Expression of rabies virus coat protein in plants and its...

Expression of rabies virus coat protein in plants

and its efficacy as anti-rabies antigens

THESIS

SUBMITTED TO THE

UNIVERSITY OF LUCKNOW

FOR THE DEGREE OF

DOCTOR OF PHILOSOPHY

IN

BOTANY

BY

ANKIT SINGH M.Sc. BIOCHEMISTRY

PLANT MOLECULAR BIOLOGY & GENETIC ENGINEERING DIVISION

NATIONAL BOTANICAL RESEARCH INSTITUTE

LUCKNOW (INDIA)

&

DEPARTMENT OF BOTANY

FACULTY OF SCIENCE

UNIVERSITY OF LUCKNOW, LUCKNOW (INDIA)

(2013)

Dedicated to my Nation, Parents and all those bright sources of knowledge

who enlighten my life….

Contents

Acknowledgements i-ii

Abbreviation iii-v List of figures vi-xi List if tables xii

Chapter 1 Introduction 1-6

Chapter 2 Review of literature 7-38

Chapter 3 Materials and methods 39-50

Chapter 4 Observations 51-58

Chapter 5 Discussion 59-66

Chapter 6 Summary and conclusions 67-71

Bibliography 72-118

List of publications 119

ACKNOWLEDGEMENTS

i

ACKNOWLEDGEMENTS

I thank Almighty for blessing me with strong will power, patience and confidence, which

helped me in completing the present work. I also very gratefully acknowledge my colleagues for helping

me in various ways to accomplish my thesis work. Without their support and inspiration my endeavors

would not have come to fruition.

First, I thank Dr. Rakesh Tuli, ExDirector, National Botanical Research Institute, for giving

me an opportunity to join his lab and also for excellent guidance, critical suggestions, long scientific

discussions and constant encouragement. His devotion to the work and untiring efforts has left deep

impression in my heart.

I am equally grateful to Dr. Gauri Saxena, Department of Botany, University of Lucknow for

accepting me as a Ph.D. student, technical discussions, critical reading of the thesis and

encouragement.

With genuine perception of moral obligation, I acknowledge my reverence and gratitude to

Dr. P. K. Singh for his constant guidance in planning and completion of this work, useful advices,

tender affection and encouragement which will be always memorable to me.

I acknowledge C.S.I.R with thanks for providing the financial support.

I gratefully acknowledge Dr. Praveen C. Verma for teaching me about hairy root system and

related molecular biology techniques.

I gratefully acknowledge the help and advice given by my seniors Dr. Sribash Roy, Dr. Dinesh

Yadav, Mr. Siddharth Tiwari, Dr. Raju Madanala, Dr. Chandrashekhar and Dr. Hemant Yadav. Very

special thanks to Mr. Rajesh Srivastava for his cooperation.

Abbreviations

iii

Abbreviations

A - Adenine

APC - Antigen presenting cell

APS - Ammonium persulphate

ARE - At rich element

BAP - 6- Benzylaminopurine

ME - -mercaptoethanol

BCIP - 5-Bromo-4-chloro-3-indolyl phosphate

Bisacrylamide - N,N’-methylene bisacrylamide

bp/Kb - Base pair/kilo base pair

BSA - Bovine serum albumin

C - Cytosine

CaMV - Cauliflower mosaic virus

cal-s - Calreticulin signal sequence

CIAP - Calf intestinal alkaline phosphatase

cm - Centimeter

CNS - Central nervous system

CPM - Count per minute

cpm - counts per minute

CTAB - Hexadecyl trimethyl-ammonium

bromide

CTB - Cholera toxin B chain protein

ctxB - Cholera toxin B chain gene

CTL - Cytotoxic T Lymhocytes

CTP - Cytosine triphosphate

CVS - Challenge Virus standard

DEPC - Diethyl pyrocarbonate

DFA - Direct fluorescent antibody

Deica - Diethyl ammonium dithiocarbamate

DMTr - Dimethyl trityl

DNA - Deoxyribonucleic acid

DNase-I - Deoxyribonuclease-I

dNTP - Deoxy nucleoside triphosphate

DSE - Downstream element

DTT - Dithiothreitol

EDTA - Ethylene diamine tetra acetic acid

ER - Endoplasmic reticulum

ERA - Evelyn – Rokitnicki – Abelseth

ERIG - Equine rabies immunoglobulin

FAM - 6-carboxy fluorescein

FUE - Far upstream element

G - Guanine

g - Gram

GLP - Good laboratory practices

GMP - Good manufacturing practices

G protein - Glycoprotein

Abbreviations

iv

(gp)2

-

Glycine-proline hinge

GTE - Glucose- Tris – EDTA

G-Vacc - Recombinant vaccinea virus

expressing rabies glycoprotein

h - Hour

HEP - High Egg Passage

HEPES - N-2-hydroxy ethyl piperazine-N’-

2ethane sulfonic acid

hptII - Hygromycin phosphotransferase II

IPTG - Isopropyl -D thiogalactopyranoside

IU - International Unit

kDa - Kilo Dalton

L - Rabies polymerase

LA - Luria agar

LB - Luria broth

LMP - Low melting point

M - Matrix protein

MES - (2- [n-Morpholino] ethanesulfonic

acid)

Mg - Milligram

MHC - Major histocompatibity complex

Min - Minute

µg - Microgram

µl - Microliter

ml - Milliliter

MOPS - N-Morpholinopropanesulfonic acid

MS - Murashige and Skoog

N - Nucleoprotein

NAA - -Naphthalene acetic acid

N-Bac - Recombinant baculovirus expressing

rabies nucleoprotein

NBT - Nitro blue tetrazolium

NFQ - Non-fluorescent quencher dye

Ng - Nanogram

NK - Natural killer cells

nptII - Neomycin phosphotransferase II

NS - Non-structural protein

NUE - Near- upstream element

N-Vacc - Recombinant pox virus expressing

rabies nucleoprotein

O.D. - Optical density

P - Phosphoprotein

PAGE - Polyacrylamide gel electrophoresis

PBS - Phosphate buffer saline

PCEC - Purified chicken embryo cell vaccine

PCR - Polymerase chain reaction

PDEV - Purified duck embryo cell vaccine

Abbreviations

v

PEG

-

Polyethylene glycol

PFU - Plague forming units

pI - Isoelectric point

PM - Pitman Moore

PMSF - Phenylmethyl sulfonyl fluoride

PPIC - Plant protease inhibitor cocktail

pr-s - Pathogen responsive signal sequence

PTGS - Post transcriptional gene silencing

PV - Pasteur Virus

PVDF - Polyvinylidenedifluoride

PVP - Polyvinyl pyrrolidone

RCGM - Review committee on genetic

manipulation

RGP - Rabies glycoprotein

rgp - Rabies glycoprotein gene

RNA - Ribonucleic acid

RNase-A - Ribonuclease-A

RNP - Ribonucleoprotein

RTB - Ricin toxin B chain protein

rtxB - Ricin toxin B chain gene

SDS - Sodium dodecyl sulphate

Sec - Second

SSC - Saline sodium citrate

STE - Saline Tris-EDTA

T - Thymine

TAE - Tris-acetate-EDTA

TBE - Tris-borate-EDTA

TCA - Trichloro acetic acid

TE - Tris-EDTA

TEMED - N,N,N’,N’-tetramethyl-ethyl-ethlene

diamine

TFA - Trifluoro acetic acid

TGS - Transcriptional gene silencing

TMV - Tobacco Mosaic Virus

Tnos - Nos terminator

Tris - Tris (hydroxymethyl) aminomethane

U - Unit

U - Unit

UV - Ultra-violet

V - Volume

VNA - Virus neutralizing antibodies

VSV - Vesicular stomatitis virus

W - Weight

WHO - World Health Organisation

X-gal - 5-Bromo-4-chloro-3-indolyl--D-

galactoside

List of figures

vi

List of figures

Chapter 1

Figure 1.1: Worldwide distribution of rabies.

Figure 1.2: Cost profile of an immunization program for a fully immunized child.

Chapter 2

Figure 2.1: Structure of rabies virus. Rabies virions are bullet shaped with 10 nm

spike like glycoprotein peplomers covering the surface. The ribo-

nucleoprotein is composed of RNA encased in nucleoprotein,

phosphoprotein and polymerase.

(A) Photograph is adapted from Centers for Disease Control and

Prevention;

(B) Negatively stained rabies virus seen by transmission electron

microscopy from the Wadsworth Center of the New York State,

Department of Health;

(C) Diagrammatic representation of the rabies virion deduced from

electron microscopy and protein analysis by Vernon et al. 1972.

Chapter 3

Figure 3.1: (A) Gene constructs showing cloning of the fusion gene ctxB-rgp in

pBI101. The pr-s-ctxB and rgp fragments were PCR amplified

from pSM31 and pSA5, respectively. Amplified PCR fragments

were digested with enzymes and triple ligated in pBI101 to

obtain pSR1241with two glycine-proline repeats as hinge.

(B) Gene construct pAS1 showing cloning of the fusion gene rgp-

rtxB in pCAMBIA1300. Both cal-s-rgp and shrgp-(gp)2-rtxB

fragments were amplified with primer extension method and

cloned in pSK+

Bluescript vector. Both fragments were cut with

PstI, HpaI and HpaI, SalI restriction enzymes, respectively, then

ligated to assemble whole cal-s-rgp-(gp)2-rtxB fusion gene.

List of figures

vii

Chapter 4

Figure 4.1: A. tumefaciens strain LBA4404 containing pSR1241and pAS1

plasmid was used for transformation of tobacco leave discs.

(A) Transgenic shoot induction from leave discs.

(B) Transgenic shoots elongation and their respective selection on

Kanamycin and Hygromycin containing media.

(C) Acclimatized mature transgenic tobacco plants in glass house.

Figure 4.2: (A) PCR detection for stable integration of ctxB-rgp fusion gene in

genomic DNA of the transgenic tobacco lines. M, λ DNA

marker, PC, positive control (plasmid DNA); lane 1-5, transgenic

tobacco lines and NT is non-transgenic tobacco.

(B) PCR amplification of rtxB from stable integration of rgp-rtxB

fusion gene in genomic DNA of the transgenic tobacco lines. M,

PC and NT are showing 100bp marker, plasmid DNA and non-

transgenic tobacco lines, respectively.

Figure 4.3: (A) Determination of CTB-RGP expression in different T0 lines of N.

tabaccum leaves by indirect ELISA with Ab1 equine anti-rabies

antibody, NT is non-transformed plant.

(B) Determination of RGP-RTB expression in different T0 lines of N.

tabaccum leaves by indirect ELISA with Ab1 equine anti-rabies

antibody, NT is non-transformed hairy root.

Figure 4.4: (A) Plasmid pSA1 containing, Agrobacterium rhizogens strain A4

mediated induction of hairy root culture from the leaves of

Solanum lycopersicum grown in ¼ MSP solid media.

(B) Transformed in vitro grown roots of Solanum lycopersicum after

grown in 28th

days in ¼ MSL in liquid media.

(C) Scale-up process of selected hairy root line (H03) in 5L air lift

bioreactor for large production and isolation of candidate protein.

List of figures

viii

Figure 4.5: (A) PCR detection for stable integration of rgp-rtxB fusion gene in

genomic DNA isolated from the transgenic hairy root lines. M, λ

DNA marker, PC, positive control (plasmid DNA); lane 1-5,

transgenic lines H01-H05 and NT are non-transgenic hairy root

lines.

(B) PCR amplification of vir C region in plasmid DNA (PC) and its

absence of selected hairy root lines. M and NT are 100bp marker

and non-transformed lines, respectively.

(C) PCR amplification of rol B region. Lane: 2-5, selected hairy

lines; NT, non-transformed control in vitro hairy roots and M is

100bp marker.

Figure 4.6: Determination of RGP-RTB expression in different lines of Solanum

lycopersicum hairy roots by indirect ELISA with Ab1 equine anti-

rabies antibody, NT is non-transformed hairy root.

Figure 4.7: Comparative study of growth kinetics analysis of selected transgenic

hairy root lines (H01-H05) of rgp-rtxB fusion gene from 1st to 5

th and

6th

is non-transformed in-vitro grown control roots during different

growth phases.

Figure 4.8: Optimum time course study for harvesting transgenic plants and hairy

root lines. Tissues were harvested at each interval of 7, 14, 21, 28 &

35 days and did ELISA by Ab1 equine raised poly clonal anti-rabies

antibody.

(A) Transgenic tobacco plant T01 has highest CTB-RGP protein

expression so that leaves from this plant was taken for the study.

(B) Tomato hairy root line H03 has highest RGP-RTB protein

expression so that taken for the standardization of optimum

harvesting time.

List of figures

ix

Figure 4.9: (A) CTB-RGP expression in different T0 lines of transgenic tobacco

by GM1 receptor based ELISA with Ab1, equine anti-rabies and

Ab2, peptide anti-rabies antibody; NT was absorbance of non-

transformed plant.

(B) RGP-RTB expression in different lines of Solanum lycopersicum

hairy roots by asialofeutin receptor based ELISA with Ab1,

equine anti-rabies and Ab2, peptide anti-rabies antibody; NT was

absorbance of non-transformed hairy root.

Figure 4.10: Quantitative expression of CTB-RGP (A) and RGP-RTB (B) fusion

proteins in their respective high expression transgenic lines by

receptor mediated ELISA with peptidal anti-rabies antibody (Ab2).

Figure 4.11: (A) Western blot analysis of transgenic tobacco plants which contain

ctxB-rgp fusion gene under denaturing condition by using anti-

rabies antibody (Ab2). Crude protein (30 µg) prepared from the

leaves of non-transgenic (NT) and transgenic plants T01, 2 and 3

was loaded along with molecular weight markers (M).

(B) Western blot analysis of transgenic tomato hairy root lines which

contain rgp-rtxB fusion gene under denaturing condition by using

peptide anti-rabies antibody (Ab1). Crude protein (50 µg) was

prepared from the hairy root lines H01, H02, H03, H04, NT (non-

transformed) lines and loaded along with molecular weight

markers (M).

Figure 4.12: Western blot analysis of transgenic lines under non-denaturing

condition by using polyclonal anti-rabies antibody (Ab2).

(A) Crude protein (30 µg) was prepared from the tobacco line of ctxB-

rgp fusion gene (T01), loaded at lane 2; M, marker and NT is non-

transformed line.

List of figures

x

(B) Crude protein (50 µg) was prepared from the tomato hairy root

line of rgp-rtxB fusion gene (H03), loaded at lane 3; M, marker

and NT is non-transformed line.

Figure 4.13: (A) Detection of chimeric ctxB-rgp gene in T0 lines of transgenic

tobacco plants by Southern hybridization analysis. Lane NT, non-

transgenic; T01, transgenic line T01 and PC represent positive

control plasmid.

(B) Detection of chimeric rgp-rtxB gene in transgenic tomato hairy

root lines by Southern hybridization analysis. NT is non-

transgenic; H03, transgenic hairy root line of H03 and PC

represent positive control.

Figure 4.14: Immune response against both the fusion protein CTB-RGP and RTB-

RGP in five Balb/c mice of each group. Both fusion proteins were

orally administered (OD) to each mice of every group in the

following manner of regime 0, 7, 14, 21 and 35. Virus + CTB and

Virus + RTB group represents attenuated virus vaccine was orally

given to mice with cholera toxin B and ricin toxin B subunit of

mucosal adjuvants, respectively.

Figure 4.15: Cartoon representation of both CTB-RGP and RGP-RTB fusion

proteins.

(A) Tertiary structure of CTB-RGP shows topology composed of N-

terminally attached Cholera toxin B Chain (Blue) with Rabies

glycoprotein (Green) using GlyProGlyPro linker.

(B) Tertiary structure of RGP-RTB shows topology composed of C-

terminally attached Ricin B Chain (Blue) with Rabies

glycoprotein (Green) using GlyProGlyPro linker (Red).

Figure 4.16: Ramachandran Plot of Phi (ψ) and Sci (ϕ) of both the fusion proteins

(A) CTB-RGP; (B) RGP-RTB.

List of figures

xi

Figure 4.17: Superimposition studies of overall cartoon structure of both the fusion

proteins.

(A) Tertiary structure of Cholera toxin B Chain and Rabies

glycoprotein shown in Blue and Green in fusion protein CTB-

RGP while superimposed CTB and RGP of PDB database shown

in Sky Blue and pink colours, respectively.

(B) Tertiary structure of Ricin toxin B Chain and Rabies

glycoprotein shown in Orange and Green in fusion protein

RGP-RTB while superimposed RTB and RGP of PDB database

shown in Sky Blue and Blue colours, respectively.

Figure 4.18: Super imposition of the cartoon structures of rabies glycoprotein from

both the fusion protein, CTB-RGP (Yellow) and RGP-RTB (Blue)

together to asses any overall change in the structure of both the

protein.

Figure 4.19: Surface representation of antigenic sites of RGP on both CTB-RGP

(A) and RGP-RTB (B) fusion proteins. Conformationally important

sites K202 and R336 of RGP shows in Hot Pink (A) / Yellow color

(B) and Brown (A) / Orange (B) color, respectively. Whereas

important antigenic sites A (34-42aa), site B (198-200aa), site C (208-

216aa) and D (286-306aa) represents as Red, Blue, Raspberry Red

and Cyan color, respectively.

Figure 4.20: Hopp-Wood (HW) and Surface Exposure (SE) plots for CTB-RGP

and RGP-RTB fusion proteins. A (32-42), B (198-200), C (208-216)

and D (286-306) represent potent antigenic sites as described by other

research groups.

List of tables

xii

List of tables

Chapter 2

Table 2.1: Predominant global rabies reservoirs

Table 2.2: Response of different vaccines against rabies

Table 2.3: Proteins of potential commercial interest produced in transgenic

plants

Chapter 3

Table 3.1: List of primers used in rgp-rtxB fusion gene construction

Chapter 4

Table 4.1: Comparative analysis of growth performance and protein expression

Table 4.2: Comparative analysis of CTB-RGP and RGP-RTB fusion proteins by

ProtParam software

Chapter 1

Introduction

Introduction

1

1.0 INTRODUCTION

The plants are considered as the most renewable production resources for a

variety of proteins, fats, essential amino acids, dyes, drugs, chemicals etc. The advent of

various plant biotechnology techniques, such as, modern breeding methods, cell and

tissue culture, somaclonal variation, clonal propagation, protoplast culture, somatic

hybridization and genetic transformation have played a vital role in establishing plant-

based industries for the production of above mentioned high value added compounds.

The first pharmaceutically relevant protein made in plants was human growth hormone

expressed in transgenic tobacco in 1986. Since then transgenic plants are rapidly

emerging as smart bioreactors for the production of protein drugs, enzymes and

biopolymers for medical and industrial applications. The first plant derived technical

protein has already reached to the market (Hood et al., 1997, Witcher et al., 1998).

Detailed economic evaluations of these proteins have demonstrated their

competitiveness against corresponding market sectors (Kusnadi et al., 1997, 1998).

Several other plant-derived bio-pharmaceutical proteins are on the terminal end of

pipeline for commercial production. These products include antibodies, vaccines,

human blood products, hormones and growth regulators (Fischer et al., 1999; Gidding

et al., 2001). Plants that express foreign proteins with industrial or pharmaceutical value

represent an economical alternative to fermentation-based production systems.

Transgenic plants are raised and cultivated on a large scale for manufacturing

vaccines against both viral and bacterial pathogenic agents of human and poultry

animals. Many proteins including viral (Norwalk virus capsid protein), bacterial

(Pseudomonas aeruginosa outer membrane protein), enterotoxin (E. coli heat-labile

enterotoxin) and non-enteric antigens (Hepatitis B surface antigen) as well as

autoimmune antigens have been produced in an increasingly diverse range of crops. A

few research groups (Hiatt et al., 1989; 1993, During et al., 1993) have also identified

plants as manufacturing units for producing properly assembled heavy and light chains

of certain antibodies. These approaches would prove extremely beneficial for the

developing and the underdeveloped countries.

Vaccination involves the stimulation of the immune system to prepare it for the

event of an invasion from a particular pathogen for which the immune system has been

primed (Masson et al., 1995; 1998). This will generate and prepare pathogen specific T

Introduction

2

and B cells for rapid proliferation and differentiation when natural pathogens will be

encountered by immune system. Construction of vaccine in several cases has been

hampered because of varying strains of the pathogen, antigen drift, antigenic shift and

other unrevealed mechanisms that make it hard to determine a suitable peptide sequence

for the priming of immune system.

Although, live attenuated and killed pathogens were used frequently to prime

the immune system but that has resulted in acquiring the same disease by few people

after vaccination. Recombinant subunit vaccines are desirable as an alternative with

potentially fewer side effects than delivering the whole organism. Recombinant subunit

vaccines do not contain whole infectious agent, and thus are safer to administer and

prepare, and doses are more uniform. Advances in molecular biology of diseases have

identified many candidate proteins or peptides that may function as effective subunit

vaccines. DNA was also used as subunit vaccine to prevent and slow down the spread

of disease, known as polynucleotide immunization or DNA vaccine. DNA that is

injected into the subject undergoes the transcription and translation which yield protein,

making the specific T and B cells to differentiate and proliferate. Therefore, the

immune system is ready to combat invading pathogen very quickly, before they get the

chance to spread throughout the body while causing discomfort to the host. Though

most of the above mentioned methods of vaccination have been effective against

diseases for which vaccines can be produced, the introduction of oral vaccines was

made to ease the discomfort associated with the mode of introduction of conventional

vaccines into the body.

Plant-derived edible vaccines have an advantage of being used orally. They have

been observed to stimulate production of mucosal antibodies more effectively than the

injected vaccines. The mucosal immune system is a part of the body’s first line of

defense against many disease-organisms. A mucosal tissue comprises all lymphoid cells

in epithelia and cells lying below the body’s mucosal surfaces. The main site of

mucosal lymphoid tissues is associated with the bronchial system and gut. To stimulate

this system in the gut, an oral vaccine has to be protected from degradation at acidic pH

of the intestine (stomach) which ultimately stimulates mucosal immune system and

results in the production of secretory antibody i.e. IgA. The secretory antibodies

comprise 75% of the total antibody synthesized and secreted in the form of tears, saliva

Introduction

3

and milk. These properties of the edible vaccine are gifted by the associated plant

tissues, which protect vaccines from degradation in the digestive tract.

In the developing and the underdeveloped countries, the cost of vaccines is a

limiting factor. A large majority of people remains unprotected against preventable

disease because they cannot afford. Vaccine production, packaging, delivery,

administration by trained people and refrigeration, which are prerequisite for shipment

or storage increase its cost (Figure 1.1). Similar economic factors apply also to large-

scale vaccination of farm animals. The advantages of biopharmaceutical proteins are

not limited to cost savings. The molecular farming of pharmaceuticals in plants

eliminates the risk of human or animal virus and prion transmission or of contamination

by harmful products of chemical synthesis or process solvents.

The current large-scale vaccines producing industries use mostly bacteria, yeast,

insect and mammalian cells and transgenic animals as production resources. Vaccines

expressed in these wild/genetically-engineered systems are essentially processed to

remove host proteins, toxins as well as other noxious compounds, which contribute to

their high cost. In addition, these production systems are highly prone to contamination

by microbes that sometimes evade detection even in the purified vaccines. Hence, these

systems cannot be considered ideal for the production and delivery of quality and

economically viable vaccines.

Designing plant-derived vaccines therefore becomes an important alternative to

meet the increasing market demand of cheaper, safer and quality vaccines. The

successful development of vaccines against human animal pathogen(s) depends

primarily on establishment of stable transformation procedure for widely and

commonly grown crops, ease in scale up of contaminant free production of antigenic

proteins. Production of the vaccines is based on two strategies: (i) Stable

transformation of plant cells with gene(s) encoding antigenic proteins and (ii) its

transient expression. Transgenic plants, especially of the edible variety, provide an

excellent alternative for the production of desirable vaccines. This system also allows

easy and economic scale-up of production by cultivating more of these plants in the

field. In addition, the continuous refinements in the plant genetic engineering

techniques and an increasing understanding of plant molecular biology have helped

improve the genetic design of plants with greater capacity for production of vaccines.

Figure 1.1: Worldwide distribution of rabies.

Figure 1.2: Cost profile of an immunization program for

a fully immunized child.

Introduction

5

enhanced presentation of the conjugated molecule to the immune system (Holmgren et

al., 1975; Nashar et al., 1996). Roy et al. (2010), successfully demonstrated

immunogenicity of cholera toxin B subunit (CTB) as N-terminal fusion partner with the

rabies glycoprotein. Seed specific promoter was also used to enhance the expression of

CTB-RGP expression in ground nut which is important for edible version of fusion

vaccine (Tiwari et al., 2009b).

Similar to the function of CTB, ricin toxin B subunit (RTB) was also used as the

mucosal adjuvant and carrier to enhance immune responses for rota virus infection

(Yu and Langridge, 2001). RTB is able to serve as C-terminal fusion carrier for delivery

of the virus antigen to the mucosal immune system and may act as a potential immune

modulator to enhance the mucosal immune response of antigens (Medina-Bolivar et al.,

2003). However, before proceeding for next step or animal experiments, we have to

check the immunogenic property of both N- and C- terminal fused rabies glycoprotein

Ricin toxin (RT) is composed of a galactose binding B chain (Mr =32,000) and a

cytotoxic A chain (Mr=30,500). RT toxicity is based on A subunit inhibition of protein

synthesis by ribosome in activation. The ricin A chain is a glycosidase that catalyzes the

removal of a single adenine residue from a highly conserved loop of the 28S ribosomal

RNA (A 4324 in rat 28S RNA) (Endo and Tsurugi, 1988). Interaction between sugar

binding moieties on the ricin B chain and terminal galactosides located on the

enterocyte membrane facilitates ricin holotoxin uptake by endocytosis into intra cellular

vesicles (Lambert et. al., 1991). Monomeric ricin B sub-unit has an advantage that they

do not require assembly in to multimeric structures prior to receptor binding as required

in CTB or LTB (Falnes and Sandvig, 2000). RTB has a broader receptor binding

specificity for membrane receptors than CTB or LTB (Falnes and Sandvig, 2000;

Chazaud et. al., 1995; Holmgren et al., 1975). RTB binds to glycoproteins, which is

found on epidermal cell membranes from about 1×107

to 3×107 molecules per cell

(Falnes and Sandvig, 2000). Both CTB and LTB bind to GM1 receptors at lower

frequencies, about 7.5×104 molecules/mucosal epidermal cell (Holmgren et al., 1975).

In contrast to CTB and LTB, the monomeric RTB subunit does not exert fusion protein

size constraints based on oligomer assembly. RTB has the potential for delivery of more

and larger antigen molecules to gut epithelial cells than either CTB or LTB. RTB has

been cloned and expressed in various organisms, e.g. Escherichia coli, Saccharomyces

Introduction

6

cerevisiae, Xenopus laevis oocytes and Nicotiana tabacum (Tagge et. al., 1996; Frankel

et. al., 1996 b; Tonevitsky et. al., 1994; Wales et. al., 1991). C-terminal fusion of RTB

with green fluorescent protein (GFP) has been synthesized in transformed tobacco and

found to generate a humoral immune response showing the presence of a Th2 response

in intranasally immunized mice (Medina-Bolivar et al., 2003). Thus, the membrane

targeting RTB sub unit of plant hetero-dimeric AB toxin from R. communis may have

the capacity to serve as a carrier for subunit vaccines. In this study we used ricin toxin

B subunit (RTB) to exploit their fusion ability as a C-terminal fusion and utilize them as

mucosal carrier and have the ability to bind with the receptors even in a single

monomer condition.

Contamination like plant pigments and low expression are the major limiting

factors for producing pharmaceutical proteins in plants. So, the technology which

provides stable integration lines and consistent with the expression level of proteins is

needed. To overcome this problem we use hairy root culture of Solanum lycopersicum

for producing RGP-RTB recombinant fusion protein. Although, Agrobacterium

rhizogene- induced transgenic hairy root cultures are not much popular (Doran PM,

2000; Gidding et al., 2000), but definitely show great advantages over plant cell

cultures and other tissues in terms of protein production (Sharp and Doran, 1999;

Wongsamuth and Doran 1997). Long term production of foreign proteins through hairy

root culture is possible due to its genetic stability and is preferred over bacteria and

yeast on the basis of glycosylation and folding accuracy (Fischer et al., 1999).

Successful establishment of such transformed root cultures holds great potential and is a

significant promise as a laboratory tool, especially for basic mechanistic studies and

quick screening of plants with superior expression of the gene of interest. Maintenance

of these hairy roots in a bioreactor is easily scalable as per the demand and avoids

further stringent regulatory approval due to in-vivo condition which give it a greater

edge over seed based platform.

This study is mainly focused on to check the efficacy of plant produced rabies

glycoprotein with fused mucosal adjuvants and aims to evaluate any change in

immunogenic property of rabies glycoprotein on the fusion of N- and C-terminal

orientation of mucosal adjuvants, hence, providing relevant information for developing

plant based oral vaccine against rabies.

Chapter 2

Review of Literature

REVIEW OF LITERATURE

7

2.0 REVIEW OF LITERATURE

2.1 History of rabies

Rabies is one of the oldest known diseases of mankind. The word, “rabies”

comes from the Sanskrit word “rabbahs” which means, “to do violence”. Rabies in

India is known since Vedic period as corroborated in Atherva Veda. Yama, the God of

Death in Hindu mythology, has been shown to be attended by dogs as his constant

companions and as emissaries of death (Ahuja et al., 1983). The first description of the

disease dates from the 23rd

century BC in the Mesopotamian Laws of Eshnuma (Fu,

1997), yet it has been only slightly more than 120 years (1885) since Pasteur developed

the first vaccine for post-exposure treatment. Since this first crude nerve tissue vaccine,

numerous other vaccines for human use have been developed. These are used with

varying degrees of effectiveness and safety but we are still facing an epidemic situation

of rabies today. In spite of numerous efforts 35,000-50,000 human fatal cases per year

are reported (WHO, 1994). Actual numbers may be much higher. This makes rabies as

one of the most mortal infectious diseases. Rabies has been and even today is regarded

in the world as one of the most terrifying diseases, and India is no exception to it.

Despite the early discovery of the rabies vaccine, this disease is still a problem today.

Moreover, the new and effective vaccines are often unaffordable for the average

citizen. In addition to these unsolved problems, emerging rabies-related viruses have

recently been described (Fraser et al., 1996), which emphasise the importance of rabies

research.

2.2 Global rabies reservoirs

Rabies is one of the most important zoonotic diseases. Rabies is a worldwide

public health hazard. The most important reason why rabies is still endemic in the huge

global reservoirs, in both domestic and wildlife animals, all mammals are thought to be

susceptible to infection, but reservoirs important to the maintenance and transmission

of rabies virus are limited to the Carnivora and Chiroptera (Rupprecht et al., 2002).

In most of the developing countries, dogs represent the major rabies reservoir.

