Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with...

1

Short title: Epigenetic Control Regulates Wheat Wax Synthesis 1

Epigenetic Activation of Enoyl-CoA Reductase By An Acetyltransferase Complex Triggers Wheat 2

Wax Biosynthesis 3

4

Lingyao Kong,a,2 Pengfei Zhi,a,2 Jiao Liu,a Haoyu Li,a Xiaona Zhang,a Jie Xu,a Jiaqi Zhou,a Xiaoyu 5

Wang,a and Cheng Chang,a,3 6

a College of Life Sciences, Qingdao University, Qingdao 266071, China 7

8

1 This research was supported by the National Natural Science Foundation of China (31701412，9

31701986), the Natural Science Foundation of Shandong Province (ZR2017BC109) and the 10

Qingdao Science and Technology Bureau Fund (17-1-1-50-jch, 18-2-2-51-jch). 11

2 These authors contributed equally to the article. 12

3 Address correspondence to [email protected]. 13

Corresponding author: The author responsible for the distribution of materials integral to the 14

findings presented in this article following the policy described in the Instructions for Authors 15

(www.plantphysiol.org) is: Cheng Chang ([email protected].). 16

The authors have declared that no competing interests exist. 17

18

Author contributions: C.C., L.K., and P.Z. conceived project and designed research; L.K. and P.Z. 19

performed most of the experiments with help from J.L., H.L., X.Z., J.X., J.Z., and X.W.; C.C., L.K., and 20

P.Z. analyzed the data and wrote the article with assistance from J.L., H.L., X.Z., J.X., J.Z., and X.W.; 21

C.C. supervised the project and completed the writing. 22

23

One-sentence summary: 24

A transcriptional activator recruits a histone acetyltransferase complex that epigenetically regulates the 25

biosynthesis of wheat cuticular wax, which is essential for triggering the germination of the powdery 26

mildew pathogen. 27

28

29

30

Plant Physiology Preview. Published on May 21, 2020, as DOI:10.1104/pp.20.00603

Copyright 2020 by the American Society of Plant Biologists

www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org

2

ABSTRACT 31

The epidermal surface of bread wheat (Triticum aestivum) is coated with a hydrophobic cuticular wax 32

layer that protects plant tissues against environmental stresses. However, the regulatory mechanism of 33

cuticular wax biosynthesis remains to be uncovered in bread wheat. Here, we identified wheat 34

Enoyl-CoA Reductase (TaECR) as a core component responsible for biosynthesis of wheat cuticular 35

wax. Silencing of TaECR in bread wheat resulted in a reduced cuticular wax load and attenuated conidia 36

germination of the adapted fungal pathogen powdery mildew (Blumeria graminis f.sp. tritici; Bgt). 37

Furthermore, we established that TaECR genes are direct targets of TaECR promoter-binding MYB 38

transcription factor 1 (TaEPBM1), which could interact with the adapter protein Alteration/Deficiency in 39

Activation 2 (TaADA2) and recruit the histone acetyltransferase General Control Non-derepressible 5 40

(TaGCN5) to TaECR promoters. Most importantly, we demonstrated that the 41

TaEPBM1-TaADA2-TaGCN5 ternary protein complex activates TaECR transcription by potentiating 42

histone acetylation and enhancing RNA polymerase II enrichment at TaECR genes, thereby contributing 43

to the wheat cuticular wax biosynthesis. Finally, we identified very-long-chain aldehydes as the wax 44

signals provided by the TaECR-TaEPBM1-TaADA2-TaGCN5 circuit for triggering Bgt conidia 45

germination. These results demonstrate that specific transcription factors recruit the TaADA2-TaGCN5 46

histone acetyltransferase complex to epigenetically regulate biosynthesis of wheat cuticular wax, which 47

is required for triggering germination of the adapted powdery mildew pathogen. 48

Keywords: ECR, ADA2, GCN5, cuticular wax biosynthesis, wheat, Blumeria graminis f.sp. tritici 49

50

INTRODUCTION 51

The epidermal surfaces of aerial plant organs are coated with a hydrophobic layer, the cuticle, to 52

protect plant tissues against enormous environmental stresses such as desiccation, ultraviolet radiation, 53

excessive light, extreme temperatures, and even pathogen infections (Nawrath 2006; Samuels et al., 54

2008; Domínguez et al. 2017). Although the composition and structure of the cuticle vary among plant 55

species, organs, developmental stages, and even environmental conditions, plant cuticle generally 56

consists of a macromolecular scaffold of cutin impregnated by and covered with the cuticular wax 57

mixture (Nawrath et al., 2006; Fernández et al., 2016; Domínguez et al., 2017). Increasing evidence 58

reveals that many microbial pathogens have acquired the capacity to utilize the plant cuticular wax 59

components to initiate their pre-invasion and infection processes (Serrano et al., 2014; Aragón et al., 60

2017; Ziv et al., 2018). For instance, Medicago truncatula mutants with loss of abaxial epicuticular wax 61

exhibit retarded infection of two rust pathogens, Puccinia emaculata and Phakopsora pachyrhizi, during 62

pre-invasion processes (Uppalapati et al. 2012). 63

Cuticular wax is a mixture of very-long-chain (VLC, > C20) fatty acids and their derivatives, such as 64

aldehydes, alcohols, alkanes, ketones, and esters (Nawrath, 2006; Lee and Suh 2013; Yeats and Rose, 65

2013; Martin and Rose, 2014). It is well established in model plant Arabidopsis thaliana that cuticular 66

wax biosynthesis begins with the esterification of CoA to the plastid-derived C16 and C18 fatty acids by 67

long-chain acyl-CoA synthetase (AtLACS) proteins in the endoplasmic reticulum, and the generated C16 68

and C18 acyl-CoAs are elongated to VLC acyl-CoAs under the action of the fatty acid elongase (FAE) 69

complex and ECERIFERUM2 (AtCER2) proteins (Xia et al., 1996; Todd et al., 1999; Fiebig et al., 2000; 70



3

Hooker et al., 2002; Schnurr et al., 2004; Zheng et al., 2005; Bach et al., 2008; Beaudoin et al., 2009; Lee 71

et al., 2009; Lu et al., 2009; Weng et al., 2010; Haslam et al., 2012; Haslam and Kunst, 2013; Kim et al., 72

2013; Haslam et al., 2015). The elongated VLC acyl-CoAs are then modified into aldehydes, alkanes, 73

secondary alcohols, and ketones by an alkane-forming pathway, or into primary alcohols and wax esters 74

by an alcohol-forming pathway (Aarts et al., 1995; Millar et al., 1999; Chen et al., 2003; Rowland et al., 75

2006; Greer et al., 2007; Rowland et al., 2007; Bourdenx et al., 2011; Bernard et al., 2012; Yang et al., 76

2017; Pascal et al., 2019). As a core component of fatty acid elongase complex, enoyl-CoA reductase 77

(ECR) catalyzes the final step in the biosynthesis of VLC acyl-CoAs (Zheng et al., 2005). In Arabidopsis 78

thaliana, silencing of AtECR results in a reduction of all cuticular wax compositions such as VLC fatty 79

acids, alcohols, aldehydes, alkanes, and ketones, suggesting that Arabidopsis AtECR gets involved in the 80

VLC acyl-CoAs biosynthesis (Zheng et al., 2005). Increasing research in Arabidopsis reveals that AtECR 81

expression is governed by multiple transcriptional regulators. For instance, the AtECR transcription is 82

up-regulated by the MYB type transcription factors such as AtMYB30 and AtMYB94, but negatively 83

regulated by the AP2/ERF-type transcription factor DECREASE WAX BIOSYNTHESIS (AtDEWAX) 84

in Arabidopsis (Raffaele et al., 2008; Go et al., 2014; Lee and Suh 2014). However, the biological 85

function and transcriptional regulation of ECR remain to be uncovered in important cereal crops such as 86

bread wheat (Triticum aestivum). 87

Chromatin modifications such as acetylation, methylation, and ubiquitination play important roles in 88

the regulation of transcriptional reprogramming associated with plant development and stress responses 89

(Jenuwein and Allis 2001; Strahl and Allis 2000). As important epigenetic modifications, trimethylation 90

of histone H3 lysine 4 and deubiquitination of histone H2B could induce a permissive chromatin 91

structure for gene activation (Kurdistani and Grunstein, 2003; Daniel et al. 2004; Schmitz et al. 2009). 92

Similarly, acetylation of histone lysine residues catalyzed by histone acetyltransferases (HAT) also 93

promotes gene transcription (Kurdistani and Grunstein, 2003). As the first HAT linked to gene 94

transcriptional activation, General Control Non-derepressible 5 (GCN5) interacts with the adaptor 95

protein Alteration/Deficiency in Activation 2 (ADA2) in the HAT module of the transcriptional 96

co-activator Spt-Ada-Gcn5-acetyltransferase (SAGA) complex, which is engaged in histone acetylation, 97

histone deubiquitination, and even recruitment of the RNA polymerase II (RNA Pol II) (Grant et al., 98

1997; Weake and Workman, 2012; Wang and Dent, 2014; Moraga and Aquea, 2015). The 99

Alteration/Deficiency in Activation 2-General Control Non-derepressible 5 (ADA2-GCN5) complex is 100

reported to function in concert with specific transcription factors (TFs) to regulate gene transcription 101

associated with plant development and response to environmental stresses in Arabidopsis, rice (Oryza 102

sativa), and even Populus trichocarpa. For instance, the rice WUSCHEL-RELATED HOMEOBOX11 103

(OsWOX11) could interact with the ADA2-GCN5 complex to establish gene expression programs of 104

crown root meristem in rice (Zhou et al., 2017). Similarly, the Populus transcription factor Abscisic 105

Acid-Responsive Element (PtAREB1) could recruit the ADA2-GCN5 complex to induce expression of 106

drought-responsive PtrNAC gene expression during drought stress (Li et al., 2018; Castroverde 2019). 107

However, to date, whether and how the TF-ADA2-GCN5 complex regulates the gene transcription 108

involved in the plant cuticular wax biosynthesis remains unknown. 109

As the causal agent of wheat powdery mildew disease, Blumeria graminis f.sp. tritici (Bgt) is the 110

airborne biotrophic fungal pathogen that is capable of infecting the important crop bread wheat, leading 111

to the wheat yield losses of 10% to 40% (Zhu et al., 2015; Zhang et al., 2016; He et al., 2018; Koller et al., 112



4

2018; Xing et al., 2018; Zou et al., 2018; Zheng et al., 2020). On the aerial surface of wheat, the first 113

contact between Bgt and wheat takes place at the cuticle, and the Bgt conidia germination is induced to 114

initiate the infection processes (Nielsen et al., 2000; Wright et al., 2002). In bread wheat, silencing of 115

3-KETOACYL-CoA SYNTHASE (TaKCS6) and WAX INDUCER 1 (TaWIN1), two positive regulators in 116

wheat cuticular wax biosynthesis, results in a reduction of Bgt conidia germination, suggesting that the 117

cuticular wax biosynthesis is essential to stimulate the Bgt conidia germination in bread wheat (Kong and 118

Chang, 2018; Wang et al., 2019). However, the function of other components responsible for the wheat 119

cuticular wax biosynthesis in modulating Bgt conidia germination needs to be characterized. 120

In this study, we showed that wheat enoyl-CoA reductase (TaECR) is a core component responsible 121

for the cuticular wax biosynthesis in bread wheat. TaECR promoter-binding MYB transcription factor 1 122

(TaEPBM1) recruits the TaADA2-TaGCN5 histone acetylatransferase complex to activate TaECR 123

transcription by potentiating histone acetylation and enhancing RNA Pol II enrichment at TaECR genes 124

and thus stimulate the cuticular wax biosynthesis required for stimulating Bgt conidia germination. 125

Besides, VLC aldehydes were identified as the wax signals provided by the 126

TaECR-TaEPBM1-TaADA2-TaGCN5 circuit for Bgt germination in bread wheat. Thus, we revealed 127

that the TaECR-TaEPBM1-TaADA2-TaGCN5 circuit regulates the wheat cuticular wax biosynthesis 128

essential for the germination of powdery mildew fungus. 129

130

RESULTS 131

Characterization of the Enoyl-CoA Reductase (ECR) Gene in Bread Wheat 132

In this study, we are interested in exploring the function of the wheat Enoyl-CoA Reductase (ECR) 133

gene in regulating the cuticular wax biosynthesis required for stimulating Bgt conidia germination. To 134

this end, we first identified the wheat TaECR genes based on the sequence of the Arabidopsis AtECR 135

gene (AT3G55360) and the reference genome of the hexaploid bread wheat (International Wheat 136

Genome Sequencing Consortium 2018). Three highly conserved homologous sequences of TaECR 137

genes separately located on chromosomes 3AS, 3BS and 3DS were isolated from the hexaploid bread 138

wheat cultivar Jing411, and were designated as TaECR-A, TaECR-B, and TaECR-D (Supplemental Fig. 139

S1). The open reading frames (ORFs) of these TaECR genomic sequences all contained four exons and 140

three introns, encoding proteins with over 99% amino acid sequence identity (Supplemental Figs. S1). 141

To analyze the evolution of ECR in land plants, we employed protein sequences of TaECR as query 142

sequences to search the genomes of representative land plant species from the Joint Genome Institute 143

(JGI) Phytozome v12.1 database. As shown in Supplemental Figure S2, highly homologous ECR 144

proteins were obtained from all test plant species including the hornwort Marchantia polymorpha and 145

moss Physcomitrella patens, suggesting that ECR proteins might be evolutionarily conserved among 146

land plants. 147

Since the biosynthesis of cuticular wax mainly occurs in the endoplasmic reticulum (ER) in plant 148

epidermal cells, we first analyzed the localization of TaECR in ER. TaECR-YFP fusion proteins were 149

transiently co-expressed with mCherry-HDEL, an ER indicator, in Nicotiana benthamiana leaves. 150

Confocal microscopic images showed that the fluorescence signal of TaECR-YFP was co-localized with 151

that of mCherry-HDEL at ER, suggesting that TaECR proteins localize to the ER in N. benthamiana cells 152



5

(Fig. 1A). In addition, we expressed TaECR-HA in the wheat protoplast and performed a sucrose 153

density-gradient fractionation to validate the ER-localization of TaECR in wheat cells. Since TaECR-A, 154

TaECR-B, and TaECR-D share more than 99% amino acid sequence identity, TaECR-A was selected as 155

a representative TaECR in this experiment. As shown in Supplemental Figure S3, TaECR-HA 156

cofractionated with the ER marker BiP and exhibited the same Mg2+-dependent density shift as the ER 157

marker BiP, further confirming the ER-localization of TaECR in bread wheat. Thereafter, the expression 158

profiles of TaECR were analyzed in different tissues of wheat cultivar Jing411 using reverse 159

transcription quantitative PCR (RT-qPCR). As shown in Figure 1B, TaECR exhibits the lowest 160

expression level in roots and the highest expression levels in epidermis of leaves and stems. Its 161

expression levels were much higher in leaves and stems than in roots (Fig. 1B). 162

To explore whether TaECR involved in the wheat cuticle biosynthesis is required for stimulating Bgt 163

conidia germination, we first conducted the barley stripe mosaic virus (BSMV) induced gene silencing 164

(BSMV-VIGS) to silence all endogenous TaECR genes, including TaECR-A, TaECR-B, and TaECR-D, 165

in wheat cultivar Jing411, and characterized the chemical composition of two major cuticle components, 166

cutin and cuticular wax, in wheat leaves about 15 days post-BSMV-infection through using gas 167

chromatography-mass spectrometry (GC-MS) (Supplemental Fig. S4). Compared with the mock control, 168

inoculation with BSMV-γ has no significant effect on the deposition of cutin and cuticular wax in bread 169

wheat (Supplemental Fig. S5). As shown in Figure 1C, the total cutin load was not significantly changed 170

by the silencing of TaECR, but the wax load decreased from 12.1 μg cm-2 on wild-type Jing 411 leaves to 171

a significant level of 2.6 μg cm-2 on TaECR-silenced wheat leaves. Further quantitative analysis of wax 172

constituents revealed that VLC fatty acids and their derivatives such as aldehydes, alcohols, alkanes, 173

ketone, and even C46-C50 esters showed a remarkable decrease in the TaECR-silenced plants (Fig. 1D). 174

Thereafter, the conidia germination of Bgt strain E09 was examined on leaves of wild-type and 175

TaECR-silenced plants using light microscopy. Compared with the mock control, inoculation with 176

BSMV-γ has no significant effect on Bgt conidia germination in bread wheat (Supplemental Fig. S5). As 177

shown in Figures 1 E and 1F, the Bgt conidia germination was affected on TaECR-silenced leaves, with 178

26% more conidia failing to germinate. Taken together, these results suggest that wheat TaECR, 179

resembling its homolog in Arabidopsis, acts as a core component responsible for the cuticular wax 180

biosynthesis and positively regulates the Bgt conidia germination in bread wheat. 181

182

TaEPBM1 Functions as a Transcriptional Activator of TaECR 183

To identify the transcriptional regulator that directly binds to TaECR promoters, we performed yeast 184

one-hybrid screening against a wheat leaf cDNA library using TaECR promoter regions as baits. One 185

R2R3 type MYB transcription factor was independently and repeatedly isolated as the binding protein of 186

the TaECR promoter, and designated as TaEPBM1 (for TaECR Promoter-Binding MYB transcription 187

factor 1). Three highly conserved homologous sequences of TaEPBM1 genes located on chromosomes 188

2AS, 2BS and 2DS were obtained from Jing411 and encode TaEPBM1-A, TaEPBM1-B, and 189

TaEPBM1-D with more than 96% amino acid sequence identity, among which, TaEPBM1-A was 190

selected as a representative TaEPBM1 in the following experiments (Supplemental Fig. S6). Previous 191

studies revealed that the R2R3 type MYB transcription factor could recognize multiple cis-elements 192

including MBS (CACCAT), which was present in the TaECR promoters. Electrophoretic mobility shift 193



6

assay (EMSA) showed that TaEPBM1 exclusively associated with the wild-type MBS but not mutant 194

MBS fragments, suggesting that TaEPBM1 has the MBS-binding activity (Supplemental Fig. S7). Yeast 195

one-hybrid assays revealed that TaEPBM1 could bind to the wild-type TaECR promoters, but not the 196

MBS cis-element mutated TaECR promoters, suggesting that TaEPBM1 could recognize the MBS 197

cis-element and directly bind to TaECR promoters in yeast cells (Fig. 2A). 198

To examine whether TaEPBM1 could bind to TaECR promoters in plant cells, we employed the wheat 199

protoplast transfection system, in which luciferase (LUC) reporters containing wild-type or mutant 200

TaECR promoter regions were cotransfected with effector constructs over-expressing TaEPBM1 (Fig. 201

2B). As shown in Figure 2C, the LucA ratio obtained from LUC reporters containing wild-type TaECR 202

promoters increased to a significant level of above 4.8 in the presence of TaEPBM1, compared with the 203

basal LUC activity of the Gal4 DNA binding domain (DBD). In contrast, the LucA ratio obtained from 204

LUC reporters containing the MBS-mutated TaECR promoters was not significantly changed by the 205

addition of TaEPBM1 (Fig. 2C). This result suggests that TaEPBM1 could bind to TaECR promoters and 206

activate their expression in wheat cells. 207

To determine the association of TaEPBM1 with TaECR promoters in bread wheat, we generated an 208

antibody specifically against TaEPBM1 and performed chromatin immunoprecipitation (ChIP) assay in 209

Jing 411 leaves (Supplemental Fig. S8A). The wheat elongation factor 1 (TaEF1) gene was employed as 210

control. As shown in Figure 2D and E, two genomic regions (represented by 1 and 2) containing the MBS 211

cis-element in TaECR promoters were subjected to the ChIP assay and found to be enriched in DNA 212

samples precipitated with the α-TaEPBM1 antibody, suggesting that TaEPBM1 associated with TaECR 213

promoters in bread wheat. At the same time, nuclear run-on assays revealed that TaECR was transcribed 214

at much lower rates in the BSMV-TaEPBM1as infected wheat plants compared with BSMV-γ plants 215

(Fig. 2F). Consistent with this, TaECR mRNA levels significantly decreased by 75% in the 216

TaEPBM1-silenced wheat leaves compared with controls, suggesting that TaEPBM1 activates the 217

TaECR transcription (Fig. 2G). In contrast, the transcription rate and expression level of TaEF1 were not 218

affected by silencing of TaEPBM1 (Supplemental Fig. S9). Together, these results indicate that 219

TaEPBM1 is a bona fide transcriptional activator of TaECR in bread wheat. 220

221

TaEPBM1 Interacts with Transcriptional Adapter TaADA2 and Forms the TaEPBM1-TaADA2- 222

TaGCN5 Ternary Protein Complex at TaECR Promoters 223

To explore the molecular mechanism by which TaEPBM1 regulates TaECR transcription, we 224

performed a yeast two-hybrid screening against a wheat leaf cDNA library to identify 225

TaEPBM1-interacting proteins. One of the isolated interacting proteins was homologous to the rice 226

ADA2 (LOC_Os03g53960) and was designated as TaADA2. Three highly-homologous sequences of 227

TaADA2 genes located on chromosomes 5AL, 5BL and 5DL were obtained from Jing411 and encode 228

TaADA2-A, TaADA2-B, and TaADA2-D with more than 99% amino acid sequence identity, among 229

which, TaADA2-A was selected as a representative TaADA2 in the following experiments 230

(Supplemental Fig. S10). As shown in Figure 3A, the interaction between TaEPBM1 and TaADA2 was 231

detected in the EGY48 yeast cells. Further yeast two-hybrid analysis with truncated TaEPBM1 and 232

