The EMBO Journal vol.1 1 no.3 pp. 1065 - 1073, 1992 A conserved 1 1 nucleotide sequence contains an essential promoter element of the maize mitochondrial atp1 gene William D.Rapp and David B.Stern Boyce Thompson Institute for Plant Research, Cornell University, Tower Road, Ithaca, NY 14853, USA Communicated by D.Lonsdale To determine the structure of a functional plant mitochondrial promoter, we have partially purified an RNA polymerase activity that correctly initiates transcription at the maize mitochondrial atpl promoter in vitro. Using a series of 5' deletion constructs, we found that essential sequences are located within -19 nucleotides (nt) of the transcription initiation site. The region surrounding the initiation site includes conserved sequence motifs previously proposed to be maize mitochondrial promoter elements. Deletion of a conserved 11 nt sequence showed that it is critical for promoter function, but deletion or alteration of conserved upstream G(A/T)3-4 repeats had no effect. When the atpl 11 nt sequence was inserted into different plasmids lacking mitochondrial promoter activity, transcription was only observed for one of these constructs. We infer from these data that the functional promoter extends beyond this motif, most likely in the 5' direction. The maize mitochondrial cox3 and atp6 promoters also direct transcription initiation in this in vitro system, suggesting that it may be widely applicable for studies of mitochondrial transcription in this species. Key words: in vitro transcription/promoter/mitochondrial DNA/maize demonstrated that each promoter has a characteristic strength, with the ribosomal RNA promoters being the strongest (Finnegan and Brown, 1990; Mulligan et al., 1991). Inspection of sequences surrounding transcription initiation sites in maize, defined by guanylyl transferase capping experiments, identified a putative 11 nucleotide (nt) promoter element with a loose consensus sequence (Mulligan et al., 1991). In addition, the repeated motif G(A/T)3_4 is found upstream of this element in some genes and the number of copies of this motif can be roughly correlated with promoter strength as judged by run-on transcription. Despite the progress that has been achieved in the analysis of plant mitochondrial gene expression, the mechanisms of transcriptional regulation have remained elusive. In particular, the inability to transcribe plant mtDNA in vitro has precluded the functional definition of promoter and transcription termination elements. To determine the structure of maize mitochondrial promoters, we have developed an in vitro transcription system. Our transcription system is similar to one from wheat that was recently reported to initiate accurately at the cox2 promoter (Hanic- Joyce and Gray, 1991). We have used the maize in vitro transcription system to study initiation at the atpl promoter (atpl encodes the ce-subunit of the F1 -FO ATPase). We demonstrate an absolute requirement for the proposed consensus promoter; however, the G(A/T)3_4 motif is dispensable in vitro. This is the first reported functional analysis of a plant mitochondrial promoter. Results Introduction Mitochondrial DNA (mtDNA) encodes several components of the respiratory chain, the F I-Fo ATPase and the mitochondrial translational apparatus. The organization and expression patterns of mitochondrial genomes vary widely between animals, fungi and plants. The vertebrate mitochondrial genome is 16 kb in size and genome-length precursor RNAs are synthesized from both DNA strands from promoters within the D loop (Tzagoloff and Myers, 1986; Clayton, 1991). The Saccharomyces cerevisiae mitochondrial genome is - 75 kb in size and transcription initiates at - 20 copies of a highly conserved nonanucleotide sequence (Constanzo and Fox, 1990). Plant mitochondria differ from their animal and fungal counterparts in that their genomes are large and that numerous transcripts can be identified from individual genes (Newton, 1988; Levings and Brown, 1989; Lonsdale, 1989). These complex transcript patterns result from the recombinogenic properties of plant mtDNA, promoter multiplicity for many genes and post-transcriptional processing events. Transcriptional run-on experiments in maize have Oxford University Press Development of a maize mitochondrial in vitro transcription system Plasmid pBHO.7, which contains the maize mitochondrial atpl promoter, was used to monitor in vitro transcription (Figure IA; see Mulligan et al., 1991). Atpl was chosen because, based on run-on transcription assays, it is one of the most actively transcribed protein-coding genes. Also, the atpl gene appears to utilize a single promoter, in contrast to most other maize mitochondrial protein-coding genes analyzed thus far (Mulligan et al., 1988a, 1988b, 1991; Kennell and Pring, 1989). To isolate mitochondrial protein fractions possessing promoter-specific transcriptional activity, a lysate of isolated mitochondria was clarified to yield a membrane-free soluble protein fraction (S-100). The S-100 fraction displayed non- specific transcriptional activity when double-stranded poly(dA -dT) was used as a template, as evidenced by the incorporation of [a-32P]UTP into high molecular weight RNA (data not shown). This activity was enriched in 20-30% and 30-50% (w/v) ammonium sulfate fractions of the S-100 fraction. However, neither the S-100 nor the ammonium sulfate fractions initiated transcription at the atpl promoter in pBHO.7. The transcriptionally active ammonium sulfate fractions 1065
Transcript
The EMBO Journal vol.1 1 no.3 pp. 1065 - 1073, 1992
A conserved 1 1 nucleotide sequence contains an
essential promoter element of the maize mitochondrialatp1 gene
William D.Rapp and David B.SternBoyce Thompson Institute for Plant Research, Cornell University,Tower Road, Ithaca, NY 14853, USA
Communicated by D.Lonsdale
To determine the structure of a functional plantmitochondrial promoter, we have partially purified anRNA polymerase activity that correctly initiatestranscription at the maize mitochondrial atpl promoterin vitro. Using a series of 5' deletion constructs, we foundthat essential sequences are located within-19 nucleotides (nt) of the transcription initiation site.The region surrounding the initiation site includesconserved sequence motifs previously proposed to bemaize mitochondrial promoter elements. Deletion of aconserved 11 nt sequence showed that it is critical forpromoter function, but deletion or alteration of conservedupstream G(A/T)3-4 repeats had no effect. When theatpl 11 nt sequence was inserted into different plasmidslacking mitochondrial promoter activity, transcriptionwas only observed for one of these constructs. We inferfrom these data that the functional promoter extendsbeyond this motif, most likely in the 5' direction. Themaize mitochondrial cox3 and atp6 promoters also directtranscription initiation in this in vitro system, suggestingthat it may be widely applicable for studies ofmitochondrial transcription in this species.Key words: in vitro transcription/promoter/mitochondrialDNA/maize
demonstrated that each promoter has a characteristicstrength, with the ribosomal RNA promoters being thestrongest (Finnegan and Brown, 1990; Mulligan et al.,1991). Inspection of sequences surrounding transcriptioninitiation sites in maize, defined by guanylyl transferasecapping experiments, identified a putative 11 nucleotide (nt)promoter element with a loose consensus sequence (Mulliganet al., 1991). In addition, the repeated motif G(A/T)3_4 isfound upstream of this element in some genes and the numberof copies of this motif can be roughly correlated withpromoter strength as judged by run-on transcription.
