Expression of Cytokine Genes, Cytokine Receptor Genes, and Transcription Factorsin Cultured Hodgkin and Reed-Sternberg Cells1
Hans-JürgenGruss, Marion A. Brach, Hans-GünterDrexler, Renate Bonifer, Roland H. Mertelsmann,and Friedhelm Herrmann2
Department of Internal Medicine I, University of Freiburg Medical Center, Freiburg [H-J. G.,M.A. B., R. B., R. H. M.,F. H.], and German Collection of Microorganismsand Cell Cultures [H-G. D.J, Braunschweig, Germany
ABSTRACT
In the present study, we show by Northern blot analysis and enzymelinked immunosorbent assay that the Hodgkin's disease (HD)-derived
cell lines HDLM-2 and KM-H2 express a variety of cytokine geneseither constitutively or upon induction with phorbol ester 12-O-tetrade-canoylphorbol-13-acetate. Cytokine genes expressed by HD-derived linesinclude granulocyte-macrophage colony-stimulating factor (( 'SI1'),mac-
rophage-CSF, interleukin (II,)-!-,». II -X IL-5, II -6, IL-8, leukemiainhibitory factor, tumor necrosis factor-«,tumor necrosis factor-/?, andtransforming growth factor-/?, while transcripts and the correspondingproteins for granulocyte-CSF, IL-1-/3, IL-2, IL-4, IL-7, IL-10, and theJE/macrophage chemoattractant and activating factor gene were notdetectable in cytoplasmic RNA and culture supernatants obtained fromboth lines. In addition, IL-2 receptor (R) p55 and macrophage-CSF R (c-fmx) genes were expressed by both lines. HDLM-2, but not KM-H2cells, exhibited the II -6 R p80 and the IL-2 R p75 chain. Analysis ofnuclear proteins that bind to oligonucleotides containing the consensussequences of the transcription factors activation protein 1, nuclear factor(NF) <cB,and NFAT 1 revealed a pattern for HD lines resembling that•¿�ofactivated T-cells: HDLM-2 and KM-H2 cells constitutively expressedNF binding to the NF of activated T-cells (type 1), previously describedto be T-cell specific. In addition, NF «B-bindingproteins obtained fromboth lines showed, in electrophoretic mobility shift assays, the samemigration pattern as T-cell-derived proteins but differed from monocyte-and B-cell-derived proteins. IV cross-linking experiments confirmed thatNF xB-binding proteins of M, 85,000, 75,000, and 50,000/55,000 weredetectable in nuclear extracts obtained from T-cells and both HD lines,while monocytes and B-cells displayed the M, 50,000/55,000 and 75,000NF *H complex only. Both HD lines also constitutively expressed transcripts for i--fiisand c-jun, which are involved in heterodimeric formation
of the transcription factor activation protein 1, as well as for the NF «B/KBF1 gene.
INTRODUCTION
HD3 is a malignant disorder morphologically characterized
by the presence of multinucleated RS and the mononuclear Hcells in a stremai background consisting of lymphocytes, plasmacells, histiocytic cells, and eosinophils (1). Both the etiology ofHD and the precursor identity of its presumed malignant component, the RS and H cells, have remained uncertain (see Ref.
Received 12/10/91; accepted 4/6/92.The costs of publication of this article were defrayed in part by the payment
of page charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.
1Supported by the Deutsche Krebshilfe.2To whom requests for reprints should be addressed, at Department of Internal
Medicine I. University of Freiburg Medical Center, Hugstetter Str. 55, D-7800Freiburg i.Br., Germany.
2 for review). Various cell types have been proposed as theoriginators of HD including lymphoid cells (3-6), mononuclearphagocytes (7-11 ), interdigitating reticulum cells ( 12), folliculardentritic cells (13, 14), and granulopoietic cells (15). Unfortunately, the analysis of RS-H cells is hampered by the scarcityof this neoplastic component and contamination with bystandercells in HD-involved tissues. The advent of improved tissueculture methodology for the establishment of immortalized celllines has enhanced the possibilities of studying neoplastic cells.Recently, a number of cell lines have been established fromtissues or pleural effusions of patients with HD (16-21), mostlywith the nodular sclerosis variant. These in vitro cultured cellsmay represent the in vivo RS-H cells having identical or verysimilar characteristic features. Therefore, they might be operationally regarded as in vitro representatives of RS-H cells,although it has to be considered that cell lines cannot be derivedfrom the vast majority of cases of HD, and therefore, HDtumors that allow establishment of cell lines may somehowbear atypical features.
Recent studies aimed at determining the precursor identityof RS-H cells and the pathogenesis of HD have focused onphenotypic studies (see Ref. 22 for review) and moleculargenetic studies of rearrangements of the T-cell receptor andimmunoglobulin genes (23-26), have analyzed possible alterations of the genomic structure and expression levels of certainprotooncogenes including those of the ras gene family (27, 28),of the c-myc gene (16, 29) and the c-fms gene (30, 31), and havealso explored the presence of Ebstein-Barr virus DNA in RS-H cells. In most of these studies, HD-derived cell lines wereused. Despite these extensive efforts, there is still no consensusconcerning either the etiology of HD or the identity of RS-Hcells. Characterization of further features of HD-derived celllines would thus be important in increasing our understandingof HD.
A number of features of HD are consistent with characteristics of a tumor of cytokine-producing cells, including occurrenceof "B" symptoms, of sclerosis, eosinophilia, and polycarion
formation. Several investigators have assessed the capacity ofRS-H cells to express cytokine genes. For instance, Paietta etal. (31) have shown that the L428 cell line, obtained from anodular sclerosis HD patient, disclosed transcripts for the M-CSF and its receptor, encoded by the c-fms protooncogene (32).CSF secretion by cultured H-RS cells has also been shown byBurrichter et al. (33) and Byrne et al. (34). Naumovski et al.(35) have described secretion of IFN--y by the SUP-HD1 cellline. By means oÃin situ hybridization, transcripts for IL-5 weredetected in RS cells of primary HD tissues by Samoszuk andNansen (36). Hsu et al. (37-39) have analyzed expression ofIL-1, TNF-a, and TNF-0 in the HDLM-1 and HDLM-ldHodgkin lines (37-39). Similarly, Kretschmer et al. (40) haveshown the ability of L428 and L540 Hodgkin cells to produceTNF. TGF-/3 and IL-6 secretion by RS-H cells has also beendemonstrated in both cultured and primary Hodgkin tissues(41-43). Also, expression of IL-9 by cultured and primary RS-
H cells has been shown (44, 45).Given these first observations, the aim of the present study
was to examine the spectrum of cytokines released by the twowell-defined HD-derived permanent cell lines HDLM-2 (46)and KM-H2 (47) in more detail. To this end, an extensive panelof cytokines was analyzed at the mRNA and protein levels,including GM-CSF, G-CSF, M-CSF, IL-1-«and IL-1-/3, IL-2,IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-10, LIF, TNF-a, TNF-0,TGF-/3, IFN-7, the gene coding for the JE/MCAF protein, andthe early response genes c-jun and c-fos, known to be involvedin cytokine signaling (48, 49). In addition, expression of thep55 IL-2R a and p75 ßchain, of the p80 IL-6R, and of the M-CSF receptor (c-fms) was assessed by Northern blotting usingspecific cDNA probes. The presence of transcription factorsknown to bind to consensus sequences in regulatory 5'-flanking
regions of many cytokine genes (50), such as the AP 1, the NF*B, and the NFAT 1, previously shown to be a T-cell-specificmolecule (51), were analyzed in nuclear extracts of both celllines, of peripheral blood T-cells, T-cell leukemia lines, lym-phoblastoid B-cell lines, and of monocytes by EMSA.