TaADA2 revealed that the C-terminal region of TaEPBM1 and the N-terminal region of TaADA2 were 233

responsible for their interaction (Fig. 3A). 234



7

To validate the TaEPBM1-TaADA2 interaction, we performed both in vitro and in vivo protein 235

interaction assays. As shown in Figure 3B, GST-TaEPBM1, but not GST alone, could retain 236

TaADA2-His instead of TaGCN5-His in the GST pull-down assay, suggesting that TaEPBM1 directly 237

interacts with TaADA2 but not TaGCN5 in vitro. In the bimolecular fluorescence complementation 238

(BiFC) assay, YFP was reconstituted in the nucleus only in the co-expression pair of nYFP-TaEPBM1 239

and cYFP-TaADA2, but not in control pairs (Fig. 3C). In addition, we generated an antibody specifically 240

against TaADA2 and performed co-immunoprecipitation (co-IP) assay to analyze the 241

TaEPBM1-TaADA2 association in Jing 411 leaves (Supplemental Fig. S8B). As shown in Figure 3D, 242

TaEPBM1 was found co-immunoprecipitated with TaADA2, which was not detected in the TaEPBM1- 243

or TaADA2- silenced plants, suggesting that TaEPBM1 interacts with TaADA2 in bread wheat. 244

In yeast and plants, ADA2 interacts with GCN5 to constitute the ADA2-GCN5 complex (Grant et al., 245

1997; Weake and Workman, 2012; Wang and Dent, 2014; Moraga and Aquea, 2015; Zhou et al., 2017; 246

Li et al., 2018; Castroverde 2019). The finding that TaEPBM1 interacts with TaADA2 prompted us to 247

ask whether TaEPBM1, TaADA2, and TaGCN5 could form a complex. To this end, we first identified 248

the wheat TaGCN5 genes using the sequence of rice OsGCN5 gene (LOC_Os10g28040) as a query to 249

search the chromosome-based reference genome of the hexaploid bread wheat (International Wheat 250

Genome Sequencing Consortium 2018). Three highly conserved homologous sequences of TaGCN5 251

genes separately located on chromosomes 1AS, 1BS and 1DS were isolated from the hexaploid bread 252

wheat cultivar Jing411 and encode TaGCN5-A, TaGCN5-B, and TaGCN5-D with more than 99% amino 253

acid sequence identity, among which, TaGCN5-A was selected as a representative TaGCN5 in the 254

following protein interaction assays (Supplemental Fig. S11). To determine the association among 255

TaEPBM1, TaADA2, and TaGCN5, we conducted yeast two-hybrid, luciferase complementation 256

imaging (LCI) and BiFC assays. As shown in Figures 4, A, B, and C, TaADA2 interacts with TaGCN5 in 257

yeast and plant cells. Notably, the association of TaEPBM1 with TaGCN5 was observed in the presence 258

but not the absence of TaADA2, suggesting that TaADA2 could function as an adapter to bridge the 259

TaEPBM1-TaGCN5 interaction in plant cells (Fig. 4, B and C). Thereafter, we performed the co-IP assay 260

to determine whether TaEPBM1, TaADA2, and TaGCN5 could form a complex in vivo. As shown in 261

Figure 4D, TaEPBM1 and TaADA2 were coimmunoprecipitated with TaGCN5-HA, but not with 262

GFP-HA. Besides, the coimmunoprecipitation of TaEPBM1 with TaGCN5-HA was abrogated by the 263

silencing of TaADA2, indicating that TaEPBM1, TaADA2, and TaGCN5 could form a ternary complex, 264

in which TaADA2 functions as an adapter to bridge the interaction between TaEPBM1 and TaGCN5 265

(Fig. 4D). 266

Having already demonstrated that TaEPBM1 directly binds to TaECR promoters and TaEPBM1, 267

TaADA2 and TaGCN5 could form a complex, we next ask whether the TaEPBM1-TaADA2-TaGCN5 268

ternary protein complex associates with TaECR promoters in bread wheat. To test this hypothesis, we 269

co-transfected the wheat protoplast with TaGCN5-HA and RNAi constructs, and performed a 270

ChIP assay to characterize the distribution of TaGCN5-HA, TaADA2, and TaEPBM1 at TaECR 271

promoters (Fig. 5). TaGCN5-HA and TaADA2 were found enriched at the promoter regions of 272

TaECR-A, TaECR-B, and TaECR-D (Fig. 5, top and middle rows), in a pattern similar with that of 273

TaEPBM1 (Fig. 5, bottom row), suggesting that they associate with TaECR promoters as a ternary 274

complex. Notably, the levels of TaADA2 and TaGCN5-HA at TaECR promoter regions were 275

significantly reduced by the silencing of TaEPBM1 (Fig. 5, Supplemental Fig. S12). Also, the silencing 276



8

of TaADA2 decreased the accumulation of TaGCN5-HA but not TaEPBM1 at TaECR promoters (Fig. 5, 277

Supplemental Fig. S12). Together, these results indicate that TaEPBM1 interacts with the adapter protein 278

TaADA2 and recruited TaADA2-TaGCN5 complex to TaECR promoters. 279

280

TaEPBM1-TaADA2-TaGCN5 Protein Complex Activates TaECR Transcription by Potentiating 281

Histone Acetylation and Enhancing RNA Pol II Enrichment at TaECR Genes 282

In yeast and other plants, the ADA2-GCN5 complex was reported to activate gene transcription 283

through enhancing histone acetylation and recruitment of the RNA polymerase II (Grant et al., 1997; 284

Weake and Workman, 2012; Wang and Dent, 2014; Moraga and Aquea, 2015; Zhou et al., 2017; Li et al., 285

2018; Castroverde 2019). The finding that TaEPBM1 recruits the TaADA2-TaGCN5 complex to TaECR 286

promoter regions led us to ask whether the complex regulates histone acetylation at TaECR promoters. 287

To this end, we separately silenced all endogenous TaEPBM1, TaADA2 and TaGCN5 genes using 288

BSMV-VIGS, and performed a ChIP assay to analyze histone acetylation such as H3K4ac, H3K9ac, 289

H3K14ac, H3K27ac, and H4K5ac at TaECR promoters (Supplemental Fig. S12). As shown in Figure 290

6A, the levels of H3K4ac, H3K9ac, H3K14ac, H3K27ac, and H4K5ac at TaECR promoters were 291

remarkably reduced by silencing of TaEPBM1, TaADA2 or TaGCN5, indicating that TaEPBM1, 292

TaADA2, and TaGCN5 mediate histone acetylation at TaECR promoters. Notably, simultaneous 293

silencing of TaEPBM1, TaADA2, and TaGCN5 failed to cause a further change in histone acetylation at 294

TaECR promoters, compared with single-silencing of TaEPBM1, TaADA2 or TaGCN5, which is 295

consistent with the fact that TaEPBM1, TaADA2, and TaGCN5 function in a ternary protein complex 296

(Fig. 6A). 297

Recent studies in P. trichocarpa revealed that the recruitment of ADA2-GCN5 complex enables the 298

enhancement of histone acetylation and enrichment of RNA polymerase II at PtrNAC genes for the 299

development of plant drought tolerance (Li et al., 2018). To examine the potential regulation of RNA Pol 300

II recruitment at TaECR genes by TaEPBM1-TaADA2-TaGCN5 protein complex, we separately 301

silenced all endogenous TaEPBM1, TaADA2, and TaGCN5 genes using BSMV-VIGS, and analyzed the 302

occupancy of total RNA Pol II at promoters and coding regions of TaECR genes using ChIP-qPCR assay 303

(Supplemental Fig. S12). Since allelic TaECR-A, TaECR-B, and TaECR-D shared over 95% nucleotide 304

sequence identity at coding regions, we chose TaECR-A as a representative TaECR gene in these 305

ChIP-qPCR assays (Fig. 6B, Supplemental Fig. S1). As shown in Figure 6C, the levels of total RNA Pol 306

II decreased by over 25% at promoters and coding regions of TaECR genes with the silencing of 307

TaEPBM1, TaADA2 or TaGCN5, suggesting that TaEPBM1, TaADA2, and TaGCN5 stimulate the RNA 308

Pol II recruitment at promoters and coding regions of TaECR genes. At the same time, nuclear run-on 309

assays revealed that TaECR was transcribed at much lower rates in the TaEPBM1, TaADA2 or TaGCN5- 310

silenced wheat leaves compared with controls (Fig. 6D; Supplemental Fig. S12). Consistent with this, 311

TaECR transcript levels decreased by over 70% in the wheat leaves infected with BSMV-TaEPBM1as, 312

BSMV-TaADA2as or BSMV-TaGCN5as compared with BSMV-γ plants (Fig. 6E; Supplemental Fig. 313

S12). Additionally, simultaneous silencing of TaEPBM1, TaADA2, and TaGCN5 failed to cause a further 314

change in RNA Pol II recruitment and transcription at TaECR genes, compared with single-silencing of 315

TaEPBM1, TaADA2 or TaGCN5, suggesting that TaEPBM1, TaADA2 and TaGCN5 function in a 316

protein complex to facilitate the RNA Pol II recruitment and activate the TaECR transcription (Fig. 6, C, 317



9

D, and E; Supplemental Fig. S12). In contrast, the transcription rate and expression level of TaEF1 were 318

not affected by the silencing of TaEPBM1, TaADA2 or TaGCN5 (Supplemental Fig. S9). Taken together, 319

these results indicate that the TaEPBM1-TaADA2-TaGCN5 protein complex activates TaECR 320

transcription by potentiating histone acetylation such as H3K4ac, H3K9ac, H3K14ac, H3K27ac, and 321

H4K5ac, as well as enhancing RNA Pol II occupancy at TaECR genes. 322

323

Reduced Expression of TaEPBM1, TaADA2 or TaGCN5 in Bread Wheat Decreased the Cuticular 324

Wax Biosynthesis and Attenuated Bgt Germination 325

The findings that TaECR acts as a core component responsible for the cuticular wax biosynthesis and 326

that the TaEPBM1-TaADA2-TaGCN5 protein complex directly activates the TaECR transcription led us 327

to ask whether the TaEPBM1-TaADA2-TaGCN5 protein complex regulates the cuticular wax 328

biosynthesis in bread wheat. To examine this hypothesis, we separately silenced all endogenous 329

TaEPBM1, TaADA2 and TaGCN5 genes using BSMV-VIGS, and determined leaf cuticular wax load in 330

wheat leaves about 15 days post-BSMV-infection by GC-MS (Supplemental Fig. S12). As shown in 331

Figure 7A, the total cuticular wax load decreased by over 50% in TaEPBM1, TaADA2 or 332

TaGCN5-silenced wheat leaves compared with controls. Further quantitative analysis of wax 333

components revealed that VLC wax components including fatty acids, aldehydes, alcohols, alkanes, 334

ketones, and even C46-C50 esters all showed a significant decrease in the TaEPBM1, TaADA2 or 335

TaGCN5-silenced plants (Fig. 7B). Thereafter, the conidia germination of Bgt strain E09 was examined 336

on leaves of wild-type Jing411 and TaEPBM1, TaADA2 or TaGCN5-silenced plants. As shown in Figure 337

7C and 7D, Bgt conidia on TaEPBM1, TaADA2 or TaGCN5-silenced wheat leaves exhibit remarkably 338

decreased germination rates than did Bgt conidia on Jing411 wild-type wheat leaves. Notably, 339

simultaneous silencing of TaEPBM1, TaADA2, and TaGCN5 failed to cause a further decrease in 340

cuticular wax biosynthesis and Bgt conidia germination compared with single-silencing of TaEPBM1, 341

TaADA2 or TaGCN5. Taken together, these results support that TaEPBM1, TaADA2 and TaGCN5 342

function in a protein complex to activate the TaECR transcription and thus contribute to the cuticular wax 343

biosynthesis and Bgt germination. 344

345

VLC Aldehydes are the Wax Signals Provided by TaECR-TaEPBM1-TaADA2- TaGCN5 Circuit 346

for Stimulating Bgt Germination in Bread Wheat 347

Increasing evidence revealed that the cuticular wax provides signals for stimulating conidia 348

germination of powdery mildew fungus Blumeria graminis (Nielsen et al., 2000; Wright et al., 2002; 349

Weidenbach et al., 2014; Kong and Chang, 2018; Li et al., 2018; Wang et al., 2019). The finding that 350

TaECR-TaEPBM1- TaADA2-TaGCN5 circuit regulates both the cuticular wax biosynthesis and Bgt 351

conidia germination led us to ask whether the cuticular wax biosynthesis regulated by 352

TaECR-TaEPBM1-TaADA2 -TaGCN5 circuit is essential to Bgt conidia germination. To this end, we 353

manipulated the cuticular wax on TaECR, TaEPBM1, TaADA2 or TaGCN5-silenced wheat leaves by 354

spraying cuticular wax isolated from BSMV-γ control plants and then analyzed the Bgt conidia 355

germination. As shown in Figure 8A, the application of cuticular wax isolated from BSMV-γ plants 356

enabled the Bgt germination rates on the TaECR, TaEPBM1, TaADA2 or TaGCN5-silenced wheat leaves 357



10

to increase by about 30%, a value nearly identical to that on BSMV-γ leaves. Similarly, Bgt germination 358

rates on the BSMV-γ leaves remarkably decreased in the presence of cuticular wax isolated from TaECR, 359

TaEPBM1, TaADA2 or TaGCN5-silenced wheat leaves (Fig. 8A). These results indicated that the 360

cuticular wax biosynthesis regulated by the TaECR-TaEPBM1-TaADA2-TaGCN5 circuit is required for 361

stimulating Bgt conidia germination in bread wheat. 362

363

Previous studies revealed that the physical properties, namely hydrophobicity, and chemical 364

composition of the cuticle determine the beginning of plant-fungi interaction (Aragón et al., 2017). To 365

analyze the hydrophobicity of leaf cuticle, we measured the contact angle of water droplets on the leaf 366

surface in wheat leaves separately infected with BSMV-TaECRas, BSMV-TaEPBM1as, 367

BSMV-TaADA2as, BSMV-TaGCN5as or BSMV-γ. As shown in Figure 8A, the leaf surfaces of 368

BSMV-γ plants showed contact angles about 153°, whereas the leaf surfaces of TaECR, TaEPBM1, 369

TaADA2 or TaGCN5-silenced plants exhibited contact angles less than 131°, indicating that silencing of 370

TaECR, TaEPBM1, TaADA2 or TaGCN5 led to reduced hydrophobicity in wheat leaf cuticle. Thereafter, 371

we employed a Formvar resin-based in vitro system, which could minimize the hydrophobicity 372

difference through providing highly homogeneous surfaces, to examine the Bgt conidia germination. As 373

shown in Figure 8B, glass slides covered with Formvar/ cuticular wax isolated from wheat leaves 374

infected with BSMV-γ, BSMV-TaECRas, BSMV-TaEPBM1as, BSMV-TaADA2as, or 375

BSMV-TaGCN5as exhibit nearly identical contact angles. The germination rate of Bgt conidia on glass 376

slides covered with Formvar/BSMV-γ cuticular wax is about 77%, but less than 59% Bgt conidia could 377

germinate on glass slides coated with the Formvar/ cuticular wax isolated from wheat leaves infected 378

with BSMV-TaECRas, BSMV-TaEPBM1as, BSMV-TaADA2as, or BSMV-TaGCN5as (Supplemental 379

Fig. S13)., suggesting that the chemical composition of cuticular wax was responsible for the difference 380

in Bgt germination rate between wild-type and TaECR, TaEPBM1, TaADA2 or TaGCN5-silenced plants. 381

To characterize the role of single wax components including aldehydes, fatty acids, alcohols, alkanes, 382

and even esters (which are reduced by silencing of TaECR, TaEPBM1, TaADA2, and TaGCN5), in 383

stimulating Bgt germination, we employed glass slides covered with Formvar/wheat cuticular wax 384

supplemented with corresponding synthetic chemicals and examined the Bgt conidia germination. As 385

shown in Figure 8B, a supplement of C26, C28 or C30-aldehyde could restore the Bgt germination penalty 386

on the glass slides coated with Formvar/cuticular wax isolated from the TaECR, TaEPBM1, TaADA2 or 387

TaGCN5-silenced plants, whereas addition of other synthetic wax components such as VLC fatty acid, 388

alkane, alcohol or alkyl ester failed to promote Bgt germination. Together, these results support that the 389

VLC aldehydes are the wax signals provided by the TaECR-TaEPBM1-TaADA2-TaGCN5 circuit for 390

stimulating Bgt germination. 391

392

DISCUSSION 393

Powdery mildew caused by the biotrophic fungal pathogen Bgt seriously threatens wheat production. 394

Therefore, characterizing the molecular mechanism by which wheat genes regulate Bgt infection is vital 395

to breeding Bgt-resistant wheat. In this study, we explored the transcriptional regulation of wheat 396

cuticular wax biosynthesis required for stimulating Bgt conidia germination, and revealed that the 397



11

transcription factor TaEPBM1 recruits TaADA2-TaGCN5 complex to activate transcription of TaECR, a 398

core gene controlling wheat cuticular wax biosynthesis, by enhancing histone acetylation and 399

RNA Pol II occupancy at TaECR gene, and thereby stimulating the cuticular wax biosynthesis essential 400

for Bgt conidia germination. 401

402

TaECR is a Core Component Responsible for the Wheat Cuticular Wax Biosynthesis 403

In previous studies, Enoyl-CoA Reductase (ECR) was revealed to function in the endoplasmic 404

reticulum (ER) to catalyze the reduction of the enoyl-CoA, the final step of VLC acyl-CoA elongation 405

(Kohlwein et al., 2001). Arabidopsis cer10 mutant disrupted in the AtECR gene exhibited reduced 406

cuticular wax load, indicating that ECR participates in VLC acyl-CoA’s elongation reactions in 407

Arabidopsis (Zheng et al., 2005). However, the biological function of ECR in other plants, especially the 408

important crops, is still unknown. In this study, we characterized the function of wheat TaECR, which 409

had more than 88% amino acid identities with Arabidopsis AtECR. Both confocal microscopy imaging 410

and sucrose density-gradient fractionation assay showed that TaECR was localized to the ER, the site of 411

cuticular wax biosynthesis. Tissue-specific analysis of TaECR transcription demonstrated that TaECR is 412

highly expressed in the epidermis of wheat leaves and stems, where the cuticular wax is accumulated. 413

Consistently, the silencing of TaECR in bread wheat led to a reduction in deposition of all cuticular wax 414

components such as VLC fatty acids, alcohols, aldehydes, alkanes, and ketones, suggesting that wheat 415

TaECR, resembling Arabidopsis AtECR, acts a core component responsible for the wheat cuticular wax 416

biosynthesis. 417

Increasing evidence revealed that the function of core components mediating the cuticular wax 418

biosynthesis is largely conserved among dicots and monocots. For instance, constitutive overexpression 419

of SHINE1 (SHN1) in bread wheat increased the content of cuticular wax constituents such as VLC 420

alkanes, aldehydes and primary alcohols, which is consistent with the results of overexpression of SHN1 421

in rice, Arabidopsis and even mulberry trees (Aharoni et al., 2004; Wang et al., 2012; Sajeevan et al., 422

2017; Bi et al., 2018). Similarly, disruption of 3-KETOACYL-CoA SYNTHASE 6 (KCS6) in Arabidopsis, 423

barley and wheat all led to the attenuated deposition of cuticular wax (Fiebig et al., 2000; Hooker et al., 424

2002; Weidenbach et al., 2014; Wang et al., 2019). However, in contrast to disruption of β-ketoacyl-CoA 425

Synthase (HvKCS1)-attenuated wax synthesis in barley, AtKCS1 has little affect on wax biosynthesis in 426

Arabidopsis, suggesting that some cuticle biosynthetic components have acquired divergent functions in 427

the evolution of dicots and monocots (Todd et al., 1999; Li et al., 2018). 428

429

TaEPBM1 Recruits the TaADA2-TaGCN5 Histone Acetyltransferase Complex to Activate 430

TaECR Transcription 431

In Arabidopsis, AtECR transcription is activated by the MYB type transcription factors such as 432

MYB30 and MYB94, and suppressed by the AP2/ERF-type transcription factor DEWAX (Raffaele et 433

al., 2008; Go et al., 2014; Lee and Suh 2014). Through employing multiple approaches such as EMSA, 434

yeast one-hybrid, and ChIP-qPCR assay, we demonstrated that the MYB type transcription factor 435

TaEPBM1 could recognize the MBS cis-element and directly bind to the promoters of TaECR genes. 436

Wheat protoplast transactivation assay and RT-qPCR revealed that TaEPBM1 acts as a transcriptional 437



12

activator of TaECR. The closest homolog of TaEPBM1 in Arabidopsis was AtMYB96 with 41.3% 438

identity, suggesting potential functional conservation of the transcription factor in monocots and dicots. 439

In previous studies, multiple MYB type transcription factors, including the Arabidopsis MYB16, 440

MYB30, MYB94, MYB96, MYB106, maize GL3, and saltwater cress EsWAX1, were reported to 441

regulate cuticular wax biosynthesis (Avato et al., 1987; Raffaele et al., 2008; Seo et al., 2011; Liu et al., 442

2012; Oshima et al., 2013; Zhu et al., 2014; Lee and Suh, 2015b; Lee et al., 2016). Here, we found that 443