Despite the progress that has been achieved in the analysisof plant mitochondrial gene expression, the mechanisms oftranscriptional regulation have remained elusive. Inparticular, the inability to transcribe plant mtDNA in vitrohas precluded the functional definition of promoter andtranscription termination elements. To determine thestructure of maize mitochondrial promoters, we havedeveloped an in vitro transcription system. Our transcriptionsystem is similar to one from wheat that was recentlyreported to initiate accurately at the cox2 promoter (Hanic-Joyce and Gray, 1991). We have used the maize in vitrotranscription system to study initiation at the atpl promoter(atpl encodes the ce-subunit of the F1 -FO ATPase). Wedemonstrate an absolute requirement for the proposedconsensus promoter; however, the G(A/T)3_4 motif isdispensable in vitro. This is the first reported functionalanalysis of a plant mitochondrial promoter.
Results
IntroductionMitochondrial DNA (mtDNA) encodes several componentsof the respiratory chain, the FI-Fo ATPase and themitochondrial translational apparatus. The organization andexpression patterns of mitochondrial genomes vary widelybetween animals, fungi and plants. The vertebratemitochondrial genome is 16 kb in size and genome-lengthprecursor RNAs are synthesized from both DNA strandsfrom promoters within the D loop (Tzagoloff and Myers,1986; Clayton, 1991). The Saccharomyces cerevisiaemitochondrial genome is - 75 kb in size and transcriptioninitiates at - 20 copies of a highly conserved nonanucleotidesequence (Constanzo and Fox, 1990).
Plant mitochondria differ from their animal and fungalcounterparts in that their genomes are large and thatnumerous transcripts can be identified from individual genes(Newton, 1988; Levings and Brown, 1989; Lonsdale, 1989).These complex transcript patterns result from therecombinogenic properties of plant mtDNA, promotermultiplicity for many genes and post-transcriptionalprocessing events.
Transcriptional run-on experiments in maize have
Oxford University Press
Development of a maize mitochondrial in vitrotranscription systemPlasmid pBHO.7, which contains the maize mitochondrialatpl promoter, was used to monitor in vitro transcription(Figure IA; see Mulligan et al., 1991). Atpl was chosenbecause, based on run-on transcription assays, it is one ofthe most actively transcribed protein-coding genes. Also, theatpl gene appears to utilize a single promoter, in contrastto most other maize mitochondrial protein-coding genesanalyzed thus far (Mulligan et al., 1988a, 1988b, 1991;Kennell and Pring, 1989).To isolate mitochondrial protein fractions possessing
promoter-specific transcriptional activity, a lysate of isolatedmitochondria was clarified to yield a membrane-free solubleprotein fraction (S-100). The S-100 fraction displayed non-specific transcriptional activity when double-strandedpoly(dA -dT) was used as a template, as evidenced by theincorporation of [a-32P]UTP into high molecular weightRNA (data not shown). This activity was enriched in20-30% and 30-50% (w/v) ammonium sulfate fractionsof the S-100 fraction. However, neither the S-100 nor theammonium sulfate fractions initiated transcription at the atplpromoter in pBHO.7.The transcriptionally active ammonium sulfate fractions
1065
W.D.Rapp and D.B.Stern
were combined and subjected to anion-exchange FPLC andproteins were eluted by step-wise increases in KClconcentration (see Materials and methods). The resultantfractions were then assayed for transcriptional activity usingHindIII-linearized pBHO.7; we found that a transcript of-300 nt was synthesized using proteins that eluted with
0.3 M KCl (Figure IB, lane 0.3). This was close in size tothe 298 nt transcript expected if transcription initiatedaccurately and terminated at the end of the linear template.No product of this size was synthesized when HindIll-linearized vector replaced pBHO.7 as template (data notshown). The heterogeneous RNA migrating above the 300 nttranscript was observed using linearized vector, indicatingthat this RNA results from non-specific transcription ofvector DNA. Similar non-specific transcriptional activitiesobserved in other in vitro transcription systems have beenattributed to non-specific initiation by RNA polymerase atnicks or ends of linear templates, or to the partial dissociationof a specificity factor from a core polymerase (Weil et al.,1979; Orozco et al., 1985; Hanic-Joyce and Gray, 1991).
