase is derived from the T4 bacteriophage.
• T4 DNA ligase requires ATP as a cofactor.
• A DNA ligase from E. coli is also available, but is not commonly used. The E. coli enzyme uses NAD as a cofactor
DNA ligasesDNA ligases
T4 DNA ligaseT4 DNA ligase
• originates from the T4 bacteriophage.
• ligate DNA fragments having overhanging, cohesive ends that are annealed together,
• ligate fragments with blunt ends, with higher concentrations of the enzyme
• The optimal incubation temperature for T4 DNA ligase is 16C
Ligation of cohesive endsLigation of cohesive ends
• ligation reaction requires three ingredients
• Two or more fragments of DNA that have either blunt or compatible cohesive ("sticky") ends.
A buffer which contains ATP.
• T4 DNA ligase. A typical reaction for inserting a fragment into a plasmid vector would utilize about 0.01 (sticky ends) to 1 (blunt ends) units of ligase.
Nucleases: DNase and RNaseNucleases: DNase and RNase
• Deoxyribonuclease I
• Deoxyribonuclease I cleaves double-stranded or single stranded DNA.
• Cleavage preferentially occurs adjacent to pyrimidine (C or T) residues, and the enzyme is therefore an endonuclease
applications of DNase Iapplications of DNase I
• Eliminating DNA (e.g. plasmid) from preparations of RNA.
• Analyzing DNA-protein interactions via DNase footprinting.
• Nicking DNA prior to radiolabeling by nick translation
Nick translationNick translation
Ribonuclease ARibonuclease A
• Ribonuclease A is an endoribonuclease that cleaves single-stranded RNA at the 3' end of pyrimidine residues.
• It degrades the RNA into 3'-phosphorylated mononucleotides and oligonucleotides
uses of RNase Auses of RNase A
• Eliminating or reducing RNA contamination in preparations of plasmid DNA.
• Mapping mutations in DNA or RNA by mismatch cleavage. RNase will cleave the RNA in RNA:DNA hybrids at sites of single base mismatches, and the cleavage products can be analyzed.
RNase HRNase H
• The enzyme RNase H is a ribonuclease that cleaves the 3'-O-P-bond of RNA in a DNA/RNA duplex to produce 3'-hydroxyl and 5'-phosphate terminated products.
RNase HRNase H
• RNase H specifically degrades the RNA in RNA:DNA hybrids it is commonly used to destroy the RNA template after first-strand complementary DNA (cDNA) synthesis by reverse transcription,
• . RNase H can also be used to degrade specific RNA strands when the cDNA oligo is hybridized, such as the removal of the poly(A) tail from mRNA hybridized to oligo(dT),
• .
RNase H applicationRNase H application
RNase H applicationRNase H application