TaEPBM1 activates TaECR transcription and positively regulates wheat cuticular wax biosynthesis, 444

further implicating the essential role of MYB type transcription factors in the transcriptional regulation 445

of plant cuticular wax biosynthesis. 446

In yeast and plants, ADA2 and GCN5 are integrated into the histone acetylation (HAT) module of the 447

transcriptional activator complex SAGA, which comprises more than 20 subunits grouped into 4 448

modules, including the HAT module, histone deubiquitination module, coactivator architecture module, 449

and recruiting module (Grant et al., 1997; Weake and Workman, 2012; Wang and Dent, 2014; Moraga 450

and Aquea, 2015). Recent studies revealed that the ADA2-GCN5 complex activates gene transcription 451

through enhancing histone acetylation and recruitment of the RNA polymerase II in rice and P. 452

trichocarpa (Zhou et al., 2017; Li et al., 2018). Here, we showed that TaADA2 and TaGCN5 were 453

enriched at TaECR promoters in a similar pattern, and silencing of TaADA2 and TaGCN5 led to the 454

attenuated histone acetylations such as H3K4ac, H3K9ac, H3K14ac, H3K27ac, and H4K5ac, as well as 455

reduced RNA Pol II recruitment at TaECR genes, suggesting that the TaADA2-TaGCN5 HAT module 456

might directly regulate the TaECR transcription by potentiating histone acetylation and enhancing 457

RNA Pol II enrichment. Therefore, it will be intriguing to test whether other subunits or modules of 458

SAGA complex are involved in the epigenetic control of TaECR transcription and cuticle wax 459

biosynthesis in the future. 460

Increasing evidence revealed that the ADA2-GCN5 complex complex is recruited to the target 461

promoters through interaction with specific transcription factors, in which ADA2 proteins serve as an 462

adapter to bridge the association between ADA2-GCN5 complex and transcription factors. For instance, 463

the rice homeodomain transcription factor WOX11 directly interacts with rice ADA2 and recruits the 464

ADA2-GCN5 complex to target root-specific genes involved in cell proliferation of crown root meristem 465

(Zhou et al., 2017). Similarly, the Arabidopsis AP2 transcription factor CBF directly interacts with 466

ADA2 to activate transcription of cold-responsive genes (Mao et al., 2006). Recent research in P. 467

trichocarpa also revealed that the AREB1 transcription factor interacts with the ADA2-GCN5 complex 468

to regulate gene expression during drought stress (Li et al., 2018; Castroverde 2019). Through employing 469

multiple approaches such as yeast two-hybrid, GST pull-down, BiFC, co-IP, and ChIP-qPCR assay, we 470

demonstrated that the TaEPBM1 directly interacts with TaADA2 and recruits the TaADA2-TaGCN5 471

complex to TaECR promoters to activate TaECR transcription by enhancing histone acetylation and 472

RNA Pol II occupancy at TaECR genes. Silencing of TaEPBM1, TaADA2 or TaGCN5 resulted in the 473

attenuation of cuticular wax biosynthesis required for stimulating Bgt germination, suggesting that 474

TaEPBM1 recruits TaADA2-TaGCN5 complex to establish the epigenetic regulation of cuticular wax 475

biosynthesis required for triggering Bgt conidia germination in bread wheat. 476

477



13

TaECR-TaEPBM1-TaADA2-TaGCN5 Circuit Regulates the Cuticular Wax Biosynthesis 478

Exploited by Bgt for Triggering Conidia Germination 479

It has been demonstrated that the fungal pathogen Blumeria graminis could utilize the plant cuticular 480

wax components to initiate its pre-penetration processes (Nielsen et al., 2000; Wright et al., 2002; 481

Weidenbach et al., 2014; Kong and Chang, 2018; Li et al., 2018; Wang et al., 2019). Additionally, VLC 482

aldehydes promote the in vitro conidia germination and appressorial development of B. graminis in a 483

dose-dependent manner (Hansjakob et al., 2010; Hansjakob et al., 2011; Kong and Chang, 2018; Wang et 484

al., 2019). Here, we showed that silencing of TaECR, TaEPBM1, TaADA2 or TaGCN5 in bread wheat 485

attenuated Bgt conidia germination, which was fully restored by application of cuticular wax isolated 486

from wild-type wheat leaves. Consistently, spraying of cuticular wax isolated from TaECR, TaEPBM1, 487

TaADA2 or TaGCN5-silenced leaves led to the reduced germination of Bgt conidia on wild-type wheat 488

leaves, indicating that the TaECR-TaEPBM1-TaADA2-TaGCN5 circuit involved in the cuticular wax 489

biosynthesis has been exploited by Bgt for triggering conidia germination. Through using an in vitro 490

system based on Formvar-coated glass slides, we showed that application of synthetic VLC aldehydes, 491

but not other synthetic wax components such as VLC fatty acids, alkanes, alcohols or alkyl esters, could 492

overcome the Bgt germination penalty on cuticular wax isolated from TaECR, TaEPBM1, TaADA2 or 493

TaGCN5-silenced wheat leaves, suggesting that VLC aldehydes are the wax signals provided by the 494

TaECR-TaEPBM1-TaADA2-TaGCN5 circuit for triggering Bgt conidia germination in bread wheat. 495

These results allowed us to establish a model about how the TaECR-TaEPBM1-TaADA2-TaGCN5 496

circuit regulates the cuticular wax biosynthesis required for stimulating Bgt conidia germination in bread 497

wheat. As shown in Figure 9, transcription factor TaEPBM1 recognizes the MBS cis-element and directly 498

targets TaECR, an essential gene in cuticular wax biosynthesis. Through directly interacting with the 499

adapter protein TaADA2, TaEPBM1 recruits the TaADA2-TaGCN5 histone acetyltransferase complex 500

to TaECR promoters, which lead to activation of TaECR transcription by potentiating histone acetylation 501

and enhancing RNA Pol II enrichment at TaECR genes. Consequently, the cuticular wax biosynthesis is 502

stimulated, leading to the accumulation of VLC aldehyde wax constituents and thereby triggering the 503

germination of Bgt conidia. Our findings support that the recruitment of the TaADA2-TaGCN5 histone 504

acetyltransferase complex by specific transcription factor plays an important role in the epigenetic 505

control of cuticular wax biosynthesis essential for stimulating Bgt conidia germination, and provide 506

insight for the improvement of wheat powdery mildew resistance in the future. 507

508

MATERIALS AND METHODS 509

Plant Materials and Fungal Inoculation 510

The cultivar Jing411 of common wheat (Triticum aestivum L.) and the isolate E09 of wheat powdery 511

mildew fungus (Blumeria graminis f. sp. tritici) were used for the wheat-powdery mildew interaction and 512

maintained under conditions as previously reported (Liu et al., 2019). The Bgt inoculation was performed 513

in the same condition. At 12 hours post-Bgt inoculation, wheat leaves were subjected to the microscopic 514

analysis of Bgt conidia germination as described by Kong and Chang (2018). 515

Subcellular Localization Analysis 516



14

TaECR coding regions were amplified using primers listed in Supplemental Table S1 and cloned into 517

vector pCAMBIA1300-YFP via the pENTRY-TaECR construct using the GATEWAY cloning 518

technology and then transformed into the Agrobacterium tumefaciens strain GV3101. The 519

pCAMBIA1300-derivatives expressing the endoplasmic reticulum (ER) marker mCherry-HDEL were 520

also transformed into the A. tumefaciens strain GV3101. Nicotiana benthamiana plants used in this study 521

were grown in a growth chamber at 22°C with a 14/10 h light /dark photoperiod. N. benthamiana leaves 522

co-infiltrated with A. tumefaciens strain GV3101 expressing TaECR-YFP and mCherry-HDEL were 523

imaged using the confocal microscope (Leica TCS SP5) at 48 hours post-Agro-infiltration. 524

For the subcellular localization analysis in wheat protoplast, the TaECR coding region was amplified 525

using primers listed in Supplemental Table S1 and cloned into the pCAMBIA1300-HA vector via the 526

pENTRY-TaGCN5 construct using GATEWAY cloning technology to generate the fusion protein 527

TaECR-HA. The wheat protoplasts were prepared as previously described by Liu et al (2019). 10 µg 528

plasmid of pCAMBIA1300-TaECR-HA construct was mixed with 200 µl wheat protoplasts in 250 µl 529

PEG solution containing 40% (w/v) PEG4000, 0.2M mannitol, and 0.1M CaCl2 and kept 30 minutes in 530

the dark for transfection. After being washed three times with W5 solution (pH 5.7, 2 mM MES, 5 mM 531

KCl, 120 mM CaCl2 and 150 mM NaCl), the transformed protoplasts were cultured in W5 solution for at 532

least 48 hours for the sucrose density-gradient fractionation assay. The sucrose density-gradient 533

fractionation assay was performed as described previously (Chen et al., 2002). The antibodies α-HA 534

(Millipore, 05-904), α-BiP (Stressgen, SPA-818), and α-H+ ATPase (Agrisera, AS07260) were 535

employed for immunobloting. For confocal microsopy imaging and sucrose density-gradient 536

fractionation assays, three independent biological replicates were perfomed with consistent results. 537

Barley Stripe Mosaic Virus (BSMV)-mediated Silencing of TaECR, TaEPBM1, TaADA2, and 538

TaGCN5 539

For the BSMV-mediated gene silencing, fragments of TaECR, TaEPBM1, TaADA2, and TaGCN5 540

(approximately 200-bp) were amplified using primers listed in Supplemental Table S1 and cloned in the 541

antisense orientation into the pCa-γbLIC vector through the ligation independent cloning technique to 542

create the BSMV-TaECRas, BSMV-TaEPBM1as, BSMV-TaADA2as, and BSMV-TaGCN5as 543

constructs, respectively. The BSMV-mediated gene silencing was performed as described (Yuan et al., 544

2011). About 3 weeks post-inoculation with BSMV virus, nascent wheat leaves with visible BSMV 545

symptoms were subjected to cuticle chemical analysis and powdery mildew infection. 546

Cuticle Chemical Analysis 547

As described in previous studies, wheat leaves with virus symptoms about 15 d post-BSMV-infection 548

were subjected to wax analysis (Kong and Chang, 2018; Wang et al., 2019). For the cutin composition 549

analysis, lyophilized wheat leaves from at least 5 BSMV-VIGS wheat plants were delipidated in an 550

isopropanol-chloroform-methanol solution containing 0.01% (v/v) butylated hydroxytoluene. After 551

being dried under an N2 stream and weighed, the extracts were depolymerized into methyl esters in a 552



15

reaction mixture containing methanol and methyl nonadecanoate. After extraction with dichloromethane 553

and dried under an N2 stream, the samples were derivatized with pyridine and bis-N,O- trimethylsilyl 554

trifluoroacetamide, and then subjected to GC-MS analysis as described previously (Kong and Chang, 555

2018). The oven temperature program was set at an initial temperature 75°C, increased to 200°C at 15°C 556

min-1, then increased to 280°C at 1.5°C min-1. Methyl nonadecanoate was added as the internal standard 557

for the FID peak-based quantification. 558

The cuticular wax composition analysis was performed as described by Hansjakob et al. (2010). 559

Briefly, wheat leaves from at least 5 BSMV-VIGS wheat plants were dipped into chloroform (Merck). 560

The extracts dried under N2 were derivatized at 70°C for 30 mins through reaction with bis-N,O- 561

trimethylsilyl trifluoroacetamide and analyzed by the same GC-MS column in cutin analysis, in which 562

H2 was used as the carrier gas. The oven temperature was programmed at an initial 50°C for 2min, 563

increased to 200°C at 40°C min-1, kept at 200°C for 2min, and then increased to 320°C at 3°C min-1, and 564

finally kept at 320°C for 30min. n-Tetracosane was added as an internal standard for the FID peak-based 565

quantification and Agilent/HP chemstation software (Agilent Technologies) were employed for the cutin 566

and wax compound identification. For cuticle chemical analysis, three biological replicates were 567

statistically analyzed. 568

Wheat Protoplast Transient Gene Silencing and Expression Assay 569

For the gene silencing in wheat protoplasts, 198-, 209-, 212-bp fragments of TaEPBM1, TaADA2 and 570

TaGCN5 were amplified using primers listed in Supplemental Table S1 and cloned in the antisense 571

orientation into the pIPKb007 vector via the pENTRY-RNAi-TaEPBM1as, 572

pENTRY-RNAi-TaADA2as, and pENTRY-RNAi-TaGCN5as constructs using GATEWAY cloning 573

technology to create the RNAi-TaEPBM1as, RNAi-TaADA2as, and RNAi-TaGCN5as constructs, 574

respectively. For gene expression in wheat protoplasts, the TaGCN5 coding region was amplified using 575

primers listed in Supplemental Table S1 and cloned into the pCAMBIA1300-HA vector via the 576

pENTRY-TaGCN5 construct using GATEWAY cloning technology to generate the fusion protein 577

TaGCN5-HA. 10 µg plasmids for RNAi and pCAMBIA1300-TaGCN5-HA constructs were 578

co-transfected into wheat protoplasts as previously described by Liu et al (2019). The transformed 579

protoplasts were cultured in W5 solution for at least 48 hours for the next gene expression analysis or 580

ChIP-qPCR assays. 581

For the wheat protoplast transactivation assay, the TaEPBM1 coding region was amplified using the 582

primers listed in Supplemental Table S1 and cloned into the vector pIPKb004 vector via the 583

pENTRY-TaEPBM1 construct using the GATEWAY cloning technology. Similarly, TaECR promoters 584

were amplified using the primers listed in Supplemental Table S1 and ligated into the vector 585

5XGAL4-LUC, which was then co-transfected with pIPKb004 derivatives and internal control pPTRL 586

into the wheat protoplast as previously described by Liu et al (2019). LUC activity was measured at 48 587

hours post-transfection using a Promega dual-luciferase reporter assay system (Promega, E1910) 588



16

according to the manual. In wheat protoplast transactivation assay, three biological replicates were 589

statistically analyzed. 590

Gene Expression Analysis 591

For gene expression analysis, wheat leaves with visible BSMV symptoms were collected at 3 weeks 592

post-inoculation with indicated BSMV virus, and wheat protoplasts were harvested at 48 hours 593

post-transfection with indicated RNAi constructs. In the nuclear run-on assay for measuring gene 594

transcription rate, wheat cell nuclei were isolated and mixed with reaction buffer (25 mM biotin-16-UTP 595

and 0.75 mM of ATP, CTP, and GTP) for the transcription reaction as described by Ding et al (2012). 596

After RNA extraction using Trizol, the nascent RNA was enriched by streptavidin magnetic beads 597

(Invitrogen) and subjected to the RT-qPCR assay using the primers listed in Supplemental Table S1. For 598

the RT-qPCR assay, total RNA was extracted using Trizol reagent and treated with Dnase I for the 599

gDNA removal. 2μg RNA was then employed to synthesize the first-strand cDNA template using the 600

cDNA synthesis supermix (Transgen) according to the manual. RT-qPCR was performed using the 601

qPCR Master Mix (Invitrogen) under the following programs: 95°C for 3 min, 40 cycles at 95°C for 20 s, 602

55°C for 20 s, and 72°C for 15 s, followed by 72°C for 1 min. The expression levels of TaGADPH, 603

TaECR, TaEPBM1, TaADA2, and TaCHR729 were analyzed using the primers listed in Supplemental 604

Table S1 and the TaGADPH, whose expression is stable among various treatments, was used as the 605

internal control for reference. For the nuclear run-on and RT-qPCR assays, three biological replicates 606

were statistically analyzed. 607

Yeast One- and Two-Hybrid Experiments 608

In yeast one-hybrid analysis, the TaEPBM1 coding region was amplified using the primers listed in 609

Supplemental Table S1 and cloned into the vector pGADT7 via the pENTRY-TaEPBM1 construct using 610

GATEWAY cloning technology to generate protein fusions to the GAL4 transcription-activating domain 611

(AD). Similarly, TaECR promoters were amplified using the primers listed in Supplemental Table S1 612

and cloned into the vectors pHIS2, which were then co-transformed with pGADT7 derivatives into 613

competent cells of yeast strain Y187 according to the manual. Yeast transformants were then grown on 614

the SD/-Trp-Leu-His plate with 15% (w/v) 3-amino-1,2,4-triazole (3-AT) to test for HIS2 expression. In 615

yeast two-hybrid analysis, the coding fragments of TaEPBM1, TaADA2, and TaGCN5 were amplified 616

using primers listed in Supplemental Table S1 and separately cloned into the vectors pLexA and 617

pB42AD via the pENTRY-TaEPBM1, pENTRY-TaADA2, and pENTRY-TaGCN5 constructs using 618

GATEWAY cloning technology; these were co-transformed into competent cells of yeast strain EGY48 619

according to the Clontech Yeast Protocols Handbook. For the truncated TaEPBM1 and TaADA2 used in 620

the yeast two-hybrid assay, the TaEPBM1-NT(1-120), TaEPBM1-CT(121-314), TaADA2-NT(1-244), 621

and TaEPBM1-NT(245-568) were amplified using primers listed in Supplemental Table S1 and cloned 622

into the vectors pLexA and pB42AD. The pB42AD-derived prey wheat cDNA library was constructed 623

and screened as previously described by Liu et al (2019). Yeast transformants were grown on the 624



17

SD/-Ura-Trp-Leu-His plate with X-gal to test for expression of LEU2 and LacZ. The yeast strains Y187 625

and EGY48 were maintained on YPAD and SD/-Ura medium, respectively. For the yeast one- and 626

two-hybrid experiments, at least three independent biological replicates were performed with consistent 627

results. 628

Electrophoretic Mobility Shift Assay (EMSA) 629

The TaEPBM1 coding region was amplified using the primers listed in Supplemental Table S1 and 630

cloned into the vector pET32, and TaEPBM1-His recombinant protein was expressed and purified from 631

E. coli using Ni-NTA resin according to the manual. The Pchn0 probe 632

(GGTCCATACACCATCTCTGTTGGGTCCATACACCATCTCTGTTGTCT) contains two copies of 633

wild type MBS cis-elements and flanking sequences from TaECR promoters. In the mutated Probe 634

mPchn0 (GGTCCATACACAATCTCTGTTGGGTCCATACACAATCTCTGTTGTCT), the MBS 635

cis-element CACCAT was replaced by CACCAT. Pchn0 and the mPchn0 probe were generated by 636

annealing oligonucleotides (see Supplemental Table S1 for sequence information) as described 637

previously (Su et al. 2015). The EMSA was performed as described by Kong and Chang (2018). The 638

DNA-protein complexes were visualized by exposing the resultant gel on the Phosphor screen for 8 639

hours. For the EMSA, at least three independent biological replicates were performed with similar 640

results. 641

Pull-Down Assay 642

For pull-down assays, the TaEPBM1 coding region was amplified using the primers listed in 643

Supplemental Table S1 and cloned into the vector pGEX4T-1 to generate the fusion protein 644

GST-TaEPBM1, while the coding regions of TaADA2 and TaGCN5 were amplified using the primers 645

listed in Supplemental Table S1 and cloned into the vector pET32 to create proteins fusions to the 646

His-tag. The pull-down assay was performed as described by Wang et al (2019). Briefly, the recombinant 647

proteins with GST and His tags were expressed and purified from E.coli using glutathione sepharose and 648

Ni-NTA resin according to the manual. Recombinant proteins with GST and His tags were mixed as 649

pairs indicated and incubated with glutathione sepharose, and then subjected to the 650

centrifugation-assisted precipitation. After being washed five times with PBS buffer, the precipitates 651

were subjected to SDS-PAGE separation, and the co-precipitation of TaADA2-His or TaGCN5-His with 652

GST or GST-TaEPBM1 was resolved by immunoblotting with α-His antibody (CWBIO, CW0286). For 653

the pull-down assays, at least three independent biological replicates were performed with similar 654

results. 655

Bimolecular Fluorescence Complementation (BiFC) Assay 656

For BiFC assays, coding regions of TaEPBM1, TaADA2, and TaGCN5 were amplified using primers 657

listed in Supplemental Table S1 and cloned into vectors pCAMBIA1300-YN and pCAMBIA1300-YC 658

via the pENTRY-TaEPBM1, pENTRY-TaADA2, and pENTRY-TaGCN5 constructs using GATEWAY 659

cloning technology to express protein fusions to the N-terminal or C-terminal domain of YFP, 660


https://www.fishersci.com/shop/products/ge-healthcare-glutathione-sepharose-4-ff-media-3/p-3676593

https://www.fishersci.com/shop/products/ge-healthcare-glutathione-sepharose-4-ff-media-3/p-3676593


18

respectively. Similarly, the TaADA2 coding region was amplified using primers listed in Supplemental 661

Table S1 and cloned into vectors pCAMBIA1300 to express TaADA2 alone. The BiFC assay was 662

performed as described by Liu et al (2019). The interaction was imaged using a confocal microscope 663

(Leica TCS SP5) at 48 hours post-Agro-infiltration. All BiFC images were collected on a Leica TCS SP5 664

confocal laser scanning system (Leica, Mannheim, Germany) connected to an inverted motorized 665

microscope with the following settings: pinhole 1 airy unit, scan speed 400 Hz bidirectional. DAPI and 666

YFP were excited with a 405 nm diode laser and a 514 nm argon laser, respectively. Fluorescence 667

emissions were collected using the following wavelengths: 420–480nm (for DAPI) and 529–540nm (for 668

YFP). Digital confocal images were analyzed using Adobe Photoshop (Version CS5) and adjusted with 669

ImageJ (Version 1.38) for the optimized intensity projection. At least three independent biological 670

replicates were performed for this BiFC assay. 671

Co-immunoprecipitation (Co-IP) Assay 672

For the Co-IP assay, wheat leaves with visible BSMV symptoms were collected at 3 weeks 673

post-inoculation with indicated BSMV virus, and wheat protoplasts were harvested at 48 hours 674

post-transfection with indicated constructs. The Co-IP assay was performed as described by Wang et al. 675