However, since the synthesis of the 300 nt transcript isabsolutely dependent upon atpl sequences and since initiationoccurs precisely at the same site as atpl mRNA initiationin vivo (see below), this protein fraction can be used withconfidence to investigate atpi promoter structure. In somepreparations, protein that eluted with 0.2 M KCl alsodisplayed a low level of atpl promoter-specifictranscriptional activity (Figure iB, lane 0.2), but this fractionappeared to contain higher levels of non-specifictranscriptional activity. Consequently, the 0.3 M KCl elutedfraction was used in all subsequent in vitro transcriptionexperiments.
Atp 1 transcription initiates accurately in vitroTo establish that transcription initiates accurately at the atpipromoter in vitro, we first compared transcripts synthesizedusing KpnI-linearized pBHO.7 with those synthesized usingthe HindIl-linearized template. KpnI cleaves pBHO.7 in thepolylinker region 34 nt downstream of the HindlIl site(Figure IA). Thus, KpnI-linearized pBHO.7 should directthe synthesis of a 332 nt transcript. Figure 2 shows thattranscripts of the expected sizes were indeed obtained usingHindIII and KpnI-digested pBHO.7.To determine the precise site of transcription initiation in
vitro, the 5' end of the 298 nt transcript was mapped byprimer extension. An oligonucleotide complementary to theatpi sense strand was annealed to in vitro-synthesized RNAand to total RNA isolated from maize mitochondria, andcDNA synthesis was carried out using reverse transcriptase.Figure 3 shows that the primer extension products of invitro-synthesized RNA and total maize mitochondrial RNAare identical (compare lanes 1 and 2). When in vitro-synthesized atpi RNA was treated with RNase A prior tohybridization with the primer, or when pBHO.7 templateDNA was omitted from the in vitro transcription reaction,
4127
g_ _k 332r r
311
Fig. 1. Assay of mitochondrial protein fractions for promoter-specifictranscriptional activity. (A) pBHO.7 contains a 0.7 kb fragment fromthe 5' non-coding region of the maize mitochondrial atpl gene
(Mulligan et al., 1991). The top arrow represents the atpltranscription initiation site. BamHI (B), HindlIl (H) and KpnI (K)restriction sites are indicated. The sizes of RNA molecules expectedfrom initiation at the atpl promoter followed by transcriptional run-offof HindIII or KpnI linearized templates are indicated. (B) Proteins thateluted from a Pharmacia Mono-Q FPLC column in buffer containing0.1, 0.2, 0.3 or 0.5 M KCI were assayed for promoter-specifictranscriptional activity using HindIII-linearized pBH0.7 as a template(see Materials and methods). In vitro transcription products were
electrophoresed in a 5% denaturing polyacrylamide gel. The arrow tothe right indicates the 298 nt transcript. Mobilities of DNA sizestandards are indicated in nt.
1066
298 lrt.
249
Fig. 2. Run-off transcript analysis. pBHO.7 was linearized with HindlIlor KpnI (see Figure IA) and used as a template in standard in vitrotranscription reactions. Products were electrophoresed in a 5%denaturing polyacrylamide gel. Mobilities of DNA size standards areindicated in nt. HindIII and KpnI linearized templates direct thesynthesis of 298 nt (lane H) and 332 nt (lane K) transcripts,respectively.
Maize mitochondrial transcription
no primer extension products were generated (Figure 3,lanes 3 and 4). This demonstrates that template-dependentRNA synthesis is occurring in vitro. Comparison of theprimer extension products with the sequence ladder showsthat the 5' ends of both the in vitro and in vivo-synthesizedtranscripts map to the previously identifed atpl transcriptioninitiation site (Figure 3; Mulligan et al., 1991). This site lieswithin an 11 nt consensus sequence that was proposed tobe a maize mitochondrial promoter element (Mulligan et al.,1991).
Upstream sequence requirements for atp 1 in vitrotranscriptionTo identify the extent of upstream sequences required foratpi transcription initiation, a series of 5' deletion constructswas generated (see Materials and methods; Figure 4A).Selected constructs were linearized and tested for their abilityto direct transcription of a 298 nt RNA species as describedabove. Figure 4B shows that deletion of 5' non-transcribed
T AAT
T A
TA
AT
T A
TAATT A
ATA
T A
AA
T A
Fig. 3. Accurate in vitro transcription initiation at the atpi promoter.An end-labeled oligonucleotide (BRIO, see Materials and methods) washybridized with maize mitochondrial RNA or with atpl RNAsynthesized in vitro using HindUI linearized pBHO.7 as a template.Primers were extended using MMLV reverse transcriptase andelectrophoresed in a 6% denaturing polyacrylamide gel. Lane 1,primer extension products from maize mitochondrial RNA; lane 2,primer extension products from in vitro-synthesized atpl RNA; lane 3,same as lane 2 except that RNA was treated with RNase A prior tohybridization with the primer; lane 4, same as lane 2 exceptpBHO.7 DNA was omitted from the in vitro transcription reaction.Dideoxynucleotide sequencing reactions using the end-labeled primerand double-stranded pBHO.7 were run in adjacent lanes to allow theprecise identification of the atpl RNA 5' ends. The sequencesurrounding 5' ends is shown to the left. The in vivo transcriptioninitiation site (arrow) and the conserved 11 nt motif (boxed sequence)are indicated (Mulligan et al., 1991).