Dogs remain the most important reservoirs in Asia, Africa and Latin America, where

most human rabies cases occur. Rabies in the wildlife presents a more challenging

problem. In North America, reservoirs of rabies exist in many diverse animal species


8

(Meslin et al., 1994; Rupprecht et al., 1995). The most frequently reported rabid

wildlife species in USA are raccoons (50.5%), followed by skunks (24.0%) (Rupprecht

et al., 1995). Outbreaks of rabies infections in these terrestrial animals are found in

broad geographical areas in the United States (Meslin et al., 1994). Fox rabies has been

endemic in Europe and North America for many years, although recent endeavours in

oral vaccination through vaccines in an edible bait has been successful in reducing or

even eliminating rabies in many parts of Europe. Recently, raccoon rabies has spread

from a focal point in Florida in the 1970s to all the eastern States in USA by 1990s.

There are other important reservoirs, including coyotes in Asia, Africa and North

America, Skunks in North America, and mongoose in Asia, Africa and the Caribbean

islands. Rabies is also endemic, the vampire bats from Mexico to Argentina and the

insectivorous bats in North America and Europe. The vampire bats transmit rabies to

cattle and cause tremendous problems for the agricultural industry in South America.

Many human rabies cases in the United States have been caused by rabies virus variants

circulating in the insectivorous bat populations. Insectivorous bats in Europe have been

reported to carry rabies-related viruses (Fu, 1997). Bat- associated rabies viruses cause

sporadic disease in humans and livestock species, and major epidemics in terrestrial

mammals are relatively commonplace (Childs et al. 2000). Humans serve only as

accidental hosts. Overlying the disease in terrestrial animals are multiple independent

reservoirs for rabies in several species of bats. As in terrestrial species, distinct viral

variants can be identified for different bat species. However, geographic boundaries

cannot be well defined (Smith, 1996). The most predominant rabies reservoirs are listed

in table 2.1 (Fu, 1997).

Rabies viruses form following two types of association with their host species

(i) The virus establishes a stable infection cycle within a particular mammalian

species, most notably observed in carnivorous mammals (dogs, foxes, raccoons,

and skunks) as well as in a variety of bat species. Whether the virus always causes

disease in these is not clear; although fatal rabies is common in infected dogs,

foxes and raccoons; the same does not always appear to be true of bats (Baer and

Lentz, 1991).

(ii) The second form of virus-host interaction occurs when the virus jumps species

boundaries to infect new hosts. The example of these “spill-over” infections is

Table 2.1: Predominant global rabies reservoirs

Dogs Major vector of rabies throughout the world, particularly Asia, Latin

America and Africa.

Foxes Europe, Arctic and North America.

Raccoons Eastern United States.

Skunks Midwestern United States, Western Canada.

Coyotes Asia, Africa and North America.

Mongooses Yellow mongoose in Asia and Africa; Indian mongoose in the

Caribbean Islands.

Bats Vampire bats from Northern Mexico to Argentina, insectivorous bats

in North America and Europe.

Taken from Fu et al., 1997.

Introduction

4

Rabies is acute progressive encephalitis. At least, 60,000 human deaths occur

worldwide annually from rabies (Meslin and Stohr, 1997). It is caused by a

promiscuous neurotropic virus of Lyssavirus genus of family Rhabodoviridae. The

disease spreads through domestic and wild animals. Rabies is a major zoonosis of

significant public health concern in many parts of the world, especially in developing

countries (Figure 1.2) where rabies is endemic among dogs (Meslin and Stohr, 1997).

The first rabies vaccine, consisted of subcutaneous inoculation of spinal cord

suspension, derived from rabid rabbits (Pasteur, 1885). Since then, a continuous effort

is going on for the improvement of the vaccine (Perrin et al., 1990; Plotkin et al., 1993).

The virus genome encodes five major proteins of which the G-protein of rabies virus

has been identified as the major viral antigen that induces protective immunity (Cox et

al., 1977). In recent years, plants are emerging as a promising alternative source for

producing safe and cost effective therapeutic proteins (Curtiss and Cardineau, 1990;

Mason et al., 1992). Recombinant proteins expressed in plants have shown sufficient

promise to warrant human clinical traits (Tiwari et al., 2009). In case of rabies

glycoprotein, stable expression in tomato plants has already been reported (McGarvey

et al., 1995), while complete protection has been shown when mice were injected with

rabies G-proteins expressed and purified from tobacco plants (Ashraf et al., 2005).

Though protein was fairly active immune-protective in nature but its expression was

quite low so that downstream scale up process created an arduous task to purify this

protein in homogeneity from plants.

There are various lectins or lectin-like proteins which have binding ability to

glyco-lipids or glyco-proteins (De Aizpurua and Russell-Jones, 1988). We utilize these

lectins for administration of rabies antigen orally to avoid near homogeneity

purification and to enhance immunogenic property of rabies antigen. Many of these

lectins have already been characterized and used as mucosal adjuvant which stimulates

strong humoral as well as cell-mediated immune responses. Out of these cholera toxin

B subunit is one of the most characterized mucosal adjuvant which provides N-terminal

fusion capability with target antigens. CTB binds to the GM1 receptor and can serve as

a mucosal adjuvant (McKenzie et al., 1984), GM1 receptor being present on most of the

cells in the body including epithelial cells and leukocytes. Efficient binding to GM1

could potentially increase the uptake of antigen across the mucosa and lead to an


9

human rabies. Occasionally, however, rabies viruses are able to establish

productive infections in new host species (Tordo et al., 1993; Nadin Davis et al.,

1994). An important example of such a successful host switch involved the transfer

of the virus from dogs to the red fox (Vulpes vulpes) in Northeast Europe during

1930s (Bourhy et al., 1999). After the initial cross- species transmission event,

rabies virus was able to spread rapidly westward and southward through European

Red fox populations in the subsequent 60 years (Bourhy et al., 1999).

2.3 Rabies pathogenesis

Rabies is a neurotropic virus, usually transmitted through the bite of a rabid

animal (Charlton, 1994; Dietzschold et al., 1996). Neurotropism is a major feature

associated with rabies virus infection, with viral replication restricted almost

exclusively to neuronal tissue (Murphy et al., 1973), but it causes no cytopathic effect

in cell culture (Crick and King, 1988). Rabies virus is a strict neuropathogen in vivo,

and yet it has a wide host range in vitro, infecting nearly all mammalian and avian cell

types (Wunner et al., 1984). In vivo, nicotinic acetylcholine receptor has been

suggested to be rabies virus receptor (Lentz et al., 1982). Other studies showed that the

problem is probably more complex, suggesting the existence of atleast two receptors at

the surface of nerve cells (Lafay et al., 1991). In vitro, gangliosides via their sialic acid

or phospholipids play the role of receptors (Superti et al., 1984a; 1984b; 1986; Wunner

et al., 1984). After exposure (that is dog bite) there are three critical events (Baer and

Lentz, 1991).

(1) Inoculation of the virus. Unless virus is inoculated there is no risk.

(2) The inoculated virus is adsorbed to, and gains entry into a susceptible cell and

begins to multiply.

(3) The virus multiplies in that region, and then enters the nerve endings,

particularly through acetylcholine receptors.

Although rabies virus has a strong neurotropism, replication in vivo does not

only take place in neuronal cells. Several investigators have shown that rabies virus

replicates in muscle cells prior to its invasion of the peripheral and central nervous

system as well as the salivary glands and other non-nervous tissues (Charlton and

Casey 1979; Fekadu and Schaddock, 1984 and Charlton et al., 1997); while other


10

studies have demonstrated that primary infection of muscle cells may not be necessary

(Coulon et al., 1989 and Johnson, 1965). Although a rapid spread of virus from the

peripheral site of entry to the CNS with little prior replication has been reported

(Ceccaldi et al., 1989; Shankar et al., 1991).

Rabies virus has also been found to cause fusion of cells and hemolysis of

erythrocytes under acidic conditions (Mifune et al., 1982). In addition, chloroquine and

ammonium chloride have been shown to prevent infection (Superti et al., 1984a;

1984b). It has been proposed that rabies virus enters the cell via the endocytic pathway,

and subsequently fuses with the membrane of the endosome after its acidification.

However, little is known about the behaviour of the rabies virus glycoprotein during

virus internalization.

The pathogenicity of rabies virus strains depends on the presence of antigenic

determinants on the viral glycoprotein. Arginine at 333 positions in glycoprotein is

essential for the integrity of an antigenic determinant and for the ability of rabies

viruses to produce lethal infection in adult mice, so arginine at 333 of glycoprotein is

critical in the pathogenicity of rabies virus (Dietzschold et al., 1983b). Mutation of

Lysine at 330 position of glycoprotein also abolishes the penetration of the virus into

motor and sensory neurons after intramuscular inoculation of the virus (Coulon et al.,

1998).

2.3.1 Virus propagation in vivo

The path of movement of the rabies virus towards the CNS after inoculation by

bite has not been clearly demonstrated (Murphy, 1977; Tsiang 1993; Charlton, 1994).

Rabies virus seems to go through a first cycle of replication in the striated muscle cells,

where the virus is in a state of sequestration during the incubation time (Murphy and

Bauer, 1974) .It has been suggested that the infection of muscle cells is mediated by the

nicotine acetylcholine. The interaction of rabies virus with the acetylcholine receptors

at the neuromascular junction is instrumental in transfer of the virus from the periphery

to the central nervous system. However, the uptake and transport of rabies virus by a

wide variety of neuron types suggest that receptors for the virus are ubiquitous.

Morphological, immuno-cytochemical, biochemical immunological techniques have

been used to describe rabies virus binding to a sub-cellular unit and molecular complex


11

at the neuromuscular junction (Burrage et al., 1985). For further spread, the virus

accumulates at neuromuscular junctions and enters the nervous system through

unmyelinated sensory and motor terminals.

Once the rabies virus enters the nervous system, it is no longer accessible to

anti- rabies antibodies (Murphy and Bauer, 1974). The ability of selected neurotropic

viruses to move transneuronally in the central nervous system makes them particularly

well suited for use as tracers in experimental neuroanatomy (Roberta and Peter, 2000;

Ugolini et al., 1989; Strack and Loewy, 1990; Hoover and Strick, 1999; Lynch et al.,

1994; Middelton and Strick, 1996; Sun et al., 1996; Jasmin et al., 1997; O’ Donnell et

al., 1997). Rabies virus moves in a time dependent manner through the central nervous

system of infected animals. The virus reaches the spinal cord by centripetal spread

(axoplasmic flow of 12 to 24 mm per day) and subsequently transported within hours to

the brainstem (Murphy et al., 1973). Although, there has been some uncertainty about

the direction of rabies transport in the central nervous system. Some investigators

proposed that rabies moves trans-neuronally in both anterograde and retrograde

directions (Gillet et al., 1986; Jackson and Reimer, 1989), and others concluded that the

virus spreads exclusively in the retrograde direction (Ugolini, 1995; Tang et al., 1999).

Rabies infections are largely confined to neurons, while ganglia infection is

rarely seen (Iwasaki and Clark, 1975; Tsiang et al., 1983). Electron microscopic studies

suggest that rabies virus is transported between neurons primarily at synaptic junctions

(Iwasaki and Clark, 1975; Charlton and Casey, 1979). Rabies virus does not cause cell

lysis. One of the hallmarks of rabies infection is the lack of pathology seen in infected

brains even at terminal stage of the disease (Murphy, 1977).

2.3.2 Virus propagation in vitro

Neuronal tropism is also observed in vitro with street rabies virus isolates

extracted from salivary glands or from the brains of rabid animals. In vitro such isolates

can only infect established cell lines of neuronal origin. However, viruses can be

adapted (Kissling, 1958) and several passages are required for the virus to be adapted

fully to the in vitro multiplication. Additional cycles of multiplication in non- neuronal

cells are necessary for the selection of fixed strains that would multiply in established


12

cell lines such as BHK21, BSR and Vero cells (Wiktor et al., 1964; Schneider et al.,

1971).

Evelyn Rokitnicky Abelseth (ERA), Pasteur Virus (PV) or Challenge Virus

Standard (CVS) are fixed rabies virus strains that have been selected and are used

around the world for laboratory investigation. All have kept their specific tropism for

neurons in animals and propagate in the nervous system like street viruses. Therefore,

adaptation did not abolish neurotropism but rendered the virus able to grow in non-

neuronal cells. It is postulated but not demonstrated that adaptation is at least partly due

to the capability of fixed strains of rabies virus to use ubiquitous receptors present on

every cell types investigated to date (Seganti et al., 1990). Ubiquitous receptors could

be molecules, such as phospholipids (Superti et al., 1984b), gangliosides (Conti et al.,

1986; Superti et al., 1986), or proteins (Wunner et al., 1984; Broughan and Wunner,

1995; Gastka et al., 1996). The neural cell – adhesion molecule is also shown to be a

receptor for rabies virus laboratory strains (Thoulouze et al., 1998). It has also been

proposed that the nicotinic acetylcholine receptor (nAChR) serves as a receptor for

rabies virus (Lentz et al., 1984; 1986; Hanham et al., 1993). But rabies virus infects

neurons that do not express nAChR (McGehee and Lorca, 1995) which suggests the

existence of other molecules mediating viral entry into neurons.

2.4 Classification and epidemiology

Rabies viruses are group members of the serologically related viruses sharing

common determinants in the RNP group antigen (Schneider et al., 1972). The

lyssavirus genus and the vesiculovirus genus make up the family rhabdoviridae.

Rhabdoviruses are members of the Mononegavirales order, which includes the

Paramyxoviruses and the Filoviruses. The lyssaviruses have been subdivided in four

serotypes on the basis of seroneutralization and monoclonal antibody studies

(Schneider et al., 1973; WHO, 1984; Wiktor and Koprowski, 1980), and into 6

genotypes according to their genomic sequence (Bourhy et al., 1993). Classical rabies

virus strains (serotype 1) and rabies – related viruses: Lagos bat virus (serotype 2),

Mokolo virus (serotype 3), and Durenhage virus (serotype 4). European bat lyssaviruses

(EBL) were proposed initially to constitute serotype 5, but were then subdivided into:

biotypes 1 and 2 (EBL1 and EBL2) respectively to be distinguished finally as two


13

clearly distinct genotypes (Bourhy et al., 1992). Rabies virus (serotype 1) is present

worldwide except on several protected islands. Rabies – related viruses have a large

geographic distribution in Africa and Europe (King and Crick 1988; Bourhy et al.,

1992). Serotypes and members of the rabies group not only vary from each other on the

basis of serological differences but also show a different lethal potential when injected

into mice.

Epidemiology is the study of the distribution and causes of disease in

populations. Epidemiologists study how many people or animals have a disease, the

outcome of the disease (recovery, death, disability etc.), and the factors that influence

the distribution and outcome of the disease. The epidemiology of rabies addresses

several questions: What animals have rabies and in what regions of the country, how

many people get rabies and in what regions of the country, how many people get rabies

and from what animals, and what are the best strategies for preventing rabies in people

and animals. Epidemiologic information is often presented by statistical data (numbers

or percentages in graphs and on maps) .

In order to successfully combat rabies, a clear understanding of the disease

epidemiology is required. The way in which viruse change and adapt to different host

species and the role, that geographical and host factors play in virus proliferation, are

issues that underlying the understanding of the disease (Nadin–Davis et al., 1993; De

Mattos et al., 1996; Bourhy et al., 1999; Badrane et al., 2001).

In recent years, a useful approach towards elucidating infectious disease

epidemiology has been through molecular sequence analysis of specific parts of the

genomes of virus isolates. For rabies sequences of genes of the nucleoprotein (Smith et

al., 1992; Tordo and Kouknetzoff, 1993), the phosphoprotein (Nadin–Davis et al.,

2000), and the G-L intergenic region (Sacramento et al., 1992) have been useful in

determining molecular epidemiology of the disease in Europe (Bourhy et al., 1999),

America (Smith et al., 1992; Nadin–Davis et al., 1993, 1999), the Middle East (David

et al., 2000) and Africa (Von Teichman et al., 1995 ; Warner et al., 1996 and Sabeta et

al., 2003).

In some developing countries of Africa, Asia and India, canine rabies remains

common. In these areas, dogs account for more than 90% of animal rabies cases, and

these countries account for 95% to 98% of human cases worldwide. Rates may range


14

from 0.01 to 0.6 deaths per 100,000 people in Latin America to 2 to 18 deaths per

100,000 people in India and Ethiopia. Countries in which canine rabies are controlled,

as in the United States, wildlife accounts for more than 95% of animal rabies cases.

These countries account for less than 5% of human case worldwide. Rates are typically

less than 0.02 deaths per 100,000 (Haupt, 1999).

Australia, previously free of rabies, became an endemic area in 1996, when a

new pteroid lyssavirus was found in flying foxes and other bats, including insectivorous

species (Hanna et al., 2000; Fraser et al., 1996). Rabies is distributed in all countries

except Antartica. The rabies vaccine strains for example, ERA (Evelyn Rokitnicki

Abelseth), HEP (High Egg Passage), CVS (Challenge Virus Standard) and PM

(Pitmann-Moor) belong to the same serotype, share common envelope and

nucleocapsid determinants and, in addition, only share ribonucleoprotein (RNP)

determinants with the Mokola virus (Schneider et al., 1972).

2.5 Structure of virus

2.5.1 Virus particle:

The rhabdoviruses comprise a large group of bullet shaped RNA Viruses.

Rabies-virus particle is a bullet shaped structure of about 75 nm by 200 nm, with a

helical nucleocapsid surrounded by a thin protein-studded membrane. It is classified as

a member of the Rhabdoviridae family by virtue of its ‘bullet-shaped’ structure. The

helical RNP (a complex between the RNA, the viral polymerase, the nucleoprotein and

the phosphoprotein) with 30 to 35 coils is surrounded by a lipoprotein envelope.

Intracellular assembly of the nucleocapsid with the matrix and G proteins are believed

to be critical for envelopment and cellular release of mature virus particles (Mebatsion

et al., 1999).

The virion is surrounded by a lipoprotein membrane (envelope), from which

spike-like projections extend outward except at the flat end of the particle (Tordo and

Poch, 1988; Wunner, 1991). Three monomeric units of the glycoprotein form each

projection (Tordo and Poch, 1988). General structure of rabies virus is shown in Figure

2.1.

Figure 2.1: Structure of rabies virus. Rabies virions are bullet shaped

with 10 nm spike like glycoprotein peplomers covering the

surface. The ribo-nucleoprotein is composed of RNA encased in

nucleoprotein, phosphoprotein and polymerase. (A) photograph

are adapted from Centers for Disease Control and Prevention;

(B), Negatively stained rabies virus seen by transmission

electron microscopy from the Wadsworth Center of the New

York State, Department of Health; (C), Diagrammatic

representation of the rabies virion deduced from electron

microscopy and protein analysis by Vernon et al. 1972.

A

B C


15

2.5.2 Virus genome:

The first complete nucleotide sequence of a rabies virus genome of highly

pathogenic strain PV was published by Tordo et al., (1988). The rabies virus genome

consists of a single-stranded, unsegmented, negative-sense RNA of about 12 kb, which

is transcribed on infection to produce five polyadenylated complementary

monocistronic mRNA species. Each of the virus – specific mRNAs representing a

structural gene of the rabies virus genome (Flamand and Delagneau, 1978) codes for a

virion structural protein (Pennica et al., 1980 and Wunner et al., 1980). The five rabies

virus specific mRNAs for L, G, N, M and P proteins have been characterized by sucrose

gradient (Wunner et al., 1980) and gel analysis (Pennica et al., 1980). These are

contained within a bullet-shaped, bilayered envelope (Tordo and Kouknetzoff, 1993).

All the five proteins are contained within the virion particle. The polymerase (L) and

phosphoprotein (P) complex with the nucleoprotein (N) form an inner capsid of the

virion. The matrix protein (M) and the glycoprotein (G) form the inner and outer layer

of the bilayered envelope (Wunner et al., 1988). The G protein spikes regulate the cell

surface receptors and antibody binding sites and any variation in the gene encoding for

this protein may affect the pathogenic and immunogenic properties of the virus

(Wunner, 1991). The nucleoprotein is highly conserved, essential for viral propagation

and an important target for diagnosis (Dean et al., 1996; Yang et al., 1998).

2.5.3 Virus proteins

2.5.3.1 Nucleoprotein (N)

Nucleoprotein is a phosphorylated (at amino acid residue 389) protein of 450

amino acids (50.5 kDa) which is present in the virion in a stochiometric amount of

approximately 1800. It is tightly associated with the viral RNA protecting the RNA

from ribonucleases, supposedly keeping it in a suitable configuration for transcription

(Sokol and Clark, 1973; Tordo et al., 1986a; Dietzschold et al., 1987a).The N protein is

involved in the regulation of transcription and replication.

2.5.3.2 Phosphoprotein (P)

Phosphoprotein is a phosphorylated protein of 297 amino acids (41 kDa) present

at about 950 molecules per virion. The phosphorylation is probably situated in the


16

amino terminal half of the protein as in the case of P protein of the vesicular stomatitis

virus -VSV (Weiss and Bennet, 1980). The phosphoprotein of rabies virus is an integral

component of the viral ribonucleoprotein complex. (Chenik et al., 1994) but it does not

participate in the viral structure (Delagneau et al., 1981). It has, therefore, been

denominated “non-structural” protein (NS). P protein is an important cofactor for the

viral polymerase.

2.5.3.3 Matrix protein (M)

About 1500 molecules of the M protein (202 amino acids, 23 kDa) are located

on the inner surface of the viral envelope (Delagneau et al., 1981), where they interact

with both the cytoplasmic domain of the anchored G protein and the virus core, binding

the membrane – associated (M and G) proteins to the RNP, possibly through interaction

with the N protein. M protein also plays a role in virus budding (Weiss and Bennet,

1980).

2.5.3.4 Polymerase (L)

The RNA-dependent RNA polymerase L (for “large”) is the largest (2142

amino acids, 244 kDa) and the less present (25 molecules per virus) rabies virus

protein. It is an enzymatic complex showing various activities: RNA dependent

polymerase, guanylyl transferase and poly (A) synthetase.

2.5.3.5 Glycoprotein (G)

The G protein, which reacts with the host cell receptors, is the main target of the

immune response and it also plays an important role in viral pathogenesis (Dietzschold

et al., 1983a; 1983b). Accordingly, extensive mapping of the functional domains of G

protein has been carried out (Seif et al., 1985; Wunner et al., 1985a; Prehaud et al.,

1988; Tuffereau et al., 1989; Dietzschold et al., 1990a; Benmansour et al., 1991;

Heijden et al., 1993; Ni et al., 1995; Raux et al., 1995). The Glycoprotein is organized

in trimers, which protrude from the viral envelope (Whitt et al., 1991; Gaudin et al.,

1992). It is a type 1 integral transmembrane glycoprotein.


17

(A) Detail structure of glycoprotein

The glycoprotein gene codes for a membrane associated molecule which forms

spike – like projections on the surface of mature rabies virions. The trimeric G protein

is the only viral protein exposed on the surface of the virion (Whitt et al., 1991). The

consequences during evolution and the adaptation to new hosts, of changes in the

binding of G protein to cellular receptors (Tuffereau et al., 1998a; 1998b; Thoulouze et

al., 1998) are presently unknown. The G protein is the major antigen of the rabies

virus, and an immunological response directed against this protein is able to protect

from rabies virus (Wiktor et al., 1984; Flamand et al., 1993; Bai et al., 1993). It is well

reported that G protein induces virus-neutralizing antibodies (VNA) (Wiktor et al.,

1973) and protection against intracerebral challenge (Perrin et al., 1985a and 1985b).

The G protein also induces the production of cell-mediated immunity (Celis et al.,

1988).

The G protein is a glycosylated protein of 505 amino acid (65 kDa) length. Each

spike consists of a homopolymer of 3 molecules and extends 8.3 nm from the viral

membrane (Delagneau et al., 1981; Gaudin et al., 1992). The G protein accounts for

about 40% of the total mass of viral proteins.

The amino acid sequences of the glycoprotein of the Evelyn Rokitnicki

Abelseth (ERA), Challenge Virus Strandard (CVS), Pasteur Virus (PV) and High Egg

Passage (HEP), and Flury strains have been deduced from the nucleotide sequence

(Anilionis et al., 1981; Yelverton et al., 1983; Tordo et al., 1986b). The absence of the

sequence AAUAAA, present in eukaryotic polyadenylated mRNA (Proudfoot and

Brownlee, 1976), in the 3’ noncoding region of rabies G mRNA and vesicular

stomatitis virus (VSV) mRNAs (Rose, 1980) presumably reflects the role of virus-

associated proteins in polyadenylation of these mRNAs (Herman et al., 1980) in place

of host enzymes.

The G protein carries four potential N-glycosylation sites which are

glycosylated to a different extent according to the virus strain. For example, G protein

of the PV strain is not glycosylated at position 37 but glycosylated at positions 158, 247

and 319 (Wunner et al., 1988). On the G protein of CVS, 2 or 3 of the potential

glycosylation sites are glycosylated, resulting in two different protein sizes (Wunner et

al., 1985b; Whitt et al., 1991). Newly synthesized G protein (524 amino acids) contains


18

4 domains: (1) the cleavable aminoterminal signal peptide (19 hydrophobic amino

acids) responsible for translocation of the nascent protein across the rough endoplasmic

reticulum (RER) membrane (Vishwanath et al., 1978; Lai and Dietzschold, 1981), (2)

the ectodomain (438 amino acids), as constituent of infection, hemagglutination activity

(Halonen et al., 1968) and immunological responses, (3) the transmembrane domain

(22 hydrophobic amino acids) responsible for the interaction with the membrane lipids,

(4) the cytoplasmic domain (44 amino acids) responsible for the interaction with core

proteins.

(B) Fusion activity

Depending on the pH , G protein can be present in at least three conformational

forms which are in a pH-dependent equilibrium : (1) the “native” ( N ) state detected at

the viral surface above pH 7 , (2) the “activated hydrophobic” state which interacts with

the target membrane as a first step of the fusion process , (3) the “fusion-inactive” ( I )

state which is present at low pH (Perrin and Atanasiu, 1981; Gaudin et al., 1993;

1995a; 1995b; 1996). There is a complex pH-dependent equilibrium between these

states. By using electron microscopy, it has been shown that the “fusion-inactive” (I)

state is 3 nm longer than the “native state” (N), from which it is also antigenically

distinct (Gaudin et al., 1993). It is proposed that G protein is transported through the

golgi apparatus in an I-like conformation to avoid undesirable fusion during its

transport through the acidic golgi vesicles (Gaudin et al., 1995a). Wojczyk et al. (1995)

demonstrated that a soluble form of G protein, constructed by insertion of a stop codon

just before the transmembrane domain, was efficiently expressed and secreted in

transfected CHO cells. The glycoprotein is also responsible for the low pH-induced

fusion of the viral envelope with the endosomal membranes (Gaudin et al., 1993; Whitt

et al., 1991). The pH threshold for fusion is about 6.3 and pre-incubation of the virus

below pH 6.75 in the absence of a target membrane results in inhibition of virus fusion

properties. This inhibition is reversible by re-incubating the virus above pH 7 (Gaudin

et al., 1993). This behaviour, shared with another rhabdovirus, VSV (Clague et al.,

1990; Pak et al., 1997), is different from that observed with other viruses, for which

low pH-induced fusion inactivation is irreversible (Gaudin et al., 1995b). The pH

dependent conformational changes are important for RNP delivery into the cell


19

cytoplasm. The region of G protein that is crucial for fusion seems to be situated

between amino acid 103 and 179 (Durrer et al., 1995). Mutations at the amino acids

124, 127 or 133 lead to altered fusion activities, though the viral particles remain

infectious (Fredericksen and Whitt, 1996). Cell fusion and formation of syncytia have

also been observed under certain conditions in infected or transfected cells. For

example, glycoprotein transfected neuroblastoma cells but not transfected BHK cells

can form synctia; indicating that some cellular factor is needed for interaction

(Morimoto et al., 1992). Transfected HeLa cells also show fusion activity at low pH

(Whitt et al., 1991).

(C) Synthesis and folding

Many details about rabies G protein synthesis and folding are not yet known,

and one often extrapolates from VSV G protein that shows some similarities (Rose et

al., 1982). Viral glycoprotein shares several functional and structural features with

other members of the group of integral membrane proteins (Doms et al., 1993). They

are important for receptor binding, membrane fusion and penetration, viral

morphogenesis at the budding site and also for stimulation of VNA production. The

majority of these properties are mediated by the ectodomain of glycoprotein.

Glycoprotein is translated by the ribosomes of the rough endoplasmic reticulum

(RER) and is inserted cotranslationally in the ER in an unfolded form. During folding,

the different parts of the proteins are exposed to different conditions: (1) the ecodomain

is situated in the ER lumen and is processed like membrane or secretary proteins, (2)

the transmembrane domain is integrated in the ER membrane, most likely in the form

of an -helix, (3) the cytoplasmic domain is located in the cytosol and is, therefore,

processed like cytoplasmic proteins. In the ER, glycoprotein are glycosylated

cotranslationally by the addition of CA-type (complex-type, high mannose content)

carbohydrates composed of mannose, galactose, fucose, N-acetyl glucosamine and N-

acetyl neuraminic acid (sialic acid). Glycosylation is a multi-step process that involves

addition and removal of sugar residues (Bergmann et al., 1981). N-linked glycosylation

is crucial for appropriate intracellular transport of glycoproteins (Burger et al., 1991;

Wojczyk et al., 1995).


20

The ER is the cellular compartment that assures folding and oxidation of newly

synthesized proteins. It resembles the extracellular space, but shows a very high Ca++

concentration (Baumann et al., 1991), often important for protein folding as well as a

high oxidation potential for the formation of disulfide bonds (Hwang et al., 1992).

Further important features of the ER are the presence of “Chaperons” and folding

enzymes. Molecular chaperons are ubiquitous proteins that assist polypeptide folding

and assembly by binding of nascent polypeptides. These, therefore prevent both

aggregation and release of incorrect or incomplete folded proteins (Ellis and

Hemmingsen, 1989). After glycosylation the rabies G protein associates with two

chaperons: calnexin and GRP78-Bip (Bip) (Gaudin, 1997). Conformational epitopes

(indicating a correct three-dimensional structure) of G are present only after full

oxidation of the protein. After oligomerization (trimer formation) the protein migrates

to the golgi apparatus (Bergmann et al., 1981), where it acquires resistance to certain

enzyme, such as endo--N acetyl glucosaminidase H (Perrin and Atanasiu, 1980) as a

sign of full maturation. Finally, G protein is transported within acidic vesicles to the

cytoplasmic membrane (presumably in the fusion inactive form; Gaudin et al., 1995b)

and assembled (possibly in interaction with M protein) with the other viral proteins at

the site of budding. Altogether, the folding of rabies G protein shows many similarities

with VSV G protein, even though the folding of rabies G protein is slower than VSV

glycoprotein.

In addition to synthesis of a full length glycoprotein, rabies infected cells secrete

a soluble form of G protein which lacks the 58 carboxy terminal amino acids. Even

though the ectodomain is complete, the soluble G protein does not induce VNA

(Dietzschold et al., 1983a), which reflects incorrect folding of the secreted soluble G

protein.

2.6 Role of viral proteins in the protection against rabies

The most important viral proteins involved in the protection against rabies are G

and N proteins. Antigenic variation of G protein between different genotypes is very

important (Wiktor and Koprowski, 1978; Flamand et al., 1980), whereas N protein

exhibits less variability: isolates that belong to different genotypes present up to 92%

amino acid homology in the N protein (Kissi et al., 1995).