(2019). The nuclear extracts were treated with DNase I to remove the potential DNA-protein interaction 676

during the Co-IP. The epitope sequences SAFEYDRKPAVLAPD and SGHKTNRPMKLETDGS were 677

chosen and synthesized, coupled to keyhole limpet hemocyanin, and immunized mice to generate 678

antibodies against TaEPBM1 and TaADA2, respectively. The antibody specificities were analyzed by 679

Western-blot assay against total leaf protein isolated from indicated BSMV-VIGS plants (shown in 680

Supplemental Fig. S8). The antibodies α-HA (Millipore, 05-904), α-TaEPBM1, and α-TaADA2 were 681

employed for immunoprecipitation. The co-immunoprecipitation of TaEPBM1, TaADA2, and TaGCN5 682

was analyzed by immunoblot with antibodies α-HA (Millipore, 05-904), α-TaEPBM1, and α-TaADA2. 683

The ECL chemiluminescence kit (Pierce Biotechnology) was employed for the immunoblot 684

visualization. For the Co-IP assay, at least three independent biological replicates were perfomed with 685

similar results. 686

Luciferase Complementation Imaging (LCI) Assay 687

For LCI assay, coding regions of TaEPBM1, TaADA2, and TaGCN5 were amplified using primers 688

listed in Supplemental Table S1 and cloned into vectors pCAMBIA-nLUC and pCAMBIA-cLUC via the 689

pENTRY-TaEPBM1, pENTRY-TaADA2, pENTRY-TaGCN5 constructs using GATEWAY cloning 690

technology to express protein fusions to the N-terminal or C-terminal domain of firefly LUCIFERASE, 691

respectively. The LCI assay was performed as described by Kong and Chang (2018). The luminescent 692

signal was collected at 60 hours post-Agro-infiltration trough using a cooled CCD camera (iXon, 693

Andor Technology). At least three independent biological replicates were performed for this LCI assay. 694

Chromatin Immunoprecipitation (ChIP) Assay 695


http://www.piercenet.com/product/fast-western-blot-kits-pierce-ecl


19

For the ChIP assay, wheat leaves and protoplasts were harvested at the same time as for the Co-IP 696

assay. The ChIP assay was performed as described by Wang et al (2019). The antibodies α-HA 697

(Millipore, 05-904), α-TaEPBM1, α-TaADA2, α-histone H3 (Abcam, ab1791), α-H3K4ac (Millipore, 698

07-539), α-H3K9ac (Abcam, ab10812), α-H3K14ac (Abcam, ab46984), α-H3K27ac (Abcam, ab4729), 699

α-H4K5ac (Millipore, 07-327), and α-Pol II (Abcam, ab817) were employed for the 700

immunoprecipitation. DNA recovery after chromatin immunoprecipitation was quantified as the 701

percentage of input. For H3K4ac, H3K9ac, H3K14ac, and H3K27ac analysis, relative enrichments were 702

calculated by normalizing the histone H3 acetylation ChIP with histone H3 ChIP. For H4K5ac analysis, 703

relative enrichments were calculated by normalizing the histone H4 acetylation ChIP with histone H4 704

ChIP. The ChIP-qPCR was performed using qPCR Master Mix (Invitrogen) under the following 705

programs: 95°C for 3 min, 40 cycles at 95°C for 20 s, 55°C for 20 s, and 72°C for 15 s, followed by 72°C 706

for 1 min. For the ChIP assay, three biological replicates were statistically analyzed. 707

Characterization and Manipulation of Leaf Surface and Glass Slide 708

The cuticle hydrophobicity on the wheat leaf surface and glass slide was analyzed by measuring the 709

contact angle of 1 μL water droplets on the indicated surface. Angles from at least 50 water droplets were 710

separately measured for 5s using the contact angle system (SDP-300, Sindin) and five independent 711

surface samples were statistically analyzed using Student’s t-test. The cuticle wax on the wheat leaf 712

surface and glass slide were manipulated as described previously (Hansjakob et al., 2011, Wang et al., 713

2019). Briefly, wheat leaves were sprayed with cuticular wax extracts in chloroform at 480 μg mL-1 or 714

chloroform only (control). Histobond glass slides (Marienfeld) were coated with chloroform solution 715

containing 0.5% (w/v) Formvar resin (Applichem) and leaf cuticular wax extract (480 μg ml-1) or wax 716

chemical components (7×10-5 mol l-1). For this study, VLC aldehydes were synthesized from VLC 717

alcohols as previously described, and other wax chemical components were purchased from 718

Sigma-Aldrich. At least three independent biological replicates were performed with similar results. 719

Accession Numbers 720

Sequence data in this study can be found in the GenBank database using the following accession 721

numbers: AcECR, MT181952; AfECR, MT181953; AtECR, At3g55360; BdECR, MT181954; MpECR, 722

MT181955; OsECR, MT181956; PpECR, MT181957; PsECR, MT181958; ScECR, MT181959; SfECR, 723

MT181960; SlECR, MT181961; SmECR, MT181962; TaECR-A, MT180310; TaECR-B, MT180311; 724

TaECR-D, MT180312; TaEPBM1-A, MT211783; TaEPBM1-B, MT211784; TaEPBM1-D, MT211785; 725

TaADA2-A, MT180316; TaADA2-B, MT180317; TaADA2-D, MT180318; TaGCN5-A, MT180319; 726

TaGCN5-B, MT180320; and TaGCN5-D, MT180321. 727

728

Supplemental Data 729

The following supplemental materials are available. 730

Supplemental Figure S1 The nucleotide sequences, structures and encoding proteins of TaECR genes. 731

Supplemental Figure S2 Protein sequence alignment of TaECR with putative orthologs from 732

representative land plant lineages. 733



20

Supplemental Figure S3 Subcellular localization analysis of TaECR-HA in wheat cells by sucrose 734

density-gradient fractionation. 735

Supplemental Figure S4 RT-qPCR analysis of TaECR expression in the wheat leaves separately 736

infected with BSMV-γ and BSMV-TaECRas. 737

Supplemental Figure S5 Analysis of cuticle chemical composition and Bgt conidia germination on the 738

wheat leaves treated with mock control and BSMV-VIGS. 739

Supplemental Figure S6 The nucleotide sequences and encoding proteins of TaEPBM1 genes. 740

Supplemental Figure S7 EMSA analysis of TaEPBM1 binding to the MBS cis-element. 741

Supplemental Figure S8 Immunoblot analysis of wheat leaf protein using antibodies α-TaEPBM1 and 742

α-TaADA2. 743

Supplemental Figure S9 Nuclear run-on analysis of TaEF1 transcription and RT-qPCR analysis of 744

TaEF1 expression in the wheat leaves infected with BSMV-γ, BSMV-TaEPBM1as, BSMV-TaADA2as, 745

or BSMV-TaGCN5as. 746

Supplemental Figure S10 The nucleotide sequences and encoding proteins of TaADA2 genes. 747

Supplemental Figure S11 The nucleotide sequences and encoding proteins of TaGCN5 genes. 748

Supplemental Figure S12 RT-qPCR analysis of expression of TaGCN5, TaADA2, and TaEPBM1 in 749

wheat protoplasts and leaves. 750

Supplemental Figure S13 Statistical analysis of Bgt conidia germination on glass slides coated with 751

Formvar/cuticular wax (480 μg ml-1) with indicated contact angles. 752

Supplemental Table S1 Primers used in this study. 753

ACKNOWLEDGMENTS 754

We would like to thank the funding support from the National Natural Science Foundation of China 755

(31701412, 31701986), the Natural Science Foundation of Shandong Province (ZR2017BC109) and the 756

Qingdao Science and Technology Bureau Fund (17-1-1-50-jch, 18-2-2-51-jch). 757

758

FIGURE LEGENDS 759

Figure 1. Characterization of TaECR in bread wheat. A, Subcellular co-localization of TaECR-YFP with 760

Endoplasmic reticulum (ER) marker mCherry-HDEL in Nicotiana benthamiana leaves. YFP 761

fluorescence signal of TaECR-YFP merged with the mCherry signal of the ER marker. Bars= 10 μm. B, 762

Transcriptional profiles of TaECR in different wheat tissues. The relative transcript abundance of TaECR 763

was compared with that in roots. C, Quantification of total cutin monomer and wax per unit surface area 764

(μg cm-2) in the BSMV-γ and BSMV-TaECRas wheat leaves. D, Amount of major wax constituents per 765

unit surface area (μg cm-2) in the wheat leaves infected with BSMV-γ and BSMV-TaECRas. N. I., not 766

identified compound. E, Bgt germination on the BSMV-γ and BSMV-TaECRas wheat leaves. Black 767

arrows indicate successfully germinated conidia with a germ tube, and red arrow indicates the 768

non-germinated conidia without germ tube. Bars= 30 μm. F, Statistical analysis of Bgt conidia 769



21

germination on the wheat leaves infected with BSMV-γ or BSMV-TaECRas. More than 10 770

BSMV-VIGS plants were employed for inoculation of Bgt conidia and at least 500 Bgt conidia were 771

analyzed for each experiment. For B, C, D, and F, three biological replicates were statistically analyzed 772

for each treatment, and data are presented as the mean±SE (Student’s t-test; ** P<0.01). 773

774

Figure 2. Transcription factor TaEPBM1 binds to TaECR promoters. A, TaEPBM1 binds to TaECR 775

promoters in yeast. Yeast cells were co-transformed with a bait vector, harboring a wild type or mutated 776

TaECR promoter fragment (labeled as pro and mpro) fused to the pHIS2 reporter, and a prey vector, 777

containing TaEPBM1 fused to a GAL4 activation domain, and were then grown on SD-Trp-Leu-His 778

plate with 15% (w/v) 3-AT to test for HIS2 expression. Optical density (OD) of diluted culture for each 779

spot is shown at the top of the panel. B, Schematic diagram of the reporter constructs harboring a 780

wild-type or mutated TaECR promoter fragment (labeled as pro and mpro) fused to the 5xGAL4 781

upstream activating sequences (UAS) and the reporter gene firefly LUCIFERASE (LUC). C, 782

Transactivation of TaECR by TaEPBM1 in wheat protoplast. Indicated pairs of effectors and LUC 783

reporters were transfected into the wheat protoplasts, and the LUC activity was measured and expressed 784

as a ration of LUC activity normalized to that obtained from protoplasts expressing DBD effectors. D, 785

Schematic diagram of TaECR promoter structures. MBS cis-element is shown as a blue box, and 786

promoter regions subjected to ChIP-qPCR analysis are labeled with numbers. Black triangle indicates 787

the start point of coding region of TaECR gene. E, ChIP-qPCR analysis of TaEPBM1 enrichment at 788

TaECR promoters in the wheat leaves infected with BSMV-γ or BSMV-TaEPBM1as. Antibody 789

α-TaEPBM1 was used for immunoprecipitation. Nuclear run-on analysis of TaECR transcription (F) and 790

RT-qPCR analysis of TaECR expression (G) in the wheat leaves infected with BSMV-γ and 791

BSMV-TaEPBM1as. For C, E, F, and G, three biological replicates were statistically analyzed for each 792

treatment, and data are presented as the mean±SE (Student’s t-test; ** P<0.01). (t-test; ** P<0.01). 793

794

Figure 3. TaEPBM1 directly interacts with TaADA2 in vitro and in vivo. A, Yeast two-hybrid analysis 795

of the interaction between TaEPBM1 and TaADA2. Different fragments of TaEPBM1 and TaADA2 796

were fused with AD and LexA vectors and cotransformed into the yeast cells. TaEPBM1 NT and CT 797

represent the N-terminal region (1-120) and C-terminal region (121-314) of TaEPBM1, whereas 798

TaADA2 NT and CT indicate the N-terminal region (1-244) and C-terminal region (245-568) of 799

TaADA2. The transformants were grown on the SD-Ura-Trp-Leu-His plate with X-gal to test for 800

expression of LEU2 and LacZ. B, GST pull-down analysis of the interaction of TaEPBM1 and TaADA2. 801

GST-TaEPBM1 or GST protein bound on GST affinity resins was incubated with TaADA2-His and 802

TaGCN5-His, and the bound protein was then detected by immunoblotting using an anti-His antibody. C, 803

BiFC analysis of the interaction between TaEPBM1 and TaADA2 in N. benthamiana leaves. The nuclei 804

were revealed by DAPI staining. The YFP fluorescence signals were detected 40 hours 805

post-Agro-infiltration. Bars= 100 μm. D, Co-IP analysis of the interaction of TaEPBM1 and TaADA2. 806

Nuclear protein was extracted from wheat leaves infected with indicated BSMV-γ, BSMV-TaEPBM1as, 807

BSMV-TaADA2as, or BSMV-TaEPBM1/TaADA2as. Antibodies α-TaEPBM1 and α-TaADA2 were 808

used for immunoprecipitation and Western-blot assays. 809

Figure 4. TaGCN5-TaADA2 complex interacts with TaEPBM1. A, Yeast two-hybrid analysis of the 810

interaction among TaGCN5, TaADA2, and TaEPBM1. The yeast transformants were grown on the 811



22

SD-Ura-Trp-Leu-His medium with X-gal to test for interaction analysis. B, LCI analysis of the 812

interaction among TaGCN5, TaADA2, and TaEPBM1 in N. benthamiana leaves. Bars= 1 cm. C, BiFC 813

analysis of the interaction among TaGCN5, TaADA2, and TaEPBM1 in N. benthamiana leaves. The 814

nuclei were revealed by DAPI staining. The YFP fluorescence signals were detected 40 hours 815

post-Agro-infiltration. Bars= 100 μm. D, Co-IP analysis of the interaction among TaGCN5, TaADA2, 816

and TaEPBM1 in wheat cells. Nuclear protein was extracted from wheat protoplasts transfected with 817

indicated vectors. Antibodies α-HA, α-TaADA2, and α-TaEPBM1 were used for immunoprecipitation 818

and Western-blot assays. 819

Figure 5. Distribution of TaGCN5-HA, TaADA2, and TaEPBM1 on TaECR promoters in wild-type and 820

TaEPBM1-, TaADA2 or TaGCN5-silenced wheat cells. The distribution of TaGCN5-HA (upper panel), 821

TaADA2 (middle panel) and TaEPBM1 (lower panel) on TaECR promoters in wheat protoplasts were 822

analyzed by ChIP-qPCR. Wheat protoplasts were cotransfected with construct TaGCN5-HA together 823

with RNAi-EV (dark), RNAi-TaEPBM1as (grey), RNAi-TaADA2as (light grey) or RNAi-TaGCN5as 824

(white). Antibodies α-HA, α-TaADA2, and α-TaEPBM1 were used for immunoprecipitation. Three 825

independent biological replicates per treatment were statistically analyzed, and data are presented as the 826

mean±SE (Student’s t-test; ** P<0.01). 827

828

Figure 6. Characterization of histone acetylation, RNA polymerase II occupancy and gene transcription 829

at TaECR loci in wild-type and TaEPBM1-, TaADA2- or TaGCN5-silenced wheat leaves. A, ChIP-qPCR 830

analysis of abundance of H3K4ac, H3K9ac, H3K14ac, H3K27ac, and H4K5ac on TaECR promoters in 831

the wheat leaves infected with BSMV-γ (dark), BSMV-TaEPBM1as (dark grey), BSMV-TaADA2as 832

(grey), BSMV-TaGCN5as (light grey) or BSMV-TaEPBM1as + BSMV-TaADA2as + 833

BSMV-TaGCN5as + BSMV-TaECRas (white). Antibodies α-H3K4ac, α-H3K9ac, α-H3K14ac, 834

α-H3K27ac, α-H4K5ac were used for immunoprecipitation. Fragments for ChIP-qPCR analysis were 835

shown in Figure 2D. B, Schematic diagram of the TaECR gene structure. Fragments subjected to 836

ChIP-qPCR analysis are labeled with numbers. Black triangle indicates the start point of coding region 837

of TaECR gene. C, ChIP-qPCR analysis of RNA Pol II abundance on promoters and coding regions of 838

TaECR genes in the BSMV-γ (dark), BSMV-TaEPBM1as (dark grey), BSMV-TaADA2as (grey), 839

BSMV-TaGCN5as (light grey) or BSMV-TaEPBM1as + BSMV-TaADA2as + BSMV-TaGCN5as + 840

BSMV-TaECRas (white) wheat leaves. Nuclear run-on analysis of TaECR transcription rates (D) and 841

RT-qPCR analysis of TaECR expression levels (E) in the wheat leaves infected with BSMV-γ, 842

BSMV-TaEPBM1as, BSMV-TaADA2as, BSMV-TaGCN5as or BSMV-TaEPBM1as + 843

BSMV-TaADA2as + BSMV-TaGCN5as + BSMV-TaECRas. For A, C, D, and E, three independent 844

biological replicates per treatment were statistically analyzed, and data are presented as the mean±SE 845

(Student’s t-test; ** P<0.01). 846

847

Figure 7. Characterization of cuticle chemical composition and Bgt conidia germination on wild-type 848

and TaEPBM1-, TaADA2- or TaGCN5-silenced wheat leaves. A, Quantification of total cuticular wax 849

per unit surface area (μg cm-2) in the wheat leaves infected with BSMV-γ (grey), BSMV-TaEPBM1as 850

(blue), BSMV-TaADA2as (green), BSMV-TaGCN5as (orange) or BSMV-TaEPBM1as + 851

BSMV-TaADA2as + BSMV-TaGCN5as (yellow). B, Amount of major wax constituents per unit surface 852

area (μg cm-2) in the BSMV-γ (grey), BSMV-TaEPBM1as (blue), BSMV-TaADA2as (green), 853



23

BSMV-TaGCN5as (orange) or BSMV-TaEPBM1as + BSMV-TaADA2as + BSMV-TaGCN5as (yellow) 854

infected wheat leaves. N. I., not identified compound. C, Bgt germination on the wheat leaves infected 855

with BSMV-γ, BSMV-TaEPBM1as, BSMV-TaADA2as, BSMV-TaGCN5as or BSMV-TaEPBM1as + 856

BSMV-TaADA2as + BSMV-TaGCN5as. Black arrows indicate successfully germinated conidia with a 857

germ tube, and red arrows indicate the non-germinated conidia without germ tube. Bars= 30 μm. D, 858

Statistical analysis of Bgt conidia germination on the BSMV-γ (dark grey), BSMV-TaEPBM1as (dark 859

blue), BSMV-TaADA2as (dark green), BSMV-TaGCN5as (dark orange) or BSMV-TaEPBM1as + 860

BSMV-TaADA2as + BSMV-TaGCN5as (dark yellow) infected wheat leaves. More than 10 861

BSMV-VIGS plants were employed for inoculation of Bgt conidia and at least 500 Bgt conidia were 862

analyzed for each experiment. For A, B, and D, three biological replicates were statistically analyzed for 863

each treatment, and data are presented as the mean±SE (Student’s t-test; ** P<0.01). 864

865

Figure 8. Characterization of Bgt conidia germination on TaECR-, TaEPBM1-, TaADA2 or 866

TaGCN5-silenced wheat leaves or glass slides coated with Formvar/wheat leaf wax. A, Statistical 867

analysis of Bgt conidia germination on wheat leaves infected with BSMV-γ (dark grey), 868

BSMV-TaECRas (dark blue), BSMV-TaEPBM1as (dark green), BSMV-TaADA2 (dark orange) or 869

BSMV-TaGCN5as (dark yellow). Wheat leaves with indicated contact angles were sprayed with 870

cuticular wax extracted in chloroform from indicated wheat leaves, or with chloroform only (control 871

treatment). B, Statistical analysis of Bgt conidia germination on glass slides coated with 872

Formvar/cuticular wax (480 μg ml-1) and pure waxes (7×10-5 mol l-1), or with Formvar/cuticular wax 873

(480 μg ml-1) only (control treatment). For A and B, more than 500 Bgt conidia were analyzed in one 874

experiment, and three biological replicates were statistically analyzed for each treatment, and data are 875

presented as the mean±SE (Student’s t-test; ** P<0.01). 876

877

Figure 9. Proposed model for the regulation of wheat cuticular wax biosynthesis and Bgt conidia 878

germination by the TaECR-TaEPBM1-TaADA2-TaGCN5 circuit. Transcription factor TaEPBM1 879

recognizes the MBS cis-element and directly targets TaECR, an essential gene in cuticular wax 880

biosynthesis, and then recruits the TaADA2-TaGCN5 transcriptional activator complex to TaECR 881

promoters, which potentiates histone acetylation such as H3K4ac, H3K9ac, H3K14ac, H3K27ac, and 882

H4K5ac, as well as enhances occupancy of RNA polymerase II at TaECR genes. Consequently, the 883

cuticular wax biosynthesis is stimulated, leading to the accumulation of VLC aldehydes and thereby 884

triggering the germination of Bgt conidia. 885

886

LITERATURE CITED 887

Aharoni A, Dixit S, Jetter R, Thoenes E, van Arkel G, Pereira A (2004) The SHINE clade of AP2 888

domain transcription factors activates wax biosynthesis, alters cuticle properties, and confers drought 889

tolerance when overexpressed in Arabidopsis. Plant Cell 16: 2463-2480 890

Aragón W, Reina-Pinto JJ, Serrano M (2017) The intimate talk between plants and microorganisms at 891

the leaf surface. J Exp Bot 68: 5339-5350 892

Aarts MG, Keijzer CJ, Stiekema WJ, Pereira A (1995) Molecular characterization of the CER1 gene 893

of Arabidopsis involved in epicuticular wax biosynthesis and pollen fertility. Plant Cell 7: 2115-2127 894