J.-__-sw. _
sequences to within 19 nt of the transcription initiation sitehad no significant effect on in vitro transcriptional activity.Deletion of an additional 16 bp, however, reducedtranscriptional activity by 90-95% (Figure 4B; lane A -3).This deletion removes the first 2 nt of the consensuspromoter. A deletion that extends 4 nt beyond thetranscription initiation site abolished transcriptional activity(Figure 4B; lane z +4).As discussed above, it was previously proposed that the
maize mitochondrial promoter consists of two elements, an11 nt motif surrounding the transcription initiation site andan upstream G(A/T)3-4 motif that is present in one toseveral copies (Mulligan et al., 1991). Two G(A/T)3>4sequences are found upstream of the atpl transcriptioninitiation site, GTTAT at nucleotides -27 to -23 andGAAAA at -13 to -9. In pBHO.7A-19, the GTTATsequence has been deleted, but a fortuitous G(A/T)3-4sequence in the vector (GAATT) was brought into proximityof the initiation site (nucleotides -26 to -22) during theconstruction of this mutant. Therefore, while the observationthat template pBHO.7A -19 supports accurate initiationallows us to conclude that there is not a requirement forspecific sequences upstream of nucleotide -19, it does notallow us to draw any conclusions about the role of theG(A/T)3-4 repeats in promoting atpl transcription.
Role of conserved motifs in promoting transcriptionTo determine if the 11 nt and G(A/T)3-4 sequences areabsolutely required for transcription initiation, thesesequences were specifically deleted from or altered in theatpl promoter by oligonucleotide-directed mutagenesis. InpBHO.7A13nt, the 11 nt consensus sequence, along with the5' and 3' flanking nucleotides, has been deleted (Figure 5A).Figure 5B (left) shows that this 13 nt deletion abolishedtranscription initiation at the atpi promoter. We concludethat the deleted region contains an essential part of the atplpromoter.To determine if the two G(A/T)3-4 repeats immediately
upstream of the 11 nt sequence are required for transcriptioninitiation, these sequences were altered by nucleotidesubstitutions. In pBHO.7/BR21, the G(A/T)3_4 elementlocated at nucleotides -13 to -9 was mutated andcorresponding mutations were made to alter the G(A/T)3-4element located at nucleotides -27 and -23 and generatepBHO.7/BR22 (Figure SA). In pBHO.7/BR21+22 bothG(A/T)34 elements have been mutated. Figure SB (right)shows that pBHO.7, pBHO.7/BR21, pBHO.7/BR22 andpBHO.7/BR21+22 all directed similar levels of transcription(the differences in transcript levels seen in Figure SB werefound not to be significant upon repetition of the experiment).Therefore, the G(A/T)34 repeats are not required for atpipromoter function in vitro, though we cannot rule out thepossibility that these elements influence atpl transcriptionin vivo through an interaction with additional factor(s) thatare not present in our transcription extract.Although the results presented in Figures 4 and 5
demonstrate that the 11 nt consensus motif includessequences that are required for atpi transcription initiation,they do not prove that the 11 nt sequence alone constitutesa functional promoter. To determine if the atpl 11 ntconsensus sequence is sufficient to promote transcription,an oligonucleotide with the same sequence (ACGTATTA-AAA) was inserted upstream of three cloned DNA fragmentsthat had no mitochondrial promoter activity (Figure 6A). In
1067
W.D.Rapp and D.B.Stern
.A-.9?;AAA.f. .AA
p .1 .. A'.AAAIe GTATTAAA(AAAAAC A -'41A A Ti T'-"A AA{xmTTA - AAA CAAAG. A
;"AAAAc;TATA;..CAAAG ... A .3 I
AlATTAAA CAAA G A 3.3AC.AAAG ...A 4
0a
L Kr-CO ,--
I'4.i. +
nt
427
298 nt-- rn-rn 311
249
Fig. 4. Effects of 5' deletions on atpl transcription initiation in vitro. (A) The sequence of the atpl promoter region and the 5' deletion constructsdescribed in Materials and methods are shown. The 11 nt (boxed) and G(A/T)3_4 (underlined) motifs are indicated, and an arrow indicates thetranscription initiation site (+ 1). (B) pBHO.7 and the six 5' deletion constructs shown in Figure 4A were linearized with HindIII and used astemplates in standard in vitro transcription reactions. Products were electrophoresed in a 4% denaturing polyacrylamide gel. Mobilities of DNA sizestandards are indicated in nt. The 298 nt atpl transcript is indicated.
p3'IR+ I1, the 11 bp sequence was inserted upstream of afragment from the 3' non-coding region of the maizemitochondrial atp9 gene (R.M.Mulligan, personalcommunication). In p(-G) + I1, the 11 bp sequence wasinserted upstream of a 'G-less' cassette (Sawadogo andRoeder, 1985), which encodes a 377 nt stretch of RNAdevoid ofG residues. In pCAB+ 11, the 11 bp sequence wasinserted upstream of a cDNA fragment corresponding to the3' region of a pea chlorophyll a/b binding protein gene(Coruzzi et al., 1983). When assayed for in vitro activity,only p3'IR+ lI directed the synthesis of a transcript of theexpected size (Figure 6B). Lane 3'IR shows that no discretetranscript was synthesized when the atp9 fragment alone wasused as a template. Thus, although the 11 nt element alonedoes not appear to be sufficient to promote transcriptioninitiation, it apparently contains enough of the promotersequence to direct transcription initiation if placed in anappropriate sequence context (see Discussion). We cannotrule out, however, the possibility that transcriptionallyinhibitory elements are fortuitously present in bothp(-G)+l1 and pCAB+ 11.