MATERIALS AND METHODS
Cell Lines and Culture Conditions. Mycoplasma-free HDLM-2 (46),KM-H2 (47), embryonic lung fibroblast FH 109 (52), the T-cell leukemia lines Jurkat, Rex, and Molt-14 (kindly provided by S. Meuer,German Cancer Research Center, Heidelberg, Germany), and the Ep-stein-Barr virus transformed B-lymphoblastoid cell lines LUNDAK(53) and Laz 506 (kindly provided by S. Meuer) were grown in standardculture medium [RPMI 1640 medium (GIBCO, Grand Island, NY)supplemented with 10% low endotoxin fetal calf serum (Hazelton,Vienna, UT), 2 miviL-glutamine, 1% penicillin/streptomycin (GIBCO)]at 37°Cin a 5% CO2 atmosphere in air. Only cultures in the log phase
of growth were investigated. In some experiments, cell lines were treatedfor 12-24 h with TPA (Sigma, Munich, Germany) at a concentrationof 24 n\i. T-cells and monocytes were prepared as previously describedin detail (54).
Cell Surface Immunophenotyping and Monoclonal Antibodies. Expression of surface and nuclear markers was examined either by indirectimmunofluorescence using flow cytometry (FACS Star; Becton Dickinson, Sunnyvale, CA) or on fixed cytospin slides according to standardprocedures (55). moAbs used in these studies included anti-CD2, -CD3,-CD4, -CDS, -CD 10, -CD1 Ib, -CD 19 , -CD20, -CD21, -CD33, -CD71(from Coulter Electronics, Hialeah, FL), anti-CD 14, -CD 15, -CD34,HLA-DR (from Becton Dickinson), anti-CD30, KI-67 (kindly providedby H. Stein, University of Berlin, Germany), polyclonal anti-human Kor Xlight-chain (from Tago, Burlingame, CA), anti-p55 IL-2R (CD25)moAb Tac (kindly provided by T. Waldman, National Institutes ofHealth, Bethesda, MD), anti-p75 IL-2R moAb (Oncogene Science,Inc., Manhasset, NY), and anti-p80 IL-6R moAb MT 18 (kindlyprovided by T. Hirano, Osaka University, Osaka, Japan). An moAbagainst the monomorphic portion of the TCR-/3 chain (BE-1) was kindlyprovided by S. Meuer.
cDNA Probes. For hybridization, the following specific cDNA probeswere used: GM-CSF, 1.0-kilobase Pstl fragment of pBR322-hGM-CSF(kindly provided by P. Habermann, Hoechst, Frankfurt, Germany); G-CSF, the 0.6-kilobase £coRI////m/III fragment of pUC8-hG-CSF(kindly provided by L. Souza, Amgen, Thousand Oaks, CA); M-CSF,the 1.0-kilobase Pstl/Bglll fragment of pUC18-hM-CSF (kindly provided by P. Ralph, Cetus Corp., Emeryville, CA); IL-1-/3, the 0.6-kilobase BamHl/Smal fragment of pYEpsecl-hIL-lb (ATCC, Rock-ville, MD); IL-2, the 0.7-kilobase £coRI fragment of PUC9-hIL-2(kindly provided by W. Sikora, Medizinische Hochschule, Hannover,Germany); IL-3, the 1.6-kilobase Hpal/Xhol fragment of pGembl-hlL-3 (P. Habermann); IL-4, the 0.4-kilobase Pst\ fragment of pcD-hIL-4(kindly provided by S. Gillis, Immunex Corp., Seattle, WA); IL-5, the0.9-kilobase BamHl fragment of phIL-5115.1 (ATCC); IL-6, the 0.55-
kilobase Taql/BanU fragment of pGEM4-hIL-6 (kindly provided by T.Hirano, University of Osaka, Osaka, Japan); IL-7, the 0.51-kilobasePvull fragment of pGembl-hIL-7 (S. Gillis); IL-8, the 0,4-kilobaseBglll/EcoRl fragment of pBBG44 (British Bio-Technology, Oxford,United Kingdom); IL-10, the 0.76-kilobase Bgm/Hindlll fragment ofpcDSRa (kindly provided by P. Vieira, DNAX Research Institute ofMolecular and Cellular Biology, Palo Alto, CA); JE/MCAF, the 0.74-kilobase Kpnl fragment of pGEM-hJE34 (kindly provided by B. Rollins,Dana-Farber Cancer Institute, Boston, MA); LIF, the 0.6-kilobase///nrfIII/£coRI fragment of pBBG 46 (British Bio-Technology); TNF-a, the 1.0-kilobase Psll fragment of pSP64-hTNF-a (kindly providedby G. Adolph, Boehringer International, Vienna, Austria); TNF-/3, the0.6-kilobase Ndel/BgllI fragment of pBBGS (British Bio-Technology);IFN-7, the 0.7-kilobase AamHI fragment of pBR322-hIFN-7 (Genen-tech, San Francisco, CA); TGF-/J, the 1.04-kilobase £coRIfragment ofpSP 64 (Genentech); c-fms, the 1.23-kilobase £coRIfragment of pcfms104 (ATCC); NF «B/KBF1,the 3.9-kilobase Noti insert of pBKS-«BFl(kindly provided by S. Gosh, Whitehead Institute, Cambridge, MA); c-jun, the 1.2-kilobase £coRI/fla/wHI fragment of pSK-hjun (ATCC); c-fos, the 0.9-kilobase £o>RIfragment of pBR322-hfos (ATCC); IL-2Ra chain, the 0.9-kilobase EcoRl fragment of PSP65-hIL-2R (W. Sikora); IL-2R ßchain, the 1.9-kilobase Sac\/BamH\ fragment of pUC10-b30SB (kindly provided by A. Kawahara, Institute for Molecularand Cellular Biology, Osaka University, Osaka, Japan); IL-6R p80, the1.7-kilobase Hindlll/Xba\ fragment of pIB176-hIL-6R (T. Hirano);and actin, the 0.8-kilobase BamHl/Pstl fragment of pBR322 chickena-actin (kindly provided by J. Ramadori, University of Mainz, Mainz,Germany). IL-1 a was probed with an oligonucleotide as previouslydescribed (56).