24

Avato P, Bianchi G, Nayak A, Salamini F, Gentinetta E (1987) Epicuticular waxes of maize as 895

affected by the interaction of mutant gl8 with gl3, gl4 and gl15. Lipids 22:11-16 896

Bach L, Michaelson LV, Haslam R, Bellec Y, Gissot L, Marion J, Da Costa M, Boutin JP, Miquel 897

M, Tellier F, et al (2008) The very-long-chain hydroxy fatty acyl-CoA dehydratase PASTICCINO2 is 898

essential and limiting for plant development. Proc Natl Acad Sci U S A 105: 14727-14731 899

Beaudoin F, Wu X, Li F, Haslam RP, Markham JE, Zheng H, Napier JA, Kunst L (2009) 900

Functional characterization of the Arabidopsis β-ketoacyl-coenzyme a reductase candidates of the fatty 901

acid elongase. Plant Physiol 150: 1174-1191 902

Bernard A, Domergue F, Pascal S, Jetter R, Renne C, Faure JD, Haslam RP, Napier JA, Lessire 903

R, Joubes J (2012) Reconstitution of plant alkane biosynthesis in yeast demonstrates that Arabidopsis 904

ECERIFERUM1 and ECERIFERUM3 are core components of a very-long-chain alkane synthesis 905

complex. Plant Cell 24: 3106-3118 906

Bi H, Shi J, Kovalchuk N, Luang S, Bazanova N, Chirkova L, Zhang D, Shavrukov Y, Stepanenko 907

A, Tricker P (2018) Overexpression of the TaSHN1 transcription factor in bread wheat leads to leaf 908

surface modifications, improved drought tolerance, and no yield penalty under controlled growth 909

conditions. Plant Cell Environ 41: 2549-2566 910

Bourdenx B, Bernard A, Domergue F, Pascal S, Léger A, Roby D, Pervent M, Vile D, Haslam RP, 911

Napier JA, et al (2011) Overexpression of Arabidopsis ECERIFERUM1 promotes wax very-long-chain 912

alkane biosynthesis and influences plant response to biotic and abiotic stresses. Plant Physiol 156: 29-45 913

Castroverde CDM (2019) The AREB1-ADA2b-GCN5 complex regulates gene expression during 914

drought stress. Plant Cell 31: 559-560 915

Chen YF, Randlett MD, Findell JL, Schaller GE (2002) Localization of the ethylene receptor ETR1 to 916

the endoplasmic reticulum of Arabidopsis. J Biol Chem 277: 19861-19866 917

Chen X, Goodwin SM, Boroff VL, Liu X, Jenks MA (2003) Cloning and characterization of the 918

WAX2 gene of Arabidopsis involved in cuticle membrane and wax production. Plant Cell 15:1170-1185 919

Daniel JA, Torok MS, Sun ZW, Schieltz D, Allis CD, Yates JR, Grant PA (2004) Deubiquitination 920

of histone H2B by a yeast acetyltransferase complex regulates transcription. J Biol Chem 279: 921

1867-1871 922

Ding Y, Fromm M, Avramova Z (2012) Multiple exposures to drought 'train' transcriptional responses 923

in Arabidopsis. Nat Commun 3: 740 924

Domínguez E, Heredia-Guerrero JA, Heredia A (2017) The plant cuticle: old challenges, new 925

perspectives. J Exp Bot 68: 5251-5255 926

Fernández V, Guzmán-Delgado P, Graça J, Santos S, Gil L (2016) Cuticle structure in relation to 927

chemical composition: re-assessing the prevailing model. Front Plant Sci 7: 427 928



25

Fiebig A, Mayfield JA, Miley NL, Chau S, Fischer RL, Preuss D (2000) Alterations in CER6, a gene 929

identical to CUT1, differentially affect long-chain lipid content on the surface of pollen and stems. Plant 930

Cell 12: 2001-2008 931

Go YS, Kim H, Kim HJ, Suh MC (2014) Arabidopsis cuticular wax biosynthesis is negatively 932

regulated by the DEWAX gene encoding an AP2/ERF-type transcription factor. Plant Cell 933

26:1666-1680 934

Grant PA, Duggan L, Côté J, Roberts SM, Brownell JE, Candau R, Ohba R, Owen-Hughes T, 935

Allis CD, Winston F, Berger SL, Workman JL (1997) Yeast Gcn5 functions in two multisubunit 936

complexes to acetylate nucleosomal histones: characterization of an Ada complex and the SAGA 937

(Spt/Ada) complex. Genes Dev 11: 1640-1650 938

Greer S, Wen M, Bird D, Wu X, Samuels L, Kunst L, Jetter R (2007) The cytochrome P450 enzyme 939

CYP96A15 is the midchain alkane hydroxylase responsible for formation of secondary alcohols and 940

ketones in stem cuticular wax of Arabidopsis. Plant Physiol 145: 653-667 941

Hansjakob A, Bischof S, Bringmann G, Riederer M, Hildebrandt U (2010) Very-long-chain 942

aldehydes promote in vitro prepenetration processes of Blumeria graminis in a dose- and chain length- 943

dependent manner. New Phytol 188: 1039-1054 944

Hansjakob A, Riederer M, Hildebrandt U (2011) Wax matters: absence of very-long-chain aldehydes 945

from the leaf cuticular wax of the glossy11 mutant of maize compromises the prepenetration processes of 946

Blumeria graminis. Plant Pathol 60: 1151-1161 947

Haslam TM, Haslam R, Thoraval D, Pascal S, Delude C, Domergue F, Fernández AM, Beaudoin 948

F, Napier JA, Kunst L, et al (2015) ECERIFERUM2-LIKE proteins have unique biochemical and 949

physiological functions in very-long-chain fatty acid elongation. Plant Physiol 167: 682-692 950

Haslam TM, Kunst L (2013) Extending the story of very-long-chain fatty acid elongation. Plant Sci 951

210: 93-107 952

Haslam TM, Mañas-Fernández A, Zhao L, Kunst L (2012) Arabidopsis ECERIFERUM2 is a 953

component of the fatty acid elongation machinery required for fatty acid extension to exceptional 954

lengths. Plant Physiol 160: 1164-1174 955

He H, Zhu S, Zhao R, Jiang Z, Ji Y, Ji J, Qiu D, Li H, Bie T (2018) Pm21, encoding a typical 956

CC-NBS-LRR protein, confers broad-spectrum resistance to wheat powdery mildew disease. Mol Plant 957

11: 879-882 958

Hooker TS, Millar AA, Kunst L (2002) Significance of the expression of the CER6 condensing 959

enzyme for cuticular wax production in Arabidopsis. Plant Physiol 129:1568-1580 960

International Wheat Genome Sequencing Consortium (2018) Shifting the limits in wheat research 961

and breeding using a fully annotated reference genome. Science 361: eaar7191 962

Jenuwein T, Allis CD (2001) Translating the histone code. Science 293: 1074-1080 963



26

Kim J, Jung JH, Lee SB, Go YS, Kim HJ, Cahoon R, Markham JE, Cahoon EB, Suh MC (2013) 964

Arabidopsis 3-ketoacylcoenzyme A synthase 9 is involved in the synthesis of tetracosanoic acids as 965

precursors of cuticular waxes, suberins, sphingolipids, and phospholipids. Plant Physiol 162:567-580 966

Kohlwein SD, Eder S, Oh CS, Martin CE, Gable K, Bacikova D, Dunn T (2001) Tsc13p is required 967

for fatty acid elongation and localizes to a novel structure at the nuclear-vacuolar interface in 968

Saccharomyces cerevisiae. Mol Cell Biol 21:109-125 969

Koller T, Brunner S, Herren G, Hurni S, Keller B (2018) Pyramiding of transgenic Pm3 alleles in 970

wheat results in improved powdery mildew resistance in the field. Theor Appl Genet 131: 861-871 971

Kong LY, Chang C (2018) Suppression of wheat TaCDK8/TaWIN1 interaction negatively affects 972

germination of Blumeria graminis f.sp. tritici by interfering with very-long-chain aldehyde 973

biosynthesis. Plant Mol Biol 96: 165-178 974

Kurdistani SK, Grunstein M (2003) Histone acetylation and deacetylation in yeast. Nat Rev Mol Cell 975

Biol 4: 276-284 976

Lee SB, Jung SJ, Go YS, Kim HU, Kim JK, Cho HJ, Park OK, Suh MC (2009) Two Arabidopsis 977

3-ketoacyl CoA synthase genes, KCS20 and KCS2/DAISY, are functionally redundant in cuticular wax 978

and root suberin biosynthesis, but differentially controlled by osmotic stress. Plant J 60: 462-475 979

Lee SB, Kim HU, Suh MC (2016) MYB94 and MYB96 additively activate cuticular wax biosynthesis 980

in Arabidopsis. Plant Cell Physiol 57: 2300-2311 981

Lee SB, Suh MC (2013). Recent advances in cuticular wax biosynthesis and its regulation in 982

Arabidopsis. Mol Plant 6: 246-249 983

Lee SB, Suh MC (2014) Cuticular wax biosynthesis is up-regulated by the MYB94 transcription factor 984

in Arabidopsis. Plant Cell Physiol 56:48-60 985

Lee SB, Suh MC (2015a) Advances in the understanding of cuticular waxes in Arabidopsis thaliana and 986

crop species. Plant Cell Rep 34: 557-572 987

Lee SB, Suh MC (2015b) Cuticular wax biosynthesis is up-regulated by the MYB94 transcription factor 988

in Arabidopsis. Plant Cell Physiol 56: 48-60 989

Li C, Haslam TM, Krüger A, Schneider LM, Mishina K, Samuels L, Yang H, Kunst L, Schaffrath 990

U, Nawrath C, et al (2018) The β-Ketoacyl-CoA synthase HvKCS1, encoded by Cer-zh, plays a key 991

role in synthesis of barley leaf wax and germination of barley powdery mildew. Plant Cell Physiol 59: 992

806-822 993

Li S, Lin YJ, Wang P, Zhang B, Li M, Chen S, Shi R, Tunlaya-Anukit S, Liu X, Wang Z, Dai X, Yu 994

J, et al (2018). Histone acetylation cooperating with AREB1 transcription factor regulates drought 995

response and tolerance in Populus trichocarpa. Plant Cell 31: 663-686 996

Liu J, Zhi P, Wang X, Fan Q, Chang C (2019) Wheat WD40-repeat protein TaHOS15 functions in a 997

histone deacetylase complex to fine-tune defense response to Blumeria graminis f.sp. tritici. J Exp Bot 998

70: 255-268 999



27

Liu S, Yeh C-T, Tang HM, Nettleton D, Schnable PS (2012) Gene mapping via bulked segregant 1000

RNA-Seq (BSR-Seq). PLOS One 7: e36406 1001

Lu S, Song T, Kosma DK, Parsons EP, Rowland O, Jenks MA (2009) Arabidopsis CER8 encodes 1002

LONGCHAIN ACYL-COA SYNTHETASE 1 (LACS1) that has overlapping functions with LACS2 in 1003

plant wax and cutin synthesis. Plant J 59: 553-564 1004

Mao Y, Pavangadkar KA, Thomashow MF, Triezenberg SJ (2006) Physical and functional 1005

interactions of Arabidopsis ADA2 transcriptional coactivator proteins with the acetyltransferase GCN5 1006

and with the cold-induced transcription factor CBF1. Biochim Biophys Acta 1759: 69-79 1007

Martin LB, Rose JK (2014) There's more than one way to skin a fruit: formation and functions of fruit 1008

cuticles. J Exp Bot 65: 4639-4651 1009

Millar AA, Clemens S, Zachgo S, Giblin EM, Taylor DC, Kunst L (1999) CUT1, an Arabidopsis 1010

gene required for cuticular wax biosynthesis and pollen fertility, encodes a very-long-chain fatty acid 1011

condensing enzyme. Plant Cell 11: 825-838 1012

Moraga F, Aquea F (2015) Composition of the SAGA complex in plants and its role in controlling gene 1013

expression in response to abiotic stresses. Front Plant Sci 6: 865 1014

Nawrath C (2006) Unraveling the complex network of cuticular structure and function. Curr Opin Plant 1015

Biol 9: 281-287 1016

Nielsen KA, Nicholson RL, Carver TLW, Kunoh H, Oliver RP (2000) First touch: An immediate 1017

response to surface recognition in conidia of Blumeria graminis. Physiol Mol Plant P 56: 63-70 1018

Oshima Y, Shikata M, Koyama T, Ohtsubo N, Mitsuda N, Ohme-Takagi M (2013) MIXTA-like 1019

transcription factors and WAX INDUCER1/SHINE1 coordinately regulate cuticle development in 1020

Arabidopsis and Torenia fournieri. Plant Cell 25: 1609-1624 1021

Pascal S, Bernard A, Deslous P, Gronnier J, Fournier-Goss A, Domergue F, Rowland O, Joubès J 1022

(2019) Arabidopsis CER1-LIKE1 functions in a cuticular very-long-chain alkane-forming complex. 1023

Plant Physiol 179: 415-432 1024

Raffaele S, Vailleau F, Léger A, Joubès J, Miersch O, Huard C, Blée E, Mongrand S, Domergue F, 1025

Roby D (2008) A MYB transcription factor regulates very-long-chain fatty acid biosynthesis for 1026

activation of the hypersensitive cell death response in Arabidopsis. Plant Cell 20: 752-767 1027

Rowland O, Zheng H, Hepworth SR, Lam P, Jetter R, Kunst L (2006) CER4 encodes an 1028

alcohol-forming fatty acyl-coenzyme A reductase involved in cuticular wax production in Arabidopsis. 1029

Plant Physiol 142: 866-877 1030

Rowland O, Lee R, Franke R, Schreiber L, Kunst L (2007) The CER3 wax biosynthetic gene from 1031

Arabidopsis thaliana is allelic to WAX2/YRE/FLP1. FEBS Lett 581: 3538-3544 1032

Sajeevan RS, Nataraja KN, Shivashankara KS, Pallavi N, Gurumurthy DS, Shivanna MB (2017) 1033

Expression of Arabidopsis SHN1 in Indian mulberry (Morus indica L.) increases leaf surface wax 1034

content and reduces post-harvest water loss. Front Plant Sci 8: 418 1035



28

Samuels L, Kunst L, Jetter R (2008) Sealing plant surfaces: cuticular wax formation by epidermal 1036

cells. Annu Rev Plant Biol 59: 683-707 1037

Schmitz RJ, Tamada Y, Doyle MR, Zhang X, Amasino RM (2009) Histone H2B deubiquitination is 1038

required for transcriptional activation of FLOWERING LOCUS C and for proper control of flowering in 1039

Arabidopsis. Plant Physiol 149:1196-1204 1040

Schnurr J, Shockey J, Browse J (2004) The acyl-CoA synthetase encoded by LACS2 is essential for 1041

normal cuticle development in Arabidopsis. Plant Cell 16: 629-642 1042

Seo PJ, Lee SB, Suh MC, Park MJ, Go YS, Park CM (2011) The MYB96 transcription factor 1043

regulates cuticular wax biosynthesis under drought conditions in Arabidopsis. Plant Cell 23: 1138- 1152 1044

Serrano M, Coluccia F, Torres M, L’Haridon F, Métraux JP (2014) The cuticle and plant defense to 1045

pathogens. Front Plant Sci 5: 274 1046

Strahl BD, Allis CD (2000) The language of covalent histone modifications. Nature 403: 41-45 1047

Todd J, Post-Beittenmiller D, Jaworski JG (1999) KCS1 encodes a fatty acid elongase 1048

3-ketoacyl-CoA synthase affecting wax biosynthesis in Arabidopsis thaliana. Plant J 17: 119-130 1049

Uppalapati SR, Ishiga Y, Doraiswamy V, Bedair M, Mittal S, Chen J, Nakashima J, Tang Y, 1050

Tadege M, Ratet P, et al (2012) Loss of abaxial leaf epicuticular wax in Medicago truncatula 1051

irg1/palm1 mutants results in reduced spore differentiation of anthracnose and nonhost rust pathogens. 1052

Plant Cell 24: 353-370 1053

Wang L, Dent SY (2014) Functions of SAGA in development and disease. Epigenomics 6: 329-339 1054

Wang X, Zhi P, Fan Q, Zhang M, Chang C (2019) Wheat CHD3 protein TaCHR729 regulates the 1055

cuticular wax biosynthesis required for stimulating germination of Blumeria graminis f.sp. tritici. J Exp 1056

Bot 70: 701-713 1057

Wang Y, Wan L, Zhang L, Zhang Z, Zhang H, Quan R, Zhou S, Huang R (2012) An ethylene 1058

response factor OsWR1 responsive to drought stress transcriptionally activates wax synthesis related 1059

genes and increases wax production in rice. Plant Mol Biol 78: 275-288 1060

Weake VM, Workman JL (2012) SAGA function in tissues pecific gene expression. Trends Cell Biol. 1061

22: 177-184 1062

Weak VM, Lee KK, Guelman S, Lin CH, Seidel C, Abmayr SM, Workman JL (2008) 1063

SAGA-mediated H2B deubiquitination controls the development of neuronal connectivity in the 1064

Drosophila visual system. EMBO J 27: 394-405 1065

Weidenbach D, Jansen M, Franke RB, Hensel G, Weissgerber W, Ulferts S, Jansen I, Schreiber L, 1066

Korzun V, Pontzen R et al (2014) Evolutionary conserved function of barley and Arabidopsis 1067

3-KETOACYL-CoA SYNTHASES in providing wax signals for germination of powdery mildew fungi. 1068

Plant Physiol 166: 1621-1633 1069

Weng H, Molina I, Shockey J, Browse J (2010) Organ fusion and defective cuticle function in a lacs1 1070

lacs2 double mutant of Arabidopsis. Planta 231: 1089-1100 1071



29

Wright AJ, Thomas BJ, Carver TLW (2002) Early adhesion of Blumeria graminis to plant and 1072

artificial surfaces demonstrated by centrifugation. Physiol Mol Plant P 61: 217-226 1073

Xia Y, Nikolau BJ, Schnable PS (1996) Cloning and characterization of CER2, an Arabidopsis gene 1074

that affects cuticular wax accumulation. Plant Cell 8:1291-1304 1075

Xing L, Hu P, Liu J, Witek K, Zhou S, Xu J, Zhou W, Gao L, Huang Z, Zhang R, et al (2018) Pm21 1076

from Haynaldia villosa encodes a CC-NBS-LRR protein conferring powdery mildew resistance in 1077

wheat. Mol Plant 11: 874-878 1078

Yang X, Zhao H, Kosma DK, Tomasi P, Dyer JM, Li R, Liu X, Wang Z, Parsons EP, Jenks MA, et 1079

al (2017) The acyl desaturase CER17 is involved in producing wax unsaturated primary alcohols and 1080

cutin monomers. Plant Physiol 173: 1109-1124 1081

Yeats TH, Rose JK (2013) The formation and function of plant cuticles. Plant Physiol 163: 5-20 1082

Yuan C, Li C, Yan L, Jackson AO, Liu Z, Han C, Yu J, Li D (2011) A high throughput barley stripe 1083

mosaic virus vector for virus induced gene silencing in monocots and dicots. PLOS One 6: e26468. 1084

Zhang JC, Zheng HY, Li YW, Li HJ, Liu X, Qin HJ, Dong LL, Wang DW (2016) Coexpression 1085

network analysis of the genes regulated by two types of resistance responses to powdery mildew in 1086

wheat. Sci Rep 6: 23805 1087

Zheng H, Dong L, Han X, Jin H, Yin C, Han Y, Li B, Qin H, Zhang JS, Shen Q, et al (2020) The 1088

TuMYB46L-TuACO3 module regulates ethylene biosynthesis in einkorn wheat defense to powdery 1089

mildew. New Phytol 225: 2526-2541 1090

Zheng H, Rowland O, Kunst L (2005) Disruptions of the Arabidopsis Enoyl-CoA reductase gene 1091

reveal an essential role for very-long-chain fatty acid synthesis in cell expansion during plant 1092

morphogenesis. Plant Cell 17: 1467-1481 1093

Zhou S, Jiang W, Long F, Cheng S, Yang W, Zhao Y, Zhou DX (2017) Rice homeodomain protein 1094

WOX11 recruits a histone acetyltransferase complex to establish programs of cell proliferation of crown 1095

root meristem. Plant Cell 29: 1088-1104 1096

Zhu L, Guo J, Zhu J, Zhou C (2014) Enhanced expression of EsWAX1improves drought tolerance 1097

with increased accumulation of cuticular wax and ascorbic acid in transgenic Arabidopsis. Plant Physiol 1098

Biochem 75: 24-35 1099

Zhu YF, Li YB, Fei F, Wang ZK, Wang W, Cao AZ, Liu Y, Han S, Xing LP, Wang HY, et al (2015) 1100

An E3 ubiquitin ligase gene CMPG1-V from Haynaldia villosa L. contributes to the powdery mildew 1101

resistance in common wheat (Triticum aestivum L.). Plant J 84: 154-168 1102

Zou S, Wang H, Li Y, Kong Z, Tang D (2018) The NB-LRR gene Pm60 confers powdery mildew 1103

resistance in wheat. New Phytol 218: 298-309 1104

Ziv C, Zhao Z, Gao YG, Xia Y (2018) Multifunctional roles of plant cuticle during plant-pathogen 1105

interactions. Front Plant Sci 9: 1088 1106





















Parsed CitationsAharoni A, Dixit S, Jetter R, Thoenes E, van Arkel G, Pereira A (2004) The SHINE clade of AP2 domain transcription factors activateswax biosynthesis, alters cuticle properties, and confers drought tolerance when overexpressed in Arabidopsis. Plant Cell 16: 2463-2480