1068
In vitro transcription initiation at the maizemitochondrial cox3 and atp6 promotersTo determine if promoters other than atpl are active in ourin vitro system, the promoters for the maize mitochondrialgenes encoding cytochrome oxidase subunit 3 (cox3) andATPase subunit 6 (atp6) were tested.Three promoters for cox3 were previously mapped to a
1.4 kb fragment contained in clone pTL42 (Figure 7A;Mulligan et al., 1988a). The linearized clone was predictedto direct the synthesis of 215 and 175 nt transcripts, as wellas a large transcript that could not be resolved in our gelsystem. As shown in Figure 7B (lane cox3), transcripts ofthe expected sizes were observed. We have confirmed byprimer extension analysis that initiation in vitro and in vivooccurs at the same sites (A.Cobb, W.Rapp and D.Stern,unpublished data).
Six promoters for atp6 have previously been mapped toa 1.1 kb fragment contained in clone pHBsN1.1 (Figure 7A;R.M.Mulligan, personal communication). Figure 7B (laneatp6) shows that a predominant transcript of - 330 nt wassynthesized using this template. This was the size expected
Maize mitochondrial transcription
A.AA.- L:7A::AAGCCALAAAGAfT7 ATTAAA -AA
.AAGTGT T >,L A .AA CC GAAAAG -v... AATGCCTT.TT A::AA:ATTAAAAG:AE-GTAAAAgA3A
Fig. 5. Effects of oligonucleotide-directed mutations on atpl transcription initiation in vitro. (A) Oligonucleotides were used to direct a deletion (seeline replacing nucleotides -6 to +7 in pBHO.7A13 nt) or nucleotide substitutions (indicated by asterisks) in pBHO.7. The 11 nt (boxed) andG(A/T)3-4 (underlined) motifs are indicated. (B) Standard in vitro transcription reactions were performed using HindHI-linearized pBHO.7A13 nt(left), and pBHO.7/BR21, pBHO.7/BR22 and pBHO.7/BR21 +22 (right). For comparison, identical reactions using pBHO.7 were performed with eachexperiment (lanes pBHO.7). The 298 nt atpl transcripts are indicated.
if transcription initiated at the distal promoter, which is alsothe most active of the atp6 promoters in vivo, as determinedby the relative abundance of primary transcripts(R.M. Mulligan, personal communication). In addition,minor transcripts of -240 and 160 nt were synthesized,along with several others ranging from 270 to 300 nt. The240 and 160 nt transcripts were of the sizes expected iftranscription initiated at two of the other atp6 promotersmapped to pHBsN1. 1 (Figure 7A).
DiscussionWe have developed and exploited a maize mitochondrial invitro transcription system that accurately initiatestranscription at several cloned maize mitochondrialpromoters. Our analysis of atpl distinguishes this plantmitochondrial promoter from mitochondrial promoters ofother organisms. Unlike the atpl promoter, which appearsto consist of a single sequence block, mammalianmitochondrial promoters span - 50 nt and are bipartite(Clayton, 1991). Although the atpl promoter bears someresemblance to the highly conserved octanucleotide andnonanucleotide promoters of Xenopus laevis and S. cerevisiae(discussed below), our and others' analyses suggest that plant
mitochondrial promoters are relatively fluid in sequence.Furthermore, transcription initiates at different positionswithin the maize consensus sequence (Mulligan et al., 1991),although a similar consensus sequence can also be formedbased on alignments at the initiation site (Lonsdale, 1989).This is in contrast to S. cerevisiae, in which initiation usuallyoccurs at the last nucleotide of the nonanucleotide consensussequence (Osinga and Tabak, 1982; Christianson andRabinowitz, 1983). In general, the maize atpl promoterappears to resemble X. laevis and S. cerevisiae mitochondrialpromoters more closely than mammalian promoters.
Atp 1 promoter structureOur deletion mutagenesis studies suggest that essentialupstream atpl promoter sequences lie within 19 nt of thetranscription initiation site. Deletion of sequences to within3 nt of the initiation site reduced transcription by 90-95%.This deletion replaced the first 2 nt of a conserved 11 ntmotif with vector sequences, but did not appear to alter theinitiation site. When the first three transcribed nucleotideswere deleted, no promoter activity was detected. Theseresults establish that a critical region of the atpl promoteris located between -3 and + 3 nt relative to the initiationsite and suggest that at least part of the sequence between
1069
W.D.Rapp and D.B.Stern
;-ess cassette._. .. i'*
APiEt_rco._._icb cDNA
4--:. rL.U.. , ei7x. ., .0
cn 1-i 1- u
427
1Ii
239_
249
'200
Fig. 6. In vitro transcription of 11 nt insertion constructs. (A) An11 bp fragment (11 nt box) with a sequence matching the consensuspromoter of atpl was inserted upstream of three different cloned DNAfragments. In p3'IR +11 the promoter fragment was inserted upstreamof a 0.3 kb fragment from the 3' non-coding region of the maizemitochondrial atp9 gene. In p(-G) +1, the promoter fragment wasinserted upstream of a synthetic 0.4 kb fragment that encodes a 377 ntRNA devoid of G residues (G-less cassette). In pCAB(+ 11), thepromoter fragment was inserted upstream of a 0.3 kb pea chlorophyllalb binding protein cDNA. Arrows show sizes of RNAs predictedfrom transcriptional run-off to the end of templates linearized by theindicated restriction endonucleases (Sc, SacI; B, BamHI; H, HindlIl).(B) The 11 nt insertion constructs and the corresponding clones lackingthe 11 nt inserts described in Figure 6A were linearized (at therestriction sites shown in Figure 6A) and tested as templates usingstandard in vitro transcription conditions. Electrophoresis and sizestandards are as in Figure 4. The arrow indicates the 230 nt transcriptdirected by p3'IR+ l1 nt.