21

Glycoprotein neutralizing monoclonal antibodies (Mabs) rose in BALB/c mice

immunized with rabies virus were shown to delineate numerous epitopes on G protein

(Flamand et al., 1980; Wiktor and Koprowski, 1980). Their patterns of cross-reactivity

to the antigenic mutants selected with some of these Mabs demonstrated that there were

at least three antigenic sites on the CVS G protein (Lafon et al., 1983) and five on the

ERA G protein (Lafon et al., 1992). It has been reported that most of the Mabs with

virus-neutralizing activity recognized conformational epitopes on G protein (Lafon et

al., 1992; Prehaud et al., 1988).

The antigenic sites of G of the ERA strain have been identified using

monoclonal antibodies (Flamand et al., 1980). Two immunodominant sites are

recognized by the majority of antibodies: site II and site III. Site II is a conformational

epitope, consisting of two parts, IIa (aa 198-200) and Ib (aa 34-42) (Prehaud et al.,

1988), that are joined by disulfide bonds (Dietzschold et al., 1982). Under denaturing

conditions this site is, therefore, not recognized by the corresponding antibody (Lafon

et al., 1985). Site III, is also a conformational site, represented by atleast three epitopes

that consist of amino acids in close relation to each other (330-338 aa). It induces a

fourth more distantly located epitope (aa 357) (Seif et al., 1985; Wunner et al., 1988).

Three minor sites have also been identified: a (aa 342-343), b and c (Prehaud et al.,

1988; Benmansour et al., 1991). Sites b and c contain the former site VI (aa 264)

(Dietzschold et al., 1983b; Bunchoten et al., 1989; Benmansour et al., 1991). The

relative importance of the different epitopes has been estimated by the number of

neutralizing monoclonal antibodies directed against them that have been isolated

(Benmansour et al., 1991).

Glycoprotein is the only rabies protein able to induce VNA (Wiktor et al., 1973;

Cox et al., 1977) and can achieve total protection against an intracerebral challenge

without the presence of other antigenic structures (Cox et al., 1977; Perrin et al., 1985b;

Takita-Sonada et al., 1993). G protein specific monoclonal antibodies that show virus

neutralizing activities in vitro protect against a peripheral challenge in vivo

(Dietzschold et al., 1990b).

The three dimensional structure of G protein and its environment are highly

important for the induction of VNA (Perrin et al., 1988a). Purified G protein forms

aggregates (“rosettes”) that induce much less VNA than correctly folded G protein,


22

indicating that G protein needs to be anchored on a membrane (viral particle or

liposomes) (Cox et al., 1980; Perrin et al., 1984; Perrin et al., 1985b). Similarly, the

soluble G protein form that lacks the transmembrane region induces 15 times less VNA

than the native G protein (Dietzschold et al., 1983a).

The G protein is recognized both by Th cells (MacFarlan et al., 1984; Xiang et

al., 1995b; Bahloul et al., 1997) and CTL (Wiktor et al., 1984; Celis et al., 1988). The

sequential synthetic peptides deduced from the amino acid sequence of rabies G protein

have been shown to stimulate the Th cell response: aa 1-44, aa 244–323 and 386-452

(MacFarlan et al., 1984). Amino acids 18-44 are also involved in the CTL responses

(MacFarlan et al., 1986). Another CTL epitope is located between aa 130 and aa 178,

containing a single disulfide loop (159-169) (Wunner et al., 1985a; MacFarlan et al.,

1986). Anchored on liposomes, purified G protein induces as much IL-2 production

upon in vitro stimulation of lymphocytes as inactivated virus (Oth et al., 1987; Perrin et

al., 1988a and 1988b).

2.6.1 Antigenicity of glycoprotein

Studies on the antigenicity of the protein have identified two immunodominant

conformational sites named sites II and III (Seif et al., 1985; Prehaud et al., 1988), one

minor site (site a) (Benmansour et al., 1991) and several linear epitopes (Bunschoten et

al., 1989; Raux et al., 1995; Lafay et al., 1996) on the external domain.The G protein is

a major determinant of the viral neurotropism. Mutations in the glycoprotein reduce or

abolish neuroinvasiveness without impairing the ability of the virus to multiply in cell

culture. Replacement of Arg 333, situated in site III of the G Protein, results in the loss

of virulence for adult animals (Dietzschold et al., 1983 b; Seif et al., 1985; Tuffereau et

al., 1989). The mutant virus is still able to infect peripheral neurons but is only

transmitted to a few categories of second order neurons in the CNS (Dietzschold et al.,

1985; Coulon et al., 1989; Lafay et al., 1991).

Antigenic site II has always been considered to be the clearly dominant

antigenic site of the rabies glycoprotein (Benmansour et al., 1991). An antigenic site in

the G gene, most notably site III, appears to be an important determinant of

neuropathogenesis (Dietzschold et al., 1983b; Flamand et al., 1993). Mutations in the G


23

protein are known to modify the virulence of rabies virus in vitro and in vivo

(Dietzschold et al., 1983b; Seif et al., 1985).

Rabies virus glycoprotein is the only rabies protein able to induce virus

neutralizing antibodies (VNA) (Wilktor et al., 1973) which are crucial element of

protection against rabies (Cox et al., 1977). Almost all antigenic mutations affecting

these epitopes are located on the G protein between amino acid positions 34 and 42,

198 and 204 (Prehaud et al., 1988) or 330 and 340 (Seif et al., 1985). Three linear

epitopes for neutralizing Mabs have been mapped on positions 251 (Lafay et al., 1996),

263 (Ni et al., 1995) and 264 (Dietzschold et al., 1990a). Synthetic peptide around

position 263 or 264 induces the neutralizing antibodies to rabies virus, although some

amino acid substitutions have been observed on this site in certain fixed or street strains

(Conzelmann et al., 1990; Bai et al., 1993; Nadin-Davis et al., 1994; Ni et al., 1995;

Morimoto et al., 1996). Most Mabs against G protein recognize the conformational

epitopes (Lafon et al., 1983; Raux et al., 1995). So far, two linear virus-neutralizing

epitopes have been identified on G protein of CVS (Ni et al., 1995) and on HEP-Flury

strains (Dietzschold et al., 1990a). Although 263-phenylalanine and 264-argnine on G

protein, which have been identified as key amino acids for linear epitopes, are

conserved among numbers of rabies strains, the replacement of 263 by leucine has

been observed in some fixed strains (Bai et al., 1993; Ito et al., 1994; Sakamoto et al.,

1999) and that of 264 by histidine has been observed in some street strains (Bai et al.,

1993 ; Nadin-Davis et al., 1994; Morimoto et al., 1996).

It has been shown that the rabies virus G protein is a major contributor to the

pathogenicity of the virus (Dietzschold et al., 1982; Morimoto et al., 1999; Seif et al.,

1985). Several G protein associated pathogenic mechanisms have been identified, for

example -

(1) G protein must interact effectively with cell surface molecules that can mediate

rapid virus uptake (Dietzschold et al., 1985; Lentz et al., 1987; Thoulouze et al.,

1998; Tuffereau et al., 1998b).

(2) G protein must interact optimally with the RNP-M complex for efficient virus

budding (Mebatsion et al., 1996; 1999; Morimoto et al., 2000).


24

(3) Expression levels of G protein must be controlled to prevent over – expression,

which causes functional impairment of the infected neuron (Morimoto et al.,

1999).

2.6.2 Antigenicity of nucleoprotein

2.6.2.1 Antigenic structure

Three antigenic sites have been described on the N protein of the ERA strain

(Lafon and Wiktor, 1985). Site I (aa 374-383) and site III (aa 313-337) contain

continuous epitopes, whereas site II is discontinuous (Lafon and Wiktor, 1985;

Dietzschold et al., 1987a). The N protein is also an efficacious Th cell inducer, and a

Th epitope has been identified (aa 404-418) (Ertl et al., 1991).

2.6.2.2 Protective properties and subunit vaccine

Viral RNP and N protein have been shown to induce partial protection against

intramuscular challenge, whereas no protection is observed when the challenge virus is

injected intra-cerebrally. Similar results have been obtained when recombinant N

proteins: purified N protein from recombinant baculovirus (N-Bac) (Fu et al., 1991), or

106-10

8 plaque forming units (PFU) of recombinant pox virus (N-Vacc) (Lodmell et al.,

1991; Sumner et al., 1991; Fekadu et al., 1992) induced partial protection against a

homologous intramuscular challenge. Furthermore, cross – protection after

nucleoprotein injection has been reported: RNP from Mokola and ERA virus can

protect against CVS and Duvenhage challenge respectively (Dietzschold et al., 1987b).

N protein has often been discussed to be an important component in a subunit

vaccine against rabies because of its capacity to induce Th cell and its conservation

between the serotypes. N protein might therefore have a possible role in a vaccine with

a broadened spectrum. However, the RNP complex could not be a part of a subunit

vaccine; it has to be extracted from virus particles or infected cells which is expensive

and carries the risk of a contamination with viral RNA (Schneider et al., 1973).

Combinations of N and G proteins have been tested for their performance in a

subunit vaccine: liposomes containing both G protein and RNP only induced a slightly

higher protection against intracerebral challenge by G protein liposome alone

(Dietzschold et al., 1987a). A tandem peptide carrying a Th epitope of N protein and a


25

B cell epitope of G protein protected against intramuscular challenge (Dietzschold et

al., 1990a). On the other hand, G-Vacc and N-Vacc injected at different sites did not

raise higher titres of VNA than G-Vacc alone (Fekadu et al., 1992).

Thus it can be concluded that while the importance of G protein in the immune

response against rabies virus infection is clearly established, the role of N protein is

uncertain. The mechanism of the protection induced by the N protein is not yet fully

understood. Though, experiments which show protection by N protein, no VNA have

been detected. The protection must therefore have been achieved by other means, such

as the Th response (Dietzschold et al., 1987b; 1989). N protein also induces non-

neutralizing antibodies that seem to be important for protection: higher anti-RNP

antibody titers are correlated with higher survivor rates in RNP or N protein immunized

mice (Fu et al., 1991). Furthermore, anti- N serum is able to protect under certain

conditions against a weak virus challenge (Lodmell et al., 1993). Protective non-

neutralizing antibodies have as well been reported in the case of other viruses, for

example, VSV (Lefrancois, 1984).

2.7 Classical Rabies vaccines and protection

Since the first rabies vaccine that was developed by Louis Pasteur (Pasteur,

1885), consisting of subcutaneous inoculation of spinal cord suspension derived from

rabid rabbits, different generations of vaccines have been developed which shown in

table 2.2 (Wiktor et al., 1988; Celis et al., 1989; Perrin et al., 1990; Plotkin, 1993).

2.8 Treatment and vaccine

Rabies is one of the most lethal infectious diseases known, being fatal in 100%

of cases if no treatment is administered. According to the World Health Organization

(WHO), an estimated 10 million people receive post–exposure treatment for rabies

every year (WHO, 1992). Despite the existence of effective pre-exposure and post–

exposure treatments, at least 60,000 deaths world-wide occur annually from rabies

(WHO, 1996).

Animals immunized with subunit vaccines based on the rabies virus G protein

are protected against a challenge with rabies virus administered peripherally or directly

into the central nervous system (Wiktor et al., 1984). Neutralizing antibodies are known

Table 2.2: Response of different vaccines against rabies

S. No. Generation Source of

preparation

Immunogenicity Human (H)/

Veterinary (V)

1. Whole

inactivated virus

NERVOUS TISSUE

-adult animals

(sheep, goat, rabbit)

poor

H

-new born mice poor H

2. Whole

inactivated virus

PRIMARY CELL EXPLANTS

-embryos (chicken,

duck)

Good

H

-kidney (hamster,

dog, pig)

Good

H

-kidney (bovine

fetus)

Good H

3. Whole

inactivated virus

DIPLOID CELLS

-human (Wi-38,

MRC-5)

Good

H

-rhesus monkey

(fibro blasts)

Good H

HETEROPLOID CELLS

-vero Good V

-BHK-21 Good V

4. Avirulent active

virus

Mutation at aa 333 Very good V

5. Recombinant

active virus

G-recombinant

vaccine

Very good V

Taken from Fu et al., 1997


26

to prevent the spread of rabies virus into the central nervous system (Shanker et al.,

1991). Rabies glycoprotein is effective as a subunit vaccine (Kieny et al., 1984)

provided that it is glycosylated (Yelverton et al., 1983; Lathe et al., 1984).

2.8.1 Different generations of vaccines

The first generation of rabies vaccines consisted of phenol or heat-inactivated

viruses produced from nervous tissue. In spite of often severe side effects that

contribute to the burden of rabies on public health, these vaccines are still used in

developing countries since they are easy to prepare and less expensive than the more

recent generations of vaccines (Meslin et al., 1994). The following types of vaccines

have been developed in recent years: purified duck embryo cell vaccine (PDEV), dog

kidney cell vaccines, purified chicken embryo cell vaccine (PCEC) and vero cell

vaccine (Sureau, 1992). Within the veterinary field, an additional type of vaccination is

available: the oral vaccination of wildlife (Winkler and Bogel, 1992). The first

vaccination campaigns were carried out using live modified virus vaccines, derived

mainly from the SAD – ERA strain, although they have been shown to maintain certain

pathogenicity against wild rodents (Artois et al., 1992). In some countries these

vaccines were replaced by recombinant vaccinia virus expressing rabies glycoprotein

(G-Vacc) (Brochier et al., 1990). The oral vaccination of wildlife, together with

domestic dogs, has led to a significant reduction of rabies incidence.

2.8.2 Anti –rabies vaccination of humans

Whereas the veterinary use of rabies vaccines is limited to preventive measures,

vaccination of human takes place mainly after exposure to a rabid animal. Different

regimens of vaccination are recommended (WHO, 1996), varying in number and site

(muscle or skin) of injections. In the case of severe exposure, vaccination is often

accompanied by injection of human rabies immunoglobulin (HRIG). However, due to

non-availability and high costs, the HRIG is often replaced by equine immunoglobulins

(ERIG). In the future, monoclonal human antibodies might be an alternative source

(Schumacher, 1989). Serum can only be used in addition to vaccination. On its own, it

does not protect against rabies (Sikes et al., 1971). A major drawback of immune serum

is that it inhibits VNA production after vaccination (Baer et al., 1988). This effect could


27

be partially overcome, if the number of vaccinations was increased or if the vaccination

took place at least 15 days after the immunoglobulin treatment, or if serums were

administered 12-24 h after vaccination (Wiktor et al., 1971). Patients who had

previously received a complete pre– or post– exposure course, or those who have been

shown at some time in the past to have rabies neutralizing antibodies (>0.5 IU/ml),

need an abbreviated injection schedule without immunoglubulin treatment.

2.8.3 Synthetic peptide vaccines

Synthetic peptide vaccines have several advantages to traditional vaccines: they

are safe, they induce well defined mono functional immune responses and they can be

produced with high reproducibility and exquisite purity in large quantities.

Nevertheless, their immunogenicity is low and the mono specificity of the immune

response allows mutating pathogens to escape from immuno surveillance (Ertl and

Xiang, 1996a). Several approaches of synthetic peptide vaccine have been tested.

1. A peptide carrying an immuno-dominant T cell determinant of the nucleoprotein.

2. A peptide containing a B cell epitope of nucleoprotein.

3. A tandem peptide containing both B-cell and T-cell epitopes of the rabies virus

nucleoprotein (Cruz et al., 2002).

4. A tandem peptide containing a Th cell epitope of N protein and a B cell epitope of

the G protein. Both tandem peptides injected together with adjuvant were able to

induce protection against a peripheral challenge with CVS virus (Dietzschold et al.,

1990a).

2.8.4 Recombinant vaccines

Till date recombinant vaccines against rabies are based either on the injection of

recombinant viruses or of recombinant proteins produced in different expression

systems.

2.8.4.1 Recombinant viruses

Apart from recombinant vaccinia viruses expressing rabies virus G protein

(RGP) that are used for wildlife immunization, recombinant vaccines have so far only

experimental importance. Recombinant vaccinia viruses (pox viruses) have been


28

successfully used for expression of foreign antigens such as hepatitis B virus surface

antigen (Smith et al., 1983a), herpes simplex virus glycoprotein D (Paoletti et al., 1984)

and influenza hemagglutinin (Smith et al., 1983b). Concerning rabies, all structural

proteins have been expressed in vaccinia viruses (Takita-Sonada et al., 1993).

Particular stress has been laid upon G protein (G-Vacc) (Kieny et al., 1984; Wiktor et

al., 1984; Fujii et al., 1994) and N protein (N-Vacc) (Sumner et al., 1991; Fekadu et al.,

1992).The G-Vacc has been used with much success for wildlife immunization in

Europe.

Other pox viruses have been used for the expression of rabies antigens: racoon

pox virus recombinants expressing N protein (Lodmell et al., 1991) and canarypox

recombinants expressing G protein (Cadoz et al., 1992; Taylor et al., 1995). The

canarypox vector has the considerable advantage not to be replicative in human cells. It

would therefore be more suitable than vaccinia virus that has been forbidden for human

use because of safety risks. The same advantage as with recombinant canarypox is valid

for recombinant adenovirus that expresses rabies G protein (Prevec et al., 1990; Lees et

al., 2002).

2.8.4.2 Recombinant proteins

Rabies G protein (RGP) that produced in Escherichia coli was not immunogenic

(Yelverton, 1983; Lathe et al., 1984) whereas G protein expressed in yeast was able to

protect against an intramuscular but not against an intracerebral virus challenge

(Klepfer, 1993). Other studies showed that G protein molecules were not processed

normally in yeast cell and have abnormal folding and multimer formation. Only a small

fraction was occasionally folded normally into the desired conformational epitopes but

these were mostly deprived of the C-terminal portion (Sakamoto et al., 1999). Other

eukaryotic expression systems are the baculoviruses. Different rabies proteins have

been expressed in the baculovirus expression system, the glycosylation seems to be

different, leading to two glycosylated species of recombinant G protein reported in case

of CVS (Tuchiya et al., 1992; Prehaud et al, 1989) and VSV glycoprotein (Bailey et

al., 1989) or influenza virus heam-agglutinin expressed in insect cells (Kuroda et

al.,1990).


29

2.8.4.3 DNA based immunization

Recently vaccinations with DNA coding for the G protein have been reported to

trigger protective levels of virus neutralizing antibodies in animal models (Lodmell et

al., 2003; Bahloul et al., 2003). The success of such treatment needs to be

systematically assessed since protective levels of neutralizing antibody in some cases

are not detected for 10-30 days after DNA immunization (Xiang et al., 1995a). By this

time, in most instances, rabies virus would have moved from the bite site, entered

peripheral nerves, invaded the central nervous system and escaped neutralization. DNA

based immunization has been tested for both rabies glycoprotein and nucleoprotein.

Plasmids encoding G induced specific CTL and Th responses as well as VNA

production and protection against intramuscular (Xiang et al., 1994) and intra-cerebral

challenges (Bahloul et al., 1997). The injection of a plasmid coding for N failed to

induce an immune response: the protein is not exported to the cell membrane and might

therefore not be recognized by the immune system of the host (Ertl and Xiang, 1996b).

The advantages of DNA immunization are well known while its risks are still discussed

(WHO, 1992a). Some of the potential risks associated with DNA-based immunization

include the integration of the plasmid DNA-based immunization including integration

of the plasmid DNA into the host genome by homologous recombination. The long

lasting immune response might cause major disadvantage, as it could induce either

tolerance or immuno pathological events. The DNA itself might induce antibodies and

therefore cause auto-immune disease.

2.9 Plants as bioreactors

The development of the first transgenic plants that expressed a mammalian

protein (Lefebvre et al., 1987) and plants with the first vaccine (Curtiss and Cardineau,

1990) that expressed the Streptococcus mutans surface protein antigen A (Spa A) in

tobacco are two major milestones in this area. In the latter study, the transgenic tobacco

tissue incorporated into the diet of mice elicited a mucosal immune response to the Spa

A protein. Although mice were not challenged with the pathogen, the induced

antibodies were biologically active when they reacted with intact S. mutans. Mason et

al. (1992) expressed the hepatitis antigen in tobacco and reported that the transgenic

plants synthesized the hepatitis B coat protein at ≈0.01% of the soluble leaf protein.


30

Since then, several mammalian genes have been expressed and plants have been

recognized as efficient bioreactors with enormous potential for the production of

proteins valuable to both medicine and industry (Ma and Hein 1995; Goddjin and Pen

1995). The utility of plants as bioreactors was further substantiated when the four

chains of a secretory immunoglobin were properly expressed and assembled in plants,

producing an antibody that was functional (Ma et al., 1995). A bacterial antigen (E. coli

enterotoxin) produced in transgenic plants was shown to effectively immunize mice

when the crude protein extracts from the transgenic plant tissue were administered

orally (Curtiss and Cardineau, 1997; Haq et al., 1995). McGarvey et al., (1995)

expressed the rabies virus glycoprotein in transgenic tomatoes. Plants have also been

used to produce vaccine antigens for human viral diseases such as, Norwalk virus

(Mason et al., 1996). In the late 1980s, plants have been suggested as an emerging

alternative in the vaccine development process. They have been assessed as an

effective, inexpensive, and safe production and delivery system for vaccines. Antigens

produced in plants can be used to generate neutralizing or protective antibodies in

animal models (Mason et al., 1992; 1996; Haq et al., 1995 and McGarvey et al., 1995).

In recent years, several groups have begun to investigate the utility of plants as vehicles

for the expression of vaccine antigens (Hiatt et al., 1989; Ma et al., 1995; Kapusta et

al., 1999; Tackett et al., 1998; 2000).

Recombinant proteins can accumulate in plant tissues. The reported levels of

accumulation range from 0.003% to as high as 14.4% of soluble leaf protein (Kusnadi

et al., 1997). The cost of recombinant protein production in plants has been estimated to

be between 1/10 and 1/50 of that in bacterial fermentation (Kusnadi et al., 1997). Plant

derived vaccines against such animal diseases as mink enteritis virus and rabies were

produced by expressing viral epitopes on the surface of plant viruses, followed by

infection of a susceptible host with the modified virus (Dalsgaard et al., 1997;

Modelska et al., 1998). Arakawa et al. (1997) expressed the cholera toxin B subunit

(CTB) in transgenic potato plants. The maximum amount of CTB protein detected in

auxin induced trangenic potato leaf & tuber tissues was approximately 0.3% of total

soluble plant protein. The first human clinical trials for a transgenic, plant-derived

antigen were planned, approved (US Food and Drug Administration) and performed in

1997 (Tackett et al., 1998). Transgenic potatoes constitutively expressing a synthetic


31

bacterial diarrhea vaccinogen (the B subunit of E. coli heat labile toxin LT-B) were

orally delivered to human volunteers in phase I/II clinical trials.

Oral administration of disease – specific autoantigens can prevent or delay the

onset of auto immune disease symptoms. Arakawa et al. (1998) generated transgenic

potato plants that synthesized human insulin at levels up to 0.05% of total soluble tuber

protein. The list of plant–derived vaccinogens continues to grow and includes viral,

bacterial, enteric and non-enteric pathogen antigens. In an effort to increase the

expression levels, stability and ease of harvest, strategically designed synthetic genes

have been constructed (Mason et al., 1998). Glycoprotein–B of HCMV (Human

cytomegalovirus), which is a membrane protein requiring complex post translational

processing has been produced in tobacco seeds (Tackaberry et al., 1999).

Recent research has concentrated on meeting the pre-requisites for the

application of plant derived vaccines to the human and animal health industries.

Information on dosage, delivery method and response type has been acquired for

pathogens including Vibrio cholerae (Arakawa et al., 1998), HIV (Durrani et al., 1998),

Pseudomonas aeruginosa (Bernnan et al., 1999), murine hepatitis virus (Koo et al.,

1999) and foot and-mouth disease virus (Wigdorovitz et al., 1999). Further

investigations are targeted at the use of chimeric synthetic genes, targeting of

vaccinogen expression to specific plant tissues, investigation of the induced immune

response and progression to human clinical trials.

In general, however, expression levels of these plant derived bio-

pharmaceuticals need to be increased before commercial production can be

accomplished (Daniell et al., 2001). In the past 12 years, substantial research has shown

that plant-derived vaccines are feasible commodities. Walmsely and Arntzen (2000)

gave a general description of this technology and its early development. The use of

plants to express antigens for application as vaccines has seen continued interest over

the past few years, as witnessed by an increasing number of reports on the expression

of new antigen in transgenic plants. A range of different plant and vector systems for

the expression of antigens have been investigated.

Targeting LT-B to specific sub-cellular locations affects its accumulation. The

LT-B levels are optimal if targeted to the vacuole, and are also high if the antigen is

directed to the cell surface. A signal directing retention of LT-B in the endoplasmic


32

reticulum favours accumulation of the protein to a greater extent than nuclear or plastid

targets, or in the absence of any target signal resulting in cytoplasmic localization

(Streatfield et al., 2003). In case of the LT-B expressed in tobacco leaves or potato

tubers, the retention in the endoplasmic reticulum promotes accumulation of the protein

three to four-fold over targeting to the cell surface (Haq et al., 1995).

The general eukaryotic protein synthesis pathway is conserved between plants

and animals, so plants can efficiently fold and assemble full-size serum

immunoglobulins as first demonstrated by Hiatt et al. (1989) and secretary IgAs , as

reported by Ma et al .(1995). The post translational modifications carried out by plants

and animals are not identical. There are minor differences in the structure of complex

glycans, such as the presence of the plant specific residues 1, 3- fucose and 1, 2-

xylose. The economic advantages of adapting plants as bioreactors on a larger scale

would reduce the cost of recombinant protein therapy and increase the number of

patients with access to these treatments. The widespread acceptance of plants will be

more likely when key bottlenecks are addressed such as the yield after extraction,

regulatory issues and plant specific glycans. Some of the commercially important

proteins expressed in plants are given in table 2.3.

The development of genetically transformed plant tissue cultures and mainly of

roots transformed by Agrobacterium rhizogenes (hairy roots), is a key step in the use of

in vitro cultures for the production commercially important of secondary metabolites

and proteins. Hairy roots are able to grow fast without phytohormones and produce

much more quantity of metabolite & proteins in comparison with parent plants. The

conditions of transformation (nature and age of the explants, bacterial strain, bacterial

density, and the protocol of infection) deeply influence the frequency of the

transformation events as well as the growth and productivity of the hairy roots. Then

optimization of the culture parameters (medium constituents, elicitation by biotic or

abiotic stress) may enhance the capability of the hairy roots to grow fast and to produce

valuable compounds.

Continuous rhizosecretion of recombinant proteins is another useful and

promising strategy. Root biomass can be significantly increased by hairy root formation

using Agrobacterium rhizogenes. The secreted proteins can be recovered easily from

the hydroponic medium and used as simple source material for protein enrichment and

Table 2.3: Proteins of potential commercial interest produced in transgenic plants.