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Aragón W, Reina-Pinto JJ, Serrano M (2017) The intimate talk between plants and microorganisms at the leaf surface. J Exp Bot 68:5339-5350


Aarts MG, Keijzer CJ, Stiekema WJ, Pereira A (1995) Molecular characterization of the CER1 gene of Arabidopsis involved inepicuticular wax biosynthesis and pollen fertility. Plant Cell 7: 2115-2127


Avato P, Bianchi G, Nayak A, Salamini F, Gentinetta E (1987) Epicuticular waxes of maize as affected by the interaction of mutant gl8with gl3, gl4 and gl15. Lipids 22:11-16


Bach L, Michaelson LV, Haslam R, Bellec Y, Gissot L, Marion J, Da Costa M, Boutin JP, Miquel M, Tellier F, et al (2008) The very-long-chain hydroxy fatty acyl-CoA dehydratase PASTICCINO2 is essential and limiting for plant development. Proc Natl Acad Sci U S A 105:14727-14731


Beaudoin F, Wu X, Li F, Haslam RP, Markham JE, Zheng H, Napier JA, Kunst L (2009) Functional characterization of the Arabidopsis β-ketoacyl-coenzyme a reductase candidates of the fatty acid elongase. Plant Physiol 150: 1174-1191


Bernard A, Domergue F, Pascal S, Jetter R, Renne C, Faure JD, Haslam RP, Napier JA, Lessire R, Joubes J (2012) Reconstitution ofplant alkane biosynthesis in yeast demonstrates that Arabidopsis ECERIFERUM1 and ECERIFERUM3 are core components of a very-long-chain alkane synthesis complex. Plant Cell 24: 3106-3118


Bi H, Shi J, Kovalchuk N, Luang S, Bazanova N, Chirkova L, Zhang D, Shavrukov Y, Stepanenko A, Tricker P (2018) Overexpression ofthe TaSHN1 transcription factor in bread wheat leads to leaf surface modifications, improved drought tolerance, and no yield penaltyunder controlled growth conditions. Plant Cell Environ 41: 2549-2566


Bourdenx B, Bernard A, Domergue F, Pascal S, Léger A, Roby D, Pervent M, Vile D, Haslam RP, Napier JA, et al (2011) Overexpressionof Arabidopsis ECERIFERUM1 promotes wax very-long-chain alkane biosynthesis and influences plant response to biotic and abioticstresses. Plant Physiol 156: 29-45


Castroverde CDM (2019) The AREB1-ADA2b-GCN5 complex regulates gene expression during drought stress. Plant Cell 31: 559-560Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Chen YF, Randlett MD, Findell JL, Schaller GE (2002) Localization of the ethylene receptor ETR1 to the endoplasmic reticulum ofArabidopsis. J Biol Chem 277: 19861-19866


Chen X, Goodwin SM, Boroff VL, Liu X, Jenks MA (2003) Cloning and characterization of the WAX2 gene of Arabidopsis involved incuticle membrane and wax production. Plant Cell 15:1170-1185


Daniel JA, Torok MS, Sun ZW, Schieltz D, Allis CD, Yates JR, Grant PA (2004) Deubiquitination of histone H2B by a yeastacetyltransferase complex regulates transcription. J Biol Chem 279: 1867-1871


Ding Y, Fromm M, Avramova Z (2012) Multiple exposures to drought 'train' transcriptional responses in Arabidopsis. Nat Commun 3:740


https://www.ncbi.nlm.nih.gov/pubmed?term=Aharoni A%2C Dixit S%2C Jetter R%2C Thoenes E%2C van Arkel G%2C Pereira A %282004%29 The SHINE clade of AP2 domain transcription factors activates wax biosynthesis%2C alters cuticle properties%2C and confers drought tolerance when overexpressed in Arabidopsis%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Aharoni&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The SHINE clade of AP2 domain transcription factors activates wax biosynthesis, alters cuticle properties, and confers drought tolerance when overexpressed in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The SHINE clade of AP2 domain transcription factors activates wax biosynthesis, alters cuticle properties, and confers drought tolerance when overexpressed in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Aharoni&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Arag�n W%2C Reina%2DPinto JJ%2C Serrano M %282017%29 The intimate talk between plants and microorganisms at the leaf surface%2E J Exp Bot&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Aragón&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The intimate talk between plants and microorganisms at the leaf surface&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The intimate talk between plants and microorganisms at the leaf surface&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Aragón&as_ylo=2017&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Aarts MG%2C Keijzer CJ%2C Stiekema WJ%2C Pereira A %281995%29 Molecular characterization of the CER1 gene of Arabidopsis involved in epicuticular wax biosynthesis and pollen fertility%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Aarts&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Molecular characterization of the CER1 gene of Arabidopsis involved in epicuticular wax biosynthesis and pollen fertility&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Molecular characterization of the CER1 gene of Arabidopsis involved in epicuticular wax biosynthesis and pollen fertility&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Aarts&as_ylo=1995&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Avato P%2C Bianchi G%2C Nayak A%2C Salamini F%2C Gentinetta E %281987%29 Epicuticular waxes of maize as affected by the interaction of mutant gl8 with gl3%2C gl4 and gl15%2E Lipids&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Avato&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Avato&as_ylo=1987&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Bach L%2C Michaelson LV%2C Haslam R%2C Bellec Y%2C Gissot L%2C Marion J%2C Da Costa M%2C Boutin JP%2C Miquel M%2C Tellier F%2C et al %282008%29 The very%2Dlong%2Dchain hydroxy fatty acyl%2DCoA dehydratase PASTICCINO2 is essential and limiting for plant development%2E Proc Natl Acad Sci U S A&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bach&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The very-long-chain hydroxy fatty acyl-CoA dehydratase PASTICCINO2 is essential and limiting for plant development&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The very-long-chain hydroxy fatty acyl-CoA dehydratase PASTICCINO2 is essential and limiting for plant development&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bach&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Beaudoin F%2C Wu X%2C Li F%2C Haslam RP%2C Markham JE%2C Zheng H%2C Napier JA%2C Kunst L %282009%29 Functional characterization of the Arabidopsis β%2Dketoacyl%2Dcoenzyme a reductase candidates of the fatty acid elongase%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Beaudoin&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Functional characterization of the Arabidopsis �?²-ketoacyl-coenzyme a reductase candidates of the fatty acid elongase&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Functional characterization of the Arabidopsis �?²-ketoacyl-coenzyme a reductase candidates of the fatty acid elongase&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Beaudoin&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Bernard A%2C Domergue F%2C Pascal S%2C Jetter R%2C Renne C%2C Faure JD%2C Haslam RP%2C Napier JA%2C Lessire R%2C Joubes J %282012%29 Reconstitution of plant alkane biosynthesis in yeast demonstrates that Arabidopsis ECERIFERUM1 and ECERIFERUM3 are core components of a very%2Dlong%2Dchain alkane synthesis complex%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bernard&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Reconstitution of plant alkane biosynthesis in yeast demonstrates that Arabidopsis ECERIFERUM1 and ECERIFERUM3 are core components of a very-long-chain alkane synthesis complex&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Reconstitution of plant alkane biosynthesis in yeast demonstrates that Arabidopsis ECERIFERUM1 and ECERIFERUM3 are core components of a very-long-chain alkane synthesis complex&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bernard&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Bi H%2C Shi J%2C Kovalchuk N%2C Luang S%2C Bazanova N%2C Chirkova L%2C Zhang D%2C Shavrukov Y%2C Stepanenko A%2C Tricker P %282018%29 Overexpression of the TaSHN1 transcription factor in bread wheat leads to leaf surface modifications%2C improved drought tolerance%2C and no yield penalty under controlled growth conditions%2E Plant Cell Environ&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bi&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Overexpression of the TaSHN1 transcription factor in bread wheat leads to leaf surface modifications, improved drought tolerance, and no yield penalty under controlled growth conditions&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Overexpression of the TaSHN1 transcription factor in bread wheat leads to leaf surface modifications, improved drought tolerance, and no yield penalty under controlled growth conditions&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bi&as_ylo=2018&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Bourdenx B%2C Bernard A%2C Domergue F%2C Pascal S%2C L�ger A%2C Roby D%2C Pervent M%2C Vile D%2C Haslam RP%2C Napier JA%2C et al %282011%29 Overexpression of Arabidopsis ECERIFERUM1 promotes wax very%2Dlong%2Dchain alkane biosynthesis and influences plant response to biotic and abiotic stresses%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Bourdenx&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Overexpression of Arabidopsis ECERIFERUM1 promotes wax very-long-chain alkane biosynthesis and influences plant response to biotic and abiotic stresses&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Overexpression of Arabidopsis ECERIFERUM1 promotes wax very-long-chain alkane biosynthesis and influences plant response to biotic and abiotic stresses&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Bourdenx&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Castroverde CDM %282019%29 The AREB1%2DADA2b%2DGCN5 complex regulates gene expression during drought stress%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Castroverde&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The AREB1-ADA2b-GCN5 complex regulates gene expression during drought stress&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The AREB1-ADA2b-GCN5 complex regulates gene expression during drought stress&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Castroverde&as_ylo=2019&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Chen YF%2C Randlett MD%2C Findell JL%2C Schaller GE %282002%29 Localization of the ethylene receptor ETR1 to the endoplasmic reticulum of Arabidopsis%2E J Biol Chem&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Chen&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Localization of the ethylene receptor ETR1 to the endoplasmic reticulum of Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Localization of the ethylene receptor ETR1 to the endoplasmic reticulum of Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Chen&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Chen X%2C Goodwin SM%2C Boroff VL%2C Liu X%2C Jenks MA %282003%29 Cloning and characterization of the WAX2 gene of Arabidopsis involved in cuticle membrane and wax production%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Chen&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Cloning and characterization of the WAX2 gene of Arabidopsis involved in cuticle membrane and wax production&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Cloning and characterization of the WAX2 gene of Arabidopsis involved in cuticle membrane and wax production&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Chen&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Daniel JA%2C Torok MS%2C Sun ZW%2C Schieltz D%2C Allis CD%2C Yates JR%2C Grant PA %282004%29 Deubiquitination of histone H2B by a yeast acetyltransferase complex regulates transcription%2E J Biol Chem&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Daniel&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Deubiquitination of histone H2B by a yeast acetyltransferase complex regulates transcription&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Deubiquitination of histone H2B by a yeast acetyltransferase complex regulates transcription&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Daniel&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1



Domínguez E, Heredia-Guerrero JA, Heredia A (2017) The plant cuticle: old challenges, new perspectives. J Exp Bot 68: 5251-5255Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Fernández V, Guzmán-Delgado P, Graça J, Santos S, Gil L (2016) Cuticle structure in relation to chemical composition: re-assessingthe prevailing model. Front Plant Sci 7: 427


Fiebig A, Mayfield JA, Miley NL, Chau S, Fischer RL, Preuss D (2000) Alterations in CER6, a gene identical to CUT1, differentially affectlong-chain lipid content on the surface of pollen and stems. Plant Cell 12: 2001-2008


Go YS, Kim H, Kim HJ, Suh MC (2014) Arabidopsis cuticular wax biosynthesis is negatively regulated by the DEWAX gene encoding anAP2/ERF-type transcription factor. Plant Cell 26:1666-1680


Grant PA, Duggan L, Côté J, Roberts SM, Brownell JE, Candau R, Ohba R, Owen-Hughes T, Allis CD, Winston F, Berger SL, WorkmanJL (1997) Yeast Gcn5 functions in two multisubunit complexes to acetylate nucleosomal histones: characterization of an Ada complexand the SAGA (Spt/Ada) complex. Genes Dev 11: 1640-1650


Greer S, Wen M, Bird D, Wu X, Samuels L, Kunst L, Jetter R (2007) The cytochrome P450 enzyme CYP96A15 is the midchain alkanehydroxylase responsible for formation of secondary alcohols and ketones in stem cuticular wax of Arabidopsis. Plant Physiol 145: 653-667


Hansjakob A, Bischof S, Bringmann G, Riederer M, Hildebrandt U (2010) Very-long-chain aldehydes promote in vitro prepenetrationprocesses of Blumeria graminis in a dose- and chain length- dependent manner. New Phytol 188: 1039-1054


Hansjakob A, Riederer M, Hildebrandt U (2011) Wax matters: absence of very-long-chain aldehydes from the leaf cuticular wax of theglossy11 mutant of maize compromises the prepenetration processes of Blumeria graminis. Plant Pathol 60: 1151-1161


Haslam TM, Haslam R, Thoraval D, Pascal S, Delude C, Domergue F, Fernández AM, Beaudoin F, Napier JA, Kunst L, et al (2015)ECERIFERUM2-LIKE proteins have unique biochemical and physiological functions in very-long-chain fatty acid elongation. PlantPhysiol 167: 682-692


Haslam TM, Kunst L (2013) Extending the story of very-long-chain fatty acid elongation. Plant Sci 210: 93-107Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Haslam TM, Mañas-Fernández A, Zhao L, Kunst L (2012) Arabidopsis ECERIFERUM2 is a component of the fatty acid elongationmachinery required for fatty acid extension to exceptional lengths. Plant Physiol 160: 1164-1174


He H, Zhu S, Zhao R, Jiang Z, Ji Y, Ji J, Qiu D, Li H, Bie T (2018) Pm21, encoding a typical CC-NBS-LRR protein, confers broad-spectrum resistance to wheat powdery mildew disease. Mol Plant 11: 879-882


Hooker TS, Millar AA, Kunst L (2002) Significance of the expression of the CER6 condensing enzyme for cuticular wax production inArabidopsis. Plant Physiol 129:1568-1580


International Wheat Genome Sequencing Consortium (2018) Shifting the limits in wheat research and breeding using a fully annotatedreference genome. Science 361: eaar7191


Jenuwein T, Allis CD (2001) Translating the histone code. Science 293: 1074-1080 www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.

https://www.ncbi.nlm.nih.gov/pubmed?term=Ding Y%2C Fromm M%2C Avramova Z %282012%29 Multiple exposures to drought %27train%27 transcriptional responses in Arabidopsis%2E Nat Commun&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ding&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Multiple exposures to drought 'train' transcriptional responses in Arabidopsis.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Multiple exposures to drought 'train' transcriptional responses in Arabidopsis.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ding&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Dom�nguez E%2C Heredia%2DGuerrero JA%2C Heredia A %282017%29 The plant cuticle%3A old challenges%2C new perspectives%2E J Exp Bot&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Domínguez&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The plant cuticle: old challenges, new perspectives&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The plant cuticle: old challenges, new perspectives&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Domínguez&as_ylo=2017&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Fern�ndez V%2C Guzm�n%2DDelgado P%2C Gra�a J%2C Santos S%2C Gil L %282016%29 Cuticle structure in relation to chemical composition%3A re%2Dassessing the prevailing model%2E Front Plant Sci&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Fernández&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Cuticle structure in relation to chemical composition: re-assessing the prevailing model.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Cuticle structure in relation to chemical composition: re-assessing the prevailing model.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Fernández&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Fiebig A%2C Mayfield JA%2C Miley NL%2C Chau S%2C Fischer RL%2C Preuss D %282000%29 Alterations in CER6%2C a gene identical to CUT1%2C differentially affect long%2Dchain lipid content on the surface of pollen and stems%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Fiebig&hl=en&c2coff=1


https://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Fiebig&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Go YS%2C Kim H%2C Kim HJ%2C Suh MC %282014%29 Arabidopsis cuticular wax biosynthesis is negatively regulated by the DEWAX gene encoding an AP2%2FERF%2Dtype transcription factor%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Go&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Arabidopsis cuticular wax biosynthesis is negatively regulated by the DEWAX gene encoding an AP2/ERF-type transcription factor&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Arabidopsis cuticular wax biosynthesis is negatively regulated by the DEWAX gene encoding an AP2/ERF-type transcription factor&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Go&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Grant PA%2C Duggan L%2C C�t� J%2C Roberts SM%2C Brownell JE%2C Candau R%2C Ohba R%2C Owen%2DHughes T%2C Allis CD%2C Winston F%2C Berger SL%2C Workman JL %281997%29 Yeast Gcn5 functions in two multisubunit complexes to acetylate nucleosomal histones%3A characterization of an Ada complex and the SAGA %28Spt%2FAda%29 complex%2E Genes Dev&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Grant&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Yeast Gcn5 functions in two multisubunit complexes to acetylate nucleosomal histones: characterization of an Ada complex and the SAGA (Spt/Ada) complex&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Yeast Gcn5 functions in two multisubunit complexes to acetylate nucleosomal histones: characterization of an Ada complex and the SAGA (Spt/Ada) complex&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Grant&as_ylo=1997&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Greer S%2C Wen M%2C Bird D%2C Wu X%2C Samuels L%2C Kunst L%2C Jetter R %282007%29 The cytochrome P450 enzyme CYP96A15 is the midchain alkane hydroxylase responsible for formation of secondary alcohols and ketones in stem cuticular wax of Arabidopsis%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Greer&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The cytochrome P450 enzyme CYP96A15 is the midchain alkane hydroxylase responsible for formation of secondary alcohols and ketones in stem cuticular wax of Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The cytochrome P450 enzyme CYP96A15 is the midchain alkane hydroxylase responsible for formation of secondary alcohols and ketones in stem cuticular wax of Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Greer&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Hansjakob A%2C Bischof S%2C Bringmann G%2C Riederer M%2C Hildebrandt U %282010%29 Very%2Dlong%2Dchain aldehydes promote in vitro prepenetration processes of Blumeria graminis in a dose%2D and chain length%2D dependent manner%2E New Phytol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hansjakob&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Very-long-chain aldehydes promote in vitro prepenetration processes of Blumeria graminis in a dose- and chain length- dependent manner&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Very-long-chain aldehydes promote in vitro prepenetration processes of Blumeria graminis in a dose- and chain length- dependent manner&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hansjakob&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Hansjakob A%2C Riederer M%2C Hildebrandt U %282011%29 Wax matters%3A absence of very%2Dlong%2Dchain aldehydes from the leaf cuticular wax of the glossy11 mutant of maize compromises the prepenetration processes of Blumeria graminis%2E Plant Pathol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hansjakob&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Wax matters: absence of very-long-chain aldehydes from the leaf cuticular wax of the glossy11 mutant of maize compromises the prepenetration processes of Blumeria graminis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Wax matters: absence of very-long-chain aldehydes from the leaf cuticular wax of the glossy11 mutant of maize compromises the prepenetration processes of Blumeria graminis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hansjakob&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Haslam TM%2C Haslam R%2C Thoraval D%2C Pascal S%2C Delude C%2C Domergue F%2C Fern�ndez AM%2C Beaudoin F%2C Napier JA%2C Kunst L%2C et al %282015%29 ECERIFERUM2%2DLIKE proteins have unique biochemical and physiological functions in very%2Dlong%2Dchain fatty acid elongation%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Haslam&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=ECERIFERUM2-LIKE proteins have unique biochemical and physiological functions in very-long-chain fatty acid elongation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=ECERIFERUM2-LIKE proteins have unique biochemical and physiological functions in very-long-chain fatty acid elongation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Haslam&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Haslam TM%2C Kunst L %282013%29 Extending the story of very%2Dlong%2Dchain fatty acid elongation%2E Plant Sci&dopt=abstract


https://scholar.google.com/scholar?as_q=Extending the story of very-long-chain fatty acid elongation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Extending the story of very-long-chain fatty acid elongation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Haslam&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Haslam TM%2C Ma�as%2DFern�ndez A%2C Zhao L%2C Kunst L %282012%29 Arabidopsis ECERIFERUM2 is a component of the fatty acid elongation machinery required for fatty acid extension to exceptional lengths%2E Plant Physiol&dopt=abstract


https://scholar.google.com/scholar?as_q=Arabidopsis ECERIFERUM2 is a component of the fatty acid elongation machinery required for fatty acid extension to exceptional lengths&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Arabidopsis ECERIFERUM2 is a component of the fatty acid elongation machinery required for fatty acid extension to exceptional lengths&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Haslam&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=He H%2C Zhu S%2C Zhao R%2C Jiang Z%2C Ji Y%2C Ji J%2C Qiu D%2C Li H%2C Bie T %282018%29 Pm21%2C encoding a typical CC%2DNBS%2DLRR protein%2C confers broad%2Dspectrum resistance to wheat powdery mildew disease%2E Mol Plant&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=He&hl=en&c2coff=1


https://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=He&as_ylo=2018&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Hooker TS%2C Millar AA%2C Kunst L %282002%29 Significance of the expression of the CER6 condensing enzyme for cuticular wax production in Arabidopsis%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Hooker&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Significance of the expression of the CER6 condensing enzyme for cuticular wax production in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Significance of the expression of the CER6 condensing enzyme for cuticular wax production in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Hooker&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=International Wheat Genome Sequencing Consortium %282018%29 Shifting the limits in wheat research and breeding using a fully annotated reference genome%2E Science 361%3A eaar&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=International&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Shifting the limits in wheat research and breeding using a fully annotated reference genome.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Shifting the limits in wheat research and breeding using a fully annotated reference genome.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=International&as_ylo=2018&as_allsubj=all&hl=en&c2coff=1



Kim J, Jung JH, Lee SB, Go YS, Kim HJ, Cahoon R, Markham JE, Cahoon EB, Suh MC (2013) Arabidopsis 3-ketoacylcoenzyme Asynthase 9 is involved in the synthesis of tetracosanoic acids as precursors of cuticular waxes, suberins, sphingolipids, andphospholipids. Plant Physiol 162:567-580