nucleotides -19 to -4 is important in determining promoterstrength. We cannot rule out the possibility that the decreasedpromoter activity associated with pBHO.7A-3 is due to anegative effect by some region of the vector that was broughtinto proximity of the atpl promoter in the construction ofthis plasmid. However, the observation that the atplsequence from nucleotides -5 to +6 (11 nt sequence) wasinsufficient to promote transcription in two out of threecontexts tested (Figure 6; discussed below) indicates that part
Fig. 7. In vitro transcription of maize mitochondrial atp6 and cox3genes. (A) pTL42 and pHBsN1.1 contain 1.4 kb and 1.1 kb fragmentsfrom the 5' non-coding regions of maize mitochondrial cox3 and atp6genes, respectively. Sites of transcription initiation in vivo for cox3(Mulligan et al., 1988a) and for atp6 (R.M.Mulligan, personalcommunication) are indicated by arrows above the boxes (forpHBsN1.1, the two arrows closest to the BstNI site each represent apair of closely spaced transcription initiation sites). The predicted sizesof in vitro run-off transcripts for KpnI-linearized pTL42 and Sacl-linearized pHBsN1 .1 are indicated by arrows under the boxes.Restriction sites are Bg, BglIl; Bs, BstNI; H, HindIII; K, KpnI; andX, XAoI. (B) HindIII-linearized pBHO.7 (lane atpl, see alsoFigure IA), SacI-linearized pHBsN1.1 (lane atp6) and KpnI-linearizedpTL42 (lane cox3) were transcribed in vitro, and the products wereelectrophoresed in a 4% polyacrylamide denaturing gel. Arrowsindicate in vitro transcripts and their sizes. Sizes were assigned basedon primer extension data of in vitro transcripts (Figure 3 for atpl;Cobb, Rapp and Stem, unpublished data, for cox3) and the assumptionthat transcription proceeds to the ends of the linear templates. For atp6transcripts (marked with asterisks), primer extension analysis has notbeen performed and sizes are based on predicted mobilities and DNAsize standards.
of the sequence outside of this region is also important forpromoter activity.Two conserved sequence motifs near the transcription
initiation sites of a number of maize mitochondrial geneshave been postulated to function as promoter elements
1070
.,! :: :. ...
d.
1?:. rct;
71
i. :1 x.
330298 nt loo. Am*
.V:
230 nt
Maize mitochondrial transcription
atpl
atpl G(A/T)3-4 mutant
atp9 3'IR + 11 nt
cox3 (-355)
cox3 (-315)
G-less + 11 nt
cab cDNA + 11 nt
... TAAGCCGAAAAGTP
...TAATATTAAAAGTP
...CTTGATATCGAATI
... ACAGATGAGAAATC
... ACGGATGAGAATTC
CGTATTAAAI
ACGTATTAAA1
ACGTATTAAA-
ACGTATCTTAC
kCGTATTCAAA
ACAA ...
ACAA ...
kATT...
'TAT...
..TGG...
... CTAGTGGATCCCCC1ACGTATTAAA7I3GGC...
... GGCCAGTGAATTC ACGTATTATT- CCAT...
Fig. 8. Comparison of sequences with promoter activity. The atpl promoter (clone pBHO.7), atpl promoter G(A/T)3-4 sequence mutant (clonepBHO.7/BR2 1), atp9 3' inverted repeat (IR) with atpl 11 nt sequence insert (clone p3' IR+ l1) and the two cox3 promoters (at nucleotides-355 and -315 relative to cox3 coding sequence; clone pTL42) all function as promoters in vitro (indicated by '+'). Constructs in which the atpl
11 nt sequence has been inserted upstream of a G-less cassette [p(-G) +11] or cab cDNA (pCAB + 11) do not display promoter activity (indicatedby '-'). Arrows indicate transcription initiation sites (those without arrows have not been mapped). Sequences conforming to the conserved 11 nt
motif are boxed. Conserved nucleotides upstream of the 11 nt motif in sequences with promoter activity are underlined.
(Mulligan et al., 1991). We found that deletion of theconserved 11 nt motif that surrounds the transcriptioninitiation site abolished promoter activity. A similar motifsurrounds wheat mitochondrial transcription initiation sites(Covello and Gray, 1991). The other conserved motif hasthe sequence G(A/T)3 4 and is repeated one to severaltimes upstream of the initiation sites of most maizemitochondrial genes. However, altering either or both of theG(A/T)3-4 sequences had no affect on promoter activity,indicating that they are not elements of the core atpipromoter. Although the G(A/T)3-4 elements were notfound to contribute to atpi promoter function in vitro, we
also found that the 11 nt sequence alone was insufficient forpromoter activity (Figure 6). Figure 8 shows a comparisonof sequences that function as promoters in vitro with thosethat do not. In addition to containing a variant of the 11 ntconsensus sequence, each functional promoter containsadenosine and thymidine residues 4 and 2 nt upstream ofthe 11 nt motif, respectively. This is also true for thestrongest atp6 promoter (Figure 7). These bases are notfound in the two sequences that did not function as
promoters. We therefore suggest that a specific nucleotidemust be present at one or both of these positions for efficientpromoter function, and that the maize mitochondrialpromoter may extend 4 nt or more upstream of the conserved11 nt motif. We have not yet explored the possibility thatsequences downstream of the 11 nt sequence also play a rolein promoter function.