Isolation of Total Cellular RNA and Northern Blot Analysis. Medium-or TPA-treated HDLM-2, KM-H2 cells, and FH109 lung fibroblasts,TPA (32 nM)/phytohemagglutinin (1 mg/mL)-activated T-lympho-cytes, or TPA (32 nM)-activated blood monocytes were harvested bycentrifugation after the appropriate culture time. Cells were resus-pended in 0. l M sodium acetate, 1 mM EDTA, pH 5.2, then lysed with0.5% SDS, and extracted with an equal volume of acetate/EDTA-equilibrated phenol (60°C).This mixture was incubated at 60'C for 25
min with frequent vortexing. The aqueous phase was recovered aftercentrifugation and extracted once with an equal volume of phenol/chloroform and twice with chloroform. The resulting RNA was precipitated overnight at —¿�20°Cwith 2.5 vol'.'mes of ethanol. The total RNA
from each sample was then electrophoresed in a 1% agarose gel containing 20 mM sodium borate, pH 8.3-0.5 mM EDTA-3% formaldehyde. The RNA was then transferred to nitrocellulose paper (Schleicherand Schuell, Dassel, Germany) in lOx SSC (1.5 Msodium chloride and150 mM sodium citrate) using capillary blotting overnight. The blotswere then backed and prehybridized at 65°Cin 7% SDS-1 Ox Den-hardt's solution (Ix Denhardt's = 0.2% Ficoll-0.2% bovine serum
albumin-0.02% polyvinylpyrolidine)-5x SSC-20 mM salmon spermDNA (Sigma). The blots were probed with specific cDNA probesradiolabeled by random priming with a [a-32P]CTP (>6000 Ci/mmol)(Amersham, Arlington Heights, IL). Hybridization with oligonucleo-tides were performed essentially as previously described (56). The blotswere washed at 55°Cin 1% SDS-lx SSC and were autoradiographedwith Kodak XAR film (Eastman Kodak, Rochester, NY) at -70°Cwith
an intensifying screen.Isolation of DNA and Southern Blot Analysis. Genomic high molec
ular weight DNA was isolated from HDLM-2 and KM-H2 cells, andSouthern analysis was performed according to standard procedures(57). DNA probes were used to detect possible rearrangements ofimmunoglobulin heavy chain genes (Ag/II-restricted genomic DNA-JHprobe), immunoglobulin light chain genes (£coRI-restricted genomicDNA-Cx probe or fla/nHI-restricted genomic DNA-C. probe), andTCR-/3 genes (///m/III-restricted genomic DNA-Ttf probe). An M-CSFand c-fms probe (see above) were also used in Southern blot analysis ofDNA digested with various restriction endonucleases (Bethesda Research Laboratory, Gaithersburg, MD).
Cytokine Determination in Culture Supernatants. Cell-free superna-tants of medium- or TPA (32 nM, 24 h)-treated cells were assessed forGM-CSF, G-CSF, M-CSF, IL-l-a, IL-l-ß,IL-2, IL-3, IL-4, IL-6, IL-
8, TNF-a, TNF-ft and TGF-/3 synthesis. Enzyme-linked immunoab-sorbent assay kits were purchased from the following suppliers andperformed as indicated by the manufacturer: R&D Systems, Minneapolis, MN (IL-l-a, IL-1-/3, IL-3, IL-4, IL-6, IL-8, TNF-«,and TNF-/3);Amgen, Thousand Oaks, ÇA(G-CSF); Medical Resource Limited,Darlington, Australia (GM-CSF); and Advanced Magnetics, Cambridge, MA (IL-2). M-CSF synthesis was quantified using a murinemacrophage colony-forming assay as previously described in detail (54).In these experiments, recombinant human M-CSF (kindly provided byP. Ralph) served as an internal standard. TGF-/3 synthesis was analyzedby Western blotting. The TGF-/Îdetection kit was obtained throughCollaborative Research Inc., Bedford, MA. All manufacturers guaranteed no cross-reactivity of the respective cytokine to be analyzed withother cytokines. Some samples required dilution up to 1:10 prior assay.
Extraction of Nuclear Proteins and Electrophoretic Mobility ShiftAssay. Nuclear extracts were prepared from IO7cells by the method of
Ohlsson and Edlund (58) with modifications as described in Ref. 59.Protein concentrations were measured according to a standard protocol(60), and 10 ^g protein was used for EMSA. EMSA was performedusing 10,000 cpm of the end-labeled double-stranded oligonucleotide(NF «B,TCGACAGAGGGGACTTTCCGAGAGGC; API,GGGAGTCCGGCTGACTCATCAAGCT; NFAT1, GGGTTAAA-GAAAGGGGAAAAACTGTTTCA; the consensus binding sites areunderlined) and 20 ng specific or nonspecific competitor oligonucleotide. The components were incubated for 30 min at room temperaturebefore separation on a 5% polyacrylamide gel. The gels were dried andthen exposed to Kodak XAR 5 films using an intensifying screen.
UV Cross-Linking. UV cross-linking was performed as previouslydescribed (61). Briefly, the NF /cB oligonucleotide was continuouslylabeled with the Klenow large fragment polymerase (Boehringer-Mann-heim, Germany) in the presence of 5 m\i dGTP-5 mM dATP (Boehrin-ger)-5 mM 5'-bromodeoxyuridine triphosphate (Sigma)-[«-"P]dCTP
(Amersham, Arlington Heights, IL). Nuclear proteins from treatedmonocytes, T-cells, HDLM-2 KM-H2, and Lundak B-cells were incubated with 100 fmol continuously labeled oligonucleotide as describedabove and then subjected to UV irradiation (254 nm) for 20 min at4°C.Proteins were separated under reducing conditions on a 12% SDS
gel. A rainbow marker (Amersham) was used as a size marker. The gelwas dried and autoradiographed at —¿�70°Cusing an intensifying screen.
RESULTS
Phenotypic and Genotypic Features of HD-derived Cell Lines.Table 1 shows the phenotypic profile of HDLM-2 and KM-H2cells. Both lines express CD 15, CD30, Ki-67, CD71, CD25,and HLA-DR. In comparison to HDLM-2 cells, CD25 expression in KM-H2 was weak and detectable in a minority of cellsonly. Similarly, HDLM-2 cells exhibited the IL-2R ßchain ontheir surface, while KM-H2 cells did not. HDLM-2 cells werestained with anti-CD2 but not with anti-CD4 moAb, while KM-H2 cells expressed CD4 but not CD2. Upon exposure to TPAfor 24 h, KM-H2 cells displayed binding sites for anti-CD33and anti-CD34 moAbs, while HDLM-2 cells did not. HDLM-2 cells failed to react with anti-B-cell antibodies (CD 10, CD 19,CD20, CD21, K,X). In contrast, KM-H2 cells stained positivelyfor the CD21 monoclonal antibody but were unlabeled by otheranti-B-cell moAbs. IL-6R p80 surface expression was seen in asubpopulation of HDLM-2 cells but not in KM-H2 cells. Therewas no difference in the morphological appearance of CD25-positive and -negative KM-H2 cells or of IL-6R p80-positiveand -negative HDLM-2 cells. Analysis of gene rearrangementsin DNA obtained from HDLM-2 cells revealed germline configuration of the immunoglobulin heavy- and light-chain genes,but the TCR-0 chain showed a biallelic rearrangement. Genotypic analysis of KM-H2 cells demonstrated rearrangement ofthe immunoglobulin heavy-chain gene but not of the K and X
light-chain genes probed with fcoRI-digested genomic DNA-Cx or ÄamHI-digested genomic DNA-C. (not shown).
Constitutive Expression of Cytokine mRNA in HD-derivedCell Lines. Next, the cell lines were tested for constitutivemRNA production of a series of cytokines, cytokine-associatedprotooncogenes, and cytokine receptors. As shown in Table 2,expression of cytokine mRNA in both lines was heterogenous.The spectrum of constitutive mRNA accumulation of HDLM-2 cells resembled that of activated T-cells, i.e., synthesis oftranscripts for IL-l-a, IL-5, IL-6, LIF, TNF-a, and TNF-/3.Transcripts for the IL-2R p55 and p75 chains, the IL-6R p80
TCR-/J chain°As proposed by the workshops on human leukocyte differentiation antigens
(Paris, France, 1982; Boston, MA, 1984; Oxford, United Kingdom, 1986).* -, negative; +, 20-50% were positive; ++, >50% were positive.' Expression upon treatment with TPA only.