Plant/Tissue Promoter Pathogen Disease Antigenic protein Reference

Tobacco/leaf CaMV35S Streptococcus mutans

bacteraemia and

infective

endocarditis

Surface antigen A Curtiss and Cardineau (1990)

Tobacco/leaf CaMV35S Vesicular stomatitis

virus (VSVG)

Severe acute

respiratory

syndrome

Glycoprotein of VSVG Galbraith et al. (1992)

Tobacco/leaf CaMV35S Hepatitis B virus

(HBV) Hepatitis

Hepatitis B surface

antigen (HBsAg) Mason et al. (1992)

Tomato/leaf,

fruit CaMV35S Rabies virus Rabies RGP McGarvey et al. (1995)

Potato/tuber,

tobacco/leaf CaMV35S E. coli Diarrhea

Heat labile toxin B

subunit (LTB) Haq et al. (1995)

Tobacco/leaf CaMV35S HBV Hepatitis HBsAg Thanavala et al. (1995)

Potato/tuber,

tobacco/leaf

Tuber specific

patatin and

CaMV35S

Norwalk virus (NV) Gastroenteritis Norwalk virus capsid

protein (NVCP) Mason et al. (1996)

Tobacco/leaf CaMV35S V. cholerae Cholera CTB Hein et al. (1996)

Potato/tuber, leaf Mannopine synthase V. cholerae Cholera CTB Arakawa et al. (1997)

Potato/tuber CaMV35S HBV Hepatitis HBsAgM Ehsani et al. (1997)

Potato/leaf, tuber CaMV35S E. coli Diarrhea LTB Mason et al. (1998)

Arabidopsis/leaf CaMV35S

Swine transmissible

gastroenteritis corona

virus (TGEV)

Transmissible

gastroenteritis

(TGE)

Glycoprotein S Gómez et al. (1998)

http://www.sciencedirect.com/science/article/pii/S0734975009000500#bib32













Potato/tuber, leaf Mannopine synthase V. cholerae Cholera CTB Arakawa et al. (1998a)

Potato/tuber, leaf Mannopine synthase V. cholerae and IDDM Cholera and

Diabetes CTB–INS (Insulin) Arakawa et al. (1998b)

Arabidopsis/leaf CaMV35S Foot and mouth

disease virus (FMDV)

Foot and mouth

disease Structural protein VP1 Carrillo et al. (1998)

Potato/leaf, tuber CaMV35S Rabbit haemorrhagic

disease virus (RHDV)

Rabbit hemorrh-

agic syndrome

Structural protein

VP60 Castañón et al. (1999)

Tobacco/seed Seed specific

glutelin Gt3

Human Cytomegalo

Virus (HCMV)

Central nervous

system disease Glycoprotein B Tackaberry et al. (1999)

Lupin/callus,

lettuce/leaf CaMV35S HBV Hepatitis HBsAg Kapusta et al. (1999)

Tomato/fruit CaMV35S and fruit

specific E8

Respiratory syncytial

virus (RSV)

Serious respiratory

tract disease RSV F protein Sandhu et al. (2000)

Potato/tuber CaMV35S TGEV TGE Glycoprotein S Gómez et al. (2000)

Tobacco/leaf Synthetic super

promoter TGEV TGE Glycoprotein S Tuboly et al. (2000)

Potato/tuber,

potato/leaf

Tuber specific

potatin and

CaMV35S

HBV Hepatitis HBsAg and HBsAg-

VSPαS/VSPαL Richter et al. (2000)

Potato/tuber, leaf CaMV35S FMDV Foot & mouth

disease Structural protein VP1 Carrillo et al. (2001)

Tobacco/leaf

(chloroplast)

Plastid rRNA operon

(Prrn) V. cholerae Cholera CTB Daniell et al. (2001a)

Arabidopsis/leaf CaMV35S Canine parvovirus

(CPV)

Canine parvovirus

disease

VP2 capsid protein of

canine parvovirus Gil et al. (2001)















White clover/leaf CaMV35S

Mannheimia haemoly-

tica (bovine pneum-

onia pasteurellosis)

Bovine viral

diarrhea Leukotoxin (Lkt) Lee et al. (2001)

Tomato/leaf,

fruit CaMV35S

Organophosphate

poisoning

Severe acute

pancreatitis and

myocardial injury

Human

acetylcholinesterase

(AchE)

Mor et al. (2001)

Potato/ tuber Mannopine synthase V. cholerae, rotavirus

and E.coli

Cholera, diarrhea &

gastroenteritis

CTB–NSP4/CTA2,

CFA/1 Yu and Langridge (2001)

Potato/tuber Tuber-specific

patatin E. coli Diarrhea LTB Lauterslager et al. (2001)

Potato/tuber CaMV35S HBV Hepatitis HBsAg Kong et al. (2001)

Tobacco/leaf CaMV35S Measles virus

(paramyxovirus) Measles

MV-H (Measels virus

hemagglutinin) Huang et al. (2001)

Potato/tuber,

callus Mannopine synthase

V. cholerae and

rotavirus

Cholera and Gast-

roenteritis

CTB–Rotavirus

enterotoxin protein

(NSP4)

Arakawa et al. (2001)

Maize/seed CaMV35S

E.coli and Swine

transmissible gastro-

enteritis corona virus

Diarrhea and Swine

transmissible gast-

roenteritis (TGE)

LTB and TGEV

glycoprotein S

Streatfield et al., 2001;

Lamphear et al., 2002

Tobacco/leaf CaMV35S Measels virus Measles MV-H Webster et al. (2002)

Tomato/fruit,

leaf CaMV35S V. cholerae Cholera CTB Jani et al. (2002)

Alfalfa/leaf CaMV35S FMDV Foot and mouth

disease Structural protein VP1 Dus Santos et al. (2002)












Potato/leaf,

tuber

CaMV35S,

Polyubiquitin,

B33patatin

RHDV Rabbit hemorrhagic

syndrome

Structural protein

VP60 Castañón et al. (2002)

Maize/seed Endosperm specific

gamma zein E. coli Diarrhea LTB Chikwamba et al. (2002)

Tobacco/ NT1,

soybean W82

cell suspension

cultures

CaMV35S HBV Hepatitis HBsAg Smith et al. (2002a; 2002b)

Tobacco/leaf CaMV35 S Enteropathogenic

E.coli (EPEC) Diarrhea

Bundle-forming pilus

structural subunit A

(BfpA)

da Silva et al. (2002)

Potato/ leaf,

tuber CaMV35S

Bovine group A

rotavirus (GAR)

severe viral diarrhea

in humans and

animals

Major capsid protein

VP6 Matsumura et al. (2002)

Tobacco/leaf CaMV35S Bacillus anthracis Anthrax Protective antigen Aziz et al. (2002)

Potato/tuber Mannopine synthase V. cholerae and

rotavirus

Cholera and

gastroenteritis CTB–NSP4 Kim and Langridge (2003)

Tomato/fruit,

leaf CaMV35S E. coli Diarrhea

LTB-Mouse (ZP3)

Zonapellucida 3

epitope

Walmsley et al. (2003)

Potato/tuber CaMV35S Caused by neuro-

degeneration Alzheimer's

Human β-amyloid

(Aβ) Kim et al. (2003)

Tobacco/leaf

(chloroplast)

Plastid rRNA operon

(Prrn) Clostridium tetani Tetanus

Tetanus vaccine

antigen (TetC) Tregoning et al. (2003)












Potato/tuber, leaf CaMV35S Rotavirus Gastroenteritis capsid of rotavirus

glycoprotein VP7 Wu et al. (2003)

Cherry

tomatillo/leaf,

stem, fruit

CaMV35S HBV Hepatitis HBsAg Gao et al. (2003)

Tobacco/NT-1

cell line culture CaMV35S HBV Hepatitis HBsAg-VSPαS Sojikul et al. (2003)

Potato/tuber, leaf CaMV35S

human

papillomaviruses

(HPV)

Cervical cancer HPV11 L1 major

capsid protein Warzecha et al. (2003)

Tobacco/leaf,

potato/tuber, leaf CaMV35S

human

papillomaviruses

(HPV)

Cervical cancer HPV 16 Virus-Like

Particles Biemelt et al. (2003)

Potato/tuber CaMV35S RHDV Rabbit hemorrhagic

syndrome

Structural protein

VP60 Martín-Alonso et zal. (2003)

Carrot/leaf, root CaMV35S Measles virus Measles MV-H Marquet-Blouin et al. (2003)

Peanut/leaf CaMV35S Rinderpest virus

(RPV) Rinderpest

H protein of rinderpest

virus Khandelwal et al. (2003)

Potato/tuber

Tuber specific

patatin and

CaMV35S

HBV Hepatitis HBsAg S and preS2

antigens Joung et al. (2004)

Tobacco/leaf psbA

V. cholerae and

Canine parovirus

(CPV)

Cholera and

Haemo-rrhagic

gastroenteritis and

myocarditis

CTB–2L21 Molina et al. (2004)

Tobacco/Leaf CaMV35S V. cholerae Cholera CTB Jani et al. (2004)













Alfalfa/leaf CaMV35S Bovine rotavirus

(BRV)

Gastroenteritis in

mammals eBRV4 Wigdorovitz et al. (2004)

A.thaliana/ leaf CaMV35S E. coli-M.

tuberculosis, M. Bovis

Diarrhea and

Tubercu-losis

LTB-Early secretory

antigenic

target6(ESAT6)

Rigano et al. (2004)

Tobacco/leaf CaMV35S Measels virus Measels MV-H Webster et al. (2005)

Tobacco/leaf and

tomato/leaf, fruit CaMV35S HBV

Hepatitis and

Gastroenteritis HBsAgM/S and NVCP Huang et al. (2005)

Tobacco/leaf CaMV35S Rabies virus Rabies RGP Ashraf et al. (2005)

Tobacco/Leaf CaMV35S E. coli Diarrhea LTB-SEKDEL Kang et al. (2005)

Alfalfa/leaf CaMV35S Rotavirus Viral gastroenteritis PBsVP6 human group

A rotavirus Dong et al. (2005)

Potato/tuber CaMV35S Porcine epidemic

diarrhea virus (PEDV) Diarrhea

Neutralizing epitope of

PEDV (COE) Kim et al. (2005)

Banana/fruit, leaf ubq3 and EFE HBV Hepatitis HBsAg Kumar et al. (2005a)

Tobacco/cell line

suspension

culture

ubq3 and EFE HBV Hepatitis HBsAg Kumar et al. (2005b)

Collard/leaf,

cauliflower/floret

of mature curd

CaMV35S and

synthetic OCS3MAS.

Vaccinia virus, human

SARS coronavirus

Smallpox and

human SARS

vaccinia virus B5 coat

protein and

coronavirus spike

glycoprotein

Pogrebnyak et al. (2006)

Potato/tuber,

hairy root EFE HBV Hepatitis HBsAg Kumar et al. (2006)

Tomato/fruit CaMV35S HBV Hepatitis HBsAg-ENV,GAG

epitopes of HIV-1 Shchelkunov et al. (2006)















Peanut/callus CaMV35S Bluetongue virus

(BTV) Bluetongue VP2 outer capsid Athmaram et al. (2006)

Potato/tuber, leaf CaMV35S Rotavirus Gastroenteritis capsid of rotavirus

glycoprotein VP7 Li et al. (2006a)

Tobacco/Leaf CaMV35S V. cholerae Cholera CTB–InsB3 Li et al. (2006b)

Tobacco/leaf,

lettuce/leaf CaMV 35S

Severe Acute

Respiratory Syndrome

Coronavirus

Severe Acute

Respiratory

Syndrome

Partial spike (S)

protein of SARS-CoV Li et al. (2006c)

Lettuce/leaf CaMV35S V. cholerae Cholera CTB–SEKDEL Kim et al. (2006)

Tobacco/Leaf CaMV35S V. cholerae Cholera CTB Mishra et al. (2006)

Tobacco/leaf CaMV35S Porcine epidemic

diarrhea virus (PEDV) Diarrhea

Neutralizing epitope of

PEDV (CO-26K) Kang et al. (2006a)

Siberian ginseng/

somatic embryos

CaMV35S and

Ubiquitin E. coli Diarrhea LTB Kang et al. (2006b)

Tomato/fruit CaMV35S Yersinia pestis Pneumonic/bubonic

plague

Antiphagocytic

capsular envelope

glycoprotein (F1) and

low calcium response

virulent antigen (V)

fusion

Alvarez et al. (2006)

Tobacco,

collard/leaf rbcS and CaMV35S Vaccinia virus Smallpox

Vaccinia virus B5 coat

protein Golovkin et al. (2007)

Tomato/fruit Fruit specific E8 V. cholerae Cholera CTB Jiang et al. (2007)

Tomato/fruit Fruit specific E8 Human immuno-

deficiency virus (HIV) AIDS Tat protein of HIV-1 Ramírez et al. (2007)














Papaya/ Embryo-

genic clones

(ETgpC)

CaMV35S Taenia solium Cysticercosis

Synthetic peptides

KETc1, KETc12,

KETc7

Hernández et al. (2007)

Tobacco and

Arabidopsis/leaf CaMV35S

HIV-1 and hepatitis B

virus (HBV)

AIDS and Hepatitis

B

Recombinant HIV-

1/HBV virus-like

particles

Greco et al. (2007)

Rice/seed Endosperm specific

GluB-1 V. cholerae Cholera CTB Nochi et al. (2007)

Soybean/ seed Seed specific

glycinin E. coli Diarrhea LTB Moravec et al. (2007)

Potato/tuber CaMV35S HBV Hepatitis HBsAgM Youma et al. (2007)

Tomato/fruit Fruit specific 2A11 HBV Hepatitis PRS-S1S2S Lou et al. (2007)

Rice/leaves,

seeds

ubiquitin and seed

specific glutelin

Newcastle disease

virus (NDV)

Newcastle disease

(ND)

NDV envelope fusion

(F) glycoprotein Yang et al. (2007)

A. thaliana/leaf,

tobacco/leaf CaMV35S HPV Cervical cancer

HPV11 L1 major

capsid protein Kohl et al. (2007)

Tomato/leaf,

fruit CaMV35S

C. diphteriae, B.

Pertussis and

Clostridium tetani

Diphtheria,

Pertussis and

Tetanus (DPT)

Epitopes of the C.

diphtheriae, B.

pertussis and C. tetani

exotoxins

Soria-Guerra et al. (2007)

Carrot/ leaf, root CaMV35S E. coli Diarrhea LTB Rosales-Mendoza et al. (2008)

Tomato/leaf CaMV35S Caused by neuro-

degeneration Alzheimer's

Human β-amyloid

(Aβ) Youma et al. (2008)













Rice/seeds Seed specific

glutelin A

Caused by

inflammation of joint

cartilage

Arthritis Type II collagen

peptide Hashizume et al. (2008)

Tomato/leaf,

fruit CaMV35S Rabies virus Rabies

Rabies nucleoprotein

(RNP) Arango et al. (2008)

Tobacco/leaf psbA Yersinia pestis plague F1-V fusion protein Arlen et al. (2008)

Peanut/seed Seed specific

legumin V. cholera and Rabies Cholera and Rabies

CTB–Rabies

glycoprotein (RGP) Tiwari (2009)

Tomato/fruit and

tobacco/leaf,

seed

Fruit specific E8 and

CaMV35S

V. cholera and

Hepatitis B virus

(HBV)

Cholera and

Hepatitis B CTB and HBsAg He et al. (2008)

Rice/seed Glub-4 HBV Hepatitis B

SS1(HBsAg)-

hepatocyte receptor-

binding presurface 1

(preS1)

Quian et al.(2008)

Tobacco/leaf CaMV35S HIV-1 AIDS Pr55Gag Meyers et al. (2008)

Tomato/fruit CaMV35S/E2L V. cholerae Cholera CTB-P4/CTB-P6/

TCPA Sharma et al. (2008)

Rice/seed Endosperm specific

Bx17 HMW V. cholerae Cholera CTB Oszvald et al. (2008)

Tobacco/leaf CaMV35S Avian influenza virus

H5/HA1 variant Avian flu

H5/HA1 variant-

HDEL

Spitsin et al. (2009)










Tobacco/

chloroplast

16S rRNA promoter

(Prrn)

Enterotoxigenic E.coli

(ETEC) strains Diarrhea

LTB—Heat stable

toxin (ST) Rosales-Mendoza et al. (2009)

Tobacco/

chloroplast PrbcS/ TrbcS5’-UTR HIV-1 AIDS Pr55(gag) Scotti et al. (2009)

Tobacco/

chloroplast Prrn/ psbA5’-UTR HPV-16 Cervical Cancer PVXCP-E7(16) Morgenfeld et al. (2009)

Lettuce/leaf CaMV35S/NtADH5’-

UTR

E. coli-O138, O139,

and O141 Edema disease

Shiga toxin 2e

(Stx2eB-HDEL) Matsui et al. (2009)

Rice/seed GluB-1 Ascaris suum Gastrointestinal parasite

CTB-AS16 Matsumoto et al. (2009)

Carrot/ root CaMV35S Helicobacter pylori

Chronic gastritis,

peptic ulcer, gastric

cancer and mucosal

lymphoma

UreB (urease B) Zhang et al. (2010)

Tobacco/leaves CaMV35S M. tuberculosis Tuberculosis 85B-ESAT-

6ELPKDEL Floss et al. (2010)

A.thhalian/seed Phaseolin promoter P. falciparum Malaria MSP1 Lau et al. (2010)

Lettuce/leaf CaMV35S Yersinia pestis Bubonic and

pneumonic plague F1-V fusion antigen Rosales-Mendoza et al. (2010)

Arabidopsis/leaf CaMV35S Helicobacter pylori Gastritis, peptic

ulcer, gastric cancer

TonB (HP1341)-

SEKDEL Kalbina et al. (2010)

Tobacco/leaf CaMV35S Rota virus (goupA) Paediatric

gastroenteritis RV VLPs(VP 2/6/7) Yang et al. (2011)

Tobacco/

chloroplast Prm HIV-1 AIDS P24-nef

Gonzalez-Rabade et al.

(2011)




Tobacco/

chloroplast Prm HPV-16 Cervical Cancer HPV-16 L1-LTB Waheed et al. (2011)

N. benthamiana/

leaf Prm-PR1a P. falciparum Malaria Pfs230CMB-KDEL Farrance et al.(2011)

A. thaliana/leaf,

D. carota/root CaMV35S

Chlamydia

trachomatis

Sexually transm-

itted infection (STI) MOMP Kalbina et al. (2011)

Maize/corn CaMV35S A. pleuropneumoniae Porcine

pleuropneumonia (CTB)-ApxIIA Shin et al. (2011)

N. benthamiana/

leaf CaMV35S H1N1, H5N1 Influenza HAC-1, HA1-05 Shoji et al. (2011)

Tobacco/

chloroplast Prm HIV-1 AIDS C4V3 Rubio-Infante et al. (2012)

Tobacco/ leaf CaMV35S Avian influenza A

(H5N1) Influenza Haemagglutinin (H5) Mortimer et al.(2012)

Tobacco/ leaf CaMV35S Bovine viral diarrhea

virus (BVDV) Diarrhea

Glycoprotein E2-

KDEL Nelson et al. (2012)

N. benthamiana/

leaf CaMV35S H1N1 Influenza HAC1 Jul-Larsen et al. (2012)

Tobacco/ leaf CaMV35S GA733 Colorectal

carcinomas GA733-Fc-KDEL Lu et al. (2012)


33

purification (Komarnytsky et al., 2004). Potato hairy roots were utilized for the

expression of HBsAg (Richter et al., 2000; Kumar et al., 2006). These offer several

advantages for the production of HBsAg, including the availability of efficient genetic

transformation, short regeneration time, availability of tissue specific promoters and

genetic stability. The rhizosecretion has also been exploited recently for heterologous

expression of human alkaline phosphatase (Gaume et al., 2003) and IgG antibodies

(Komarnytsky et al., 2006).

Use of hairy root technology for the production of secondary metabolites such

as gossypol (Verma et al., 2009), isoflavonoid (Udomsuk et al., 2009) and withanolides

(Mirjalili et al., 2009) and important pharmaceuticals recombinant proteins like human

interferon alpha-2b (Luchakivskaia et al. 2012), P450 (Banerjee et al., 2002), mouse IL-

12 (Liu et al., 2009) have successfully established the utility of this system.

2.9.1 Oral Vaccines

Various plant biotechnological techniques, such as, modern breeding methods,

clonal propagation, cell suspension culture, hairy root culture and genetic

transformation can play a vital role in establishing the use of plants as “surrogate

production organisms”. One or more immuno-protective antigens of pathogens can be

produced in plants by the expression of gene(s) encoding the protein(s). In recent years,

plant-based novel production systems aimed at developing edible or oral vaccines have

also been discussed (Ma et al., 2003, 2005; Koprowski, 2005; Lal et al., 2007; Mishra

et al., 2008; Houdebine et al., 2009).

Oral vaccines are more affordable and accessible to the inhabitants of

developing countries, who needlessly die, in the thousands, from diseases, which can

easily be prevented by vaccination. Food vaccines are like subunit preparations in that

they are engineered to contain antigens but bear no genes that would enable whole

pathogens to form. These vaccines basically work in the same way as the injected DNA

vaccine, since a peptide sequence similar to an infectious part of a pathogen is

synthesized, by itself, and is used to prime T and B cells in the body. The big difference

in this case is that the protein sequences are encoded in a plant to form the desired

protein. This protein is then ingested, as the plant or its fruit is eaten. One becomes

immune against the ingested protein, as T and B cells become stimulated to proliferate


34

and differentiate. Successful expression of antigens in plants was achieved for Rabies

virus G-protein in tomato (McGarvey et al., 1995), Norwalk virus capsid protein in

tobacco and potato (Mason et al., 1996), Hepatitis B virus surface antigen in tobacco

and potato (Thanavala et al., 1995), E. coli heat-labile enterotoxin B subunit (LTB) in

tobacco & potato (Haq et al., 1995), Cholera toxin B subunit (CT-B) in potato

(Arakawa, 1997). Food vaccines are also used to suppress autoimmune disorders like

type-1 diabetes, multiple sclerosis, rheumatoid arthritis etc. Foods under study include

potatoes, bananas, lettuce, rice, wheat, soybean, corn and legumes.


glyco-lipids or glycoproteins (De Aizpurua and Russell-Jones, 1988) which mediate the

internalization of therapeutically important proteins through gut epidermis. Many of

these proteins have already characterized and used as mucosal adjuvant which

stimulates strong humoral as well as cell-mediated immune responses. Cholera toxin B

subunit is one which well-studied and provides N- terminal fusion capability only.

While ricin toxin B subunit can provides N-terminal as well as C-terminal fusion

capability with their target antigens. Ricin is the toxic lectin which isolated from the

castor bean plant Ricinus communis, is a 65 kDa glycoprotein containing an A chain

(RTA) and a B chain (RTB) linked by a disulphide bond. Ricin is extremely toxic to

eukaryotic cells. Since Lin et al. reported that ricin showed anti-tumour activity, the

biochemical and biological properties of this protein have been extensively studied by

several investigators. The toxin is composed of two subunits linked together by a single

disulphide bond. The A chain (M, = 30,600) has been shown catalytically to inactivate

the 60S ribosomal subunit such that it has a greatly reduced interaction with the

elongation factors. The B chain (M, = 31,400) is a lectin with a high affinity for

galactose (Vitetta and Yen, 1990; Sphyris et al., 1995; Swimmer et al., 1992; Frankel et

al., 1996; Steeves et al., 1999). It is also known to bind cell surface receptors from

about 1×107

to 3×107 molecules/ cell (Sandvig et al., 1976) presumably via

oligosaccharide recognition, and to thereby initiate into the cell RTB is galactose

specific lectin that mediates binding of the toxin to the surface of mammalian cells.

After binding and internalization of ricin, RTA translocates across intracellular vesicle

membranes to the cytosol, where it catalytically inactivates 60S ribosomal subunits and

thereby inhibits protein synthesis and causes cell death. Mature ricin consists of a


35

ribosome-inactivating A-chain (RTA) linked by a disulphide bond and non-covalent

interactions to a galactose binding B-chain (RTB). This heterodimer is toxic to

mammalian cells because it can bind via RTB to a variety of galactosylated cell surface

molecules and following retrograde transport to the endoplasmic reticulum (ER). RTB

binds to glycoproteins, which is found on epidermal cell membranes.

The degradation of protein components in the stomach (due to low pH and

gastric enzymes) and gut before eliciting immune response is a main concern of oral

vaccination (Daniell et al., 2001), but the rigid plant cell walls could provide protection

from intestinal degradation (Webster et al., 2002). The degradation can be compensated

by repeating the exposure of the antigen until immunological tolerance is accomplished

(Mason et al., 1995). The M cells lining the small intestine take in the components that

have entered the small intestine (including pathogens) and pass them to other cells of

the immune system, such as antigen presenting cells and macrophages. These cells

chop up their acquisitions and display the resulting protein fragments on the cell

surface. Helper T lymphocytes recognize the displayed fragments as foreign, induce B

lymphocytes to secrete neutralizing antibodies and also help to initiate a broader attack

on the perceived enemy. Mucosal immune responses represent a first line of defence

against most pathogens. Second generation edible vaccines are also called as multi

component vaccines that provide protection against several pathogens. An elegant

approach to achieve this goal, based on epitope fusion to both subunits of the cholera

toxin (CT), was recently demonstrated by Yu and Langridge (2001). CT provides a

scaffold for presentation of protective epitopes of rotavirus and ETEC (Entero-

toxigenic, E. coli), acts as a vaccine candidate by its own right and as a mucosal

adjuvant devoid of toxicity. The trivalent edible vaccine elicited significant humoral

responses, as well as memory B cells and T helper cell responses, important hallmarks

of successful immunization. In the clinical trials described 100 g of raw potato tubers

expressing LTB of E. coli in three doses had to be consumed in order to overcome

digestive losses of the antigen and to elicit a significant immune response (Tackett et

al., 1998).

Traditional production systems that use microbial, insect, mammalian cell

culture and transgenic animals have drawbacks in terms of cost, scalability, product

safety and authenticity. Molecular farming in plants has many practical, economic and


36

safety advantages as compared to more conventional systems, so the use of plants for

large-scale protein synthesis is gaining wider acceptance. The first pharmaceutically

relevant protein made in plants was human growth hormone expressed in transgenic

tobacco in 1986. Since then many proteins including viral (Norwalk virus capsid

protein), bacterial (Pseudomonas aeruginosa outer membrane protein- Gilleland et al.,

2000), enteric (E. coli heat-labile enterotoxin- Haq et al., 1995) and non-enteric

antigens (Hepatitis B surface antigen- Thanavala et al., 1995) as well as autoimmune

antigens have been produced in an increasingly diverse range of crops. In 1989, the first

antibody was expressed in tobacco, which showed that plants could assemble complex

functional glycoproteins with several subunits. The structural authenticity of plant

derived recombinant protein was confirmed in 1992, when correct assembly of the

Hepatitis B virus surface antigen was reported in tobacco. Further work showed that

plant expressed Hepatitis B particles induced expected immune response in mice.

Generally these recombinant proteins are produced at very low levels in plants,

typically less than 0.1% of total soluble proteins. Besides the factors influencing

transcription and translation efficiency, the accumulation of recombinant protein as

well as their stability strongly depends on the compartments of the plant cell chosen for

expression. All plant production systems can perform a variety of post-translational

modifications, which are similar to those accomplished in mammalian cells. Such

modifications are of special importance for proper function and stability of recombinant

proteins.

The techniques to enhance antigen accumulation in plant tissues are being

explored and include optimization of the coding sequence of bacterial or viral genes for

expression as plant nuclear genes, and defining the sub cellular compartment in which

to accumulate the product for optimal quantity and quality. Despite many recent

advances, low concentrations of heterologous proteins are accumulating in plants.

Several laboratories are also developing alternative expression systems to improve

accumulation. Though, the optimization of expression cassettes is one of the major

ways to make in planta production and purification is economically more feasible. The

regulatory sequence like 5’UTR of the seed storage protein gene arcelin5-I (arc5-I) of

common bean along with β-phaseolin promoter was evaluated in Arabidopsis thaliana.

Nuclear transformations of this construct boosting the heterologous expression up to


37

36.5% of total soluble protein (TSP) in seeds of homozygous plant (Jaeger et al., 2002).

It indicates the importance of UTR and other signal sequences in expression cassette.

Plants offer a good alternative to develop technologies related to large-scale

manufacture of biologically active proteins. The knowledge of plant using as bioreactor

to produce economically important therapeutics is long standing which successfully

commercially exploited and use to produce several examples. In our laboratory, gene of

rabies glycoprotein was first optimized to clone against CaMV35S in plant expression

vector and transformed it into Nicotiana tabaccum. Glycosylated rabies glycoprotein

not only expressed at the level of 0.38% of TSP but also immuno-protective in the

nature (Ashraf et al., 2005). However, localization of glycoprotein is plays an important

and ER localized protein shows more immuno-protection than non-ER localized protein

(Yadav et al., 2012). But the low level of expression limits the extent of immune

response that leads the development of an effective plant-based oral vaccine. Strategies

like co-administration with an adjuvant (Wang et al., 2005) and fusion of antigens with

an effective carrier molecule, either chemically or genetically, can increase the

immunogenicity of antigens (Kanq et al., 2006; Woffenden et al., 2008). We are not

only successfully employed strategies like N- or C- terminal genetically fusion of

adjuvant to rabies glycoprotein but also scale up to them to perform animal experiment

for fulfillment of commercialization aspect. Compared to traditional vaccines, edible

vaccines offer simplicity of use, lower cost, convenient storage, economic delivery and

mucosal immune response.

This work aims to examine the efficacy of plant based oral vaccine against

rabies which expressed in different part of the plants as well as explore its scalability

option so that it could provide economically viable potions which in turn solve the

problem of needle-free vaccination for animals and humans.


38

2.10 Objectives of this study

In lieu of the available information, the present study was undertaken with the

following objectives:

1. Construction of N-terminal fusion of CTB to RGP to form CTB-RGP fusion

gene.

2. Sub-cloning of CTB-RGP fusion gene in plant expression vectors.

3. Isolation and cloning of RTB subunit from Ricinus communis.

4. Construction of C-terminal fusion of RTB and RGP to form RGP-RTB fusion

gene.

5. Sub-cloning of RGP-RTB fusion gene in plant expression vectors.

6. Agrobacterium mediated genetic transformation in plant tissues of Nicotiana

tabaccum and Solanum lycopersicum with the above gene constructs.

7. Molecular screening and analysis of transgenic expressing CTB-RGP and RGP-

RTB fusion proteins.

8. Evaluation of antigenic and immunogenic property of CTB- RGP and RGP-

RTB fusion proteins.

Chapter 3

Materials and Methods


39

3.0 MATERIALS AND METHODS

3.1 Construction of fusion gene and their cloning into plant expression cassette

3.1.1 Construction of ctxB & rgp fusion gene and their cloning into plant

expression vector

We have earlier reported designing and cloning of plant codon optimized

synthetic ctxB gene of Vibrio cholerae O139 strain 1854 (Mishra et al, 2006) and rgp

gene of rabies virus glycoprotein (Ashraf et al., 2005) and their expression in tobacco

leaves. In this study, a glycine-proline hinge was used at the point of fusion of

translational frames of the CTB and RGP proteins. The signal sequence PR-S, of the

pathogenesis induced tobacco protein PR-1a was used to facilitate transport of the

fusion protein to endoplasmic reticulum (Sijmons et al., 1990). The pr-s-ctxB was PCR

amplified using a forward primer (5’ACTCTAGAATGAACTTCCTCAAGTCCTT

C3’) with XbaI and a reverse primer (5’AGGCCCGGGACCGTTAGCCATGGAGAT

AG 3’) with SmaI site using pSM31 (Mishra et al, 2006) as the template DNA. The

reverse primer was de-signed to include codons for the glycine-proline hinge at the

3’end of ctxB. The synthetic G protein gene was PCR amplified using pSA5 (Ashraf et

al., 2005) as template DNA and a forward primer (5’GGTCCCGGGCCTAAGTTCCC

TATCTACAC3’) with SmaI site including codons for the glycine–proline of the hinge

region. The reverse primer (5’ACGAGCTCTCATCACAACTCATCCTTCTC3’)

carried a SacI site. Amplified PCR fragments were digested with the respective

enzymes and triply ligated in the vector, pBI101 containing the enhanced CaMV35S

promoter to obtain pSR1241 with two glycine-proline repeats as hinge at the 3’end of

ctxB (Figure 3.1A).

3.1.2 Construction of rgp & rtxB fusion gene and their cloning into plant

expression vector

The rgp gene was amplified with Phusion polymerase (Finzyme, England) from

pSA33 (Ashraf et al., 2005) by using RGP F1 forward and RGP R1, reverse primers to

amplified fragment of ~1.5kb. ER targeting signal of calreticuline of tobacco and

glycine-proline (GP)2 hinge region were added into the amplified rgp fragment as

primer extension method by using Cal F1, Cal F2 , Cal F3 forward and RGP R1

reverse primers. The gene of rtxB was intron-less and directly amplified from the

Figure 3.1:(A) Gene constructs showing cloning of the fusion gene ctxB-rgp in

pBI101. The pr-s-ctxB and rgp fragments were PCR amplified

from pSM31 and pSA5, respectively. Amplified PCR fragments

were digested with enzymes and triple ligated in pBI101 to

obtain pSR1241with two glycine-proline repeats as hinge.

(B) Gene construct pAS1 showing cloning of the fusion gene rgp-

rtxB in pCAMBIA1300. Both cal-s-rgp and shrgp-(gp)2-rtxB

fragments were amplified with primer extension method and

cloned in pSK+ Bluescript vector. Both fragments were cut with

PstI, HpaI and HpaI, SalI restriction enzymes, respectively,

then ligated to assemble whole cal-s-rgp-(gp)2-rtxB fusion gene.

pSR1241 pCaMV35S

HindIII SacI BglII

SEKDEL

pr-s rgp

2040bp

CtxB

H-(GP)2

ApaI

RB

Tnos nptII

LB

Pnos

Tnos

XbaI XhoI AgeI

(A)

pAS1

RB

Tnos pCaMV35S

HindIII SacI

SalI PstI

Tnos G-Protein

SEKDEL

cal-s rgp hptII

LB

2241bp

rtxB

H-(GP)2

EcoRI

pCaMV35S

HpaI

(B)


40

genomic DNA of Ricinus communis. Forward primers Ricin F1 which contains the

sequences of glycine-proline hinge region and reverse primer Ricin R1 and Ricin R2

which contains the SEKDEL sequences were used to extent the rtxB gene at N and C

terminal respectively. The fragment cal-rgp-gp and gp-rtxB-SEKDL was joined by

overlapping assembly PCR method as describe by Shevchuk et al., (2004) and Young

& Dong, (2004). The assembled cal-rgp-gp-rtxB-SEKDL gene was finally amplified

with terminal Cal F1forward and Ricin R2 reverse primer which contains restriction

site PstI and SacI respectively. cycling parameters for amplification of whole gene from

phusion polymerase was used: 98°C for 2 min; 35 cycles of 98°C for 20 sec; 60°C for

15 sec, 72°C for 30 sec; 72°C for 5 min. After amplification of whole gene, PCR

product was cleaned with PCR cleanup kit (Sigma chemicals) and ligated into EcoRV

digested SK+ Bluescript for the sequencing and verification of proper assembly of

whole gene. After sequencing, whole gene was sub-cloned into pCAMBIA1300 at PstI

and SacI restriction sites. CaMV35S double enhancer promoter was amplified from

pCAMBIA1300 with CaMV1F forward and CaMV1R reverse primer containing

HindIII and PstI sites respectively. The amplified product was sub-cloned into same

pCAMBIA1300 which have assembled gene, as describe above into the HindIII and

PstI restriction sites. Finally, Tnos fragment was isolated by digesting with SacI and

EcoRI restriction enzymes from pBI121 and cloned into the same pCAMBIA1300

which contain CaMV35S promoter and whole gene to obtain pAS1(Figure 3.1B). List

of all primers used in above amplifications are given in table 3.1.