Mitochondrial promoter heterogeneityMitochondrial promoters have now been analyzed by in vitrotranscription for plants, animals and fungi. One class ofpromoters, of which S. cerevisiae (Constanzo and Fox,1990), Neurospora crassa (Kennell and Lambowitz, 1989),X. laevis (Bogenhagen and Romanelli, 1988), sea urchin(Elliot and Jacobs, 1989) and maize atpi are representative,consist of a single sequence block of - 9-15 nt. The maizeatpi promoter (AGTAACGTATTAAA) is most similar tothe X. laevis consensus promoter (ACGTTATA), but distinctfrom that of S. cerevisiae [(A/T)TATAAGTA]. Thesignificance of these comparisons awaits a more detailedanalysis of the maize atpi and other plant mitochondrialpromoters.
The bipartite mammalian mitochondrial promotersrepresent a second class. These promoters contain an
upstream binding site for the essential mitochondrialtranscription factor mtTF1 (Clayton, 1991). A possible third
promoter class would include those of trypanosomemitochondria. A promoter consisting of an inverted repeatand a consensus sequence 5'-RYAYA-3' was proposed byPollard et al. for several Trypanosoma brucei guide RNAgenes (Pollard et al., 1990), but this is clearly not universalfor trypanosome mitochondria (Michelotti and Hajduk,1987). Thus, sequence and structural diversity appear to behallmarks of mitochondrial promoter structure as well as
mitochondrial genome structure.
Specificity of mitochondrial RNA polymerase activityPromoter-specific initiation in maize mitochondrial extractsrequired several purification steps. The lack of transcriptionalspecificity with crude RNA polymerase fractions was alsoobserved in a wheat mitochondrial extract, and there are
several possible explanations (Hanic-Joyce and Gray, 1991).For example, specific initiation may be dependent on a
threshold concentration of transcription factors that is onlyattained in the final purification step. Alternatively, an
activity that promotes non-specific initiation, or one thatinhibits specific initiation, may have been removed.Although we have demonstrated specific transcription
initiation at the maize atpl, cox3 and atp6 promoters(Figure 7), we have not been able to obtain efficienttranscription of the maize mitochondrial 18S rRNA gene
(data not shown). This suggests that while our RNApolymerase preparation has a general role in transcribingprotein-coding genes, rDNA transcription may be carriedout by a modified or distinct RNA polymerase activity. Innuclei and chloroplasts, protein-coding and ribosomal RNAgenes are transcribed by biochemically separable RNApolymerase activities. For example, in chloroplasts a
'transcriptionally active chromosome' (TAC) activity thatpreferentially transcribes rRNA genes remains membrane-associated during purification of the soluble (protein-codinggene transcribing) RNA polymerase (Greenberg et al.,1984). Thus, it is possible that our extract lacks essentialcomponents for rDNA transcription, although we cannot ruleout the possibility that the construct used (pHB650; Mulliganet al., 1988b) lacks a critical promoter element. SincepHB650 includes -480 nt upstream of the 18S rRNAinitiation site, however, we feel that this explanation isunlikely. We therefore speculate either that the maizemitochondrial 18S rRNA gene is transcribed by a modifiedRNA polymerase, or that essential transcriptional factorsdiffer from those that transcribe protein-coding genes. SincerRNA must be synthesized at a high rate relative to mRNA
1071
Promoteractivity
+
W.D.Rapp and D.B.Stern
(given similar turnover rates), an 'ideal' promoter sequencealone may not be sufficient to impart the necessarytranscriptional activity.
ConclusionsThe maize mitochondrial in vitro transcription system willallow a detailed characterization of regulatory sequences andproteins involved in the transcription initiation process inplant mitochondria. The development of mammalian,amphibian and fungal mitochondrial in vitro transcriptionsystems has allowed the discovery of fundamental differencesin the mitochondrial transcriptional machinery in theseorganisms (Schinkel and Tabak, 1989). It will be of interestto discover to what extent the components of the plantmitochondrial transcription complex resemble those of theseother organisms. In addition, plant mitochondrial in vitrosystems should enable us to expand our understanding ofthe transcriptional and post-transcriptional mechanismsunderlying the expression of cytoplasmic male sterility.
Materials and methodsPreparation of transcription extractsMaize inbred line B73 and hybrid lines B73 x Mol7, Mol7 x B73 andPioneer brand 3377 were germinated and grown in the dark for 3-4 days.Intact mitochondria were isolated from etiolated maize seedlings bydifferential centrifugation of a crude homogenate, followed by Percoll densitygradient centrifugation (Moore and Proudlove, 1983). The transcriptionextract was isolated according to a modification of the method used to isolatewheat mitochondrial transcriptional activity (Hanic-Joyce and Gray, 1991).Briefly, mitochondria were lysed in the presence of 1 M KCl and 0.5%Triton X-100. Centrifugation of the lysate at 100 000 g yielded a membrane-free soluble protein fraction (S-100). The S-100 fraction was subjected toammonium sulfate fractionation, and the 20-30% and 30-50% (w/v)ammonium sulfate fractions were combined and subjected to anion-exchangeFPLC using a Pharmacia Mono-Q column. Proteins that bound in BufferA [10 mM Tris-HCI pH 8.0, 50 mM KCI, 1 mM DTT, 0.1 mM EDTA,7.5% (w/v) glycerol] were eluted by KCI concentrations of 0. 1, 0.2, 0.3,0.5 and 1.0 M. Protein concentrations were determined by the Bradfordassay (Bradford, 1976). The fractions were dialyzed against Buffer Acontaining 10 mM KCI, concentrated using a Centricon microconcentrator(Amicon), rapidly frozen and stored at -80°C. In general, hybrid linesyielded transcription extracts with a higher specific activity.