Kohlwein SD, Eder S, Oh CS, Martin CE, Gable K, Bacikova D, Dunn T (2001) Tsc13p is required for fatty acid elongation and localizesto a novel structure at the nuclear-vacuolar interface in Saccharomyces cerevisiae. Mol Cell Biol 21:109-125


Koller T, Brunner S, Herren G, Hurni S, Keller B (2018) Pyramiding of transgenic Pm3 alleles in wheat results in improved powderymildew resistance in the field. Theor Appl Genet 131: 861-871


Kong LY, Chang C (2018) Suppression of wheat TaCDK8/TaWIN1 interaction negatively affects germination of Blumeria graminis f.sp.tritici by interfering with very-long-chain aldehyde biosynthesis. Plant Mol Biol 96: 165-178


Kurdistani SK, Grunstein M (2003) Histone acetylation and deacetylation in yeast. Nat Rev Mol Cell Biol 4: 276-284Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Lee SB, Jung SJ, Go YS, Kim HU, Kim JK, Cho HJ, Park OK, Suh MC (2009) Two Arabidopsis 3-ketoacyl CoA synthase genes, KCS20and KCS2/DAISY, are functionally redundant in cuticular wax and root suberin biosynthesis, but differentially controlled by osmoticstress. Plant J 60: 462-475


Lee SB, Kim HU, Suh MC (2016) MYB94 and MYB96 additively activate cuticular wax biosynthesis in Arabidopsis. Plant Cell Physiol 57:2300-2311


Lee SB, Suh MC (2013). Recent advances in cuticular wax biosynthesis and its regulation in Arabidopsis. Mol Plant 6: 246-249Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Lee SB, Suh MC (2014) Cuticular wax biosynthesis is up-regulated by the MYB94 transcription factor in Arabidopsis. Plant Cell Physiol56:48-60


Lee SB, Suh MC (2015a) Advances in the understanding of cuticular waxes in Arabidopsis thaliana and crop species. Plant Cell Rep 34:557-572


Lee SB, Suh MC (2015b) Cuticular wax biosynthesis is up-regulated by the MYB94 transcription factor in Arabidopsis. Plant CellPhysiol 56: 48-60


Li C, Haslam TM, Krüger A, Schneider LM, Mishina K, Samuels L, Yang H, Kunst L, Schaffrath U, Nawrath C, et al (2018) The β-Ketoacyl-CoA synthase HvKCS1, encoded by Cer-zh, plays a key role in synthesis of barley leaf wax and germination of barley powderymildew. Plant Cell Physiol 59: 806-822


Li S, Lin YJ, Wang P, Zhang B, Li M, Chen S, Shi R, Tunlaya-Anukit S, Liu X, Wang Z, Dai X, Yu J, et al (2018). Histone acetylationcooperating with AREB1 transcription factor regulates drought response and tolerance in Populus trichocarpa. Plant Cell 31: 663-686


Liu J, Zhi P, Wang X, Fan Q, Chang C (2019) Wheat WD40-repeat protein TaHOS15 functions in a histone deacetylase complex to fine-tune defense response to Blumeria graminis f.sp. tritici. J Exp Bot 70: 255-268


Liu S, Yeh C-T, Tang HM, Nettleton D, Schnable PS (2012) Gene mapping via bulked segregant RNA-Seq (BSR-Seq). PLOS One 7: www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from Copyright © 2020 American Society of Plant Biologists. All rights reserved.

https://www.ncbi.nlm.nih.gov/pubmed?term=Jenuwein T%2C Allis CD %282001%29 Translating the histone code%2E Science&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Jenuwein&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Translating the histone code&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Translating the histone code&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Jenuwein&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Kim J%2C Jung JH%2C Lee SB%2C Go YS%2C Kim HJ%2C Cahoon R%2C Markham JE%2C Cahoon EB%2C Suh MC %282013%29 Arabidopsis 3%2Dketoacylcoenzyme A synthase 9 is involved in the synthesis of tetracosanoic acids as precursors of cuticular waxes%2C suberins%2C sphingolipids%2C and phospholipids%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kim&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Arabidopsis 3-ketoacylcoenzyme A synthase 9 is involved in the synthesis of tetracosanoic acids as precursors of cuticular waxes, suberins, sphingolipids, and phospholipids&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Arabidopsis 3-ketoacylcoenzyme A synthase 9 is involved in the synthesis of tetracosanoic acids as precursors of cuticular waxes, suberins, sphingolipids, and phospholipids&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kim&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Kohlwein SD%2C Eder S%2C Oh CS%2C Martin CE%2C Gable K%2C Bacikova D%2C Dunn T %282001%29 Tsc13p is required for fatty acid elongation and localizes to a novel structure at the nuclear%2Dvacuolar interface in Saccharomyces cerevisiae%2E Mol Cell Biol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kohlwein&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Tsc13p is required for fatty acid elongation and localizes to a novel structure at the nuclear-vacuolar interface in Saccharomyces cerevisiae&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Tsc13p is required for fatty acid elongation and localizes to a novel structure at the nuclear-vacuolar interface in Saccharomyces cerevisiae&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kohlwein&as_ylo=2001&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Koller T%2C Brunner S%2C Herren G%2C Hurni S%2C Keller B %282018%29 Pyramiding of transgenic Pm3 alleles in wheat results in improved powdery mildew resistance in the field%2E Theor Appl Genet&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Koller&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Pyramiding of transgenic Pm3 alleles in wheat results in improved powdery mildew resistance in the field&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Pyramiding of transgenic Pm3 alleles in wheat results in improved powdery mildew resistance in the field&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Koller&as_ylo=2018&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Kong LY%2C Chang C %282018%29 Suppression of wheat TaCDK8%2FTaWIN1 interaction negatively affects germination of Blumeria graminis f%2Esp%2E tritici by interfering with very%2Dlong%2Dchain aldehyde biosynthesis%2E Plant Mol Biol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kong&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Suppression of wheat TaCDK8/TaWIN1 interaction negatively affects germination of Blumeria graminis f&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Suppression of wheat TaCDK8/TaWIN1 interaction negatively affects germination of Blumeria graminis f&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kong&as_ylo=2018&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Kurdistani SK%2C Grunstein M %282003%29 Histone acetylation and deacetylation in yeast%2E Nat Rev Mol Cell Biol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Kurdistani&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Histone acetylation and deacetylation in yeast&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Histone acetylation and deacetylation in yeast&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Kurdistani&as_ylo=2003&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Lee SB%2C Jung SJ%2C Go YS%2C Kim HU%2C Kim JK%2C Cho HJ%2C Park OK%2C Suh MC %282009%29 Two Arabidopsis 3%2Dketoacyl CoA synthase genes%2C KCS20 and KCS2%2FDAISY%2C are functionally redundant in cuticular wax and root suberin biosynthesis%2C but differentially controlled by osmotic stress%2E Plant J&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lee&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Two Arabidopsis 3-ketoacyl CoA synthase genes, KCS20 and KCS2/DAISY, are functionally redundant in cuticular wax and root suberin biosynthesis, but differentially controlled by osmotic stress&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Two Arabidopsis 3-ketoacyl CoA synthase genes, KCS20 and KCS2/DAISY, are functionally redundant in cuticular wax and root suberin biosynthesis, but differentially controlled by osmotic stress&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lee&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Lee SB%2C Kim HU%2C Suh MC %282016%29 MYB94 and MYB96 additively activate cuticular wax biosynthesis in Arabidopsis%2E Plant Cell Physiol&dopt=abstract


https://scholar.google.com/scholar?as_q=MYB94 and MYB96 additively activate cuticular wax biosynthesis in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=MYB94 and MYB96 additively activate cuticular wax biosynthesis in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lee&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Lee SB%2C Suh MC %282013%29%2E Recent advances in cuticular wax biosynthesis and its regulation in Arabidopsis%2E Mol Plant&dopt=abstract


https://scholar.google.com/scholar?as_q=Recent advances in cuticular wax biosynthesis and its regulation in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Recent advances in cuticular wax biosynthesis and its regulation in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lee&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Lee SB%2C Suh MC %282014%29 Cuticular wax biosynthesis is up%2Dregulated by the MYB94 transcription factor in Arabidopsis%2E Plant Cell Physiol&dopt=abstract


https://scholar.google.com/scholar?as_q=Cuticular wax biosynthesis is up-regulated by the MYB94 transcription factor in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Cuticular wax biosynthesis is up-regulated by the MYB94 transcription factor in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lee&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Lee SB%2C Suh MC %282015a%29 Advances in the understanding of cuticular waxes in Arabidopsis thaliana and crop species%2E Plant Cell Rep&dopt=abstract


https://scholar.google.com/scholar?as_q=Advances in the understanding of cuticular waxes in Arabidopsis thaliana and crop species&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Advances in the understanding of cuticular waxes in Arabidopsis thaliana and crop species&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lee&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Lee SB%2C Suh MC %282015b%29 Cuticular wax biosynthesis is up%2Dregulated by the MYB94 transcription factor in Arabidopsis%2E Plant Cell Physiol&dopt=abstract


https://scholar.google.com/scholar?as_q=Cuticular wax biosynthesis is up-regulated by the MYB94 transcription factor in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Cuticular wax biosynthesis is up-regulated by the MYB94 transcription factor in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lee&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Li C%2C Haslam TM%2C Krüger A%2C Schneider LM%2C Mishina K%2C Samuels L%2C Yang H%2C Kunst L%2C Schaffrath U%2C Nawrath C%2C et al %282018%29 The β%2DKetoacyl%2DCoA synthase HvKCS1%2C encoded by Cer%2Dzh%2C plays a key role in synthesis of barley leaf wax and germination of barley powdery mildew%2E Plant Cell Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Li&hl=en&c2coff=1


https://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Li&as_ylo=2018&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Li S%2C Lin YJ%2C Wang P%2C Zhang B%2C Li M%2C Chen S%2C Shi R%2C Tunlaya%2DAnukit S%2C Liu X%2C Wang Z%2C Dai X%2C Yu J%2C et al %282018%29%2E Histone acetylation cooperating with AREB1 transcription factor regulates drought response and tolerance in Populus trichocarpa%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Li&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Histone acetylation cooperating with AREB1 transcription factor regulates drought response and tolerance in Populus trichocarpa&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Histone acetylation cooperating with AREB1 transcription factor regulates drought response and tolerance in Populus trichocarpa&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Li&as_ylo=2018&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Liu J%2C Zhi P%2C Wang X%2C Fan Q%2C Chang C %282019%29 Wheat WD40%2Drepeat protein TaHOS15 functions in a histone deacetylase complex to fine%2Dtune defense response to Blumeria graminis f%2Esp%2E tritici%2E J Exp Bot&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Liu&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Wheat WD40-repeat protein TaHOS15 functions in a histone deacetylase complex to fine-tune defense response to Blumeria graminis f&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Wheat WD40-repeat protein TaHOS15 functions in a histone deacetylase complex to fine-tune defense response to Blumeria graminis f&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Liu&as_ylo=2019&as_allsubj=all&hl=en&c2coff=1


e36406Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Lu S, Song T, Kosma DK, Parsons EP, Rowland O, Jenks MA (2009) Arabidopsis CER8 encodes LONGCHAIN ACYL-COA SYNTHETASE1 (LACS1) that has overlapping functions with LACS2 in plant wax and cutin synthesis. Plant J 59: 553-564


Mao Y, Pavangadkar KA, Thomashow MF, Triezenberg SJ (2006) Physical and functional interactions of Arabidopsis ADA2transcriptional coactivator proteins with the acetyltransferase GCN5 and with the cold-induced transcription factor CBF1. BiochimBiophys Acta 1759: 69-79


Martin LB, Rose JK (2014) There's more than one way to skin a fruit: formation and functions of fruit cuticles. J Exp Bot 65: 4639-4651Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Millar AA, Clemens S, Zachgo S, Giblin EM, Taylor DC, Kunst L (1999) CUT1, an Arabidopsis gene required for cuticular waxbiosynthesis and pollen fertility, encodes a very-long-chain fatty acid condensing enzyme. Plant Cell 11: 825-838


Moraga F, Aquea F (2015) Composition of the SAGA complex in plants and its role in controlling gene expression in response to abioticstresses. Front Plant Sci 6: 865


Nawrath C (2006) Unraveling the complex network of cuticular structure and function. Curr Opin Plant Biol 9: 281-287Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Nielsen KA, Nicholson RL, Carver TLW, Kunoh H, Oliver RP (2000) First touch: An immediate response to surface recognition inconidia of Blumeria graminis. Physiol Mol Plant P 56: 63-70


Oshima Y, Shikata M, Koyama T, Ohtsubo N, Mitsuda N, Ohme-Takagi M (2013) MIXTA-like transcription factors and WAXINDUCER1/SHINE1 coordinately regulate cuticle development in Arabidopsis and Torenia fournieri. Plant Cell 25: 1609-1624


Pascal S, Bernard A, Deslous P, Gronnier J, Fournier-Goss A, Domergue F, Rowland O, Joubès J (2019) Arabidopsis CER1-LIKE1functions in a cuticular very-long-chain alkane-forming complex. Plant Physiol 179: 415-432


Raffaele S, Vailleau F, Léger A, Joubès J, Miersch O, Huard C, Blée E, Mongrand S, Domergue F, Roby D (2008) A MYB transcriptionfactor regulates very-long-chain fatty acid biosynthesis for activation of the hypersensitive cell death response in Arabidopsis. PlantCell 20: 752-767


Rowland O, Zheng H, Hepworth SR, Lam P, Jetter R, Kunst L (2006) CER4 encodes an alcohol-forming fatty acyl-coenzyme A reductaseinvolved in cuticular wax production in Arabidopsis. Plant Physiol 142: 866-877


Rowland O, Lee R, Franke R, Schreiber L, Kunst L (2007) The CER3 wax biosynthetic gene from Arabidopsis thaliana is allelic toWAX2/YRE/FLP1. FEBS Lett 581: 3538-3544


Sajeevan RS, Nataraja KN, Shivashankara KS, Pallavi N, Gurumurthy DS, Shivanna MB (2017) Expression of Arabidopsis SHN1 inIndian mulberry (Morus indica L.) increases leaf surface wax content and reduces post-harvest water loss. Front Plant Sci 8: 418


Samuels L, Kunst L, Jetter R (2008) Sealing plant surfaces: cuticular wax formation by epidermal cells. Annu Rev Plant Biol 59: 683-707Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Schmitz RJ, Tamada Y, Doyle MR, Zhang X, Amasino RM (2009) Histone H2B deubiquitination is required for transcriptional activationof FLOWERING LOCUS C and for proper control of flowering in Arabidopsis. Plant Physiol 149:1196-1204 www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from

Copyright © 2020 American Society of Plant Biologists. All rights reserved.

https://www.ncbi.nlm.nih.gov/pubmed?term=Liu S%2C Yeh C%2DT%2C Tang HM%2C Nettleton D%2C Schnable PS %282012%29 Gene mapping via bulked segregant RNA%2DSeq %28BSR%2DSeq%29%2E PLOS One 7%3A e&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Liu&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Gene mapping via bulked segregant RNA-Seq (BSR-Seq).&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Gene mapping via bulked segregant RNA-Seq (BSR-Seq).&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Liu&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Lu S%2C Song T%2C Kosma DK%2C Parsons EP%2C Rowland O%2C Jenks MA %282009%29 Arabidopsis CER8 encodes LONGCHAIN ACYL%2DCOA SYNTHETASE 1 %28LACS1%29 that has overlapping functions with LACS2 in plant wax and cutin synthesis%2E Plant J&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Lu&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Arabidopsis CER8 encodes LONGCHAIN ACYL-COA SYNTHETASE 1 (LACS1) that has overlapping functions with LACS2 in plant wax and cutin synthesis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Arabidopsis CER8 encodes LONGCHAIN ACYL-COA SYNTHETASE 1 (LACS1) that has overlapping functions with LACS2 in plant wax and cutin synthesis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Lu&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Mao Y%2C Pavangadkar KA%2C Thomashow MF%2C Triezenberg SJ %282006%29 Physical and functional interactions of Arabidopsis ADA2 transcriptional coactivator proteins with the acetyltransferase GCN5 and with the cold%2Dinduced transcription factor CBF1%2E Biochim Biophys Acta&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Mao&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Physical and functional interactions of Arabidopsis ADA2 transcriptional coactivator proteins with the acetyltransferase GCN5 and with the cold-induced transcription factor CBF1&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Physical and functional interactions of Arabidopsis ADA2 transcriptional coactivator proteins with the acetyltransferase GCN5 and with the cold-induced transcription factor CBF1&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Mao&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Martin LB%2C Rose JK %282014%29 There%27s more than one way to skin a fruit%3A formation and functions of fruit cuticles%2E J Exp Bot&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Martin&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=There's more than one way to skin a fruit: formation and functions of fruit cuticles&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=There's more than one way to skin a fruit: formation and functions of fruit cuticles&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Martin&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Millar AA%2C Clemens S%2C Zachgo S%2C Giblin EM%2C Taylor DC%2C Kunst L %281999%29 CUT1%2C an Arabidopsis gene required for cuticular wax biosynthesis and pollen fertility%2C encodes a very%2Dlong%2Dchain fatty acid condensing enzyme%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Millar&hl=en&c2coff=1


https://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Millar&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Moraga F%2C Aquea F %282015%29 Composition of the SAGA complex in plants and its role in controlling gene expression in response to abiotic stresses%2E Front Plant Sci&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Moraga&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Composition of the SAGA complex in plants and its role in controlling gene expression in response to abiotic stresses.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Composition of the SAGA complex in plants and its role in controlling gene expression in response to abiotic stresses.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Moraga&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Nawrath C %282006%29 Unraveling the complex network of cuticular structure and function%2E Curr Opin Plant Biol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nawrath&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Unraveling the complex network of cuticular structure and function&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Unraveling the complex network of cuticular structure and function&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nawrath&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Nielsen KA%2C Nicholson RL%2C Carver TLW%2C Kunoh H%2C Oliver RP %282000%29 First touch%3A An immediate response to surface recognition in conidia of Blumeria graminis%2E Physiol Mol Plant P&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Nielsen&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=First touch: An immediate response to surface recognition in conidia of Blumeria graminis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=First touch: An immediate response to surface recognition in conidia of Blumeria graminis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Nielsen&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Oshima Y%2C Shikata M%2C Koyama T%2C Ohtsubo N%2C Mitsuda N%2C Ohme%2DTakagi M %282013%29 MIXTA%2Dlike transcription factors and WAX INDUCER1%2FSHINE1 coordinately regulate cuticle development in Arabidopsis and Torenia fournieri%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Oshima&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=MIXTA-like transcription factors and WAX INDUCER1/SHINE1 coordinately regulate cuticle development in Arabidopsis and Torenia fournieri&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=MIXTA-like transcription factors and WAX INDUCER1/SHINE1 coordinately regulate cuticle development in Arabidopsis and Torenia fournieri&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Oshima&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Pascal S%2C Bernard A%2C Deslous P%2C Gronnier J%2C Fournier%2DGoss A%2C Domergue F%2C Rowland O%2C Joub�s J %282019%29 Arabidopsis CER1%2DLIKE1 functions in a cuticular very%2Dlong%2Dchain alkane%2Dforming complex%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Pascal&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Arabidopsis CER1-LIKE1 functions in a cuticular very-long-chain alkane-forming complex&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Arabidopsis CER1-LIKE1 functions in a cuticular very-long-chain alkane-forming complex&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Pascal&as_ylo=2019&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Raffaele S%2C Vailleau F%2C L�ger A%2C Joub�s J%2C Miersch O%2C Huard C%2C Bl�e E%2C Mongrand S%2C Domergue F%2C Roby D %282008%29 A MYB transcription factor regulates very%2Dlong%2Dchain fatty acid biosynthesis for activation of the hypersensitive cell death response in Arabidopsis%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Raffaele&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=A MYB transcription factor regulates very-long-chain fatty acid biosynthesis for activation of the hypersensitive cell death response in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=A MYB transcription factor regulates very-long-chain fatty acid biosynthesis for activation of the hypersensitive cell death response in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Raffaele&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Rowland O%2C Zheng H%2C Hepworth SR%2C Lam P%2C Jetter R%2C Kunst L %282006%29 CER4 encodes an alcohol%2Dforming fatty acyl%2Dcoenzyme A reductase involved in cuticular wax production in Arabidopsis%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Rowland&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=CER4 encodes an alcohol-forming fatty acyl-coenzyme A reductase involved in cuticular wax production in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=CER4 encodes an alcohol-forming fatty acyl-coenzyme A reductase involved in cuticular wax production in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Rowland&as_ylo=2006&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Rowland O%2C Lee R%2C Franke R%2C Schreiber L%2C Kunst L %282007%29 The CER3 wax biosynthetic gene from Arabidopsis thaliana is allelic to WAX2%2FYRE%2FFLP1%2E FEBS Lett&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Rowland&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The CER3 wax biosynthetic gene from Arabidopsis thaliana is allelic to WAX2/YRE/FLP1&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The CER3 wax biosynthetic gene from Arabidopsis thaliana is allelic to WAX2/YRE/FLP1&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Rowland&as_ylo=2007&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Sajeevan RS%2C Nataraja KN%2C Shivashankara KS%2C Pallavi N%2C Gurumurthy DS%2C Shivanna MB %282017%29 Expression of Arabidopsis SHN1 in Indian mulberry %28Morus indica L%2E%29 increases leaf surface wax content and reduces post%2Dharvest water loss%2E Front Plant Sci&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Sajeevan&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Expression of Arabidopsis SHN1 in Indian mulberry (Morus indica L.) increases leaf surface wax content and reduces post-harvest water loss.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Expression of Arabidopsis SHN1 in Indian mulberry (Morus indica L.) increases leaf surface wax content and reduces post-harvest water loss.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Sajeevan&as_ylo=2017&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Samuels L%2C Kunst L%2C Jetter R %282008%29 Sealing plant surfaces%3A cuticular wax formation by epidermal cells%2E Annu Rev Plant Biol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Samuels&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Sealing plant surfaces: cuticular wax formation by epidermal cells&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Sealing plant surfaces: cuticular wax formation by epidermal cells&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Samuels&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1