3.2 Transformation of constructs

3.2.1 Generation of transgenic tobacco lines

Agrobacterium tumefaciens LBA4404 was transformed with pSR1241 and

pAS1 by electroporation and used for tobacco (Nicotiana tabaccum cv. Petit Havana)

transformation using the leaf disc method (Horsch et al., 1985). A single isolated

colony of A. tumefaciens LBA 4404 (pAL4404) harbouring binary vector pSR1241 and

pAS1 were inoculated in YEP medium containing antibiotics streptomycin, rifampicin,

kanamycin and hygromycine (for pCAMBIA 13000) and grown (200 rpm, overnight,

28oC). Fifty l of the overnight culture was diluted to 100 ml in YEP medium and

grown till OD600 reached to 0.8. Cells were recovered by centrifugation in SS34 rotor

(5,000 rpm, 10 min, 4oC). The pellet was suspended in co-cultivation medium [MS

Table 3.1: List of primers used in rgp-rtxB fusion gene construction

S.

No

Primer

Name 5’ to 3’ Sequence

Nt.

Length

1. RGP F1

TCTCTCTGCTCGTCGCTGTCGTCTCCGCTAAGTT

CCCTATCTACACTATC 50

2. Cal F1

ACTGCAGATGGCTACTCAACGAAGGGCAAACC 33

3. Cal F2

CTACTCAACGAAGGGCAAACCCATCTTCTCTTC

ACCTAATTACTG 45

4. Cal F3

CATCTTCTCTTCACCTAATTACTGTATTCTCTCT

GCTCGTCGCTGTC 47

5. RGP R1

TGGCCCTGGCCCCTTACCCCAGTTTGGGAGA 31

6. Ricin F1

GTAAGGGGCCAGGGCCAGCTGATGTTTGTATGG

ATCCT 38

7. Ricin R1

CATCCTTCTCGGAAAATAATGGTAACCATATTT

GGTTTG 39

8. Ricin R2

GCTCTAGATCATCACAACTCATCCTTCTCGGAA

AATAATG 40

9.

CaMV1

F

ATTTACTGAATTCGCGTATTGGCTAGAGCAGCT

TGCCAACATGGTG 46

10.

CaMV1

R

TTCTGCAGAGAGATAGATTTGTAGAGAGAGAC 32

11. Rol B F

ACTATAGCAAACCCCTCCTGC 21

12. Rol B R

TTCAGGTTTACTGCAGCAGGC 21

13. vir C F

ATCATTTGTAGCGACT 16

14. vir C R

AGCTCAAACCTGCTTC 16


41

salts, 2% glucose, 10 mM MES and 100 mM acetosyringone (3, 5-

Dimethoxyacetophenone) pH 5.6] to OD600 0.6. Tobacco leaf discs were co-cultivated

with Agrobacterium tumefaciens for two days in dark. After co-cultivation, the leaf

discs were transferred to regeneration medium supplemented with cefotaxime (250

g/ml), kanamycin (100 g/ml) and hygromycine (30 mg/ml). The culture was

incubated in light (photoperiod 16/8) for a period of four weeks. After this, the

transgenic shoots were harvested and transferred to rooting medium containing

kanamycin (50 g/ml). After incubation for 2-4 weeks, the putative transgenic plantlets

were transferred to Hoagland’s solution for acclimatisation and then transferred to

vermiculite for hardening. Kanamycin resistant T0 plantlets of pSR1241 and

hygromycine resistant T0 hardened plantlets were transferred to pot which containing

soil and shifted to the green house until these grown up to maturity or seed setting

stage.

3.2.2 Generation of transgenic tomato hairy roots lines

Plasmid (Figure 3.1B) was electroporated into Agrobacterium rhizogens A4 by

electroporation method (Cangelosi et al., 1991). The second and third leaves of in vitro

grown Solanum lycopersicum plants were used to transform according to a method

described previously by Banerjee et al., (2002). The seeds of Solanum lycopersicum

were germinated in vitro on MS media after 2.5 minute of surface sterilization with

0.1% HgCl2 followed by extensive washing with distilled water. Hygromycin-sensitive

control and Hygromycin-resistance transgenic hairy roots were excised from each

wound site and maintained further at 24oC. Transgenic hairy roots were

micropropagated on MS medium (Medina-Bolivar et al., 2003), supplemented with 100

mg/l Kanamycin and 250 mg/l Cefotaxime.

3.3 Molecular screening of putative transgenic tobacco plants and tomato hairy

roots lines

DNA was isolated from transgenic leaves, hairy roots and non-transgenic

control leaves, roots frozen in liquid nitrogen by using DNeasy mini kit (Qiagen,

Valencia, CA). Transgenic plants were screened for the presence of the ctxB-rgp gene

by PCR, using forward 5’ATCGATGTCGACTAACAACTTCCTCAAGTCTT3’ and


42

reverse 5’AGATCGTCGACT CATCACAACTCATCCCTCTCGGAC3’ primers. with

cycling parameters: 95°C for 3 min; 35 cycles of 95°C for 1min; 60°C for 1 min, 72°C

for 2 min; 72°C for 5 min.

Detection of target gene in putative transgenic hairy root lines was performed

by PCR. Genomic DNA was isolated and subjected to PCR using end RGP F1 and

Ricin R1 primer of RGP-RTB fusion gene with cycling parameters: 95°C for 3 min; 35

cycles of 95°C for 1min; 62°C for 1 min, 72°C for 2 min; 72°C for 5 min. The

polymerase chain reaction was also performed to confirm the presence of the rol B and

absence of vir C genes in the hairy root and control roots. PCR experiments were

performed by using Rol B F forward and Rol B R reverse primer designed for the

amplification of a 652-bp rol B fragment. Forward primer vir C F and reverse primer

vir C R were used to amplify a 730-bp of vir C fragment. Each PCR reaction was

carried out in 50 μl, containing 200 mM of each dNTP, 0.2–0.5 μg of genomic DNA,

1mM of each primer, 1.25U Taq DNA polymerase (Banglore genei, Banglore) and

PCR buffer contained 2mM magnesium chloride. The mixture was amplified in a

thermal cycler (Thermojet, Eurogentec).

Samples were subjected to 35 cycles of 1 min denaturation at 95°C, 1 min

annealing at 55°C for the amplification of the rol B and vir C fragments, and 1 min

extension at 72°C. Amplified DNAs were detected on 1% (w/v) agarose gels.

3.3 Expression analysis of transgenic lines

3.3.1 Extraction of protein

Tomato hairy root and leave tissues were harvested from culture, drained on

paper towels, and stored at -80°C until use. Protein extracts were prepared as

follows: hairy root and leave tissues were ground in liquid nitrogen with mortar and

pestle and transferred to a centrifuge tube containing Tris-Cl extraction buffer [100

mM Tris base, 150 mM NaCl, 2.5% (w/v) PVP-40, 0.1% Tween 20; pH 8.0] at 3:1

buffer to tissue ratio and vortexed vigorously for 1 min. Extracts were centrifuged at

~ 13,000 x g for 10 min at 4°C and supernatants were filtered through four layers of

MiraclothTM

(Calbiochem-EMD Biosciences, San Diego, CA). The total protein

concentration of crude protein extracts was measured using the Advanced Protein

Assay (Cytoskeleton, Denver, CO) in a Bio-Tek EL808 Ultra Microplate


43

Reader. Total protein determinations were made in reference to bovine albumin

serum (BSA) standards dissolved in Tris-Cl extraction buffer.

3.3.2 Enzyme Linked Immuno Sorbent Assay (ELISA)

3.3.2.1 Indirect ELISA

Total soluble protein was estimated by the Bradford reagent (Bio-Rad). A 96-

well micro-titre plate was coated with sample (100 l) of total soluble protein of each

transformed and non-transformed lines of tobacco leaves and hairy roots which lysed in

20 mM Tris-Cl buffer (pH 8.0). The plates were incubated overnight at 4C or at 37C

for 2h and processed as per ELISA method described by Harlow and Lane, 1988. The

plate was blocked with 1.0% BSA in PBS containing 0.05% Tween-20 (PBS-T buffer).

Between any two incubations, the plates were washed with PBS-T three times with 2

min soak time on Plate washer (PW-40 Bio-Rad). After blocking, the plates were

probed with the peptide antibody against RGP and equine anti-rabies polyclonal

antibody (primary antibodies) at 1:5000 dilutions and incubated for 2h in PBST

containing 0.25% BSA. The plates were further incubated with ALP conjugated anti-

rabbit and anti-horse IgG in 1:20000 dilutions for 2h. The wells were washed 100 μl

pNPP (p-nitrophenyl phosphate disodium salt) esubstrate (Bangalore Genie,

Bangalore) was applied per well. The reaction was stopped after 15 min by the

addition of 50 μl of 2N NaOH. Absorbance (A405nm) was read in a Microplate Reader

(Bio-Rad).

3.3.2.2 Direct ELISA

(A) GM1-binding ELISA

Expression of ctxB-rgp gene in leaves was determined by quantitative mono-

sialoganglioside-dependent enzyme linked immuno-sorbent assay (GM1-ELISA). Total

soluble proteins of different sample were diluted serially. Volume of 100 l was added

into the wells in triplicate and incubated for 2h. Wells were washed three times between

each step using 300 l of phosphate buffered saline with added Tween-20 (PBST;

0.01M Na2HPO4, 0.003M KH2PO4, 0.1M NaCl, pH 7.4, 0.05% Tween-20 v/v). ELISA

was carried out at 370C. The 96 well micro-titre plates (Greiner, Germany) were coated

for 1h with 3.0 g/ml GM1 made in sodium carbonate coating buffer pH 9.6 (15 mM


44

Na2CO3, 35mM NaHCO3). As control, BSA (3.0 g/ml) in bicarbonate buffer was

coated in some wells. The wells were blocked with 300 l of 1% BSA in PBST for 1h,

followed by washing with PBST. After washing three times with PBST, the peptide

antibody against RGP and equine anti-rabies polyclonal antibody were added at 1:5000

dilutions and incubated for 2h in PBST containing 0.25% BSA. The plates were further

incubated with ALP conjugated anti-rabbit and anti-horse IgG in 1:20000 dilutions for

2h. Plates were developed with p-nitrophenyl phosphate substrate. The reaction was

terminated by addition of 3M NaOH. The plates were read at 405 nm and the RGP

expression level was quantified on a linear standard curve. All estimations were made

on the basis of three independent experiments.

(B) Asialofeutin-binding ELISA

The functionality of recombinant protein in the protein extracts of transgenic

hairy root lines was determined via binding to asialofeutin. Two hundred microliters

of asialofeutin (Sigma; St. Louis, MO) at a concentration of 100 μg/ml in

biocarbonate buffer (pH 9.6) was coated per well of an Immulon 4HBX (Fisher,

Pittsburg, PA) microtiter plate for 2h at room temperature (RT). The coating solution

was discarded, and the wells were blocked with 300 μL of 1% BSA, 0.05% Tween-20

in PBS for 1h at RT. The blocking solution was discarded and 100 μl each of RTB

standards (described below) and sample protein extracts (prepared as above) was

applied in triplicate wells and incubated for 1h at RT. The blocking solution was

discarded, and wells were washed three times with PBS, 0.1% Tween 20. The rabbit

peptide antibody against RGP and equine anti-rabies polyclonal antibody were added at

1:5000 dilutions and incubated for 2h in PBS-T containing 0.25% BSA at RT. The

wells were then washed as before. Alkaline phosphatase-conjugated anti-rabbit and

anti-horse IgG (Sigma; St. Louis, MO) secondary antibodies were applied at a

1:20000 dilution in blocking buffer and incubated for 1h at RT, then discarded. The

wells were washed three times as before, and 100 μl pNPP (p-nitrophenyl phosphate

disodium salt) substrate (Bangalore Genie, Bangalore) was applied per well. The

reaction was stopped after 15 min by the addition of 50 μl of 2N NaOH. Absorbance

(A405nm) was read in a Microplate Reader (Bio-Rad). Hundred µg of total protein

extract from hairy root tissue or 100 ml of media from hairy root cultures were


45

assessed compared to a standard curve consisting of serially diluted castor E. coli-

derived SUMO-RGP (Singh et al., 2012) in Tris-Cl buffer (above), in concentrations

ranging from 2.5ng to 500ng RTB per well.

3.4 Polyacrylamide gel electrophoresis of plan proteins

3.4.1 SDS-Polyacrylamide gel electrophoresis

Total soluble plant proteins were electrophoresed on denaturing polyacrylamide

gel for western blot analysis. The SDS-polyacrylamide gel was made from stock of

acrylamide and bis-acrylamide solution (30% w/v in a ratio 29:1). Composition of gel

was as follows

Running gel

Acrylamide-bis-acrylamide → 10% (w/v)

Tris- Cl (pH 8.8) → 0.125 M

SDS → 0.1% (w/v)

TEMED → 0.067% (v/v)

Ammonium per sulfate → 0.33% (w/v)

Stacking gel

Acrylamide-bis-acrylamide → 5% (w/v)

Tris-Cl (pH 6.8) → 0.375 M

SDS → 0.1% (w/v)

TEMED → 0.067% (v/v)

Ammonium per sulfate → 0.33% (w/v)

The electrophoresis was carried out in Mini Protean II Dual Slab Cell System

(Bio-Rad). Thirty g protein extract of transgenic and non-transgenic plants along with

molecular weight markers mixed with equal volume of 2X gel loading buffer

containing glycerol 20% (v/v); 0.1 M Tris-Cl, pH 6.8; 4% SDS, 100mM DTT and 0.2%

(w/v) bromophenol blue. Protein samples were loaded directly on the gel with heat

treatment or boiled for 5 min to dissociate oligomer into monomers. The samples were

centrifuged in microfuge (12,000xg, 5 min, 4oC) and loaded on 10% sodium dodecyl

sulfate polyacrylamide gel. The electrophoresis was carried out in buffer (25 mM Tris-

Cl, pH 8.8; 192 mM glycine and 0.1% SDS) at constant current of 16 mA.


46

3.4.2 Native polyacrylamide gel electrophoresis

The native State of CTB-RGP and RGP-RTB fusion protein were detected by

using 6% SDS-PAGE. Unboiled (non-reduced) samples were loaded without adding

DTT in sample loading buffer (Areas et al., 2004). The gel was run at constant 30 V for

at least 5h and blotted into PVDF membrane by electro-blotting on Hoefer TransphorTM

apparatus with cooling.

3.5 Western blot analysis

Samples were mixed with equal volume of sample loading buffer (25mM Tris-

Cl, pH 6.8, 2% SDS, 200 mM DTT, 20% glycerol and 0.25% Bromophenol Blue),

immediately boiled in a water bath for 5 min and centrifuged at 13,000xg. The

supernatant was electrophoresed on a 10% Tris-acrylamide gels, a discontinuous SDS-

PAGE in Mini-gel apparatus (Bio-Rad, Hercules, CA) and transferred to 0.2 µm

immunoBlot® PVDF membrane (Bio-Rad) in blotting buffer (25mM Tris-base,

192mM glycine and 20% methanol). All washings, blocking and antibody dilutions

were made in TBS-T buffer (100 mM Tris pH 7.5, 150 mM NaCl, 0.1% Tween-20).

The membrane was blocked with 5% non -fat dry milk powder (Bio-Rad) for one hour,

followed by incubation with the designated primary antibody in blocking solution for

further 2 h. Membranes were washed three times for 5 min each with TBS-T buffer and

incubated with secondary antibody for 2h and washed 3 times as above. The primary

and secondary antibody was used at 2,000-fold and 10,000 dilutions respectively and

the blot was developed with AP substrate colour developer kit (Bio-Rad; Hercules,

CA).

3.6 Southern analysis of transgenic plants

3.6.1 Isolation of the genomic DNA from tissue

The genomic DNA was isolated from mature tissue following modified CTAB

method. Cut-micro tips were used to handle genomic DNA. Following steps were

performed for this purpose. One gram of fresh tissue was ground to fine powder in

liquid nitrogen. 12 ml of CTAB extraction buffer (2%, w/v CTAB; 50 mM Tris-base,

20 mM EDTA, 1.4 NaCl and 0.1% v/v, β-ME) was added to powdered tissue and

homogenized. The mixture was kept at 68oC for 2h for lysis. After incubation, the


47

temperature of lysate was brought down to the room temperature. The lysate was

extracted with 0.7 volume chloroform: isoamyl alcohol. The aqueous layer was

collected in a fresh tube after centrifugation (SS34 rotor, 10,000 rpm, 10 min, 22oC).

The nucleic acids were precipitated with 0.7 volume isopropanol by keeping on ice for

10 min and then recovered by centrifugation. The pellet was washed with 70% ethanol

and dried at room temperature. The nucleic acids containing genomic DNA were

dissolved in 750 l of 10 mM Tris-Cl, pH 7.4 containing DNase free RNase A (50

µg/ml) and transferred to eppendorf tubes. The tubes were kept overnight at 37oC to

carry out RNA digestion. The genomic DNA was extracted once with phenol:

chloroform: isoamyl alcohol (25:24:1) and twice with chloroform: isoamyl alcohol

(24:1). DNA was precipitated with 0.7 volume isopropanol, dried in air, dissolved in

water and quantified on spectrophotometer.

3.6.2 Digestion of the genomic DNA

Twenty g genomic DNA was digested with Xho I restriction enzymes in 300

l reaction mixture, 5 U/g restriction enzyme was used in two steps. The enzyme was

mixed by swirling the solution with microtip and the digestion was carried out for 16h.

Digested genomic DNA was checked on 0.8% agarose gel to confirm complete

digestion. Rest of the digested genomic DNA was extracted with chloroform: iso-amyl

alcohol. The DNA was precipitated and dissolved in 18 l of TE buffer (pH 8.0).

3.6.3 Transfer of the DNA from gel to nylon membrane

After electrophoresis, the agarose gel was washed with sterile water and placed

in 0.25 M HCl for depurination. The treatment was carried out for 20 min. The gel was

washed with water. The DNA of the gel was transferred to positively charged nylon

membrane (Hybond N+ membrane, Amersham Life Science) with 20X SSC as transfer

buffer following capillary blot method as instructed by the manufacturer and discussed

by Sambrook et al. (1989). The transfer was carried out for overnight. After the

transfer, membrane was washed with 2X SSC buffer, wrapped in Saran wrap and stored

at 4oC.


48

3.6.4 Hybridization of probe and autoradiography for Southern analysis

Stable integration and copy number of the transgene were established by

Southern hybridization as described in (Ashraf et al., 2005). Hybridization was

performed at 65oC for 16 h, using [α P

32] dCTP labeled probe, comprising 570 bp Xho

I–Age I and 519 bp EcoR V– Hpa I fragment at 3’end of ctxB-rgp and rgp-rtxB genes

respectively. The membrane was exposed to Fuji screen for 24 h and scanned on

phosphor imager (Molecular Imager FX, Bio-Rad, and Hercules, USA).

3.7 Immunization of Balb/c mice

BALB/c mice (5 in each group) were orally primed by 50g of each extracted

and partially purified CTB-RGP, RGP-RTB fusion proteins along with phosphate

buffer saline used as a negative control. Then, three booster doses of 25g were given

on the 7th

, 14th

and 28th

day. Serum was collected after 7th

days from the third booster

means 35th

days. SUMO-RGP + CTB and SUMO-RGP + RTB group represents 25µg

of attenuated viral vaccine was orally given to mice with 25µg of each mucosal

adjuvant, cholera and ricin toxin B subunit, respectively. The mice were bled on 35th

day, from the retro-orbital sinus for the estimation of anti-rabies antibody titre in serum.

3.7.1 Titration of antibody response from sera of immunized mice

The ELISA was carried out in a 96 well micro-titre plate (Nunc Maxisorp). The

micro-titre plates were incubated with 100l per well of the commercial virus based

vaccine (Abhayrab, Indian Immunologicals) at the dilution of 1:50 in PBS-Tween buffer

containing 0.25% BSA at 4oC for 2h. The micro-titre plates were again washed with

PBS-Tween buffer. The washed micro-titre plates were further filled by 100l/ well of

serum (1:100) of different groups of mice and incubated for 2h at 4oC. The micro-titre

plates were then washed and incubated for 2 h at 37oC, containing 100l/ well of

horseradish peroxidase conjugated anti-mouse anti-IgG1 (1:1,000) and anti-mouse anti-

IgG2a (1:1,000) in PBS-T containing 0.25 % BSA at 37oC for 2 h. The chromo-genic

reaction was allowed to take place by adding 100µl/well of tetra-methylbenzidine for

horseradish peroxidase conjugates and reaction was allowed for 30 min at 37oC. The

enzymatic reaction was stopped by adding 1N sulphuric acid (50µl/well). Absorbance

was measured at 450 nm.


49

3.8 In silico analysis of CTB-RGP and RGP-RTB fusion proteins

An alignment of the amino acid sequences of Ricin chain B chain, Rabbies

glycoprotein G and Hybrid was produced with Clustal W program. This alignment

project file was submitted to Swiss‐Model in the expasy server

(http://www.expasy.ch/spdbv) and a preliminary model for Hybrid was retrieved. The

tertiary structure with PDB file of RGP-RTB fusion protein was generated by using

MULTICOM protein tertiary structure prediction server (http://www.molbiol-

tools.ca/protein_tertiary structure.htm) which uses multiple templates for homology

dependent tertiary structure prediction. We used RAMPAGE : Ramachandran

Plot Assessment tool to analyse the quality of the deduced model

(http://mordred.bioc.cam.ac.uk/~rapper/rampage.php). Pymol software was used for

superimposition study. The Hopp–Woods hydrophilicity scale of amino acids is a

method of ranking the amino acids in a protein according to their water solubility in

order to search their surface locations on proteins, especially those locations that tend to

form strong interactions with other macromolecules and antigenically important was

done by using Sci-Ed software. Protparam analysis of CTB-RGP and RGP-RTB fusion

proteins were also perform.

3.9 Up-scaling of the selected hairy root clone in bioreactor

In course of the present study, attempts were also made for up-scaling the

selected hairy root clone of Lycopersicon esculantum expressing RGP-RTB in a 5L

Bench top fermenter (model Bioflo-3000 from M/s New Brunswick Scientific Co. Inc.,

USA) through applying the design modifications, already established for the scaling-up

of hairy root cultures of other plant system (Banerjee et al., 2002) and optimization of

critical parameters.

Design modifications which were employed for the present study included the

following amendments: (i) inclusion of a nylon mesh septum (pore size 200u),

tightened on the lower stainless steel semi-circular ring of the baffle assembly, dividing

the reactor vessel into an upper and a lower chamber, (ii) the marine blade impeller was

positioned in the lower chamber (9 cm down from the nylon septum) and sparger was

placed in lower chamber (12cm down the septum); the agitation speed was kept

http://www.google.co.in/url?sa=t&rct=j&q=ramachandran%20plot%20prediction%20tool&source=web&cd=2&cad=rja&sqi=2&ved=0CDMQFjAB&url=http%3A%2F%2Fmordred.bioc.cam.ac.uk%2F~rapper%2Frampage.php&ei=t-IHUevDIMLprAf0ioCYBA&usg=AFQjCNEwZXe4ZRZurO4gr3BqA5XJ6j13OA&bvm=bv.41524429,d.bmk

http://www.google.co.in/url?sa=t&rct=j&q=ramachandran%20plot%20prediction%20tool&source=web&cd=2&cad=rja&sqi=2&ved=0CDMQFjAB&url=http%3A%2F%2Fmordred.bioc.cam.ac.uk%2F~rapper%2Frampage.php&ei=t-IHUevDIMLprAf0ioCYBA&usg=AFQjCNEwZXe4ZRZurO4gr3BqA5XJ6j13OA&bvm=bv.41524429,d.bmk

http://mordred.bioc.cam.ac.uk/~rapper/rampage.php


50

constant at 100 rpm and the air flow rate was fixed at 1.3L per minute using an air-

compressor via hydrophobic membrane filter (0.22µ; Whatman, USA).

The culture conditions were maintained as follows:

(i) 2.5 liters of half -strength MS medium with B5 vitamins and 3% sucrose was

used in the bioreactor vessel;

(ii) Initial inoculum of 4.0 g (FW) per liter was used, which was obtained from

fifteen days old hairy root cultures and was inoculated aseptically through the

optimally-flamed inoculation-port of the bioreactor under a sterile laminar-hood

(iii) Culture temperature was maintained constantly at 25±2° C by circulating cold

water from a chiller attachment through the cooling jacket;

(iv) Roots were grown in dark.

(v) The culture period continued till the 21st day of inoculation.

After 21 days of sterile run, the roots were harvested through dismantling the

vessel-assembly, washed under running tap water, blotted dry between filter papers and

weighed on a Mettler pan balance to determine the fresh weights. The harvested root

sample was analysed through ELISA as per the already stated method in-order to

quantify the contents of the two specified proteins, i.e. RGP and RTB.

Chapter 4

Observations

Observations

51

4.0 OBSERVATIONS

4.1 Construction of ctxB-rgp and rgp-rtxB fusion genes

The amplified coding sequences of ctxB-rgp and rgp-rtxB fusion gene were

cloned in pBI101 and pCAMBIA1300 vector, respectively, in a way that the complete

ORF produces CTB-RGP (Figure 3.1A) and RGP-RTB protein, respectively (Figure

3.1B). The ctxB-rgp and rgp-rtxB fusion gene were containing 63bp of N-terminal ER

targeting pathogen responsive signal sequence (PR-S) sequence and 27bp of ER

targeting Calreticulin (Cal-S) sequence from tobacco, respectively. Both the fusion

protein C-terminally extended for 18bp of SEKDEL, an ER retention signal which were

amplified through primer extension method.

The pr-s-ctxB was PCR amplified using a forward primer with XbaI and a

reverse primer with SmaI site using pSM31 (Mishra et al, 2006) as the template DNA.

The reverse primer was designed to include codons of glycine-proline hinge at the

3’end of ctxB. SmaI containing forward primer and SacI containing reverse primer were

used for PCR amplification of rgp gene from pSA5. Amplified PCR fragments were

digested with the respective enzymes and triply ligated in pBI101 vector containing the

enhanced CaMV35S promoter to obtain pSR1241. The size of ctxB-rgp fusion gene is

2.04 kb along signal sequences and two glycine-proline repeats as hinge.

The rgp-rtxB gene was amplified with forward and reverse end primer which

contains PstI and SacI restriction sites, respectively. PCR amplified product was blunt

end ligated into EcoRV digested pBluescript SK+.

After validating the fusion gene

through sequencing, restriction digestion was perform with PstI and SacI which

produced the band of and rgp-rtxB fusion gene of 2.24 kb which was purified from

agarose gel and finally subcloned into the downstream of CaMV35S double enhancer

containing pCAMBIA1300 plant expression vector. The expression construct was

known as pAS1.

4.2 Transformation, molecular screening of putative transgenic tobacco and

tomato hairy root lines

Plasmid pSR121 and pAS1 were transformed into tobacco (Figure 4.1). Five

lines for ctxB-rgp (Figure 4.2A) and eight lines for rgp-rtxB (Figure 4.2B)

independently transformed kanamycin resistant tobacco plants were verified for the

(C)

(A) (B)

Figure 4.1: A. tumefaciens strain LBA4404 containing pSR1241and pAS1

plasmid was used for transformation of tobacco leave discs.

(A) Transgenic shoot induction from leave discs.

(B) Transgenic shoots elongation and their respective selection on

Kanamycin and Hygromycin containing media.

(C) Acclimatized mature transgenic tobacco plants in glass house.

Figure 4.2: (A) PCR detection for stable integration of ctxB-rgp fusion gene in

genomic DNA of the transgenic tobacco lines. M, λ DNA marker,

PC, positive control (plasmid DNA); lane 1-5, transgenic tobacco

lines and NT is non transgenic tobacco.

(B) PCR amplification of rtxB from stable integration of rgp-rtxB

fusion gene in genomic DNA of the transgenic tobacco lines.

M, PC and NT are showing 100bp marker, plasmid DNA and

non- transgenic tobacco lines, respectively.

(A)

(B)

M 1 2 3 4 5 NT PC

2.0 Kb

800 bp

M NT 1 2 3 4 5 6 7 8 PC

Observations

52

presence of respective genes by PCR amplification of the genomic DNA. The expected

amplification product of ~2.0 kb for ctxB-rgp gene (lanes 1-5) and ~800bp of rtxB gene

from rgp-rtxB gene (lanes 1-8) was observed in all the plants along with respective

positive control plasmid (lane PC) whereas genomic DNA of the non-transgenic plant

gave no amplification (lane NT). The quantitative analysis of ctxB-rgp (Figure 4.3A)

and rgp-rtxB (Figure 4.3B) gene expression carried out by ELISA showed the highest

expression level in plant T01 and T05, respectively. Transgenic tobacco plant T01 of

ctxB-rgp and T05 of rgp-rtxB shows 5-fold and 3-fold higher expression as compared

to that of least expressing plants, respectively.

Plasmid pAS1 was also transformed in tomato hairy root lines (Figure 4.4).

Initially eight hairy root lines were isolated and kept on selection of 15 mg/l

hygromycin for two cycles of 10-10 days with 250 mg/l Cefotaxime. Out of eight hairy

root lines, five hairy root lines remained healthy however three stopped proliferating

and showed necrosis in root tip region. The hairy root lines were screened by PCR

using rgp-rtxB fusion gene spe f e od ed 2.1kb band from isolated

genomic DNA of different transgenic hairy root lines (Figure 4.5A). Lane 1 to 5 of

figure 4.5A shows amplification from transgenic hairy root lines from H01 to H05,

respectively. Lane NT and PC, shows amplification from hairy roots which developed

from non-transformed A4 strain as negative control and pSA1 plasmid as a positive

control, respectively. Primers of vir C and rol B gene were used for validating as

negative and positive control of Agrobacterium contamination in the genomic DNA of

hairy root lines. A band of 730 bp of vir C in lane PC was amplified through isolated

plasmid pAS1 from transformed A. rhizogens (Figure 4.5B). In figure 4.5B except lane

PC which is a positive control, all the lane 1-5 of five hairy root lines from H01-H05

and NT of negative control shows no amplification, respectively. Figure 4.5C, shows

the amplification of rol B gene. Lane PC shows amplification of the positive control

and same as vir C lane 1-5 shows amplifications from genomic DNA isolated from

hairy root lines and NT is negative control. The quantitative analysis of rgp-rtxB gene

expression in hairy root lines carried out by ELISA (Figure 4.6) showed the highest

expression level in plant H03. Transgenic tomato hairy root lines H03 of rgp-rtxB

showed 5-fold higher expression as compared to that of least expressing line H05,

respectively.