Table 2 Constitutive and TPA-inducible mRNA expression of selected cytokines,protooncogenes, and cytokine receptors by HD-derived cell lines
" mRNA expression was assessed by Northern hybridization of cytoplasmicRNA (15 ng/lane) using specific cDNA probes. IL-I-«transcripts were detectedwith a specific oligonucleotide probe. Absence of RNA degradation and comparable RNA loading in single lanes was confirmed by staining of rRNA inethidium bromide gels.
chain, c-jun, c-fos, and NF /cB were also synthesized. Unlikeactivated T-cells, however, HDLM-2 cells failed to produce IL-2, IL-4, IFN-7, IL-7, and IL-10 mRNA. Exposure to TPA alsodid not lead to expression of these genes. Detection of M-CSFand c-fms mRNA in both cell lines was surprising, becauseexpression of these genes was previously found in monocytes/macrophages and placenta tissue only. Recently, c-fms expression was also identified in the HD-derived L428 line (31) andwas interpreted as being indicative of the affiliation of RS-Hcells with the phagocytic lineage. To determine whether c-fmsand M-CSF transcript synthesis by HDLM-2 and KM-H2 cellswas due to an aberrant expression resulting from a rearrangement. Southern blot analysis of restriction enzyme fragment length polymorphism for BamHl. Rsal, Hind\\\, £coRl,Pstl, and Bgl\\ was performed but did not reveal any grossrearrangement or amplification of either gene upon probingwith the respective genomic probes. In addition, typical mono-cyte products such as IL-l-tf, G-CSF, and JE/MCAF (62, 63)were not detectable in 15 ng RNA collected from HDLM-2 andKM-H2 cells. TGF-/Õtranscripts were, however, constitutivelyexpressed in both cell lines.
Effect of TPA on Expression of Cytokine mRNA by HD-derived Cell Lines. Since most of the cytokine genes investigatedhere contain TPA-responsive elements in their regulatory 5'
sequences (50) conferring transcriptional activation upon binding, the effect of TPA treatment on mRNA accumulation ofvarious genes that were not constitutively expressed by eitherline [GM-CSF, G-CSF, IL-l-ß,IL-2, IL-3, IL-4, IL-7, IL-8, ILIO, and LIF (for KM-H2 cells only) and IFN-7, JE, IL-6R p80,and IL-2R p75] was investigated. To this end, HDLM-2 andKM-H2 were exposed to TPA (24 n\i) for 12 and 24 h. In allexperiments, cell viability in TPA treated cultures was >95%by trypan blue dye exclusion. As shown in Table 2, GM-CSFand IL-3 mRNA, albeit not constitutively expressed by eithercell line, was induced in HDLM-2 and KM-H2 cells by TPA.LIF and IL-8, as well as IL-2R ßchain, mRNA not detectablein unstimulated KM-H2 was inducible upon TPA treatment, aswas IL-8 mRNA in HDLM-2 cells. TPA failed, however, toelicit synthesis of transcripts for G-CSF, IL-1-/3, IL-2, IL-4, IL-7, IL-10, IFN-7, and JE/MCAF in both cell lines and also didnot induce IL-6R p80 mRNA expression in KM-H2 cells.
Identification of Proteins of Various Cytokines in Supernatantsof Cultures of HD-derived Cell Lines. Given the finding ofmRNA synthesis of various cytokines by HDLM-2 and KM-H2 cells, release of the corresponding proteins was assessed incell-free culture supernatants of both lines. Cultures of HDLM-2 and KM-H2 cells were performed in the presence or absenceof TPA (24 n\i) during a period of 24 h. Thereafter, cell-freeculture supernatants were harvested and were subjected toanalysis of cytokine proteins by enzyme-linked immunoabsor-bent assay (GM-CSF, G-CSF, IL-1-«,IL-1-/3, IL-2, IL-3, IL-4,IL-6, IL-8, TNF-a, and TNF-/3), biological assay (M-CSF), orWestern blot analysis (TGF-/Õ).As shown in Table 3, HDLM-2 and KM-H2 cells secreted M-CSF, IL-6, TNF-«,and TNF-/Öin the absence of TPA treatment. Upon exposure to TPA,secretion of GM-CSF, IL-l-n, IL-3, and IL-8 protein becamedetectable. G-CSF, IL-1-/Ì,IL-2, and IL-4 protein was, however,not detectable in supernatants of HDLM-2 and KM-H2 cultures irrespective of the presence or absence of TPA.
Effect of Anti-M-CSF and Anti-IL-6 Antibody on GrowthCharacteristics of KM-H2 Cells. Since both cell lines coex-pressed M-CSF and its receptor and HDLM-2 cells exhibitedthe IL-6R p80 chain and secreted IL-6, the possibility of auto-
Table 3 Protein expression of selected cytokines by HD-derived cell lines
All experiments were repeated three times and gave comparable results. Theresults show a representative experiment (mean values of triplicate cultures withSD<10%).
crine growth stimulation by both factors was investigated.HDLM-2 and KM-H2 cells were seeded at IO5 cells/mL into96-well flat bottom plates (Greiner, Nürtingen,Germany) instandard culture medium with or without neutralizing moAbsto recombinant human M-CSF (kindly provided by P. Ralph)or recombinant human IL-6 (kindly provided by J. Content,University of Brabant, Brussels, Belgium) at final dilutions of1:100. This concentration neutralized >1000 units/mL of M-CSF and >50 ng/mL of IL-6 in pilot experiments investigatingthe effect of M-CSF and IL-6 on growth of the myeloid leukemia WEHI 3BD* and the hybridoma B.9 cells. Cultures wereperformed for a period of 24, 48, and 72 h with [(H]thymidine
(37 mBq/well) being present for the last 6 h. The cells werethen collected onto glass fiber strips with a semiautomatic cellharvester (Cambridge Technology Inc., Cambridge, MA) anddried. The amount of ['H]thymidine incorporated into DNA
was determined by liquid scintillation counting. Since no difference in the cultures with or without anti-M-CSF or anti-IL-6 moAbs could be detected (not shown), M-CSF and IL-6 maynot have served as autocrine growth factors for either cell line,at least so far as the secreted form of these molecules isconcerned. However, internal association of the M-CSF andIL-6R with their growth factors might be the mode of autocrineloop existent in the Hodgkin lines, but this was not investigatedhere.
Assay of Nuclear Proteins Obtained from HD-derived CellLines. Nuclear extracts from medium- or TPA (24 nM, 1 h)-treated HDLM-2, KM-H2 cells, T-cells, LUNDAK B-cells, andmonocytes were analyzed for the expression of the transcriptionfactors AP 1, NFAT 1, and NF *B using EMSA (Table 4).HDLM-2 and KM-H2 cells constitutively produced a proteinthat bound an oligonucleotide containing the AP l consensussequence from the collagenase enhancer. Both T-cells andHDLM-2 cells exhibited low AP 1-binding activity in an unstimulated state that was enhanced upon exposure to TPA by7- to 8-fold and 3- to 4-fold, respectively. KM-H2 cells constitutively showed high AP 1-binding activity that was not furtherenhanced by TPA treatment. Normal peripheral blood T-cells,leukemic T-cell lines, and HDLM-2 and KM-H2 cells alsodisplayed constitutive binding activity to an oligonucleotidecontaining the NFAT 1 consensus sequence, a nuclear factorpreviously demonstrated to be T-cell specific. Binding wasfurther enhanced in all T-cell types and HDLM-2 cells uponexposure to TPA but was downregulated in KM-H2 cells afterTPA treatment. Normal human monocytes and lymphoblastoid
Medium TPA Medium TPA Medium TPA Medium TPA Medium TPA
AP-1NF «BNFAT l
1-. no binding delectable; +. weak constitutive binding; ++. strong constitutive binding; +++, enhanced binding upon treatment with TPA (for 1 h. 24 nvi).