In vitro transcription reactionsStandard in vitro transcription reactions contained 10 mM Tris-HCI pH7.9, 10 mM MgCl2, 1 mM DTT, 0.5 mM each ATP, CTP and GTP,25 jiM UTP, 10 /Ci [a-32P]UTP (800 Ci/mmol) and 40 U RNasin(Promega). Template DNA was added to a final concentration of 50 ,ug/ml,and 10-100 ag of protein per 12.5 ,1l reaction was included. Reactionswere incubated at 30°C for 30 min and terminated by the addition of 37.5 itlstop mix [4.8 M urea, 0.4 M sodium acetate, 5.3 mM aurintricarboxylicacid, 26 Ag/ml tRNA, 0.8% (w/v) SDS], and immediately extractedwith phenol/chloroform/isoamyl alcohol (24:24:1). Following ethanolprecipitation, the reaction products were resuspended in 80% formamide,1 x TBE and electrophoresed in denaturing polyacrylamide gels.
Template DNAPoly(dA-dT) was purchased from Pharmacia. The following maizemitochondrial clones were kindly provided by R.M.Mulligan (Universityof California, Irvine): pBHO.7, containing atpl 5' flanking sequences(Mulligan et al., 1991); pBBstO.3, containing atp9 3' flanking sequences;pHBsN1. 1, containing atp6 5' flanking sequences (R.M.Mulligan, personalcommunication); pTL42, containing 5' flanking sequences from cox3(Mulligan et al., 1988a) and pHB650, containing rrnl8 (18S rRNA gene)5' flanking sequences (Mulligan et al., 1988b). Clone pC2AT, containinga guanosine-free (G-less) cassette, was generously provided by R.Roeder(Sawadogo and Roeder, 1985). Clone pLSK2 contains a 0.3 kb Hindll -PstIfragment derived from the chlorophyll alb binding protein cDNA clonepAB96 (Coruzzi et al., 1983).
Deletion mutants pBHO.7A-141, pBHO.7A-101, pBHO.7A-31,pBH0.7zA -19, pBHO.7A-3 and pBHO.7A+4 were generated by E.coliexonuclease III digestion of BamHI-linearized pBHO.7 (Henikoff, 1984).
1072
The deletion end point (relative to the transcription initiation site) is indicatedby the clone number.
Oligonucleotide-directed mutagenesis of pBHO.7 was performed accordingto standard methods (Ausubel et al., 1990). To generate pBHO.7A13nt,oligonucleotide BR 1I (TTAAGCCGAAAAGTCAAAGTGAACAAAG)was used. To generate pBHO.7/BR21, BR21 (CTTGTTATTATTAATA-TTAAAAGTAACGTATTA) was used. BR22 (GTGCCCAGGAATAA-ITTAAATTATTATTAA) was used to generate pBHO.7/BR22. To generatepBHO.7/BR21 +22, BR22 was used to mutagenize pBHO.7/BR2 1.The 11 nt insertion constructs were made by annealing BR 17 (AGCTA-
TTAAAA) and its complement (BR18) to create an 11 bp fragment, andinserting it into: (i) the blunt-ended EcoRI site flanking the pBBstO.3 insert(after subcloning of the insert into Bluescript SK(-) from Stratagene); (ii)the blunt-ended Sacl site flanking the pC2AT insert; (iii) the SmaI siteflanking the pLSK2 insert.The identity of all constructs was verified by sequence analysis. For use
as in vitro transcription templates, plasmids were purified by CsCl densitygradient centrifugation, digested with appropriate restriction endonucleases,phenol/chloroform extracted and precipitated with ethanol.
Primer extensionMitochondrial RNA (mtRNA) was isolated as described (Stern and Newton,1985) and in vitro-synthesized atpl RNA was purified from transcriptionreactions, except that aurintricarboxylic acid was omitted in both cases. AllRNA was treated with RNase-free DNase I (Promega). Primer extensionanalysis of maize mtRNA and in vitro synthesized atpi RNA using theatpl-specific primer BR1O (5'-TAGGGCCAGCCTGGCTCAAC-3') wasperformed according to standard methods (Ausubel et al., 1990) usingSuperscript MMLV reverse transcriptase (Bethesda Research Laboratories).Hybridizations were performed at 30°C (in vitro-synthesized RNA) or 50°C(mtRNA). Sequencing reactions were performed using end-labeled BR1O anddouble-stranded plasmid DNA (Ausubel et al., 1990).
AcknowledaementsWe thank Dr M.Gray, Dr R.M.Mulligan and Dr K.Newton for their interestand helpful advice, and Dr R.M.Mulligan and Dr R.Roeder for gifts ofplasmid clones. Pioneer brand seed was generously provided by DrM.Albertson of Pioneer Hi-Bred International, Inc. This work was supportedby grants from the Cornell Biotechnology Program, which is sponsoredby the New York State Science and Technology Foundation, a consortiumof industries, the US Army Research Office and the National ScienceFoundation, from the Cornell National Science Foundation Plant ScienceCenter, a unit in the US Department of Agriculture/Department ofEnergy/NSF Plant Science Centers Program and a unit of the CornellBiotechnology Program, and from the Cooperative State Research Service,US Department of Agriculture, under agreement no. 91-37301-6419.
