Evidence of Evolution
Biogeography
The Age of Earth and Fossils
Ancient artiodactyl
Modern whale
Ancestors of Whales
Ambulocetus could both
swim in shallow water
and walk on land.
AmbulocetusRodhocetusPakicetus
Ancient
artiodactyl
Rodhocetus
probably spent
most of its time in
water.
Evolution of Whales
Basilosaurus
Dorudon
Mysticetes
Odontocetes
Modern
whales
Basilosaurus
only swims.
Modern whales have
ancient structures
Gaps in the Fossil Record
Homology
►What does the word Homologous mean?
►Homology is the study of similarity between organisms
►There are three major branches of homology: Anatomical Homology
Embryological Homology
Molecular Homology
Homologous Structures
Ancient lobed-finned fish
Frog Alligator Chicken Horse
Vestigial Structures
Evidence of Evolution►Analogous Structures: structures similar in
function, but not inherited from a common
ancestor.
►Same function, different structure
Development
Embryological Homology
► The diagram below shows embryos of five different species: pig, chicken, fish, turtle, and human. Can you tell which is which?
Figured it out yet?
How about now?
Did you guess correctly?
Embryological Homology
► Did you know that when you were inside your mother’s womb, for a while you looked almost exactly like a fish?
► Vertebrate embryos all share a similar pattern of development, suggesting that they may share common ancestry
Human – 31 days
Chicken – 2 ½ days
Pig – 21 days
Genetics and Molecular Biology
Molecular Homology
►All living things contain DNA and RNA.
►Changes in Proteins, DNA and RNA can be traced from ancestors to their descendents.
►The fewer Amino Acid differences between organisms, the closer their inferred evolutionary relationship.
Hemoglobin and Cytochrome C are a group of proteins that are commonly found in manydifferent organisms
Our ancient DNA
GTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAG
►Codes for an RNA enzyme that plays a crucial role in protein synthesis
►Present in EVERY cell in the world (and some viruses…)
►Evolved in the common ancestor of ALL life
Our modern DNA…
►There are around 100 mutations in your genome that are NOT present in your mother or father
Testing Natural Selection
Platyspiza strips bark with a beak
designed to grip and hold tightly,
like a pair of pliers.
Certhidea picks insects off surfaces
with a straight, narrow beak, like
needle-nose pliers.
Pinaroloxias probes for insects, fruit,
and nectar with a curved beak, like
needle-nose pliers.
Geospiza breaks large, thick seeds with
a beak that is thick, strong, and sharp,
like heavy-duty wire cutters.
Bird Survival Based on Beak Size
Genes and Variation
Genotype and PhenotypeGenotype: particular combination of alleles
Phenotype: physical, physiological, and behavioral characteristics
Genetics and Evolutionary Theory
Natural selection acts on an organism’s characteristics, not on
its alleles.
Allele Frequency
Number of times an allele occurs in a gene pool, as a percentage
of the total occurrence of all alleles
In 50 alleles:
20 alleles are B (black)
30 alleles are b (brown)
In 100 alleles:
are B (black)
are b (brown)
40
60
Alleles in a PopulationEvolution involves any change in the frequency of alleles in a
population over time. In a population of 25 mice, how many mice
are in each genotype?
4
12
9
Genetic Variation
Three evolutionary mechanisms
that generate genetic variation:
• mutation
• genetic recombination
• lateral gene transfer
Possible chromosome
combinations is 2n.
In humans, n = 23.
223 = 8,388,608
Single-Gene Traits
Traits controlled by only one gene
With bands
Without bands
Single-Gene Traits
Phenotypic ratios are determined by the frequency of alleles and
by whether the alleles are dominant or recessive.
23%
77%
Polygenic Traits
Traits controlled by two or more genes
Polygenic Traits
Height in humans is an example of a polygenic trait.
Evolution as Genetic Change
in Populations
How Natural Selection Works
An
is any genetically controlled trait
that increases an individual’s
fitness.
evolutionary adaptation
Natural Selection on Single-Gene Traits
Natural selection on single-gene traits can produce changes in allele
frequencies that may be reflected by simple changes in phenotype
frequencies.
Natural Selection on Polygenic Traits
Natural selection on polygenic traits can produce three types of
selection:
• directional selection
• stabilizing selection
• disruptive selection
Directional Selection
Individuals at one end of the curve have higher fitness than
individuals in the middle or at the other end.
Stabilizing Selection
Individuals near the center of the curve have higher fitness than
individuals at either end.
Disruptive Selection
Phenotypes at the upper and lower ends of the curve have higher
fitness than individuals near the middle.
Genetic Drift
Genetic drift is a random change in allele frequency.
• Genetic bottlenecks
• The founder effect
Founding
populationsDescendants
Evolution Versus Genetic Equilibrium
If a population is not evolving, the
population is in genetic equilibrium.
• Sexual reproduction
• Hardy–Weinberg principle
If p = 0.40 and q = 0.60:
Probability of genotype aa:
If p = 0.40 and q = 0.60:
Probability of genotype Aa:
If p = 0.40 and q = 0.60:
Probability of genotype AA:
Hardy–Weinberg Principle
and
In words, this is stated:
(frequency of AA) + (frequency of Aa) + (frequency of aa) = 100%
and
(frequency of A) + (frequency of a) = 100%
16%36%48%
Hardy–Weinberg Principle
To maintain genetic equilibrium there must be:
• Random mating
• Large population size
• No immigration or emigration
• No mutations
• No natural selection
The H-W Principle predicts that:
If any of these conditions occur
it can disturb genetic equilibrium,
causing evolution.