o O SS I *
Fig. I. A, constitutive binding of NF »Bproteinisolated from untreated blood monocytes (Mo).HDLM-2, KM-H2. and T-cells (T). Nuclear proteins(10 mg) obtained from these cells were incubatedwith an oligonucleotide containing the NF kB consensus sequence in the absence (no competitor) orpresence of 25-fold M excess of unlabeled NF «Boligonucleotide (specific competitor) or 25-fold Mexcess of an unlabeled unrelated oligonucleotide (notshown). Arrowhead, unbound DNA. B, L'V cross-linking analysis of DNA-protein complexes formedwith nuclear extracts obtained from T-cells (T),HDLM-2, KM-H2. and blood monocytes (Mo) withthe NF «Boligonucleotide. Protein-DNA complexeswere UV cross-linked in solution and then analyzedon a 12% SDS/poIyacrylamide gel under reducingconditions.
nnnnB
i l II l i lo g o 5 u Du§5. o S. o o. o» c w c We 85 kD
75 kD
55 kD
B-cell lines, however, failed to express a NFAT 1-bindingprotein constitutively or in response to TPA or other stimuliincluding IL-1, TNF-a, and endotoxin (not shown). We alsoanalyzed for constitutive and inducible binding activity of theNF KB transcription factor. All cells investigated showed constitutive NF *B-binding activity that could be further augmentedby TPA (Table 4). Interestingly, however, retarded bands frommonocytes, T-cells, K.M-H2, and HDLM-2-derived proteins
displayed differential migration pattern, suggesting size heterogeneity of nuclear factors binding to the NF «Bconsensussequence (Fig. 1/4). For all cell types, binding was competed forby an unlabeled oligonucleotide carrying the NF *B-bindingsite but not with an unrelated oligonucleotide (Fig. ÌA,and datanot shown). We, therefore, sought to determine the molecularsize of nuclear proteins binding to the NF «Boligonucleotide.To this end, UV cross-linking experiments were performed. Asshown in Fig. \B, both HDLM-2 and KM-H2 cells exhibited
three different nuclear proteins of M, 85,000, 75,000, and50,000. The same protein pattern was observed in T-cells, whilemonocyte-derived nuclear proteins and nuclear proteins collected from the LUNDAK B-cell line (not shown) displayed theM, 50,000/55,000 and 75,000 protein complex only and lackedthe M, 85,000 moiety.
DISCUSSION
We have shown the expression of a variety of cytokines (i.e.,GM-CSF, M-CSF, IL-1-a, IL-3, IL-5, IL-6, IL-8, LIF, TNF-a, TNF-/3, TGF-/3, cytokine receptors (IL-2R p55 and p75, IL-6R p80, M-CSF receptor), cytokine-associated protooncogenes,and transcription factors (NF xB, NFAT1, c-fos, and c-junwhich form the heterodimeric transcription factor AP 1) inHD-derived cell lines. The lines we have investigated (HDLM-2 and KM-H2) can be regarded as representatives of the neo-
plastic component of HD based on many characteristics of"true" RS-H cells (46, 47, 64), although it has to be considered
that cell lines cannot be derived from the vast majority of casesof HD, and therefore, HD tumors that allow establishement ofcell lines may bear atypical features. To establish concordancebetween primary RS-H cells and those in the HD-derived cellslines and to establish a relationship between cytokine expressionby these cells and the pathophysiology of HD, future studies ofthe expression of the respective genes in primary HD-involvedtissues will be clearly needed. A direct comparison between theprimary tumor cells from which the cell lines were originallyderived and both lines revealed, however, an almost identicalmorphology, cytochemical staining profile, immunophenotype,and genotype (46, 65, 66).
Constitutional B symptoms, elevations of acute phase reac-tants in the serum, the presence of mild thromobocytosis, orcertain histopathological manifestations such as sclerosis, po-lycarion formation, plasmacytosis, and eosinophilia are common features in active HD (l) and may relate to an abnormalor unbalanced secretion of cytokines. Indeed, several of thecytokines identified here as products of RS-H cells exert biological effects that resemble distinct clinical and morphologicalfeatures seen in HD. For instance, IL-6 is the major hepatocyte-
stimulating factor that induces release of acute phase proteins(67). In addition, IL-6 exhibits thrombopoietin activity, anactivity shared by LIF (68), and induces terminal differentiationof B-lymphocytes into immunoglobulin-producing cells. Injection of TNF-a and IL-1 can cause fever and sweats (69), clinicalfindings similar to B symptoms in HD. TNF-a also causeselevation of fibrinogen serum levels, also frequently seen inHD. LIF and TGF-0 are known to be involved in collagensynthesis and, thus, in sclerosis formation (70, 71). Both IL-5and GM-CSF are potent eosinopoietic growth factors and activators. Our results may therefore explain the prominent infiltration by eosinophils in many cases of HD. In addition, thesupernatant obtained from cultures of HDLM-2 cells has beenshown to contain a differentiation activity for myelomonocyticcells (35) that may be ascribed to the various CSFs and IL-6produced by these cells. GM-CSF and IL-3 are involved in theinduction of histamine release. The generalized itching oftenexperienced by HD patients may be linked to secretion of thesefactors.
The presence of M-CSF/c-fms on HDLM-2 and KM-H2cells and of IL-6/IL-6R p80 on HDLM-2 cells suggests autocrine growth stimulation. However, we were unable to detectsuch an autocrine loop generated outside the cells. Based onour experiments we cannot exclude any internal association ofthe M-CSF receptor and IL-6R with their respective ligands. Itmight also be possible that only a minor subpopulation of cellsparticipates in autocrine growth stimulation that is not detectable by ['Hjthymidine incorporation assay. In this regard, the
observation that only the L428KSA variant but not the parentalL428 HD line autocrinously generated M-CSF is of note.Remarkably, cell cycle kinetic studies revealed that L428KSAwas derived from the proliferatively active cell population ofthe parental line (31).
The spectrum of cytokines being produced by HDLM-2 andKM-H2 may also serve to define the precursor identity of RS-H cells. The HDLM-2 cells have rearranged the gene for the ßchain of the TCR, which appears to be nonfunctional becauseneither cytoplasmic nor surface expression of the TCR-/? chaincould be detected by using a moAb against a monomorphicportion of TCR-/3. HDLM-2 cells also produce IL-2R tran
scripts and express the p55 and p75 IL-2R chain on the cellsurface. The HDLM-2 cells produce mRNA of cytokines whichare normally products of activated T-cells, including GM-CSF,IL-3, IL-5, IL-6, LIF, and TNF-/3 (which has been found inlymphocytes only). High levels of IL-1-a were also recentlyfound in activated T-cells (72). Similarly, also M-CSF expression by activated T-cells has been reported (73). Clinical heterogeneity is apparent in HD, and thus, HD-derived cell linesshow heterogeneity. Extrapolation of the information gainedfrom KM-H2 cells would also support a T-cell origin ratherthan an affiliation with the macrophage or B-cell lineage, although KM-H2 cells nonproductively rearrange the immuno-globulin heavy-chain gene and display the B lineage-associatedCD21 antigen. Interestingly, both cell lines expressed the IL-8gene, previously observed in monocytes and fibroblasts only.Other typical monocyte products such as IL-1-0, JE/MCAF,and G-CSF were, however, not detectable in cytoplasmic RNAof HDLM-2 and KM-H2 cells. Expression of c-fms by both celllines must be ranked as abnormal. Aberrant expression of c-fms has been reported in some solid tumor cells (32, 74, 75)and also in the HD-derived L428 line (31) and may be theresult of an altered activation of the c-fms promoter. Nevertheless, restriction enzyme analysis of DNA obtained from bothlines failed to disclose a gross DNA rearrangement of the c-fmsgene (and of the M-CSF gene). Therefore, we are currentlyinvestigating the c-fms gene in KM-H2 in more detail by Sl-nuclease assay.