Figure 4.3: (A) Determination of CTB-RGP expression in different T0 lines

of N. tabaccum leaves by indirect ELISA with Ab1 equine

anti-rabies antibody, NT is non-transformed plant.

(B) Determination of RGP-RTB expression in different T0 lines

of N. tabaccum leaves by indirect ELISA with Ab1 equine

anti-rabies antibody, NT is non transformed hairy root.

(A)

(B)

Figure 4.4: (A) Plasmid pSA1 containing, Agrobacterium rhizogens strain A4

mediated induction of hairy root culture from the leaves of

Solanum lycopersicum grown in ¼ MSP solid media.

(B) Transformed in vitro grown roots of Solanum lycopersicum after

grown in 28th days in ¼ MSL in liquid media.

(C) Scale-up process of selected hairy root line (H03) in 5L air lift

bioreactor for large production and isolation of candidate protein.

(B)(A)

(C)

Figure 4.5: (A) PCR detection for stable integration of rgp-rtxB fusion gene in

genomic DNA isolated from the transgenic hairy root lines. M,

λ DNA marker, PC, positive control (plasmid DNA); lane 1-5,

transgenic lines H01- H05 and NT is non-transgenic hairy root

lines.

(B) PCR amplification of vir C region in plasmid DNA (PC) and its

absence of selected hairy root lines. M and NT are 100bp marker

and non-transformed lines, respectively.

(C) PCR amplification of rol B region. Lane: 2-5, selected hairy lines;

NT, non-transformed control in vitro hairy roots and M is 100bp

marker.

M PC 1 2 3 4 5 NT

M 1 2 3 4 5 NT PC

M PC 1 2 3 4 5 NT

730 bp

(A)

(B)

(C)

2.0 Kb

652 bp

M 1 2 3 4 5 NT PC

M PC 1 2 3 4 5 NT

M PC 1 2 3 4 5 NT

Figure 4.6: Determination of RGP-RTB expression in different lines of

Solanum lycopersicum hairy roots by indirect ELISA with

Ab1 equine anti-rabies antibody, NT is non transformed

hairy root.

Observations

53

The quantitative analysis of rgp-rtxB gene expression in both hairy root lines

and tobacco shows RGP-RTB protein expression. However difference in expression of

rgp-rtxB gene between highest expressing hairy root line (H03) and tobacco leaves

(T05) is approximately 4-fold higher. Comparison between expression analysis of

tobacco leaves and hairy root lines suggest that hairy root lines have higher expression

level probably due to the lower background protein concentrations and easy in vitro

scalability than tobacco. Therefore detailed studies of RGP-RTB protein expression and

immunogenicity were conducted further on tomato hairy root lines.

4.3 Growth Kinetics of tomato hairy root lines

Growth kinetics study of hairy root lines was conducted for the optimization of

harvesting time. Out of eight hairy root lines, six were healthy when grown on selection

media. The six selected hairy root clones were further transferred to liquid half strength

MS medium with B5 vitamins containing 3% sucrose to study their growth

characteristic during different growth phases i.e. 14, 21, 28 and 35 days. Although the

morphological appearance of these five clones was quite similar initially, two of these

clones could be distinguished from the rest three by increased lateral branching and

healthy appearance. A gradual increase in fresh weight up to 21 days of culture could

be noted with all the root clones, amongst which two clones H04 and NT (lane 4 and 6)

continued to grow further even up to 35 days of culture while the rest four clones H01,

H02, H03 and H05 (lane 1, 2, 3 and 5) exhibited a decline in their growth after 21 days

of culture (Figure 4.7). The growth increment was highest with the hairy root clone

H03 which exhibited a maximum of 29.6 fold increase in biomass over 21 days of

culture followed by that of the H02 and H01 after the same period of time.

4.4 Optimization of harvesting time for ctxB-rgp and rgp-rtxB genes expression

by indirect ELISA

Tobacco leaves of T01 line was selected to validate the optimum time of

harvesting on the basis of CTB-RGP fusion protein accumulation. The data of maturing

transgenic leaf was collected on different time interval which is shown in figure 4.8A.

The accumulation of the protein was maximum on the 14th

day (2nd

week from

inoculation) and gradually decreased as culture proceeded to 21st, 28

th and 35

th days of

maturity (Figure 4.8A).

Figure 4.7: Comparative study of growth kinetics analysis of selected transgenic

hairy root lines (H01-H05) of rgp-rtxB fusion gene from 1st to 5th and

6th is non-transformed in-vitro grown control roots during different

growth phases.

0

5

10

15

20

25

30

35

1 2 3 4 5 6

Gro

wth

ind

ex

Number of lines of hairy root cultures

14 days

21 days

28 days

35 days

Figure 4.8: Optimum time course study for harvesting transgenic plants and

hairy root lines. Tissues were harvested at each interval of 7, 14,

21, 28 & 35 days and did ELISA by Ab1 equine raised poly clonal

anti-rabies antibody.

(A) Transgenic tobacco plant T01 has highest CTB-RGP protein

expression so that leaves from this plant was taken for the study.

(B) Tomato hairy root line H03 has highest RGP-RTB protein

expression so that taken for the standardization of optimum

harvesting time.

(A)

(B)

Observations

54

H03 line of hairy root was selected to validate the optimum time of harvesting

hairy root culture on the basis of RTB-RGP fusion protein accumulation. Figure 4.8B

shows that the accumulation of the protein was maximum on the 21st day (3

rd week

from inoculation) and gradually decreased as culture proceeded to 28th

and 35th

days of

post inoculation (Figure 4.8B).

4.5 Immunological activities of CTB-RGP and RGP-RTB fusion proteins

Functionality of CTB-RGP fusion protein was correlated with the ability to bind

to GM1-ganglioside. Three microgram per milliliter of GM1 was optimized within the

linear range of binding at variable molar concentrations of CTB-RGP fusion protein.

Immunological activity of the fusion protein CTB-RGP was checked by performing

both direct GM1-ELISA (Figure 4.9A) and indirect ELISA (Figure 4.3A). Fourteen

days mature leaves of all the transgenic tobacco lines were harvested for analyzing the

immunological activity of fusion protein. Peptide antibodies (Ab2) against the rabies

glycoprotein as well as equine anti-rabies antibodies (Ab1) were used as primary

antibodies in direct GM1-ELISA. The binding of the CTB-RGP protein to GM1

receptors in GM1-ELISA established that the fusion protein expressed in tobacco

leaves was in pentameric form and immunologically active against the rabies

antibodies. It is also established that CTB is in their right confirmation so that they

attain pentameric structure and bind to its receptors. According to indirect ELISA,

CTB-RGP fusion protein of T01 transgenic tobacco line has higher expression and

immunological activity. Consistently in T01 to T05, Anti-rabies antibodies (Ab1) show

more absorbance intensity as compared to peptidal anti-rabies antibody (Ab2).

All the hairy root lines were harvested on the 21st day for analyzing the

maximum accumulation of RGP-RTB fusion protein and immunological activity.

Asialofeutin mediated direct ELISA of all the 5 transgenic hairy lines was performed

with two different antibodies, equine anti-rabies (Ab1) and peptide anti-rabies antibody

(Ab2) (Figure 4.9B). Direct ELISA showed that after 21st day of inoculation of hairy

root line, H03 had maximum accumulation of fusion protein followed by line H01

which had second highest accumulation. This result is in agreement with the result of

indirect ELISA (Figure 4.6). It suggests that hairy root expressed RGP-RTB fusion

protein is immunological active and shows higher expression than CTB-RGP from

leaves of tobacco lines.

Figure 4.9: (A) CTB-RGP expression in different T0 lines of Transgenic

tobacco by GM1 receptor based ELISA with Ab1 equine

anti-rabies and Ab2 peptide anti-rabies antibody, NT was

absorbance of non transformed plant.

(B) RGP-RTB expression in different lines of Solanum

lycopersicum hairy roots by asialofeutin receptor based

ELISA with Ab1 equine anti-rabies and Ab2 peptide anti-

rabies antibody, NT was absorbance of non transformed

hairy root .

(A)

(B)

Observations

55

4.6 Quantitation of CTB-RGP and RGP-RTB fusion proteins in highest

expressing transgenic lines

The level of pentameric form of CTB-RGP protein expressed in transgenic

tobacco lines was determined by monosialoganglioside dependent enzyme linked

immuno-sorbent assay (GM1-ELISA) of total leaf protein. The TSP extracted from the

leaves of T01 plant showed highest level of CTB-RGP expression (0.4%) whereas

second highest expression observed in T03 (0.21%) plant (Figure 4.10A).

Tomato hairy root lines of H01 and H03 were further taken into account for the

estimation of accumulated RGP-RTB fusion protein by asialofeutin mediated ELISA

(Figure 4.10B). As depicted in figure 4.10B, line no. H01 and H03 showed 0.9 and

1.2 % of total soluble protein accumulation, respectively. Hairy root lines H01 and H03

contained 6 and 8µg of RGP-RTB fusion protein in per gram of tissue, respectively.

4.7 Western blot analysis of CTB-RGP and RGP-RTB fusion proteins in native

and denaturing conditions

Western blotting was attempted for qualitative analysis of transgenic protein and

its accumulation in the tissue. The transgenic tobacco plants T01, T02 and T03 which

showing high expression of CTB-RGP fusion protein, were selected for analysis on

denaturing immunoblot assay. Under the denaturing conditions, a band of ~80.6kDa

(~66kDa glycosylated RGP + ~14.6kDa glycosylated CTB polypeptides), representing

the monomeric fusion polypeptide was detected by using equine anti-rabies antibodies

(Ab1) while non-transformed plant (NT) showed no band (Figure 4.11A). As expected

in the non-reduced and un-boiled condition, a pentamer size of (~403 kDa) CTB-RGP

fusion protein was detected by equine anti-rabies antibodies (Figure 4.12A). No band

was detected in the non-transgenic plants. The highest expression of CTB-RGP protein

was noticed in plant T01 in figure 4.11A which is consistent with the ELISA result.

The transgenic hairy root lines H01, H02, H03 and H04 showing high

expression of RGP-RTB fusion protein, were selected for analysis on denaturing

immunoblot assay. Under the denaturing conditions, a band of ~84kDA (~52.5kDa

glycosylated RGP + ~31.5kDa glycosylated RTB polypeptides) was seen in each lane

from H01 to H04 by using equine anti-rabies antibodies (Ab1) while non-transformed

plant (NT) showed no band (Figure 4.11B). In the non-reduced and un-boiled

Figure 4.10: Quantitative expression of CTB-RGP (A) and RGP-RTB (B)

fusion proteins in their respective high expression transgenic

lines by receptor mediated ELISA with peptidal anti-rabies

antibody (Ab2).

(A)

(B)

Figure 4.11: (A) Western blot analysis of transgenic tobacco plants which

contain ctxB-rgp fusion gene under denaturing condition

by using anti-rabies antibody (Ab2). Crude protein (30 µg)

prepared from the leaves of non-transgenic (NT) and

transgenic plants T01, 2 and 3 was loaded along with

molecular weight markers (M).

(B) Western blot analysis of transgenic tomato hairy root lines

which contain rgp-rtxB fusion gene under denaturing

condition by using peptide anti-rabies antibody (Ab1).

Crude protein (50 µg) was prepared from the hairy root

lines H01, H02, H03, H04, NT (non-transformed) lines

and loaded along with molecular weight markers (M).

M H01 H02 H03 H04 NT

≈ 84 kDa

M T01 T02 T03 NT

≈ 81 kDa

(A)

(B)

Figure 4.12: Western blot analysis of transgenic lines under non-denaturing

condition by using polyclonal anti-rabies antibody (Ab2).

(A) Crude protein (30 µg) was prepared from the tobacco line of

ctxB-rgp fusion gene (T01), loaded at lane 2; M, marker and NT

is non-transformed line.

(B) Crude protein (50 µg) was prepared from the tomato hairy root

line of rgp-rtxB fusion gene H03), loaded at lane 3; M, marker

and NT is non-transformed line.

≈ 403 kDa

≈ 168 kDa

(A)

(B)

M T01 NT

M NT H03

Observations

56

condition, ~168kDa dimer size of RGP-RTB fusion protein was detected in H03 line of

hairy root line by equine anti-rabies antibodies (Figure 4.12B). As in ELISA result,

line H03 showed highest expression of RGP-RTB protein in figure 4.11B.

4.8 Southern analysis of transgenic tobacco and hairy root lines

The transgenic tobacco plant T01 showing the highest expression of ctxB-rgp

gene was further analyzed by Southern hybridization for determining the copy number

of the transgene insertion and stable integration. The transgenic plant T01 contained

single copy of the transgene inserted into its genome while non-transformed (NT)

showed no band (Figure 4.13A). XhoI digested linear plasmid of pS1241 was used as

positive control.

Similarly, transgenic tomato hairy root line H03 showing the highest expression

of rgp-rtxB gene, was further analyzed by Southern hybridization for determining the

copy number of the transgene insertion and stable integration. The transgenic hairy root

line H03 contained single copy of the transgene inserted into its genome while non-

transformed (NT) showed no band (Figure 4.13B). HpaI digested linear plasmid of

pAS1 was used as positive control and shown a band.

4.9 Immune response of mice against CTB-RGP and RGP-RTB fusion proteins

The results of the mice experiments (Figure 4.14) show that both the CTB-RGP

and RGP-RTB fusion proteins enriched plant fraction elicits an immune response in

mice. However, the ratio of IgG2a and IgG1 indicate that mice have both Th1 and Th2

response and induction of Th2 is more than Th1 response for both fusion proteins.

Although, the intensity of immune response in RGP-RTB fusion proteins is little higher

than CTB-RGP fusion protein, overall immune response is lower for both proteins. It

suggests that quantity of oral dose for both the fusion proteins were lower and need to

optimize further with higher quantity of priming and booster doses. Oral delivery of

attenuated virus vaccine with cholera toxin B and ricin toxin B subunit (Virus + CTB

and Virus + RTB) were not induced significant immune response.

4.10 Scale-up process of tomato hairy roots

The high protein expressing hairy root line (H03) was further set for the up-

scaling through its cultivation in a structurally modified mechanically agitated

H03 PC NTPC T01 NT

(A) (B)

Figure 4.13: (A) Detection of chimeric ctxB-rgp gene in T0 lines of

transgenic tobacco plants by Southern hybridization

analysis. Lane NT, non-transgenic; T01, transgenic line

T01 and PC represent positive control plasmid.

(B) Detection of chimeric rgp-rtxB gene in transgenic tomato

hairy root lines by Southern hybridization analysis. NT,

non-transgenic; H03, transgenic hairy root line H03 and

PC represent positive control plasmid.

Figure 4.14: Immune response against both the fusion protein CTB-RGP

and RTB-RGP in five Balb/c mice of each group. Both fusion

proteins were orally administered (OD) to each mice of every

group in the following manner of regime 0, 7, 14, 21 and 35.

Virus + CTB and Virus + RTB group represents attenuated

virus vaccine was orally given to mice with cholera toxin B

and ricin toxin B subunit of mucosal adjuvants, respectively.

Observations

57

bioreactor of 5l working capacity consisting of earlier mentioned modification for

optimum growth (Figure 4.4C).

With the earlier optimized bioreactor configuration as described by Banerjee et

al., (2002), a 49.6 fold growth enhancement (496.3 g FW) could be obtained after the

same period of 21 days of culture through controlled air-flow rate (1.5 l/min) and

agitation speed of 50 rpm. Although in terms of fold increase, this growth rate was

higher than that noted in case of the shake flask grown roots which exhibited 29.6 fold

growth increases within the same growth period (Figure 4.7), the biomass yield per

liter of the bioreactor was higher than that of the shake flask grown roots (Table 4.1).

Both in terms of protein expression of RGP-RTB and productivities,

comparable results could be obtained between that recorded in the shake-flask (Figure

4.4B) and bioreactor grown roots (Figure 4.4C). However, productivity recorded

during the bioreactor run remained comparatively lower than shake flask which might

be due to callogenesis of the root tissues in bioreactor.

4.11 In-silico analysis of CTB-RGP and RGP-RTB fusion protein

The predicted tertiary structure of CTB-RGP and RGP-RTB fusion protein are

shown in figure 4.15 and their quality assessment was done and cross verified by

corresponding Ramachandran plot (Figure 4.16). However, in comparison to RGP-

RTB, CTB-RGP shows more scattering in Ramachandran plot. But the quality of

tertiary structure model of CTB-RGP and RGP-RTB fusion proteins are in agreement

with the Ramachandran plot.

Superimposition study of native tertiary structure of Rabies glycoprotein and

cholera toxin B subunit (PDB) was performed with CTB-RGP fusion protein (Figure

4.17A). It showed complete superimposition to native cholera toxin B subunit and

achieved its actual tertiary confirmation so that it could bind readily with GM1

receptors. Similarly as above superimposition study of native tertiary structure of

Rabies glycoprotein and Ricin B chain was performed with RGP-RTB fusion protein

(Figure 4.17B) showed complete superimposition to native ricin B chain and achieved

its confirmation so that it could bind readily with their receptors. This study is in total

agreement with the results of GM1 and asialofeutin mediated ELISA for CTB-RGP and

RGP-RTB fusion proteins. However, Superimposition of Rabies glycoprotein (RGP),

Table 4.1: Comparative analysis of growth performance and protein expression

Parameters 250 ml flask 5 l bioreactor

Medium Volume 50 ml 2.5 l

Inoculum Weight (g) 0.18 10.0

Final fresh weight (g) 5.32 493.6

Biomass yield (g/l) 102.4 108

RGP RTB (% expression) 7.3 7.54

Comparative analysis of growth performance and protein expression of selected

hairy root clone H03 that cultivated under shake flask and bioreactor conditions for

21 days.

(B)

(A)

Figure 4.15: Cartoon representation of both CTB-RGP and RGP-RTB fusion

proteins.

(A) Tertiary structure of CTB-RGP shows topology composed of N-

terminally attached Cholera toxin B Chain (Blue) with Rabies

glycoprotein (Green) using GlyProGlyPro linker.

(B) Tertiary structure of RGP-RTB shows topology composed of C-

terminally attached Ricin B Chain (Blue) with Rabies

glycoprotein (Green) using GlyProGlyPro linker (Red).

(A)

(B)

Figure 4.16: Ramachandran Plot of Phi (ψ) and Sci (ϕ) of both the

fusion proteins. (A) CTB-RGP, (B) RGP-RTB.

(A)

(B)

Figure 4.17: Superimposition studies of overall cartoon structure of both the

fusion proteins.

(A) Tertiary structure of Cholera toxin B Chain and Rabies

glycoprotein shown in Blue and Green in fusion protein CTB-

RGP while superimposed CTB and RGP of PDB database shown

in Green and pink colours, respectively.

(B) Tertiary structure of Ricin toxin B Chain and Rabies glycoprotein

shown in Orange and Green in fusion protein RGP-RTB while

superimposed RTB and RGP of PDB database shown in Sky Blue

and Blue colours, respectively.

Observations

58

between CTB-RGP and RGP-RTB fusion proteins had somewhat similar confirmation

(Figure 4.18) and showed very little variation (RMS 4.89).

Different important antigenic epitopes and active sites which are crucial for

structural confirmation and stability of rabies glycoprotein (RGP) are shown in CTB-

RGP and RGP-RTB fusion proteins (Figure 4.19). Hopp-Wood hydrophilicity and

surface exposure plot of CTB-RGP and RGP-RTB proteins (Figure 4.20) showed great

harmony with overall predicted tertiary structure of fusion proteins. K202 is

participating in conformational stability of rabies glycoprotein. Whereas, sites A (32-

42aa), B (198-200aa), C (208-216) and D (286-306) constitute the antigenic site II

important for the antigenicity of rabies glycoprotein. R333 are syncytium formation site

and form antigenic site III of rabies glycoprotein. These antigenic epitopes are

commonly marked as A (32-42), B (198-200), C (208-216) and D (286-306) sites in

both the fusion proteins in figure 4.19 & 4.20 (Prehaud et al., 1988; Tomar et al., 2011).

Asialofeutin and GM1 mediated direct ELISA with peptidal anti-rabies antibody (Ab2)

which rose against the D epitopic region of rabies glycoprotein complement the result

of in-silico analysis.

Protparam analysis of CTB-RGP and RGP-RTB fusion proteins showed that

isoelectric point (pI) of both the protein was not neutral (7.28 and 6.68, respectively),

they could not precipitate in alkaline solution of pH8.0 or above. However, RGP-RTB

has negatively charged than neutral CTB-RGP fusion, hence immunogenicity of RGP-

RTB was likely to be more which has also seen in the results of animal experiment

(Table 4.2). Half-life of both the fusion protein as predicted by protparam is 30 hours

in human blood (Table 4.2).

Figure 4.18: Super imposition of the cartoon structures of rabies glycoprotein

from both the fusion protein, CTB-RGP (Yellow) and RGP-RTB

(Blue) together to asses any overall change in the structure of

protein .

R333 K202

(B)

(A)

Site C Site D Site A Site B

Figure 4.19: Surface representation of antigenic sites of RGP on both CTB-RGP

(A) and RGP-RTB (B) fusion proteins. Conformationally important

sites K202 and R333 of RGP shows in Hot Pink (A)/ Yellow color

(B) and Brown (A)/ Orange (B) color, respectively. Whereas

important antigenic sites A (34-42aa), site B (198-200aa), site C

(208-216aa) and D (286-306aa) represents as Red, Blue, Raspberry

Red and Cyan color, respectively.

A B C D

A B C D

(A)

(B)

Figure 4.20: Hopp-Wood (HW) and Surface Exposure (SE) plots for CTB-

RGP and RGP-RTB fusion proteins. A (32-42), B (198-200),

C (208-216) and D (286-306) represent potent antigenic sites

as described by other research groups.

Table 4.2: Comparative analysis of CTB-RGP and RGP-RTB fusion proteins

by ProtParam software

S.

No. Different Fields

Fusion Protein

CTB-RGP RGP-RTB

1. Number of atoms 9992 11355

2. Formula C3175H4977N867O938S35 C3607H5637N997O1076S38

3. Molecular weight 71424.7 81403.7

4. Number of amino acid 639 731

5. Theoretical pI 7.28 6.68

6.

Number of negatively

charged residues

(Asp + Glu)

70 74

7.

Number of positively

charged residues

(Arg + Lys)

70 71

8. Extinction

coefficient

Assuming all

pairs of Cys

residues form

cystines

87415 130635

Abs. of 0.1%

(=1g/l) 1.224 1.605

9.

Estimated half-life in

mammalian reticulocytes

(in vitro)

30 hours 30 hours

10. Aliphatic index 82.50 84.62

11. Grand average of

hydropathicity (GRAVY) -0.253 -0.247

Chapter 5

Discussion

Discussion

59

5.0 DISCUSSION

Plant-based biopharming is a powerful tool for mass production of recombinant

and industrial proteins. The molecular farming of pharmaceuticals in plants eliminates

the risk of human or animal virus and prion transmission or contamination by harmful

chemically synthesized products or process solvents. Many of the quality control tests

that require animals also can be eliminated (Joshi and Lopez, 2005). It has already been

shown by various authors that genes encoding antigens of bacterial and viral pathogens

can be expressed in plants in a form at which they retain their native immunogenic

properties. Plants acting as a source of vaccines would offer the advantage of

inexpensive production of the vaccines which could be made easily available to

developing countries (Ma JK-C et al., 2005). Advances in molecular biology of

diseases have identified many candidate proteins or peptides that may function as

effective subunit vaccines however their availability in biologically functional form and

at an affordable cost still remains a challenge.

Rabies virus genome encodes five major proteins- nucleoprotein -N,

phosphoprotein -P, matrix protein -M, glycoprotein -G and RNA-dependent RNA

polymerase -L (Coslett et al., 1980; Conzelmann et al., 1990). The rabies glycoprotein

(G) plays an important role in viral pathogenesis and functions as a protective antigen

(Wiktor et al., 1973). The G protein is a trans-membrane protein that forms the spikes

of the virus, induces virus neutralizing antibodies (VNA) and gives protection against

intra-cerebral challenge. Rabies glycoprotein (G-protein) also induces the production of

T-helper (Th) and cytotoxic T-cells (CTL). The three dimensional structure of G

protein molecule is critical for both virus neutralizing antibody induction and protection

against the rabies.

Several approaches have been suggested for the preparation of rabies subunit

vaccine. The rabies glycoprotein expressed by baculo virus vectors gives protection

against GT1 (CVS G protein), and GT3 (Mok G protein). However, entire cells were

used for injection and this approach would be of limited use for parenteral vaccination

(Prehaud et al., 1989). Other alternate like, recombinant vaccinia virus (Rupprecht et

al., 1986), adenovirus (Prevec et al., 1990) and animal cell lines are also considered as

less desirable for developing human rabies vaccines because of safety concerns.

However, rabies glycoprotein fairly produced in E. coli, shown immunogenicity (Singh

Discussion

60

et al., 2012) but lacks immuno-protection activity probably due to the absence of

appropriate post-translational modifications (Yelverton et al., 1983; Lathe et al., 1984).

On the other hand, yeast eukaryotic system was also used for producing the viral

antigen because of its ability to produce the glycosylated form of proteins. But it gives

protection only against intramuscular and not intra-cerebral virus challenge due to

differences in yeast based glycosylation (Klepfer et al., 1993). Glycosylation of rabies

glycoprotein plays important role in their conformation and also their immunogenic

property. The extracellular domain of rabies virus glycoprotein have three important N-

glycosylation sequins at Asn37, Asn247 and Asn319 out of which N-glycans of

Asn319 is mainly responsible for conformationally relevant form of the glycoprotein

(Wojczyk et al., 1998). The glycosylation of Asn319 is critical in stabilizing the local

confirmation of region as it contains syncytium formation sites at Asn333 (Seif et al.,

1985; Tuffereau et al., 1989) and the putative leucine zipper domain at Asn378-Asn399

responsible oligomerization in ERA strain of the rabies glycoprotein of rabies virus

(Conzelmann et al., 1990), thus allowing proper folding of soluble rabies glycoprotein.

Misfolded and nonglycosylated proteins bind to the grp78/BiP chaperon which can

prevent secretion or cell surface expression and lead to the intracellular proteolysis of

rabies glycoprotein (Wojczyk et al.,1998; Hurtley et al.,1989). Glycosylation of the

RGP is required for immuno-protection by the rabies vaccines (Foley et al., 2000). The

least expensive rabies vaccine used in developing countries is prepared from animal

brain which gives undesirable reactions or consequences in some cases and is not

affordable by the poorest. This has hampered the mass immunization program against

rabies. Hence, affordable and safe rabies vaccines are always needed.

Among plant-based systems, the expression of rabies glycoprotein (RGP) has

been reported in transgenic tomato (McGarvey et al., 1995). However, the expression

level was very low and immuno-protective ability was not examined. Rabies virus

surface glycoprotein gene (rgp) had earlier been engineered and transformed in tobacco

plants in our laboratory which gave complete protection to the mice against the live

virus challenge and led the foundation for the development of plant based rabies

vaccine (Ashraf et al., 2005). Since the expression was low and an alternative method

was required to produce functionally active form of protein (glycosylated RGP) in

sufficient quantity from plant. This creates major constraint for using plant as


Discussion

61

bioreactor. One of the most important factors governing the yield of recombinant

proteins is sub-cellular targeting, which affects the interlinked processes of folding,

assembly and post-translational modification. The oxidizing environment of the

endoplasmic reticulum, the lack of proteases and the abundance of molecular

chaperones are important factors for correct protein folding and assembly. Also, protein

glycosylation occurs only in the endoplasmic membrane system and this modification is

required for correct function of many proteins. In the absence of further targeting

information, proteins in the endoplasmic membrane system are secreted to the apoplast,

where they might be retained or secreted into the external environment. The protein is

retained in the ER lumen using an H/KDEL C-terminal tetra-peptide tag, as this

compartment has a stabilizing influence. Retention of proteins in endoplasmic

reticulum cause increase in expression and immunogenicity of glycosylated rabies

glycoprotein (Yadav et al., 2013).

Arango et al. (2008) reported CaMV35S promoter regulated rabies N protein

antigen expression in tomato plants and performed mice immuno-protection assay.

Only intra peritoneal immunized mice showed weak protection against virus challenge

while the orally immunized mice were not protected. This suggested that the lack of

mucosal adjuvant in oral administration of antigen as the possible reason for diminished

immune response. Thus, the development of appropriate formulations for rapid

absorption through buccal mucosa is needed for mucosal vaccination. The

term mucosal vaccination has traditionally been used to describe strategies in which a

vaccine is administered via the mucosal route. Unlike parenteral vaccination, mucosal

vaccines do not require the use of needles, thus enabling vaccine compliance and

reducing logistical challenges and the risks of acquiring blood borne infections. The

great success of mucosal vaccines such as the polio vaccine which produce effective

elicitation of immunity against pathogens has popularised the concept.

This study is mainly focused on plant produced rabies glycoprotein which

fused with mucosal adjuvants and evaluates their immunogenic property after the N-

and C-terminal fusion of mucosal adjuvants. There are various lectins or lectin-like

proteins which have binding ability to glycolipids or glycoproteins (De Aizpurua and

Russell-Jones, 1988). Many of these proteins have already characterized and used as

mucosal adjuvant which stimulates strong humoral as well as cell-mediated immune

http://www.horizonpress.com/vaccine-design

Discussion

62

responses. Out of which cholera toxin B subunit is one of the most characterized

mucosal adjuvant which provides N-terminal fusion capability with target antigens.

CTB binds to the GM1 receptor in its pentamer confirmation and can serve as a

mucosal adjuvant from very long-time (McKenzie et al., 1984). Efficient binding to

GM1 could potentially increase the uptake of antigen across the mucosa and lead to an

enhanced presentation of the conjugated molecule to the immune system (Holmgren et

al., 1975; Nashar et al., 1996). CTB induces major histocompatibility complex (MHC)

class II expression on B cells (Francis et al., 1992), and also enhances antigen

presentation by macrophages in the absence of enhanced MHC II expression (Nashar et

al., 1996). A number of proteins have been genetically fused to the C-terminus of the

CTB and expressed in different plant tissues in earlier studies. For instance, human

insulin expressed in potato tuber and leaf (Arakawa et al. 1998), rotavirus enterotoxin

protein (NSP4) (Arakawa et al.2001; Kim and Langridge 2003) and anthrax lethal

factor protein (LF) (Kim et al. 2004) in potato tuber, B chain of human insulin (InsB3)

in tobacco leaf (Li et al. 2006) and surface protective antigen (SpaA) of Erysipe-lothrix

rhusiopathiae in tobacco hairy root (Ko et al. 2006). In each case, the fusion protein

retained their functional activity with respect to pentamerization and GM1 binding. The

stable pentamer formation of the CTB-RGP fusion protein in tobacco leaves was

confirmed by Western blot analysis and the expected ~403 kDa (pentamer of ~14.6 kDa

glycosylated CTB + ~66.0 kDa glycosylated RGP) band (figure 4.12A) was observed.