Schnurr J, Shockey J, Browse J (2004) The acyl-CoA synthetase encoded by LACS2 is essential for normal cuticle development inArabidopsis. Plant Cell 16: 629-642


Seo PJ, Lee SB, Suh MC, Park MJ, Go YS, Park CM (2011) The MYB96 transcription factor regulates cuticular wax biosynthesis underdrought conditions in Arabidopsis. Plant Cell 23: 1138- 1152


Serrano M, Coluccia F, Torres M, L'Haridon F, Métraux JP (2014) The cuticle and plant defense to pathogens. Front Plant Sci 5: 274Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Strahl BD, Allis CD (2000) The language of covalent histone modifications. Nature 403: 41-45Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Todd J, Post-Beittenmiller D, Jaworski JG (1999) KCS1 encodes a fatty acid elongase 3-ketoacyl-CoA synthase affecting waxbiosynthesis in Arabidopsis thaliana. Plant J 17: 119-130


Uppalapati SR, Ishiga Y, Doraiswamy V, Bedair M, Mittal S, Chen J, Nakashima J, Tang Y, Tadege M, Ratet P, et al (2012) Loss of abaxialleaf epicuticular wax in Medicago truncatula irg1/palm1 mutants results in reduced spore differentiation of anthracnose and nonhostrust pathogens. Plant Cell 24: 353-370


Wang L, Dent SY (2014) Functions of SAGA in development and disease. Epigenomics 6: 329-339Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Wang X, Zhi P, Fan Q, Zhang M, Chang C (2019) Wheat CHD3 protein TaCHR729 regulates the cuticular wax biosynthesis required forstimulating germination of Blumeria graminis f.sp. tritici. J Exp Bot 70: 701-713


Wang Y, Wan L, Zhang L, Zhang Z, Zhang H, Quan R, Zhou S, Huang R (2012) An ethylene response factor OsWR1 responsive todrought stress transcriptionally activates wax synthesis related genes and increases wax production in rice. Plant Mol Biol 78: 275-288


Weake VM, Workman JL (2012) SAGA function in tissues pecific gene expression. Trends Cell Biol. 22: 177-184Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Weak VM, Lee KK, Guelman S, Lin CH, Seidel C, Abmayr SM, Workman JL (2008) SAGA-mediated H2B deubiquitination controls thedevelopment of neuronal connectivity in the Drosophila visual system. EMBO J 27: 394-405


Weidenbach D, Jansen M, Franke RB, Hensel G, Weissgerber W, Ulferts S, Jansen I, Schreiber L, Korzun V, Pontzen R et al (2014)Evolutionary conserved function of barley and Arabidopsis 3-KETOACYL-CoA SYNTHASES in providing wax signals for germination ofpowdery mildew fungi. Plant Physiol 166: 1621-1633


Weng H, Molina I, Shockey J, Browse J (2010) Organ fusion and defective cuticle function in a lacs1 lacs2 double mutant ofArabidopsis. Planta 231: 1089-1100


Wright AJ, Thomas BJ, Carver TLW (2002) Early adhesion of Blumeria graminis to plant and artificial surfaces demonstrated bycentrifugation. Physiol Mol Plant P 61: 217-226


Xia Y, Nikolau BJ, Schnable PS (1996) Cloning and characterization of CER2, an Arabidopsis gene that affects cuticular waxaccumulation. Plant Cell 8:1291-1304

Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title www.plantphysiol.orgon August 27, 2020 - Published by Downloaded from

Copyright © 2020 American Society of Plant Biologists. All rights reserved.

https://www.ncbi.nlm.nih.gov/pubmed?term=Schmitz RJ%2C Tamada Y%2C Doyle MR%2C Zhang X%2C Amasino RM %282009%29 Histone H2B deubiquitination is required for transcriptional activation of FLOWERING LOCUS C and for proper control of flowering in Arabidopsis%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Schmitz&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Histone H2B deubiquitination is required for transcriptional activation of FLOWERING LOCUS C and for proper control of flowering in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Histone H2B deubiquitination is required for transcriptional activation of FLOWERING LOCUS C and for proper control of flowering in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Schmitz&as_ylo=2009&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Schnurr J%2C Shockey J%2C Browse J %282004%29 The acyl%2DCoA synthetase encoded by LACS2 is essential for normal cuticle development in Arabidopsis%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Schnurr&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The acyl-CoA synthetase encoded by LACS2 is essential for normal cuticle development in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The acyl-CoA synthetase encoded by LACS2 is essential for normal cuticle development in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Schnurr&as_ylo=2004&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Seo PJ%2C Lee SB%2C Suh MC%2C Park MJ%2C Go YS%2C Park CM %282011%29 The MYB96 transcription factor regulates cuticular wax biosynthesis under drought conditions in Arabidopsis%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Seo&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The MYB96 transcription factor regulates cuticular wax biosynthesis under drought conditions in Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The MYB96 transcription factor regulates cuticular wax biosynthesis under drought conditions in Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Seo&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Serrano M%2C Coluccia F%2C Torres M%2C L%27Haridon F%2C M�traux JP %282014%29 The cuticle and plant defense to pathogens%2E Front Plant Sci&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Serrano&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The cuticle and plant defense to pathogens.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The cuticle and plant defense to pathogens.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Serrano&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Strahl BD%2C Allis CD %282000%29 The language of covalent histone modifications%2E Nature&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Strahl&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The language of covalent histone modifications&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The language of covalent histone modifications&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Strahl&as_ylo=2000&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Todd J%2C Post%2DBeittenmiller D%2C Jaworski JG %281999%29 KCS1 encodes a fatty acid elongase 3%2Dketoacyl%2DCoA synthase affecting wax biosynthesis in Arabidopsis thaliana%2E Plant J&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Todd&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=KCS1 encodes a fatty acid elongase 3-ketoacyl-CoA synthase affecting wax biosynthesis in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=KCS1 encodes a fatty acid elongase 3-ketoacyl-CoA synthase affecting wax biosynthesis in Arabidopsis thaliana&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Todd&as_ylo=1999&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Uppalapati SR%2C Ishiga Y%2C Doraiswamy V%2C Bedair M%2C Mittal S%2C Chen J%2C Nakashima J%2C Tang Y%2C Tadege M%2C Ratet P%2C et al %282012%29 Loss of abaxial leaf epicuticular wax in Medicago truncatula irg1%2Fpalm1 mutants results in reduced spore differentiation of anthracnose and nonhost rust pathogens%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Uppalapati&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Loss of abaxial leaf epicuticular wax in Medicago truncatula irg1/palm1 mutants results in reduced spore differentiation of anthracnose and nonhost rust pathogens&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Loss of abaxial leaf epicuticular wax in Medicago truncatula irg1/palm1 mutants results in reduced spore differentiation of anthracnose and nonhost rust pathogens&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Uppalapati&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Wang L%2C Dent SY %282014%29 Functions of SAGA in development and disease%2E Epigenomics&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wang&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Functions of SAGA in development and disease&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Functions of SAGA in development and disease&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wang&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Wang X%2C Zhi P%2C Fan Q%2C Zhang M%2C Chang C %282019%29 Wheat CHD3 protein TaCHR729 regulates the cuticular wax biosynthesis required for stimulating germination of Blumeria graminis f%2Esp%2E tritici%2E J Exp Bot&dopt=abstract


https://scholar.google.com/scholar?as_q=Wheat CHD3 protein TaCHR729 regulates the cuticular wax biosynthesis required for stimulating germination of Blumeria graminis f&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Wheat CHD3 protein TaCHR729 regulates the cuticular wax biosynthesis required for stimulating germination of Blumeria graminis f&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wang&as_ylo=2019&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Wang Y%2C Wan L%2C Zhang L%2C Zhang Z%2C Zhang H%2C Quan R%2C Zhou S%2C Huang R %282012%29 An ethylene response factor OsWR1 responsive to drought stress transcriptionally activates wax synthesis related genes and increases wax production in rice%2E Plant Mol Biol&dopt=abstract


https://scholar.google.com/scholar?as_q=An ethylene response factor OsWR1 responsive to drought stress transcriptionally activates wax synthesis related genes and increases wax production in rice&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=An ethylene response factor OsWR1 responsive to drought stress transcriptionally activates wax synthesis related genes and increases wax production in rice&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wang&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Weake VM%2C Workman JL %282012%29 SAGA function in tissues pecific gene expression%2E Trends Cell Biol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Weake&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=SAGA function in tissues pecific gene expression&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=SAGA function in tissues pecific gene expression&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Weake&as_ylo=2012&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Weak VM%2C Lee KK%2C Guelman S%2C Lin CH%2C Seidel C%2C Abmayr SM%2C Workman JL %282008%29 SAGA%2Dmediated H2B deubiquitination controls the development of neuronal connectivity in the Drosophila visual system%2E EMBO J&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Weak&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=SAGA-mediated H2B deubiquitination controls the development of neuronal connectivity in the Drosophila visual system&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=SAGA-mediated H2B deubiquitination controls the development of neuronal connectivity in the Drosophila visual system&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Weak&as_ylo=2008&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Weidenbach D%2C Jansen M%2C Franke RB%2C Hensel G%2C Weissgerber W%2C Ulferts S%2C Jansen I%2C Schreiber L%2C Korzun V%2C Pontzen R et al %282014%29 Evolutionary conserved function of barley and Arabidopsis 3%2DKETOACYL%2DCoA SYNTHASES in providing wax signals for germination of powdery mildew fungi%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Weidenbach&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Evolutionary conserved function of barley and Arabidopsis 3-KETOACYL-CoA SYNTHASES in providing wax signals for germination of powdery mildew fungi&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Evolutionary conserved function of barley and Arabidopsis 3-KETOACYL-CoA SYNTHASES in providing wax signals for germination of powdery mildew fungi&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Weidenbach&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Weng H%2C Molina I%2C Shockey J%2C Browse J %282010%29 Organ fusion and defective cuticle function in a lacs1 lacs2 double mutant of Arabidopsis%2E Planta&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Weng&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Organ fusion and defective cuticle function in a lacs1 lacs2 double mutant of Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Organ fusion and defective cuticle function in a lacs1 lacs2 double mutant of Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Weng&as_ylo=2010&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Wright AJ%2C Thomas BJ%2C Carver TLW %282002%29 Early adhesion of Blumeria graminis to plant and artificial surfaces demonstrated by centrifugation%2E Physiol Mol Plant P&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Wright&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Early adhesion of Blumeria graminis to plant and artificial surfaces demonstrated by centrifugation&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Early adhesion of Blumeria graminis to plant and artificial surfaces demonstrated by centrifugation&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Wright&as_ylo=2002&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Xia Y%2C Nikolau BJ%2C Schnable PS %281996%29 Cloning and characterization of CER2%2C an Arabidopsis gene that affects cuticular wax accumulation%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Xia&hl=en&c2coff=1


https://scholar.google.com/scholar?as_q=&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Xia&as_ylo=1996&as_allsubj=all&hl=en&c2coff=1


Xing L, Hu P, Liu J, Witek K, Zhou S, Xu J, Zhou W, Gao L, Huang Z, Zhang R, et al (2018) Pm21 from Haynaldia villosa encodes a CC-NBS-LRR protein conferring powdery mildew resistance in wheat. Mol Plant 11: 874-878


Yang X, Zhao H, Kosma DK, Tomasi P, Dyer JM, Li R, Liu X, Wang Z, Parsons EP, Jenks MA, et al (2017) The acyl desaturase CER17 isinvolved in producing wax unsaturated primary alcohols and cutin monomers. Plant Physiol 173: 1109-1124


Yeats TH, Rose JK (2013) The formation and function of plant cuticles. Plant Physiol 163: 5-20Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title

Yuan C, Li C, Yan L, Jackson AO, Liu Z, Han C, Yu J, Li D (2011) A high throughput barley stripe mosaic virus vector for virus inducedgene silencing in monocots and dicots. PLOS One 6: e26468.


Zhang JC, Zheng HY, Li YW, Li HJ, Liu X, Qin HJ, Dong LL, Wang DW (2016) Coexpression network analysis of the genes regulated bytwo types of resistance responses to powdery mildew in wheat. Sci Rep 6: 23805


Zheng H, Dong L, Han X, Jin H, Yin C, Han Y, Li B, Qin H, Zhang JS, Shen Q, et al (2020) The TuMYB46L-TuACO3 module regulatesethylene biosynthesis in einkorn wheat defense to powdery mildew. New Phytol 225: 2526-2541


Zheng H, Rowland O, Kunst L (2005) Disruptions of the Arabidopsis Enoyl-CoA reductase gene reveal an essential role for very-long-chain fatty acid synthesis in cell expansion during plant morphogenesis. Plant Cell 17: 1467-1481


Zhou S, Jiang W, Long F, Cheng S, Yang W, Zhao Y, Zhou DX (2017) Rice homeodomain protein WOX11 recruits a histoneacetyltransferase complex to establish programs of cell proliferation of crown root meristem. Plant Cell 29: 1088-1104


Zhu L, Guo J, Zhu J, Zhou C (2014) Enhanced expression of EsWAX1improves drought tolerance with increased accumulation ofcuticular wax and ascorbic acid in transgenic Arabidopsis. Plant Physiol Biochem 75: 24-35


Zhu YF, Li YB, Fei F, Wang ZK, Wang W, Cao AZ, Liu Y, Han S, Xing LP, Wang HY, et al (2015) An E3 ubiquitin ligase gene CMPG1-V fromHaynaldia villosa L. contributes to the powdery mildew resistance in common wheat (Triticum aestivum L.). Plant J 84: 154-168


Zou S, Wang H, Li Y, Kong Z, Tang D (2018) The NB-LRR gene Pm60 confers powdery mildew resistance in wheat. New Phytol 218: 298-309


Ziv C, Zhao Z, Gao YG, Xia Y (2018) Multifunctional roles of plant cuticle during plant-pathogen interactions. Front Plant Sci 9: 1088Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title


https://www.ncbi.nlm.nih.gov/pubmed?term=Xing L%2C Hu P%2C Liu J%2C Witek K%2C Zhou S%2C Xu J%2C Zhou W%2C Gao L%2C Huang Z%2C Zhang R%2C et al %282018%29 Pm21 from Haynaldia villosa encodes a CC%2DNBS%2DLRR protein conferring powdery mildew resistance in wheat%2E Mol Plant&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Xing&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Pm21 from Haynaldia villosa encodes a CC-NBS-LRR protein conferring powdery mildew resistance in wheat&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Pm21 from Haynaldia villosa encodes a CC-NBS-LRR protein conferring powdery mildew resistance in wheat&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Xing&as_ylo=2018&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Yang X%2C Zhao H%2C Kosma DK%2C Tomasi P%2C Dyer JM%2C Li R%2C Liu X%2C Wang Z%2C Parsons EP%2C Jenks MA%2C et al %282017%29 The acyl desaturase CER17 is involved in producing wax unsaturated primary alcohols and cutin monomers%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yang&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The acyl desaturase CER17 is involved in producing wax unsaturated primary alcohols and cutin monomers&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The acyl desaturase CER17 is involved in producing wax unsaturated primary alcohols and cutin monomers&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yang&as_ylo=2017&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Yeats TH%2C Rose JK %282013%29 The formation and function of plant cuticles%2E Plant Physiol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yeats&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The formation and function of plant cuticles&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The formation and function of plant cuticles&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yeats&as_ylo=2013&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Yuan C%2C Li C%2C Yan L%2C Jackson AO%2C Liu Z%2C Han C%2C Yu J%2C Li D %282011%29 A high throughput barley stripe mosaic virus vector for virus induced gene silencing in monocots and dicots%2E PLOS One 6%3A e&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Yuan&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=A high throughput barley stripe mosaic virus vector for virus induced gene silencing in monocots and dicots&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=A high throughput barley stripe mosaic virus vector for virus induced gene silencing in monocots and dicots&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Yuan&as_ylo=2011&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Zhang JC%2C Zheng HY%2C Li YW%2C Li HJ%2C Liu X%2C Qin HJ%2C Dong LL%2C Wang DW %282016%29 Coexpression network analysis of the genes regulated by two types of resistance responses to powdery mildew in wheat%2E Sci Rep&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhang&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Coexpression network analysis of the genes regulated by two types of resistance responses to powdery mildew in wheat.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Coexpression network analysis of the genes regulated by two types of resistance responses to powdery mildew in wheat.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhang&as_ylo=2016&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Zheng H%2C Dong L%2C Han X%2C Jin H%2C Yin C%2C Han Y%2C Li B%2C Qin H%2C Zhang JS%2C Shen Q%2C et al %282020%29 The TuMYB46L%2DTuACO3 module regulates ethylene biosynthesis in einkorn wheat defense to powdery mildew%2E New Phytol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zheng&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The TuMYB46L-TuACO3 module regulates ethylene biosynthesis in einkorn wheat defense to powdery mildew&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The TuMYB46L-TuACO3 module regulates ethylene biosynthesis in einkorn wheat defense to powdery mildew&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zheng&as_ylo=2020&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Zheng H%2C Rowland O%2C Kunst L %282005%29 Disruptions of the Arabidopsis Enoyl%2DCoA reductase gene reveal an essential role for very%2Dlong%2Dchain fatty acid synthesis in cell expansion during plant morphogenesis%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zheng&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Disruptions of the Arabidopsis Enoyl-CoA reductase gene reveal an essential role for very-long-chain fatty acid synthesis in cell expansion during plant morphogenesis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Disruptions of the Arabidopsis Enoyl-CoA reductase gene reveal an essential role for very-long-chain fatty acid synthesis in cell expansion during plant morphogenesis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zheng&as_ylo=2005&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Zhou S%2C Jiang W%2C Long F%2C Cheng S%2C Yang W%2C Zhao Y%2C Zhou DX %282017%29 Rice homeodomain protein WOX11 recruits a histone acetyltransferase complex to establish programs of cell proliferation of crown root meristem%2E Plant Cell&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhou&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Rice homeodomain protein WOX11 recruits a histone acetyltransferase complex to establish programs of cell proliferation of crown root meristem&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Rice homeodomain protein WOX11 recruits a histone acetyltransferase complex to establish programs of cell proliferation of crown root meristem&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhou&as_ylo=2017&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Zhu L%2C Guo J%2C Zhu J%2C Zhou C %282014%29 Enhanced expression of EsWAX1improves drought tolerance with increased accumulation of cuticular wax and ascorbic acid in transgenic Arabidopsis%2E Plant Physiol Biochem&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhu&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Enhanced expression of EsWAX1improves drought tolerance with increased accumulation of cuticular wax and ascorbic acid in transgenic Arabidopsis&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Enhanced expression of EsWAX1improves drought tolerance with increased accumulation of cuticular wax and ascorbic acid in transgenic Arabidopsis&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhu&as_ylo=2014&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Zhu YF%2C Li YB%2C Fei F%2C Wang ZK%2C Wang W%2C Cao AZ%2C Liu Y%2C Han S%2C Xing LP%2C Wang HY%2C et al %282015%29 An E3 ubiquitin ligase gene CMPG1%2DV from Haynaldia villosa L%2E contributes to the powdery mildew resistance in common wheat %28Triticum aestivum L%2E%29%2E Plant J&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zhu&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=An E3 ubiquitin ligase gene CMPG1-V from Haynaldia villosa L&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=An E3 ubiquitin ligase gene CMPG1-V from Haynaldia villosa L&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zhu&as_ylo=2015&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Zou S%2C Wang H%2C Li Y%2C Kong Z%2C Tang D %282018%29 The NB%2DLRR gene Pm60 confers powdery mildew resistance in wheat%2E New Phytol&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Zou&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=The NB-LRR gene Pm60 confers powdery mildew resistance in wheat&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=The NB-LRR gene Pm60 confers powdery mildew resistance in wheat&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Zou&as_ylo=2018&as_allsubj=all&hl=en&c2coff=1

https://www.ncbi.nlm.nih.gov/pubmed?term=Ziv C%2C Zhao Z%2C Gao YG%2C Xia Y %282018%29 Multifunctional roles of plant cuticle during plant%2Dpathogen interactions%2E Front Plant Sci&dopt=abstract

https://scholar.google.com/scholar?as_q=&num=10&as_occt=any&as_sauthors=Ziv&hl=en&c2coff=1

https://scholar.google.com/scholar?as_q=Multifunctional roles of plant cuticle during plant-pathogen interactions.&num=10&btnG=Search+Scholar&as_epq=&as_oq=&as_eq=&as_occt=any&as_publication=&as_yhi=&as_allsubj=all&hl=en&lr=&c2coff=1

https://scholar.google.com/scholar?as_q=Multifunctional roles of plant cuticle during plant-pathogen interactions.&num=10&btnG=Search+Scholar&as_occt=any&as_sauthors=Ziv&as_ylo=2018&as_allsubj=all&hl=en&c2coff=1


Date post:	14-Jul-2020
Category:	Documents
Upload:	others
View:	8 times
Download:	0 times

Epigenetic Activation of Enoyl-CoA Reductase By An …€¦ · 104 (OsWOX11) could interact with...

Documents