Date post: | 18-Dec-2015 |
Category: |
Documents |
View: | 263 times |
Download: | 0 times |
Everything you wanted to know about ENCODE
But were afraid to ask
Top 5 Reasons Biologists Go Into Bioinformatics
5 - Microscopes and biochemistry are so 20th century.
Top 5 Reasons Biologists Go Into Bioinformatics
5 - Microscopes and biochemistry are so 20th century.
4 - Got started purifying proteins, but it turns out the cold room is really COLD.
Top 5 Reasons Biologists Go Into Bioinformatics
5 - Microscopes and biochemistry are so 20th century.
4 - Got started purifying proteins, but it turns out the cold room is really COLD.
3 - After 23 years of school wanted to make MORE than $23,000/year as a postdoc.
Top 5 Reasons Biologists Go Into Bioinformatics
5 - Microscopes and biochemistry are so 20th century.
4 - Got started purifying proteins, but it turns out the cold room is really COLD.
3 - After 23 years of school wanted to make MORE than $23,000/year as a postdoc.
2 - Like to swear, @ttracted to $_ Perl #!!
Top 5 Reasons Biologists Go Into Bioinformatics
5 - Microscopes and biochemistry are so 20th century.
4 - Got started purifying proteins, but it turns out the cold room is really COLD.
3 - After 23 years of school wanted to make MORE than $23,000/year as a postdoc.
2 - Like to swear, @ttracted to $_ Perl #!!1 - Getting carpel tunnel from pipetting
Top 5 Reasons Computer People go into Bioinformatics
5 - Bio courses actually have some females.
Top 5 Reasons Computer People go into Bioinformatics
5 - Bio courses actually have some females.
4 - Human genome more stable than Windows XP
Top 5 Reasons Computer People go into Bioinformatics
5 - Bio courses actually have some females.
4 - Human genome more stable than Windows XP
3 - Having mastered binary trees, quad trees, and parse trees ready for phylogenic trees.
Top 5 Reasons Computer People go into Bioinformatics
5 - Bio courses actually have some females.
4 - Human genome more stable than Windows XP
3 - Having mastered binary trees, quad trees, and parse trees ready for phylogenic trees.
2 - Missing heady froth of the internet bubble.
Top 5 Reasons Computer People go into Bioinformatics
5 - Bio courses actually have some females.
4 - Human genome more stable than Windows XP
3 - Having mastered binary trees, quad trees, and parse trees ready for phylogenic trees.
2 - Missing heady froth of the internet bubble.
1 - Must augment humanity to defeat evil artificial intelligent robots.
The Paradox of GenomicsHow does a long, static, one dimensional string of DNA turn into the remarkably complex, dynamic, and three dimensional human body?
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
GTTTGCCATCTTTTGCTGCTCTAGGGAATCCAGCAGCTGTCACCATGTAAACAAGCCCAGGCTAGACCAGTTACCCTCATCATCTTAGCTGATAGCCAGCCAGCCACCACAGGCATGAGT
Looks like ‘code’ not enough, must study actual cells & DNA
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
How DNA is Used by the Cell
Promoter Tells Where to Begin
Different promoters activate different genes indifferent parts of the body.
A Computer in Soup
Idealized promoter for a gene involved in making hair.Proteins that bind to specific DNA sequences in the promoter region together turn a gene on or off. Theseproteins are themselves regulated by their own promotersleading to a gene regulatory network with many of thesame properties as a neural network.
Regulation By Txn Factor Binding
When I-KB is removed fromby phosphorylation, NF-KB complex binds to dna.
Note that you would needBoth NF-KB p65 and NF-KB p50Subunits to be expressed in same cellFor this transcription activation Pathway to work. Selective, combinatoricalexpression of txn factors is very importantIn defining different types of cells.
The Decisions of a Cell
• When to reproduce?
• When to migrate and where?
• What to differentiate into?
• When to secrete something?
• When to make an electrical signal?The more rapid decisions usually are via the cell membrane and 2nd messengers. The longer acting decisions are usually made in the nucleus.
Nucleus Used to Appear Simple
• Cheek cells stained with basic dyes. Nuclei are readily visible.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
Mammalian Nuclei Stained in Various Ways
Image from Tom Misteli lab
Artist’s rendition of nucleus
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
Image from nuclear protein database
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
Chromatin
Turning on a gene:
• Getting DNA into the right compartment of the nucleus (may involve very diffuse signals in DNA over very long distances)
• Loosening up chromatin structure (this involves enhancers and repressors which can act over relatively long distances)
• Attracting RNA Polymerase II to the transcription start site (these involve relatively close factors both upstream and downstream of transcription start).