The expression of CTB-RGP protein in different transgenic plants showed wide

variation, i.e. 0.002–0.4% of TSP in leaf (figure 4.10A). This is consistent with the

direct GM1 ELISA result which done by both the antibodies Ab1 and Ab2 (figure

4.9A). The variation in expression is probably due to position effect in which

integration of the transgene occur at different positions in the genome of independent

transgenic lines (Peach and Velten, 1991). The ability of CTB-RGP fusion protein to

induce immune system through mucosal route is validated by immunization experiment

(figure 4.14).

Similarly, ricin B chain was also used here for the C- terminal fusion partner for

RGP which could facilitate its purification and its application as an oral vaccine. RTB

works as mucosal adjuvant and binds to lactose receptors that are present on mucosal

lining of gut epithelium (Sandvig et. al., 1976). It has been previously demonstrated

Discussion

63

that intranasal administration of a recombinant fusion protein of ricin B chain (RTB)

with NSP4 rotavirus antigen purified from E. coli was highly effective in stimulating

mucosal antibody response in mice (Choi et al., 2006). Interaction between sugar-

binding moieties on the ricin B chain and terminal galactosides located on the

enterocyte membrane facilitates ricin holotoxin uptake by endocytosis into intracellular

vesicles (Lambert et al., 1991). The sugar-binding activity of the Ricin B chain is

largely dependent on one of three lactose-binding sites (Vitetta and Yen, 1990; Sphyris

et al., 1995; Swimmer et al., 1992; Frankel et al., 1996; Steeves et al., 1999). N-

terminus of RTB is located far from the membrane receptor-binding sites than the C-

terminus and that may permit C-terminal fusion with larger antigen molecules without

generating any problems of steric hindrance (Medina-Bolivar et al., 2003). Woffenden

et al. (2008) demonstrated that RTB fused with F1 and V antigens of Yersinia pestis

expressed in tobacco hairy roots has shown potential for protection of animals and

humans against bubonic and pneumonic plague. The small amount of protein required

for internalization and administration of fusion protein also improves the cost efficiency

of the product due to higher number of receptor per cell than GM1.

Asialofeutin and GM1 mediated direct ELISA with two different antibodies,

one is equine derived anti-rabies polyclonal and other is rabbit derived peptidal

antibody for specific immuno protective epitope region of rabies glycoprotein showed

equal competence. Variation in recognition of both the antibodies for CTB-RGP and

RGP-RTB fusion protein can be easily understood by different coverage of epitope

regions which rationalize the deviation and explain the functional validation of this

plant expressed protein to animal immune system.

Fusions of both the mucosal adjuvants with rabies glycoprotein were separated

by two repeats of glycine-proline hinge region which reduced steric hindrance and

helped in independent folding of each subunit of both the fusion proteins (Arakawa et

al., 1998). RTB monomers have the ability to bind its receptors from any of the three

available receptor binding sites which gives more opportunity of internalization through

mucosal lining, subsequently their presentation to immune system being 103

times

higher than conventionally used CTB pentamer fusion systems. However, ~168 kDa

dimerization of RGP-RTB fusion protein exhibits a structural integrity and stability of

RTB (figure 4.12B) which also complements the result of asialofeutin mediated direct

Discussion

64

ELISA (figure 4.9B). RTB presents each molecule of fusion protein to antigen

presenting cell (APC) more readily which also enhances the immune response for

fusion protein than CTB that reflects in the antibody titre assay of the animal

experiment in which IgG1 and IgG2a response is higher in RGP-RTB than CTB-RGP

fusion proteins, however low immune response indicates the need of further

optimization of oral doses with higher concentration (figure 4.14). It could only be

possible by developing technologies like hairy root which can scalable the plant tissues

and produce large quantities of these proteins.

Superimposition of RGP (Figure 4.18) indicated that Gly-Pro hinge plays an

important role in confirmation of both the fusion proteins so that domains of mucosal

adjuvants did not get involved with tertiary folding of rabies glycoproteins. The

important antigenic epitopes and active sites which are crucial for structural

confirmation and stability of rabies glycoprotein (RGP) are shown in CTB-RGP and

RGP-RTB fusion proteins during in-silico analysis (Figure 4.19). Hopp-Wood

hydrophilicity and surface exposure plot of CTB-RGP and RGP-RTB proteins (Figure

4.20) complements the prediction of tertiary structure for both the fusion proteins.

However, Asialofeutin and GM1– receptor mediated direct ELISA with peptidal anti-

rabies antibody (Ab2) which rose against the D epitopic region provides a direct

evidence for in-silico analysis.

For RGP-RTB fusion protein, hairy root culture system was opted over the

transgenic plant leaves due to its ability of expression and accumulation of higher

amount of fusion proteins (figure 4.3B, 4.6), which in turn fulfil our aim to validate

proof of concept and obtaining a continuous biomass through bioreactor for further

experiments. Use of Solanum lycopersicum for production of foreign proteins through

hairy roots cultures in vitro has an advantage that it does not produce any hazardous

alkaloid, unlike tobacco. The possibility of any such alkaloid contamination in oral

application with this chimeric fusion protein is extremely remote. These features may

be helpful in the context of acquiring regulatory approval for proteins produced through

hairy roots of Solanum lycopersicum in future.

A variety of approaches may be used for long term maintenance of transgenic

hairy roots involved in foreign protein production. Maintenance of transgenic plants in

a bio-contained green house or as axenic plantlets in vitro may also represent a feasible,

Discussion

65

cheap and technologically simple way to maintain germplasm for species which readily

regenerate plants from hairy roots (Christey, 2001). Further work has also shown that

hairy roots can also be established from offspring of these transgenic plants (De

Guzman et al., 2011) allowing the possibility of long term storage of therapeutic protein

producing hairy root germplasm in the form of seeds. Use of bioreactor for the

production of secondary metabolites such as gossypol (Verma et al., 2009),

isoflavonoid (Udomsuk et al., 2009) and withanolid (Mirjalili et al., 2009) and

important pharmaceutical proteins like human interferon alpha-2b (Luchakivskaia et al.

2012), P450 (Banerjee et al., 2002), mouse IL-12 (Liu et al., 2009) have successfully

established the utility of this system.

The principle cost of most commercial vaccines is in the form of production,

packaging and delivery. Injectable vaccines incur further expenses related to the use

and disposal of needles and syringes, trained personnel to administer injections, and

refrigeration required during shipping and storage. These factors prevent widespread

vaccination of livestock, poultry and swine against preventable diseases. Producing this

fusion protein in hairy root has shown equal competence to overcome all the above

problems. The RGP-RTB fusion protein expresses up to 1.1 % of TSP (figure 4.10) in

hairy roots which accounts nearly 8 µg of total protein in per gram of tissue,

optimization of air lift bioreactor to produce nearly 108 times of initial biomass of hairy

roots as achieved in the present study is sufficient to furbish future oral immunization

goal against rabies.

A critical review of the published reports indicates that the use of mechanically

agitated reactors with immobilization structures is not useful (Verma et al., 2003). In

this study the immobilization structure had been used to isolate the roots from the

stirrer mechanism in order to avoid shear damage of the roots by direct contact with the

impeller. The use of isolated impeller reactors with the nylon mesh had proved

effective for hairy root clone H03 for better growth, immobilization and uniform

distribution of the root tissues through-out the entire bioreactor vessel. The velocity of

the bulk fluid in the reactor vessel and the penetration of convection currents into the

root mass determine the rate of oxygen and nutrient uptake by hairy roots (Flores and

Curtis, 1992). Optimization of the air flow rate and agitation speed were found critical

for efficiently directing the flow of the media through the compact root tissues due to

Discussion

66

its powerful axially directed volumetric flow and resulted in comparable biomass as in

the shake flask condition. This study once again reiterates the fact that for optimization

of bioreactor performance, the morphological and physiological properties of the

specific hairy root clone of any particular plant system need to be taken into

consideration as these characters strongly influence the final productivities of the

concerned root clone, both in terms of biomass as well as the recombinant protein of

interest.

Chapter 6

Summary and Conclusions


67

6.0 SUMMARY AND CONCLUSIONS

6.1 Summary

Recombinant subunit vaccines are desirable as an alternative with potentially

fewer side effects than delivering the whole organism. Because recombinant subunit

vaccines do not contain an infectious agent, they are safer to administer, prepare and

doses are more uniform. Recombinant vaccines have a potential for being highly

effective in preventing disease, both in humans and animals, but are rather costly to

produce, and therefore are in limited use worldwide. However, the use of plants as

bioreactors is a solution to the current manufacturing bottleneck that is faced by the

pharmaceutical and biotechnology industries. Plants are used as the production units

(i.e. bioreactor, farms or greenhouses) and can be economically expanded or reduced

depending on the demand for a specific plant-derived drug. Rabies is an acute

contagious infection of the central nervous system caused by rabies virus.

Approximately 60,000 human deaths occur worldwide annually from rabies (Meslin

and Stohr, 1997). Plant produced recombinant subunit vaccine of rabies glycoproteins

has shown remarkable promise in protecting animals against rabies, but has lesser

expression and insufficient for purification and mass immunization task for animals and

humans. Contamination like plant pigments and low expression are the major limiting

factors for producing pharmaceutical proteins in plants. This could be avoided by oral

immunization of plant produced vaccines antigens with mucosal adjuvants.


glycolipids or glycoprotein. Many of these lectins have already been characterized and

used as mucosal adjuvant which stimulate strong humoral as well as cell-mediated

immune responses. We utilize these lectins for administration of rabies antigen orally to

avoid near homogeneity purification and to enhance immunogenic property of rabies

antigen. It was previously shown that intranasal administration of an antigen which

fused with the mucosal adjuvant and derived from transgenic plants were found highly

effective in stimulating a mucosal antibody response in mice. We have employed

strategies like N- or C- terminal genetically fused adjuvant to rabies glycoprotein for

the assessment of their role in immunization efficacy and internalization ability.

The pentameric B subunit of cholera toxin (CTB) is an efficient N-terminal

mucosal adjuvant for vaccines antigen. We report the expression of a chimeric protein


68

comprising the synthetic cholera toxin B subunit fused at its C-terminal with rabies

surface glycoprotein (G protein) in tobacco plants. The ~80.3 kDa fusion polypeptide

expressed at 0.4% of the total soluble protein in leaves of the selected transgenic lines.

The fusion protein formed a ~403 kDa pentameric protein which was functionally

active in binding to GM1 receptor. The plant-made protein had a higher affinity for

GM1 receptor than the native bacterial CTB. The pentameric fusion protein was

recognized by the anti-rabies antibodies.

Similarly CTB, RTB act as C-terminal mucosal adjuvant and more efficiently

binds to its asialofeutin receptor. However, transgenic tobacco and hairy roots of

Solanum lycopersicum are generated to express a recombinant protein containing a

fusion of rabies glycoprotein and ricin toxin B chain (rgp-rtxB) antigen under the

control of constitutive CaMV35S promoter. Expression of RGP-RTB fusion protein in

transgenic tomato hairy roots is more than the leaves of transgenic tobacco for the same

construct. Hairy root culture shows higher expression and accumulation of RGP-RTB

fusion proteins. Asialofetuin mediated direct ELISA of transgenic hairy root extracts is

performed by using polyclonal anti-rabies glycoprotein (ab1) antibodies and epitope

specific peptidal anti- rabies glycoprotein (ab2) antibodies confirmed expression of

functionally viable RGP-RTB fusion protein. ELISA based on asialofeutin binding

activity was used to screen crude hairy root protein extracts from five transgenic lines.

Expressions of RGP-RTB fusion protein in different tomato hairy root lines vary

between 1.4 to 8µg in per gram of tissue. Immuno blotting assay from hairy root lines

detected ~84kDa protein on denaturing gel which is as per the predicted size of RGP-

RTB fusion protein monomer and ~168kDa protein dimer was also detected on a native

gel. Out of five, one line H03 showed highest level of RGP-RTB protein expression.

Regeneration of tomato hairy roots line H03 is readily achieved and used further in

bench top bioreactor for further optimization and scale up process to produce large

quantities of recombinant proteins. Bioreactor grown hairy roots showed similar growth

pattern and total protein content as in the shake flask grown hairy root. Large quantities

of fusion proteins will be needed to initialize for intranasal immunization of animal

experiment and further evaluation of this recombinant protein for use as oral vaccine.

The important antigenic epitopes and active sites which are crucial for structural

confirmation and stability of rabies glycoprotein (RGP) were studied in CTB-RGP and


69

RGP-RTB fusion proteins during in-silico analysis which showed equal competence for

stability and immunogenicity of predicted tertiary structure for both the fusion proteins.

Primary immunization experiment induces less immune response probably due to the

quantitatively less oral doses but both the fusion protein remarkably induce Th1 and

Th2 responses, even in the lower administered doses. So detailed immunization

experiment should be performed after scaling up our system which may lead to the

foundation of commercialization and mass immunization aspect. Hence, this study is a

first step towards an improved oral vaccine and provides proof of concept for oral

immunization against rabies.

We have not only successfully employed strategies like N- or C- terminal

genetically fusion of adjuvants to rabies glycoprotein but have also scale them up to

perform animal experiment for fulfillment of commercialization aspect. Compared to

traditional vaccines, oral vaccines offer simplicity of use, lower cost, convenient

storage, economic delivery and mucosal immune response. This study can solve the

challenge of rabies prevention by establishment of low-cost alternatives for effective

oral vaccine that provides lasting protection after immunization and is conveniently or

readily available for frequent administration to regions where rabies is endemic.


70

6.2 Conclusions

1. Oral vaccines expressed in plant can offer simplicity of use, lower cost,

convenient to store and give systemic immune response.

2. It can also provide needle-free vaccination and economical delivery system

against rabies.

3. RGP maintained their conformational epitopes and are immunogenically active

in both the fusion proteins.

4. Mucosal adjuvants in both CTB-RGP and RGP-RTB fusion protein attain their

native structure and stably bind to its receptors.

5. Fusion of mucosal adjuvant to rabies glycoprotein enhanced the stability of

expressed vaccine antigens in plant tissues which can be of advantage in

development of formulations for improve immunogenicity and rapid absorption

through mucosal route.

6. RGP-RTB fusion protein induces more immunogenic response than CTB-RGP,

since its monomer has three receptor binding sites and can readily bind to its

receptors.

7. Standardization of dosage for oral vaccination against rabies is needed as plant

produced fusion proteins shows immunogenicity but lower Th responses.

8. The selection of suitable plant tissue for expression and isolation of fusion

protein, ER targeting signal sequence, ER retention sequence, plant preferred

codon usage, protein stabilization, post translational modification etc. will lead

to increase in the accumulation of fusion proteins in plant tissues.

9. Human pathogenic contamination free preparations can be made and used

through oral route. These strategies are more conveniently amenable to

development of GLP and GMP protocols.

10. Expression of RGP-RTB fusion protein in transgenic tomato hairy roots is more

as compared to the leaves of transgenic tobacco for the same construct, probably

due to lower background proteins, pigment concentration and higher growth

rate.

11. Hairy root cultures are genetically stable and show clonal fidelity which in turn

provides stable long term product profile or similar expression.


71

12. Hairy root cultures have greater autonomy for auxin biosynthesis which in turn

gives faster growth rate in comparison to the whole plant.

13. Hairy root cultures have minimum nutritional requirements which reduce the cost

of in-vitro culture practices and give scalability option in fermenter based

systems for industrial application.

14. Issues relating to the ethical, social, biosafety, environmental impact and

RCGM approval which directly or indirectly effect the deployment of

genetically modified plants are very much addressed by using hairy root system.

15. The plant based oral vaccine technology might be first targeted to wild and

domesticated animals to gain experience which in turn will benefit agricultural

productivity and will provide easy vaccination option for farm animals and

poultry.

In view of above, this study checks the efficacy of plant produced rabies

glycoprotein with N- and C-terminally fused mucosal adjuvants and provides relevant

information for developing plant based oral vaccine against rabies.

Bibliography

Bibliography

72

BIBLIOGRAPHY

Ahuja S., Tripathi K.K., Saha S.M. and Saxena S.N. (1983). Epidemiology of

Rabies in India. Proceedings of an international conference on rabies control in

the tropics. Tunis. Oct 3-6, 1983.

Alvarez M.L., Pinyerd H.L., Crisantes J.D., Rigano M.M., Pinkhasov J. and

Walmsley A.M. (2006). Plant-made subunit vaccine against pneumonic and

bubonic plague is orally immunogenic in mice. Vaccine 24: 2477–90.

Anilionis A., Wunner W.H. and Crutis P.J. (1981). Structure of the glycoprotein

gene in rabies virus. Nature 294: 275-278.

Arakawa T., Chong D., Merritt J. and Langridge W. (1997). Expression of cholera

toxin B subunit oligomers in transgenic potato plants. Trans. Res. 6: 403-413.

Arakawa T., Yu J., Chong D.K., Hough J., Engen P.C. and Langridge W.H.

(1998). A plant-based cholera toxin B subunit-insulin fusion protein protects

against the development of autoimmune diabetes. Nat. Biotechnol. 16: 934–938.

Arakawa T., Chong D., Langridge W. (1998a). Efficacy of a food plant based oral

cholera toxin B subunit vaccine. Nat. Biotechnol. 16: 292-297.

Arakawa T., Yu J. and Langridge W.H. (2001). Synthesis of a cholera toxin B

subunit-rotavirus NSP4 fusion protein in potato. Plant Cell Rep. 20: 343–348

Arango I.P., Rubio E.L., Anaya E.R., Flores T.O., de la Vara L.G. and Lim

M.A.G. (2008). Expression of the rabies virus nucleoprotein in plants at high-

levels and evaluation of immune responses in mice. Plant Cell Rep. 27: 677–685

Areas A.P.M., Oliveira M.L.S., Miyaji E.N., Leite L.C.C., Aires K.A., Dias W.O.

and Ho P.L. (2004). Expression and characterization of cholera toxin B-

pneumococcal surface adhesion A fusion protein in Escherichia coli: ability of

CTB-PsA to induce humoral immune response in ice. Biochem. Biophys. Res.

Commun. 321: 192–196

Arlen P.A., Singleton M., Adamovicz J.J., Ding Y., Davoodi-Semiromi A. and

Daniell H. (2008). Effective plague vaccination via oral delivery of plant cells

expressing F1-V antigens in chloroplasts. Infect. Immun. 76: 3640–50.

Bibliography

73

Artois M., Guittre I., Thomas I., Leblois H., Brochier B. and Barrat J. (1992).

Potential pathogenicity for rodents of vaccines intended for oral vaccination

against rabies: a comparison. Vaccine 10: 524-528.

Ashraf S., Singh P.K., Yadav D.K., Shahnawaz M., Mishra S., Sawant S.V. and

Tuli R. (2005). High level expression of surface glycoprotein in tobacco and its

immuno-protective activity in mice. J. Biotechnol. 119: 1-14.

Athmaram T.N., Bali G. and Devaiah K.M. (2006). Integration and expression of

Bluetongue VP2 gene in somatic embryos of peanut through particle

bombardment method. Vaccine 24: 2994–00.

Aziz M.A., Singh S., Kumar P.A., Bhatnagar R. (2002). Expression of protective

antigen in transgenic plants: a step towards edible vaccine against anthrax.

Biochem. Biophys. Res. Commun. 299: 345–51.

Badrane H., Bahloul C., Perrin P. and Tordo N. (2001). Evidence of two Lyssavirus

phylogroups with distinct pathogenicity and immunogenicity. J. Virology 75:

3268-3276.

Baer G., Shaddock J., Levy H. and Johnston P. (1988). Interferon in post-exposure

prophylaxis. In “Progress in rabies control” (Traenhart O., Koprowski H., Bogel

K. and Sureau, P. Eds), Wells Medical: 245-250.

Baer G.M. and Lentz T.L. (1991). Rabies Pathogenesis to the central nervous system.

In: The Natural History of Rabies Ed: Baer G.M., Boca Raton F.L CRC Press:

105-120.

Bahloul C., Ahmed S.B.H., B’ chir B.I., Kharmachi H., Hayouni E.A. and Dellagi

K. (2003). Post exposure therapy in mice against experimental rabies: a single

injection of DNA vaccine is as effective as five injections of cell culture-derived

vaccine. Vaccine 22: 177-184.

Bahloul C., Jacob Y., Tordo N. and Perrin P. (1997). DNA-based immunization for

exploring the enlargement of immunological cross-reactivity against the

lyssaviruses. Vaccine 16: 417-425.

Bibliography

74

Bai X., Warner C.K. and Fekadu M. (1993). Comparisons of nucleotide and deduced

amino acid sequences of the glycoprotein genes of a Chinese street strain

(CGX89-J) and a Chinese vaccine strain (3a G) of rabies virus. Virus Res. 27:

101-112.

Bailey M.J., Mcleod D.A., Kang C.-Y., Bishop D.H.L. (1989). Glycosylation is not

required for the fusion activity of the G protein of vesicular stomatitis virus in

insect cells. Virology 169: 323-331.

Banerjee S., Shang T.Q., Wilson A.M., Moore A.L., Strand S.E., Gordon M.P. and

Doty S.L. (2002). Expression of functional mammalian P450 2E1 in hairy root

cultures. Biotechnol. Bioengin. 77: 462–466.

Baumann O., Walz B., Somlyo A.V. and Somlyo A.P. (1991). Electron probe

microanalysis of calcium release and magnesium uptake by endoplasmic

reticulum in bee photorceptors. Proc. Natl. Acad. Sci. U.S.A. 88: 741-744.

Benmansour A., Leblois H., Coulon P., Tuffereau C., Gaudin Y., Flamand A. and

Lafay F. (1991). Antigenicity of rabies virus glycoprotein. J. Virol. 65: 4198-

4203.

Bergmann J.E., Tokuyasu K.T. and Singer S.J. (1981). Passage of an integral

membrane protein, the vesicular stomatitis virus glycoprotein, through the Golgi

apparatus en route to the plasma membrane. Proc. Natl. Acad. Sci., USA. 78:

1746-1750.

Bernnan F.R., Jones T.D., Gilleland L.B., Bellaby T., Xu F., North P.C.,

Thompson A., Staczek J. and Lin T. Johnson J.E. (1999). Pseudomonas

aeroginosa outer–membrane protein F epitopes are highly immunogenic in mice

when expressed on a plant virus. Microbiol. 145: 211-220.

Biemelt S., Sonnewald U., Galmbacher P., Willmitzer L., Müller M. (2003).

Production of human papillomavirus type 16 virus-like particles in transgenic

plants. J. Virol. 77: 9211–20.

Bourhy H., Kissi B. and Tordo N. (1993). Molecular diversity of the Lyssavirus

genus. Virology 194: 70-81.

Bibliography

75

Bourhy H., Kissi B., Audry L. and Smreczak M. (1999). Ecology and evolution of

rabies virus in Europe. Journal of General Virology 80: 2545-2557.

Bourhy H., Kissi B., Lafon M., Sacramento D. and Tordo N. (1992). Antigenic and

molecular characterization of bat rabies virus in Europe. J. Clin. Microbiol. 30:

2419-2426.

Broughan J.H. and Wunner W.H. (1995). Characterization of protein involvement in

rabies virus binding to BHK-21 cells. Arch. Virol. 140: 75-93.

Bunschoten H., Gor M., Claassen I.J.T.M., Uytedehaag F.G.C.M., Dietzschold B.,

Wunner W.H. and Osterhaus A.D.M.E. (1989). Characterization of a new

virus-neutralizing epitope that denotes a sequential determinant on the rabies

virus glycoprotein. Journal of General Virology 70: 291-298.

Burger S.R., Remaley A.T., Danley J.M., Moore J., Muschel R.J., Wunner W.H.

and Spitalnik S.L. (1991). Stable expression of rabies virus glycoprotein in

Chinese hamster ovary cells. Journal of General Virology 72: 359-367.

Burrage T.G., Tiqnor G.H. and Smith A.L. (1985). Rabies virus binding at

neuromuscular junctions. Virus Res. 2: 273-289.

Cadoz M., Strady A., Meignier B., Taylor J., Tartaglia J., Paoletti E. and Plotkin

S. (1992). Immunisation with canarypox virus expressing rabies glycoprotein.

The Lancet 339: 1429-1432.

Cangelosi G.A., Best E.A., Martinetti G. and Nester E.W. (1991). Genetic analysis

of Agrobacterium. Methods Enzymol. 204: 384-97.

Carrillo C., Wigdorovitz A., Oliveros J.C., Zamorano P.I., Sadir A.M. and Gomez

N. (1998). Protective immune response to foot-and-mouth disease virus with VP1

expressed in transgenic plants. J. Virol. 72: 1688–90.

Carrillo C.,Wigdorovitz A., Trono K., Dus Santos M.J., Castañón S. and Sadir

A.M. (2001). Induction of a virus-specific antibody response to foot and mouth

disease virus using the structural protein VP1 expressed in transgenic potato

plants. Viral Immunol. 14:49–57.

http://www.ncbi.nlm.nih.gov/pubmed/1658565


Bibliography

76

Castañón S., Marín M.S., Martín-Alonso J.M., Boga J.A., Casais R., Humara J.M.

and Ordás R.J. (1999). Immunization with potato plants expressing VP60

protein protects against rabbit hemorrhagic disease virus. J. Virol. 73: 4452–5.

Castañón S., Martín-Alonso J.M., Marín M.S., Boga J.A., Alonso P. and Parra F.

(2002). The effect of the promoter on expression of VP60 gene from rabbit

hemorrhagic disease virus in potato plants. Plant Sci. 162:87–95.

Ceccaldi P.E., Gillet J.P. and Tsiang H. (1989). Inhibition of the transport of rabies

virus in the central nervous system. J. Neuropathol. Exp. Neurol. 48: 620-630.

Celis E., Ou D.W., Dietzschold B. and Koprowski H. (1988). Recognition of rabies

and rabies-related viruses by T cells derived from human vaccine recipients. J.

Virol. 62: 3128-3134.

Celis E., Ou D., Dietzschold B., Otvos L. and Koprowski H. (1989). Rabies virus

specific T cell hybridomas: identification of class II MHC-Restricted T-cell

epitopes using synthetic peptides. Hybridoma 8: 263-275.

Charlton K.M. (1994). The pathogenesis of rabies and other lyssaviral infections:

recent studies. In: “Lyssaviruses”, Ruprecht C.E., Dietzschold B. and Koprowski

H.( Eds), Springer- Verlag, Berlin, Heidelberg, New York. 95-120.

Charlton K.M. and Casey G.A. (1979). Experimental rabies in skunks. Immuno-

fluorescence light and electron microscopic studies. Lab. Inves. 41: 36-44.

Charlton K.M., Nadin-Davis S., Casey G.A. and Wandeler A.I. (1997). The long

incubation period in rabies: Delayed progression of infection in muscle at the site

of exposure. Acta. Neuropathol. 94: 73-77.

Chazaud B., Muriel M.P., Wantyghem J., Aubery M. and Decastel M. (1995).

Ricin toxicity and intracellular routing in tumoral HT-29 cells. Exp. Cell. Res.

221: 214–220.

Chenik M., Chebli K., Gaudin Y. and Blondel D. (1994). In vivo interaction of

rabies virus phosphoprotein (P) and nucleoprotein (N): existence of two N-

binding sites on P protein. Journal of General Virology. 75: 2889-2896.

http://www.ncbi.nlm.nih.gov/pubmed?term=Wantyghem%20J%5BAuthor%5D&cauthor=true&cauthor_uid=7589248

http://www.ncbi.nlm.nih.gov/pubmed?term=Aubery%20M%5BAuthor%5D&cauthor=true&cauthor_uid=7589248

http://www.ncbi.nlm.nih.gov/pubmed?term=Decastel%20M%5BAuthor%5D&cauthor=true&cauthor_uid=7589248

Bibliography

77

Chikwamba R., Cunnick J., Hathaway D., McMurray J., Mason H. and Wang

K.A. (2002). Functional antigen in a practical crop: LT-B producing maize

protects mice against Escherichia coli heat labile enterotoxin (LT) and cholera

toxin (CT). Transgenic Res. 11: 479 93.

Childs J.E., Cums A.T. and Dey M.E. (2000). Predicting the local dynamics of

epizootic rabies among raccoons in the United States. Proc. Natl. Acad. Sci.,

U.S.A. 97: 13666-13671.

Choi N.W., Estes M.K. and Langridge W.H. (2006). Mucosal immunization with a

ricin toxin B subunit-rotavirus NSP4 fusion protein stimulates a Th1 lymphocyte

response. J. Biotechnol. 121: 272-83.

Christey M.C. (2001). Transgenic crop plants using Agrobacterium rhizogenes

mediated transformation. In: Doran P.M. (Ed.), Hairy roots: culture and

application. Amsterdam: Harwood Academic. 99-111.

Clague M.J., Schoch C., Zech L. and Bluementhal R. (1990). Gating kinetics of pH-

activated membrane fusion of vesicular stomatitis virus with cells: stopped-flow

measurements by sequencing of octadecylrhodamine fluorescence. Biochem. 29:

1303-1308.

Conti C., Superti F. and Tsiang H. (1986). Membrane carbohydrate requirement for

rabies virus binding to chicken embryo related cells. Intervirol. 26: 164-168.

Conzelmann K.K., Cox J.H., Schneider L.G. and Thiel H.I. (1990). Molecular

cloning and complete nucleotide sequence of attenuated rabies virus SAD B19.

Virology 75: 485-499.

Coslett D.G., Hollow B.P., Obijeski J.K. (1980). The structural proteins of rabies

virus and evidence for their synthesis from separate monocistronic RNA species.

J. Gen. Virol. 49: 161–180.

Coulon P., Derbin C., Kucera P., Lafay F., Prehaud C. and Flamand A. (1989).

Invasion of the peripheral nervous systems of adult mice by the CVS strain of

rabies virus and its avirulent derivative Av 01. J. Virol. 63: 3550-3554.

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Choi%20NW%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Estes%20MK%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Langridge%20WH%22%5BAuthor%5D


Bibliography

78

Coulon P., Ternaux J.P., Flamand A. and Tuffereau C. (1998). An avirulent mutant

of rabies virus is unable to infect motoneurons in vivo and in vitro. J. Virol. 72:

273-278.

Cox J., Dietschold B. and Schneider L. (1977). Rabies virus glycoprotein: Biological

and serological characterization. Infect. Immun. 16: 754 -759.

Cox J., Dietzschold B., Weiland F. and Scheider L. (1980). Preparation and

characterization of rabies virus hemagglutinin. Infect. Immun. 30: 572-577.

Cox J.H., Dietzschold B. and Schneider L.G. (1977). Rabies virus glycoprotein II:

Biological and serological characterization. Infect. Immun. 16: 754–759.

Crick J. and King A. (1988). Culture of rabies virus in vitro. In: Rabies. Eds:

Campbell J.B. and Charlton K.M., Boston, Kluwer Academic. 47-66.

Cruz F.W., McBride A.J.A., Conceicao F.R., Dale J.W., McFadden J. and

Dellagostin O.A. (2002). Expression of the B-cell and T-cell epitopes of the

rabies virus nucleoprotein in Mycobacterium bovis BCG and induction of a

humoral response in mice. Vaccine 20: 731-736.