Both KM-H2 and HDLM-2 cells display a pattern of nuclearproteins binding to the NF <cBoligonucleotide which resemblesthat of T-cells in EMSA. UV cross-linking experiments confirmthat HD-derived NF KB proteins have the same molecularweight as T-cell-derived NF «B-bindingproteins, while monocytes (and also B-cells) show a NF *B-binding complex lackingthe A/r 85,000 moiety. One might argue that the pattern of NF«Bexpression may be related to levels of monocyte differentiation. We have, however, never observed the appearance of p85protein regardless of mode (TPA, IL-1, TNF-a, endotoxin) andduration (30 min-6 h) of monocyte stimulation. In addition, thenuclear transcription factor NFAT 1, previously characterizedas being T-cell specific, is constitutively expressed in bothHDLM-2 and KM-H2 cells and binding activity is enhanced inresponse to TPA. Human monocytes and B-cells, however,failed to show NFAT 1-binding activity in the presence orabsence of appropriate stimulation.
REFERENCES
1. Kaplan, H. S. Hodgkin's Disease, p. 52. Boston, MA: Harvard University
Press, 1980.2. Jones, D. B. The histogenesis of the Reed-Sternberg cell and its mononuclear
counterparts. J. Pathol., 151: 191-196, 1987.3. Falini, B., Stein, H.. Pileri, S., Canino. S.. Farabbi, R., Martelli, M. F.,
Grignani. F., Fagioli, M., Minelli, O.. Ciani, C., and Flenghi, L. Expressionof lymphoid-associated antigens on Hodgkin's and Reed-Sternberg cells ofHodgkin's disease. An immunocytochcmical study on lymph node cytospinsusing monoclonal antibodies. Histopathology, //: 1229-1234, 1987.
4. Drexler, H. G., Leber, B. F., Norton, J., Yaxley. J., Tatsumi, E., Hoffbrand,A. V., and Minowada, J. Genotypes and immunophenotypes of Hodgkin'sdisease-derived cell lines. Leukemia (Baltimore). 2: 371-377, 1988.
5. Griesser, H.. and Mak, T. W. Immunogenotyping in Hodgkin's disease.Hematol. Oncol.. 6: 239-245, 1988.
6. Herbst, H., Tippelmann, G., Anagnostopoulos, I., Gerdes, J., Schwarting,R., Boehm, T.. Pileri, S., Jones, D. B., and Stein, H. Immunoglobulin andT-cell receptor gene rearrangements in Hodgkin's disease and Ki-1-positive
anaplastic large cell lymphoma: dissociation between phenotype and genotype. Leuk. Res., 13: 103-110, 1989.
7. Olsson, L., and Behnke, O. Phenotypic attributes of the malignant cellpopulation in Hodgkin's disease indicate a monocyte macrophage origin.Cancer Surv., 4: 421-427, 1985.
8. Kadin, M. E., Stiles, O. P., Levy, R.. and Warnke, R. Exogenous immuno-globulin and the macrophage origin of Reed-Sternberg cells in Hodgkin'sdisease. N. Engl. J. Med., 299: 1208-1214, 1978.
9. Kaplan, H. S., and Gartner, S. "Sternberg-Reed" giant cells of Hodgkin's
disease: cultivation in vitro, heterotransplantation, and characterization asneoplastic macrophages. Int. J. Cancer, 19: 511-517, 1977.
10. Hsu, S. M., and Hsu, P. L. Aberrant expression of T cell and B cell markersin myelocyte/monocyte/histiocyte-derived lymphoma and leukemia cells. Isthe infrequent expression of T/B cell markers sufficient to establish a lymph-oid origin for Hodgkin's Reed-Sternberg cells? Am. J. Pathol., 134: 203-
210, 1989.11. Hansmann, M. L., Radzun, H. J., Nebendahl, C., and Parwaresch, M. R.
Immunoelectronmicroscopic investigation of Hodgkin's disease with monoclonal antibodies against histiocytes. Eur. J. Haematol., 40: 25-31, 1988.
12. Kadin, M. E. Possible origin of the Reed-Sternberg cell from an interdigitat-ing reticulum cell. Cancer Treat. Rep., 66: 601-608, 1982.
13. Fisher, R. J., Bostick-Bruton, F., Sauder, N., Scala, G., and Diehl, V.Neoplastic cells obtained from Hodgkin's disease are potent stimulators ofhuman primary mixed lymphocyte cultures. J. Immunol., 130: 2666-2673,1983.
14. Fisher, R. J., Cossman, J., Diehl, V., and Volkman, D. Y. Antigen presentation by Hodgkin's disease cells. J. Immunol., 135: 3568-3573, 1985.
15. Stein, H., Uchanska-Ziegler. B., Gerdes, J., Ziegler, A., and Wernet, P.Hodgkin's and Reed-Sternberg cells contain antigens specific to late cells ofgranulopoiesis. Int. J. Cancer, 29: 283-290, 1982.
16. Athan, E. S., Paietta, E., Papenhausen. P. R., Augenlicht, L., Wiernik, P.H., and Gallagher, R. E. Stability of multiple antigen receptor gene rearrangements and immunophenotype in Hodgkin's disease-derived cell lineL428 and variant subline L428KSA. Leukemia (Baltimore). 3: 505-511,1989.
17. Diehl, V., Kirchner, H. H., Burrichter. H., Stein, H., Fonatsch, C., Gerdes,J., Schaadt, M., Heit, W., Uchanska-Ziegler, B., Ziegler, A., Heintz, H., andSueno, K. Characteristics of Hodgkin's disease-derived cell lines. CancerTreat. Rep., 66: 615-622, 1982.
18. Olsson, L., Olav. B., Pleibel, N., D'Amore, F., Werdelin. O., Fry, K. E., and
Kaplan, H. S. Establishment and characterization of a cloned giant cell linefrom a patient with Hodgkin's disease. J. Nail. Cancer Inst., 73: 809-815,
1984.19. Jones, D. B., Scott, C. S.. Wright, D. H., Stein, H., Beverley. P. C. L., Payne,
S. V., and Crawford, D. H. Phenotypic analysis of an established cell linederived from a patient with Hodgkin's disease. Hematol. Oncol., 3:133-140,
1985.20. Poppema, S., de Long, B.. Atmosverodjo, J., Idenburg, V., Visser, L., and
de Ley, L. Morphologic, immunologie, enzyme, histochemical and chromosomal analysis of a cell line derived from Hodgkin's disease. Evidence for aB-cell origin of Sternberg-Reed cells. Cancer (Phila.), 55:683-689, 1985.