H3K4me3
H3K4me2
H3K4me1
H3acK9/14
H4acK5/8/12/16
Modification
HISTONE MODIFICATIONS4
Effect
Slide adapted from Christoph Kock, Sanger Institute
Methods for Studying TranscriptionTraditional• Genetics in model organisms• Promoters/enhancers hooked to reporter genes• Gel shifts and DNAse footprinting.ENCODE/High Throughput• Phylogenic footprinting• Motif searches in clusters of coregulated genes.• Chromatin Immunoprecipitation & CHIP/CHIP• DNAse hypersensitivity
Drosophila Genetics
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
normal antennapediamutant
QuickTime™ and aTIFF (Uncompressed) decompressorare needed to see this picture.
Reporter Gene Constructs
promoter to study easily seen gene
QuickTime™ and aTIFF (Uncompressed) decompressorare needed to see this picture.
Drosophila embryo transfected with ftz promoter hookedup to lacz reporter gene, creating stripes where ftz promoteris active.
QuickTime™ and aTIFF (Uncompressed) decompressor
are needed to see this picture.
Txn factorfootprint
Gel showing selective protection of DNA from nuclease digestion where transcription factor is bound.
Biochemical Footprinting Assays
Comparative Genomics
Webb Miller
Comparative Genomics at BMP10
Conservation of Gene Features
Conservation pattern across 3165 mappings of human RefSeq mRNAs to the genome. A program sampled 200 evenly spaced bases across 500 bases upstream of transcription, the 5’ UTR, the first coding exon, introns, middle coding exons, introns, the 3’ UTR and 500 bases after polyadenylatoin. There are peaks of conservation at the transition from one region to another.
50%
55%
60%
65%
70%
75%
80%
85%
90%
95%
100%
aligning identity
Normalized eScores
Conservation Levels of Regulatory Regions in
Human/Mouse Alignments
Dnase I Hypersensitivity, CHIP/CHIP, transcription data on ENR333
CHromatin ImmunoPrecipitation• Crosslink cells with formaldehyde.• Sonicate to shear DNA• Add antibody to a protein involved in
transcription.• Precipitate antibody and and everything
attached• Heat to release DNA.• Analyse DNA with PCR or microarrays
– CHIP on microarray = CHIP/CHIP
CHIP/CHIP in ENCODE
• groups: Sanger, Yale, Affy, UCSD, Stanford, GIS (more?)
• proteins: RNA Pol II, TAF1, histones in various states of acylation/methylation
• cells: various cell lines treated various ways.
CHIP/CHIP Groups
• Sanger - sequencing center in UK that does a lot of annotation as well.
• UCSD/Ludwig Institute - where Bing Ren, a pioneer of CHIP lives
• GIS - Genome Institute Singapore - using “paired-end ditag” CHIP.
• Stanford, YALE, Affy you all know.
CHIP/CHIP Targets• RNA Polymerase II, converts DNA->RNA
for protein coding genes. – Antibody targets form in initiation complex
(start of gene)
• TAF1 - A basal transcription factor. Involved in recruiting Pol II to initiation site
• Histones 3&4 - the balls DNA winds around– Antibodies against various acylated and
methylated forms, most of which are associated with chromatin opening
Cell Types• HELA - cervical epithelial carcinoma• HCT116 - colon epithelial carcinoma• IMR90 - lung fibroblast• THP1 - blood monocyte leukemia• GMO6990 - lymphoblastoid
• HL-60 - promyelocytic leukemia cell line• Many others in Stanford promoter track.
DNAse hypersensitivity• Very old technique being adapted to high
throughput.• DNA cutting enzymes can access open chromatin
faster than closed chromatin• Other things may also influence how susceptible a
particular piece of DNA is to DNAse cutting.• What is hypersensitive in a particular cell line is
quite reproducible.• There are various techniques for seeing where cut
is: sequencing cut ends, PCR around cut site, etc.
Dnase I Hypersensitivity, CHIP/CHIP, transcription data on ENR333
Dnase I Hypersensitivity, CHIP/CHIP, transcription data on ENR333
Close up of same region
The END
How is a gene turned on?• “Pioneering” transcription factors bind to
DNA and tag it for “chromatin opening”• Histones are acylated/methylated which
opens chromatin.• More transcription factors bind newly
exposed sites in DNA.• RNA Polymerase II attracted to txn factors• Yet more txn factors phosphorylate tail of
Pol II, allowing it to start transcription.