21. Schaadt, M., Fonatsch, C., Kirchner, H. H., and Diehl, V. Establishment ofa malignant, Epstein-Barr-virus (EBV)-negative cell-line from the pleuraleffusion of a patient with Hodgkin's disease. Blut, 38: 185-190, 1979.
22. Drexler, H. G., Amlot, P. L., and Minowada, J. Hodgkin's disease derivedcell lines—conflicting clues for the origin of Hodgkin's disease? Leukemia(Baltimore), I: 629-634, 1987.
23. Weiss, L. M., Strickler, J. G., Hu, E., Warnke, R. A., and Sklar, J. Immu-noglobulin gene rearrangements in Hodgkin's disease. Hum. Pathol., 17:1009-1014, 1986.
24. Brinker, M. G. L., Poppema, S., Buys, C. H. C. M., Timens. W., Osinga, J.,and Visser, L. Clonal immunoglobulin gene rearrangements in tissues involved by Hodgkin's disease. Blood, 70: 186-191, 1987.
25. Sundeen, J., Lipford. E., Uppenkamp. M., Sussman, E., Wahl, L., Raffeld,M., and Cossman, J. Rearranged antigen receptor genes in Hodgkin's disease.Blood, 70:96-101, 1987.
26. Knowles, D. M., Il, Neri, A., Pelicci, P. G., Burke, J. S., Wu, A., Winberg,C. D., Sheibani, K., and Dalia-Pavera, R. Immunoglobulin and T-cell receptorB-chain gene rearrangement analysis of Hodgkin's disease: implications for
lineage determination and differential diagnosis. Proc. Nati. Acad. Sci. USA.83: 7942-7947, 1986.
27. Steenvoorden, A. C. M., Janssen, J. W. G., Drexler, H. G., Lyons, J., Tesch,H., Binder, T., Jones, D. B., and Bartram, C. R. Ras mutations in Hodgkin'sdisease. Leukemia (Baltimore), 2: 325-331, 1988.
28. Milani, S., Sugawara, I., Shiku, H., and Mori, S. Expression of c-myconcogene product and rai family oncogene products in various humanmalignant lymphomas defined by immunohistochemical techniques. Cancer(Phila.). 62: 2085-2090, 1988.
29. Tesch, H., Jiicker, M., Falk, M. H., Bornkamm, G. W., Jones, D. B., andDiehl, V. Molecular analysis of Hodgkin's disease-derived cell lines. Hematol. Oncol., 6: 223-228, 1988.
30. Slmmm. D. J., deKernion, J. B., Verma, I. M., and Cline, M. J. Expressionof cellular oncogenes in human malignancies. Science (Washington DC),224:256-261, 1984.
31. Paietta, E., Racevskis. J., Stanley, R., Andreeff, M., Papenhausen, P., andWiernik, P. H. Expression of the macrophage growth factor, CSF-1, and itsreceptor c-fms by a Hodgkin's disease-derived cell line and its variants. CancerRes., 50: 2049-2054. 1990.
32. Rettenmier, C. W., Sacca, R., Furman. W. L., Roussel. M. F.. Holt, J. T.,Nienhuis, A. W.. Stanley, E. R., and Sherr. C. J. Expression of the humanc-fms proto-oncogene product (colony-stimulating factor-1 receptor) on peripheral blood mononuclear cells and choriocarcinoma cell lines. J. Clin.Invest., 77: 1740-1745, 1986.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44,
45
46
47
48
49
50
51
52
53
54
55
56
57.
58
Burrichter, H., Heit, W., Schaadt, M., Kirchner, H., and Diehl, V. Productionof colony-stimulating factors by Hodgkin cell lines. Int. J. Cancer, 31: 269-274, 1983.Byrne, P. V., Heit, W., and March, C. J. Human granulocyte-macrophagecolony-stimulating factor purified from a Hodkin's tumor cell line. Biochim.Biophys. Acta, 874: 266-273, 1986.Naumovski, L., Utz, P. J., Bergstrom, S. K., Morgan, R., Molina, A., Toóle,J. J., Glader, B. E., McFall, P., Weiss, L. M., Warnke, R., and Smith, S. D.SUP-HD1: a new Hodgkin's disease-derived cell line with lymphoid featuresproduces interferon-7. Blood, 74: 2733-2739, 1989.Samoszuk, M., and Nansen, L. Detection of interleukin-5 messenger RNAin Reed-Sternberg cells of Hodgkin's disease with eosinophilia. Blood, 75:13-18, 1990.Hsu, S. M., Krupen, K., and Lachman, L. B. Heterogeneity of interleukin 1production in cultured Reed-Sternberg cell lines HDLM-1, HDLM-ld andKM-H2. Am. J. Pathol., 135: 33-38, 1989.Hsu, P. L., and Hsu, S. M. Production of tumor necrosis factor-a andlymphotoxin by cells of Hodgkin's neoplastic cell lines HDLM-1 and KMH2.Am. J. Pathol., 135: 735-745, 1989.Hsu, S. M., and Zhao, X. Expression of interleukin-1 in Reed-Sternberg cellsand neoplastic cells from true histiocytic malignancies. Am. J. Pathol., 725:221-225, 1986.Kretschmer, C, Jones, D. B., Morrison. K., Schlüter,C., Feist, W., Ulmer,A. J., Arnoldi, J., Matthes, J., Diamantstein, T., Fiad, H. D., and Gerdes, J.Tumor necrosis factor alpha and lymphotoxin production in Hodgkin'sdisease. Am. J. Pathol., 137: 341-351, 1990.Newcom, S. R., Kadin. M. E., Ansari, A. A., and Diehl, V. L-428 nodularsclerosing Hodgkin's cell secretes a unique transforming growth factor-betaactive at physiologic pH. J. Clin. Invest., 82: 1915-1921, 1988.Kadin, M. E., Agnarsson, B. A., Ellingsworth, L. R., and Newcom, S. R.Immunohistochemical evidence of a role for transforming growth factor betain the pathogenesis of nodular sclerosing Hodgkin's disease. Am. J. Pathol.,136: 1209-1214, 1990.Jücker,M., Abts, H., Li, W., Schindler, R., Merz, H.. Günther,A., vonKalle, C., Schaadt, M.. Diamantstein, T.. Feller, A. C., Krueger, G. R. F.,Diehl, V., Blankenstein, T., and Tesch, H. Expression of interleukin-6 andinterleukin-6 receptors in Hodgkin disease derived cell lines. Blood, 77:2413-2418. 1991.Merz, H., Houssiau, F. A., Orscheschek, K., Renauld, J. C. Fliedner, A..Herin, M., Noel, H., Kadin, M., Mueller-Hermelink, H. K., Van Snick, J.,and Feller, A. C. Interleukin-9 expression in human malignant lymphomas:unique association with Hodgkin's disease and large cell anaplastic lymphoma. Blood, 78: 1311-1317, 1991.Gruss, H. J., Brach, M. A., Drexler, H. G., Bross, K. J.. and Herrmann, F.Interleukin 9 is expressed by primary and cultured Hodgkin and Reed-Sternberg cells. Cancer Res., 52: 1026-1031, 1992.Drexler, H. G., Gaedicke, G., Lok, M. S., Diehl, V., and Minowada, J.Hodgkin's disease derived cell lines HDLM-2 and L-428: comparison ofmorphology, immunological and isoenzyme profiles. Leuk. Res.. 10: 487-492. 1986.Kamesaki, H., Fukuhara. S., Tatsumi. E., Uchino, H., Yamabe, H., Miwa,H., Shirakawa, S., Hatanaka. M.. and Honjo, T. Cytochemical, immunologie,chromosomal and molecular genetic analysis of a novel cell line derived fromHodgkin's disease. Blood, 68: 285-290. 1986.
Crabtree. G. R. Contingent genetic regulatory events in T lymphocyte activation. Science (Washington DC), 243: 355-358, 1989.Chiù,R., Boyle, W. J., Meek, J., Smeal, T., Hunter, T., and Karin, M. Thec-fos protein interacts with c-jun/\P 1 to stimulate transcription of AP lresponsive genes. Cell, 54: 541-547, 1988.Taniguchi. T. Regulation of cytokine gene expression. Annu. Rev. Immunol.,6:439-446, 1988.Shaw, J-P., Utz, P. J., Durand, D. B., Toóle, J. J., Emmel, E. A., andCrabtree, G. R. Identification of a putative regulator of early T cell activationgenes. Science (Washington DC), 241: 202-205. 1988.Mantovani. L., Henschler, R., Brach, M. A„Wieser, R., Lübbert,M.,Lindemann. A., Mertelsmann. R. H., and Herrmann, F. Differential regulation of interleukin-6 expression in human fibroblasts by tumor necrosisfactor-a and lymphotoxin. FEBS Lett., 270: 152-157, 1990.Lindemann, A., Dörken,B., Henschler, R., Mertelsmann, R„and Herrmann,F. Screening for expression of cytokines with hematopoietic growth factoractivity by permanent human B-cell lines. Leukemia (Baltimore), 5: 715-719, 1991.Oster, W., Lindemann, A., Horn, S., Mertelsmann, R., and Herrmann, F.Tumor necrosis factor (TNF)-alpha but not TNF-beta induces secretion ofcolony-stimulating factor for macrophages (CSF-1) by human monocytes.Blood, 70: 1700-1704. 1987.Herrmann, F., Cannistra, S. C., Levine, H., and Griffin, J. D. Expression ofIL-2 receptors and binding of IL-2 by gamma-interferon induced humanleukemic and normal monocytic cells. J. Exp. Med. 162: 1111-1116, 1985.Herrmann, F., Cannistra, S. A., Lindemann, A., Blohm, D., Rambaldi, A.,Mertelsmann, R. H., and Griffin. J. D. Functional consequences of monocyteIL-2 receptor expression: induction of IL-10 secretion by IFN-f and IL-2. J.Immunol., 142: 139-145, 1989.Southern, E. Detection of specific sequences among DNA fragments separated by gel electrophoresis. J. Mol. Biol., 98: 503-508, 1975.Ohlsson, H., and Edlund, T. Sequence-specific interactions of nuclear factorswith the insulin gene enhancer. Cell, 45: 35-40, 1986.
59. Brach, M. A., Henschler, R., Mertelsmann. R. H., and Herrmann, F. Regulation of M-CSF expression by M-CSF: role of protein kinase C and transcription factor NF.B. Pathobiology, 59: 284-290, 1991.
60. Sen, R., and Baltimore, D. Multiple nuclear factors interact with the immu-noglobulin enhancer sequences. Cell, 46: 705-710, 1986.
61. Molitor, J. A., Walker, W. H., Doerre, S., Ballard, D. W., and Greene, W.C. NF-kB: a family of inducible and differentially expressed enhancer-bindingproteins in human T cells. Proc. Nati. Acad. Sci. USA, 87: 10028-10034,1990.
62. Cochran, B. H., Reffel, A. C, and Stiles, C. D. Molecular cloning of genesequences regulated by platelet-derived growth factor. Cell, 33: 939-945,1983.
63. Rollins, B., Stier, P., Ernst, T., and Wong, G. G. The human homolog ofthe JE gene encodes a monocyte secretory protein. Mol. Cell. Biol., 9:4687-4693, 1989.64. Drexler, H. G., Jones, D. B.. Diehl, V., and Minowada. J. Is the Hodgkin's
cell a T- or B-lymphocyte? Recent evidence from geno- and immunopheno-typic analysis and in-vitro cell lines. Hematol. Oncol., 7: 95-101, 1989.
65. Hsu, S. M., Xi, S. S., and Hsu, P. L. The cultured Reed-Sternberg cellsHDLM-1 and KM-H2 can be induced to become histiocyte-like cells: H-RScells are not derived from lymphocytes. Am. J. Pathol., 137: 353-359, 1990.
66. Drexler, H. G., Leber, B. F.. Norton, J., Yaxley, J., Tatsumi, E., Hoffbrand,A. V., and Minowada. J. Genotypes and immunophenotypes of Hodgkin'sdisease-derived cell lines. Leukemia (Baltimore), 2: 371-377, 1988.
67. Bauer, J., and Herrmann, F. IL-6 in clinical medicine. Ann. Hematol., 62:203-209, 1991.
68. Brach, M. A., Löwenberg,B., Mantovani, L., Schwulera, U., Mertelsmann,
R., and Herrmann, F. Interleukin-6 (IL-6) is an intermediate in IL-1-inducedproliferation of leukemic human megakaryoblasts. Blood, 76: 1972-1979,1990.
69. Gamm, H., Lindemann, A., Mertelsmann, R. H., and Herrmann, F. Recombinant human TNF-a in patients with advanced malignancy: results of aphase I clinical study. Eur. J. Cancer, 27:856-863, 1991.
70. Metcalf, D., and Gearing, D. P. A myelosclerotic syndrome in mice engraftedwith cells producing high levels of leukemia inhibitory factor (LIF). Leukemia(Baltimore), 3: 847-853, 1989.
71. Wahl, S. M., McCartney-Francis, N., and Mergenhagen, S. E. Inflammatoryand immunomodulatory roles of TGF-beta. Immunol. Today, 10: 258-264,1989.
72. Cerdan, C., Martin, Y., Brailly, H., Courcoul, M., Flavetta, S., Costello, R.,Mawas, C., Birg, F., and Olive, D. IL-la is produced by T lymphocytesactivated via the CD2 plus CD28 pathways. J. Immunol.. 146: 560-566,1991.
73. Hallet, M-M., Praloran, V., Vie, H., Peyrat, M-A., Wong, G., Witek-Giannotti, J., Soulillou, .11'.. and Moreau J-F. Macrophage colony-stimulating factor (CSF-1) gene expression in human T-lymphocyte clones. Blood,77:780-786, 1991.
74. Horiguchi, J., Sherman, M. L., Sampson-Johannes, A., Weber, B. L., andKufe, D. W. CSF-1 and c-fms gene expression in human carcinoma cell lines.Hindu-m. Biophys. Res. Commun., 157: 395-402, 1988.
75. Kacinski, B. M., Carter, D., Mittal, K., Kohorn, E. I., Shaeffer Bloodgood,R., Donahue, J., Donofrio, L., Edwards, R., Schwartz, P. E., Chambers, J.T., and Chambers, S. K. High level expression of/mi protooncogene mRNAis observed in clinically aggressive human endometrial adenocarcinomas. Int.J. Radiât.Oncol. Biol. Phys., IS: 823-830, 1988.
1992;52:3353-3360. Cancer Res Hans-Jürgen Gruss, Marion A. Brach, Hans-Günter Drexler, et al. CellsTranscription Factors in Cultured Hodgkin and Reed-Sternberg Expression of Cytokine Genes, Cytokine Receptor Genes, and