Curtiss R. and Cardineau G.A. (1990). Oral immunization by transgenic plants. World

Patent Application. WO 90/02484.

Curtiss R. and Cardineau G.A. (1997). Oral immunization by transgenic plants. US

Patent. 5: 686-079.

Da Silva J.V., Garcia A.B., Flores V.M.Q., de Macedo Z.S. and Medina-Acosta E.

(2002). Phytosecretion of enteropathogenic Escherichia coli pilin subunit A in

transgenic tobacco and its suitability for early life vaccinology. Vaccine 20:

2091–101.

Dalsgaard K., Uttenthal A., Jones T.D., Xu F., Merryweather A., Hamilton W.D.,

Langeveld J.P., Boshwizen R.S., Kamstrup S., Lomonossoff G.P., Porta C.,

Vela C., Casal J.L., Meloen R.H. and Rodgers P.B. (1997). Plant derived

vaccine protects target animals against a viral disease. Nat. Biotech. 15: 248-252.

Bibliography

79

Daniell H., Streatfield S.J. and Wycoft K. (2001). Medical molecular farming

production of antibodies, biopharmaceuticals and edible vaccines in plants.

Trends plant Sci. 6: 219-226.

David D., Yakobson B., Smith J.S. and Stram Y. (2000). Molecular epidemiology of

rabies virus isolates from Israel and other middle and near-eastern countries. J.

Clinical Microbiol. 38: 755-762.

De Guzman G., Walmsley A.M., Webster D.E. and Hamill J.D. (2011). Hairy roots

cultures from different Solanaceous species have varying capacities to produce E.

coli B-subunit heat-labile toxin antigen. Biotechnol. Lett. 33: 2495-502.

De Mattos C.A., De Mattos C.C., Smith J.S., Miller E.T., Papo S., Utrera A. and

Osburn B.I. (1996). Genetic characterization of rabies field isolates from

Venezuela. J. Clinical. Microbiol. 34: 1553-1558.

De Aizpurua H.J. and Russell-Jones G.J. (1988). Oral vaccination: Identification of

classes of proteins that provoke an immune response upon oral feeding. J. Exp.

Med. 167: 440-51.

Dean D.J., Ablesetg M.K. and Atanasiu P. (1996). The fluorescent antibody test. In:

Laboratory Techniques in Rabies. Meslin F.X., Kaplan M.M. and Koprowski H.

(Eds.) Geneva, WHO. 88-95.

Delagneau J.F., Perrin P. and Atanasiu P. (1981). Structure of the rabies virus:

spatial relationships of the proteins G, M1, M2 and N. Ann. Virol. Inst. Pasteur

132: 473-493.

Dietzschold B., Wiktor T.J., Macfarlan R. and Varrichio A. (1982). Antigenic

structure of rabies virus glycoprotein: ordering and immunological

characterisation of large CNBr peptide fragments. J. Virol. 44: 595-602.

Dietzschold B., Wiktor T. J., Wunner W. and Varrichio A. (1983a). Chemical and

immunological analysis of the rabies soluble glycoprotein. Virology 124: 330-

337.

Dietzschold B., Wunner W., Wiktor T. J., Lopes D., Lafon M., Smith C. and

Koprowski H. (1983b). Characterization of an antigenic determinant of the

http://www.ncbi.nlm.nih.gov/pubmed?term=%22De%20Guzman%20G%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Walmsley%20AM%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Webster%20DE%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Hamill%20JD%22%5BAuthor%5D


http://www.ncbi.nlm.nih.gov/pubmed?term=de%20Aizpurua%20HJ%5BAuthor%5D&cauthor=true&cauthor_uid=3346623

http://www.ncbi.nlm.nih.gov/pubmed?term=Russell-Jones%20GJ%5BAuthor%5D&cauthor=true&cauthor_uid=3346623



Bibliography

80

glycoprotein that correlates with pathogenicity of rabies virus. Proc. Natl. Acad.

Sci., U.S.A. 80: 70-74.

Dietzschold B., Wiktor T.J., Trojanowski J.Q., Macfarlan R., Wunner W.H.,

Torres–Anjel M.J. and Koprowski H. (1985). Differences in cell-to-cell spread

of pathogenic and a pathogenic rabies virus in vivo and in vitro. J. Virol. 56: 12-

18.

Dietzschold B., Lafon M., Wang H., Otvos L., Celis E., Wunner W. and

Koprowski H. (1987a). Localization and immunological characterization of

antigenic domains of the rabies virus internal N and Ns proteins. Virus Research

8: 103-125.

Dietzschold B., Wang H., Rupprecht C.E., Celis E., Tollis M., Ertl H., Heber Katz

E. and Koprowski H. (1987b). Induction of protective immunity against rabies

by immunisation with rabies virus ribonucleoprotein. Proc. Natl. Acad. Sci.,

U.S.A. 84: 9165-9169.

Dietzschold B., Gore M., Ertl. H., Celis E., Otvos L. and Koprowski H. (1989).

Analysis of protective immune mechanisms induced by rabies nucleoprotein.

“Genetics and Pathogenicity of negative strand viruses”, In: Mahy B.W.J. and

Kolakofski D. (Eds.), Elsevier Science, New York. 295-309.

Dietzschold B., Gore M., Marchadier D., Niu H.-S., Bunschoten H.M., Otvos L.J.,

Wunner W.H., Ertl H.C.J., Osterhaus A.D.M.E. and Koprowski H. (1990a).

Structural and immunological characterization of a linear virus-neutralizing

epitope of the rabies virus glycoprotein and its possible use in synthetic vaccine.

J. Virol. 64: 3804-3809.

Dietzschold B., Gore M., Casali P., Ueki Y., Rupprecht C., Notkins A. and

Koprowski H. (1990b). Biological characterization of human monoclonal

antibodies to rabies virus. J. Virol. 64: 3087-3090.

Dietzschold B., Rupprecht C.E., Fu Z.F. and Koprowski H. (1996). Rhabdoviruses.

In Fields B.N., Knipe D.M. and Howley P.M. (eds.), Fields Virology III

Lippincott –Raven Press, Philadelphia, PA. 1137-1159.

Bibliography

81

Doms R.W., Lamb R.A., Rose J.K. and Helenius A. (1993). Folding and assembly of

viral membranes proteins. Virology. 193:545-562.

Dong J.L., Liang B.G., Jin Y.S., Zhang W.J., Wang T. (2005). Oral immunization

with pBsVP6-transgenic alfalfa protects mice against rotavirus infection.

Virology 339: 153–63.

Doran P.M. (2000). Foreign protein production in plant tissue cultures. Curr. Opin.

Biotech. 11: 199-204.

During K., Porsch P., Fladung M., Lorz H. (1993). Transgenic potato plants resistant

to the phytopathogenic bacterium Erwinia carotovora. Plant J. 3: 587-598.

Durrani Z., Mclnerney T.L., McLain L., Jones T., Bellaby T., Bernnan F.R. and

Dimmock N.J. (1998). Intranasal immunization with a plant virus expressing a

peptide from HIV-1 gp41 stimulates better musoal and systemic HIV-1 specific

1gA and 1gG than oral immunization. J. Immunol. Method. 220: 93-103.

Durrer P., Gaudin Y., Ruigrok R.W.H., Graf R. and Brunner J. (1995).

Photolabeling identifies a putative fusion domain in the envelope glycoprotein of

rabies and vesicular stomatitis virus. J. Biol. Chem. 270: 17575-17581.

Dus Santos M.J., Wigdorovitz A., Trono K., Rios R.D., Franzone P.M., Gil F.

(2002). A novel methodology to develop a foot and mouth disease virus (FMDV)

peptide-based vaccine in transgenic plants. Vaccine 20: 1141–7.

Ehsani P., Khabiri A. and Domansky N.N. (1997). Polypeptides of hepatitis B

surface antigen produced in transgenic potato. Gene 190: 107–11.

Ellis R.J. and Hemmingsen S.M. (1989). Molecular chaperons: proteins essential for

the biogenesis of some macromolecular structures. Trends Biochem. Sci. 14: 339-

342.

Endo Y. and Tsurugi K. (1988). The RNA N-glycosidase activity of ricin A-chain. J

Biol. Chem. 263: 8735–8739.

Ertl H., Dietzschold B. and Otvos L. (1991). T helper epitope of rabies virus

nucleoprotein defined by tri and tetrapeptides. Eur. J. Immunol. 21:1-10.

Bibliography

106

Rupprecht C.E., Wiktor T.J., Johnston D.M., Hamir A.N., Dietzschold B.,

Wunner W.H., Glickman L.T. and Koprowski H. (1986). Oral immunization

and protection of raccoons (Procyon lotor) with a vaccinia-rabies glycoprotein

recombinant virus vaccine. Proc. Natl. Acad. Sci., U.S.A. 83: 7947-7950.

Sabeta C.T., Bingham J. and Nel L.H. (2003). Molecular epidemology of canid

rabies in Zimbabwe and South Africa. Virus Research 91: 203-211.

Sacramento D., Badrane H., Bourhy H. and Tordo N. (1992). Molecular

epidemiology of rabies virus in France: comparison with vaccine strains. Journal

of General Virology 73: 1149-1158.

Sakamoto S., Ide T., Tokiyoshi S., Nakao J., Hamada F., Yamamoto M., Grosby

J.A., Ni Y. and Kawai A. (1999). Studies on the structures and antigenic

properties of rabies virus glycoprotein analogues produced in yeast cells. Vaccine

17: 205-218.

Sambrook J., Fritsch E.F. and Maniatis T. (1989). Molecular Cloning: A Laboratory

Mannual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.

Schneider L.G., Horzinek M. and Matheka H.D. (1971). Purification of rabies virus

from tissue culture. Arch. Gesamte. Virusforsch. 34: 351-359.

Sandhu J.S., Krasnyanski S.F., Domier L.L., Korban S.S., Osadjan M.D. and

Buetow D.E. (2000). Oral immunization of mice with transgenic tomato fruit

expressing respiratory syncytial virus- F protein induces a systemic immune

response. Transgenic Res. 9: 127–35.

Sandvig K., Olsnes S. and Pihl A. (1976). Kinetics of binding of the toxic abrin and

ricin to surface receptors of human cells. J. Biol. Chem. 251, 3977–3984

Schneider L.G., Dietzschold B., Dierks R.E., Matthaeus W., Enzmann P.J. and

Strohmaier K. (1973). Rabies group- specific ribonucleoprotein antigen and a

test system for grouping and typing of rhabdoviruses. J. Virol. 11: 748-755.

Schneider L.G. and Schoop U. (1972). Pathogenesis of rabies and rabies like viruses.

Ann. Institute Pasteur (Paris). 123: 469-476.

Bibliography

118

Yadav D.K., Ashraf S., Singh P.K. and Tuli R. (2012). Localization of rabies virus

glycoprotein into the endoplasmic reticulum produces immunoprotective antigen.

Protein J. 31: 447-56.

Yang J., Hooper D.C., Wunner W.H., Koprowski H., Dietzschold B. and Fu Z.F.

(1998). The specificity of rabies virus RNA encapsidation by nucleoprotein.

Virology 242: 107-117.

Yang Z.Q., Liu Q.Q., Pan Z.M., Yu H.X. and Jiao X.A. (2007). Expression of the

fusion glycoprotein of Newcastle disease virus in transgenic rice and its

immunogenicity in mice. Vaccine 25: 591-8.

Yang Y., Li X., Yang H., Qian Y., Z hang Y., Fang R. and Chen X. (2011).

Immunogenicity and virus-like particle formation of rotavirus capsid proteins

produced in transgenic plants. Sci. China Life Sci. 54: 82-9.

Yelverton E., Norton S., Obijeski J.F. and Goeddel D.V. (1983). Rabies virus

glycoprotein analogs: biosynthesis in Escherichia coli. Science 219: 614-620.

Youma J.W., Won Y.S., Jeon J.H., Ryu C.J., Choi Y.K. and Kim H.C. (2007). Oral

immunogenicity of potato-derived HBsAg middle protein in BALB/c mice.

Vaccine 25: 577–84.

Youma J.W., Jeon J.H., Kim H., Kim Y.O., Ko K. and Joung H. (2008). Transgenic

tomatoes expressinghuman beta-amyloid for use as a vaccine against Alzheimer's

disease. Biotechnol. Lett. 30: 1839–45.

Young L. and Dong Q. (2004). Two-step total gene synthesis method. Nucleic Acids

Research 32: e59.

Yu J. and Langridge W.H.R. (2001). A plant-based multicomponent vaccine protects

mice from enteric diseases. Nat. Biotechnol. 19: 548–552.

Zhang H., Liu M., Li Y., Zhao Y., He H., Yang G. and Zheng C. (2010). Oral

immunogenicity and protective efficacy in mice of a carrot-derived vaccine

candidate expressing UreB subunit against Helicobacter pylori. Protein Expr.

Purif. 69:127-31.

http://www.ncbi.nlm.nih.gov/pubmed?term=Yadav%20DK%5BAuthor%5D&cauthor=true&cauthor_uid=22592449

http://www.ncbi.nlm.nih.gov/pubmed?term=Ashraf%20S%5BAuthor%5D&cauthor=true&cauthor_uid=22592449

http://www.ncbi.nlm.nih.gov/pubmed?term=Singh%20PK%5BAuthor%5D&cauthor=true&cauthor_uid=22592449

http://www.ncbi.nlm.nih.gov/pubmed?term=Tuli%20R%5BAuthor%5D&cauthor=true&cauthor_uid=22592449





Bibliography

82

Ertl H. and Xiang Z. (1996a). Novel vaccine approaches. J. Immunol. 156: 3579-

3582.

Ertl H.C.J. and Xiang A.Q. (1996b). Genetic Immunization. Viral Immunology 9:1-9.

Falnes P. and Sandvig K. (2000). Penetration of protein toxins into cells. Curr. Opin.

Cell Biol. 12: 407–413.

Farrance C.E., Rhee A., Jones R.M., Musiychuk K., Shamloul M., Sharma S.,

Mett V., Chichester J.A., Streatfield S.J., Roeffen W., van de Vegte-Bolmer

M., Sauerwein R.W., Tsuboi T., Muratova O.V., Wu Y. and Yusibov V.

(2011). A plant-produced Pfs230 vaccine candidate blocks transmission of

Plasmodium falciparum.Clin Vaccine Immunol. 18: 1351-7.

Fekadu M. and Schaddock J.H. (1984). Peripheral distribution of virus in dogs

inoculated with two strains of rabies virus. An. J. Vet. Res. 45: 724-729.

Fekadu M., Sumner J., Shaddock J., Sanderlin D. and Baer G. (1992). Sickness

and recovery of dogs challenged with street rabies virus after vaccination with

vaccinia virus recombinant expressing rabies virus N protein. J. Virol. 66: 2601-

2604.

Fischer R., Drossard J., Commandeur U., Schillberg S. and Emans N. (1999).

Towards molecular farming in the future: moving from diagnostic protein and

antibody production in microbes to plants. Biotechnol. Appl. Biochem. 30: 101-

108.

Flamand A. and Delagneau J.F. (1978). Transcriptional mapping of rabies virus in

vivo. J. Virol. 28: 518-523.

Flamand A., Wiktor T.J. and Koprowski H. (1980). Use of hybridoma monoclonal

antibodies in the detection of antigenic differences between rabies and rabies-

related virus proteins. I. The nucleocapsid protein. J. Gen. Virol. 48: 97-104.

Flamand A., Blancou J., Coulon P.O., Lafay F., Leblois H., Prehaud C. and

Tuffereau C. (1989). The antigenic structure of the rabies glycoproteins.

Application of basic research to oral vaccination of foxes. “New Development in

Rabies control.” WHO, Paris.

http://www.ncbi.nlm.nih.gov/pubmed?term=Flamand%20A%5BAuthor%5D&cauthor=true&cauthor_uid=6155436

http://www.ncbi.nlm.nih.gov/pubmed?term=Wiktor%20TJ%5BAuthor%5D&cauthor=true&cauthor_uid=6155436

http://www.ncbi.nlm.nih.gov/pubmed?term=Koprowski%20H%5BAuthor%5D&cauthor=true&cauthor_uid=6155436


Bibliography

83

Flamand A., Raux H., Gaudin Y. and Ruigrok R.W.H. (1993). Mechanisms of

rabies virus neutalization. Virology 194: 302-313.

Flores H.E. and Curtis W.R. (1992). Approaches to understanding and manipulating

the biosynthetic potential of plant roots. In: Pederson H, Mutharsan R, Di Biasio

D, editors. Biochemical Engineering VII: Cellular and Reaction Engineering.

Ann. N.Y. Acad. of Sci. 665: 188-209.

Floss D.M., Mockey M., Zanello G., Brosson D., Diogon M., Frutos R., Bruel T.,

Rodrigues V., Garzon E., Chevaleyre C., Berri M., Salmon H., Conrad U.

and Dedieu L. (2010). Expression and immunogenicity of the mycobacterial

Ag85B/ESAT-6 antigens produced in transgenic plants by elastin-like peptide

fusion strategy. J. Biomed. Biotechnol. 2010: 274346.

Foley H.D., McGettigan J.P., Siler C.A., Dietzschold B., Schnell M.J. (2000). A

recombinant rabies virus expressing vesicular stomatitis virus glycoprotein fails

to protect againstrabies virus infection. Proc. Natl. Acad. Sci., U. S. A. 97: 14680-

5.

Frankel A.E., Tagge E., Chandler J., Burbage C., Hancock G., Vessel J. and

Willingham M. (1996). Characterization of single site ricin toxin B chain

mutants. Bioconjug. Chem. 7: 30–37.

Frankel A.E., Burbage C., Fu T., Tagge E., Chandler J. and Willingham M.

(1996). Characterization of a ricin fusion toxin targeted to the interleukin-2

receptor. Protein Eng. 9: 913–919.

Fraser G.C., Hooper P.T. and Lunt R.A., Gould A.R., Gleeson L.J., Hyatt A.D.,

Russell G.M., Kattenbelt J.A. (1996). Encephalitis caused by a Lyssavirus in

Fruit bats in Australia. Emorg. Infect. Dis. 2: 327-331.

Fredericksen B. L. and Whitt M.A. (1996). Mutations at two conserved acidic amino

acids in the glycoprotein of vesicular stomatitis virus affect pH-dependent

conformational changes and reduce the pH threshold for membrane fusion.

Virology 217: 49-57.




Bibliography

84

Fu Z. F. (1997). Rabies and rabies research: past, present and future. Vaccine 15: 520-

524.

Fu Z.F., Dietzschold B., Schumacher C.L., Wunner W.H., Ertl H.C.J. and

Koprowski H. (1991). Rabies virus nucleoprotein expressed in and purified from

insect cells is efficacious as a vaccine. Proc. Natl. Acad. Sci., U.S.A. 88: 2001-

2005.

Fujii H., Takita-Sonoda Y., Mifune K., Hirai K., Nishizono A. and Mannen K.

(1994). Protective efficacy in mice of post-exposure vaccination with vaccinia

virus recombinant expressing either rabies virus glycoprotein or nucleoprotein.

Journal of General Virology 75: 1339-1344.

Galbraith D.W., Zeiher C.A., Harkins K.R. and Afonso C.L. (1992). Biosynthesis,

processing and targeting of the G-protein of vesicular stomatitis virus in tobacco

protoplasts. Planta 186:324–36.

Gao Y., Ma Y., Li M., Cheng T., Li S.W. and Zhang J. (2003). Oral immunization of

animals with transgenic cherry tomatillo expressing HBsAg. World J.

Gastroenterol. 9: 996-1002.

Gastka M., Horvath J. and Lentz T.L. (1996). Rabies virus binding to the nicotinic

acetylcholine receptor -subunit demonstrated by the virus overlay protein

binding assay. Journal of General Virology 77: 2437-2440.

Gaudin Y., Ruigrok R.W., Tuffereau C., Knossow M. and Flamand A. (1992).

Rabies virus glycoprotein is a trimer. Virology 187: 627-632.

Gaudin Y., Ruigrok R.W.H., Knossow M. and Flamand A. (1993). Low-pH

conformational changes of rabies virus glycoprotein and their role in membrane

fusion. J. Virol. 67: 1365-1372.

Gaudin Y., Ruigrok R.W.H. and Brunner J. (1995a). Low-pH induced

conformational changes in viral fusion proteins: implications for the fusion

mechanism. Journal of General Virology 76: 1541-1556.

Gaudin Y., Tuffereau C., Durrer P., Flamand A. and Ruigrock R. (1995b).

Biological function of the low-pH, fusion-inactive conformation of rabies virus

Bibliography

85

glycoprotein (G): G is transported in a fusion-inactive state-like conformation. J.

Virol. 69: 5528-5533.

Gaudin Y., Raux H., Flamand A. and Ruigrok R. (1996). Identification of amino

acids controlling the low-pH-induced conformational change of rabies virus

glycoprotein. J. Virol. 70: 7371-7378.

Gaudin Y. (1997). Folding of rabies virus glucoprotein: epitope acquisition and

interaction with endoplasmic reticulum chaperons. J. Virol. 71: 3742-3750.

Gaume A., Komarnytsky S., Borisjuk N. and Raskin I. (2003). Rhizosecretion of

recombinant proteins from plant hairy roots. Plant Cell Rep. 21: 1188–93.

Giddings G., Allison G., Brooks D. and Carter A. (2000). Transgenic plants as

factories for biopharma-ceuticals. Nat. Biotechnol. 18: 1151-1155.

Gil F., Brun A., Wigdorovitz A., Catalá R., Martínez-Torrecuadrada J.L. and

Casal I. (2001). High-yield expression of a viral peptide vaccine in transgenic

plants. FEBS Lett. 488: 13–7.

Gilleland Jr. H.E., Gilleland L.B., Staczek J., Harty R.N., Garcia-Sastre A. and

Palese P. (2000). Chimeric animal and plant viruses expressing epitopes of outer

membrane protein F as a combined vaccine against Pseudomonas aeruginosa lung

infection. FEMS Immunol. Med. Microbiol. 27: 291–7.

Gillet J.P., Derer P. and Tsiang H. (1986). Axonal transport of rabies virus in the

central nervous system of the rat. J. Neuropathol. Exp. Neurol. 45: 619-634.

Goddjin O.J.M. and Pen J. (1995). Plants as bioreactors. TIBTECH. 13: 379-387.

Golovkin M., Spitsin S., Andrianov V., Smirnov Y., Xiao Y. and Pogrebnyak N.

(2007). Smallpox subunit vaccine produced in planta confers protection in mice.

Proc. Natl. Acad. Sci., U.S.A. 104: 6864–9.

Gómez N., Carrillo C., Parra F, Salinas J., Borca M.V., Escribano M. (1998).

Expression of immunogenic glycoprotein S polypeptides from transmissible

gastroenteritis coronavirus in transgenic plants. Virology 249: 352–8.



Bibliography

86

Gómez N, Wigdorovitz A, Castañón S, Gil F, Ordás R. and Borca M.V. (2000).

Oral immunogenicity of the plant derived spike protein from swine-transmissible

gastroenteritis coronavirus. Arch. Virol. 145: 1725–32.

Gonzalez-Rabade N., McGowan E.G., Zhou F., McCabe M.S., Bock R., Dix P.J.,

Gray J.C. and Ma J.K. (2011). Immunogenicity of chloroplast-derived HIV-1

p24 and a p24-Nef fusion protein following subcutaneous and oral administration

in mice. Plant Biotechnol. J. 9: 629-38.

Greco R., Michel M., Guetard D., Cervantes-Gonzalez M., Pelucchi N. and Wain-

Hobson S. (2007). Production of recombinant HIV-1/HBV virus-like particles in

Nicotiana tabacum and Arabidopsis thalianaplants for a bivalent plant-based

vaccine. Vaccine 25: 8228–40.

Halonen P.E., Murphy F.A., Fields B.N. and Reese D.R. (1968). Hemagglutination

of rabies and some other bullet-shaped viruses. Proc. Soc. Exp. Biol. Med. 127:

1037-1042.

Hanham C.A., Zhao F. and Tignor G.H. (1993). Evidence from the anti-idiotypic

network that the acetylcholine receptor is a rabies virus receptor. J. Virol. 67:

530-542.

Hanna J.N., Carney I.K., Smith G.S., Tannenberg A.E., Deverill J.E., Bothat J.A.,

Serafin I.L., Harrower H.J., Fitzipatrick P.F. and Searle J.W. (2000).

Australian bat lyssavirus infection: a second Human case, with a long incubation

period. Medical Journal of Australia 172: 597-599.

Haq T.A., Mason H.S., Clements J.D. and Arntzen C.J. (1995). Oral immunization

with a recombinant bacterial antigen produced in transgenic plants. Science 268:

714-716.

Harlow E. and Lane D. (1988). Antibodies: A Laboratory Manual. Cold Spring

Harbor, NY: Cold Spring Harbor Laboratory Press.

Hashizume F., Hino S., Kakehashi M., Okajima T., Nadano D. and Aoki N. (2008).

Development and evaluation of transgenic rice seeds accumulating a type II-

collagen tolerogenic peptide. Transgenic Res. 17: 1117–29.

Bibliography

87

Haupt W. (1999). Rabies: risk of exposure and current trends in prevention of human

cases. Vaccine 17: 1742-1749.

He Z.M., Jiang X.L., Qi Y. and Luo D.Q. (2008). Assessment of the utility of the

tomato fruit-specific E8 promoter for driving vaccine antigen expression.

Genetica 133: 207–14.

Heijden R.W.J., Langedijk J.P.M., Goren J., Ujtdehaaad F.G.C.M., Meloen R.H.

and Osterhaus A.D.M.E. (1993). Structural and functional studies on a unique

linear neutralizing antigenic site (G5) of the rabies virus glycoprotein. Journal of

General Virology 49: 1539-1545.

Hein M.B., Yeo T., Wang F. and Sturtevant A. (1996). Expression of cholera toxin

subunits in plants. Ann. N.Y. Acad. Sci. 792: 50–6.

Herman R.C., Schubert M., Keene J.D. and Lazzarini R.A. (1980). Polycistronic

vesicular stomatitis virus RNA transcripts. Proc. Natl. Acad. Sci., U.S.A. 77:

4662-4665.

Hernández M., Cabrera-Ponce J.L., Fragoso G., López-Casillas F., Guevara-

García A. and Rosas G. (2007). A new highly effective anti-cysticercosis

vaccine expressed in transgenic papaya. Vaccine 25: 4252–60.

Hiatt A., Cafferkey R. and Bowdish K. (1989). Production of antibodies in transgenic

plants. Nature 342: 76-78.

Hiatt A.C. and Ma J.K.C. (1993). Characterization and applications of antibodies

produced in plants. Int. Rev. Immunol. 10: 139-152.

Holmgren J., Lonnroth I., Mansson J.-E. and Svennerholm L. (1975). Interaction of

cholera toxin and membrane GM1 ganglioside of small intestine. Proc. Natl.

Acad. Sci, U.S.A. 72: 2520–2524.

Hood E.E., Witcher D., Maddock S., Meyer T., Baszezynski C., Bailey M., Flyn P.,

Register J., Marshall L., Bond D., Kulisek E., Kusnadi A., Evangelista R.,

Nikolov Z., Wooge C., Mehigh R., Hennan R., Heman R., Kappel W.,

Ritland D., Li C-P. and Howard J. (1997). Commercial production of avidin

Bibliography

88

from transgenic maize: characterization of transformant, production, processing,

extracting and purification. Mol. Breed. 3: 291-306.

Hoover J.E. and Strick P.L. (1999). The organization of cerebellar and basal ganglia

outputs to primary motor cortex as revealed by retrogade trans neuronal transport

of herpes simplex virus type 1. J. Neuro. Sci. 19: 1446-1468.

Horsch R.B., Fry J.E., Hoffmann N.L., Eicholtz D., Rogers S.G. and Fraley R.T.

(1985). A simple and general method for transferring genes into plants. Science

227: 1229-1231.

Houdebine L.M. (2009). Production of pharmaceutical proteins by transgenic animals.

Comp. Immunol. Microbiol. Infect. Dis. 32: 107–21.

Huang Z., Dry I., Webster D., Strugnell R. and Wesselingh S. (2001). Plant-derived

measles virus hemagglutinin protein induces neutralizing antibodies in mice.

Vaccine 19: 2163–71.

Huang Z., Elkin G., Maloney B.J., Beuhner N., Arntzen C.J. and Thanavala Y.

(2005). Virus-like particle expression and assembly in plants: hepatitis B and

Norwalk viruses. Vaccine 23: 1851–8.

Hurtley S.M., Bole D.G., Hoover L.H., Helenius A. and Copeland C.S. (1989).

Interactions of misfolded influenza virus hemagglutinin with binding protein

(BiP). J. Cell Biol. 108: 2117-26.

Hwang C., Sinskey A.H. and Lodish H.F. (1992). Oxidised redox state of glutathione

in the endoplasmic reticulum. Science 257: 1496-1502.

Ito H., Minamoto N., Watanabe T., Goto H., Luo T.R., Sugiyama M., Kinjo T.,

Mannen K., Mifune K., Konobe T., Yoshida I. and Takamizawa A. (1994). A

unique mutation of glycoprotein gene of the attenuated RC-HL strain of rabies

virus, a seed virus used for production of animal vaccine in Japan. Microbiol.

Immunol. 38: 479-482.

Iwasaki Y. and Clark H.F. (1975). Cell to cell transmission of virus in the central

nervous system II. Experimental rabies in mouse. Lab. Inves. 33: 391-399.

http://www.ncbi.nlm.nih.gov/pubmed?term=Hurtley%20SM%5BAuthor%5D&cauthor=true&cauthor_uid=2738090

http://www.ncbi.nlm.nih.gov/pubmed?term=Bole%20DG%5BAuthor%5D&cauthor=true&cauthor_uid=2738090

http://www.ncbi.nlm.nih.gov/pubmed?term=Hoover-Litty%20H%5BAuthor%5D&cauthor=true&cauthor_uid=2738090

http://www.ncbi.nlm.nih.gov/pubmed?term=Helenius%20A%5BAuthor%5D&cauthor=true&cauthor_uid=2738090

http://www.ncbi.nlm.nih.gov/pubmed?term=Copeland%20CS%5BAuthor%5D&cauthor=true&cauthor_uid=2738090


Bibliography

89

Jackson A.C. and Reimer D.L. (1989). Pathogenesis of experimental rabies in mice:

An immunohistochemical study. Acta. Neuropathol. 78: 159-165.

Jaeger G., Scheffer S., Jacobs A., Zambre M., Zobell O., Goossens A., Depicker A.

and Angenon G. (2002). Boosting heterologous protein production in transgenic

dicotyledonous seeds using Phaseolus vulgaris regulatory sequences. Nat.

Biotechnol. 20: 1265–1268.

Jani D., Meena L.S., Rizwan-ul-Haq Q.M., Singh Y., Sharma A.K., Tyagi A.K.

(2002). Expression of cholera toxin B subunit in transgenic tomato plants.

Transgenic Res. 11: 447–54.

Jani D., Singh N.K., Bhattacharya S., Meena L.S., Singh Y. and Upadhyay S.N.

(2004). Studies on the immunogenic potential of plant-expressed cholera toxin B

subunit. Plant Cell Rep. 22: 471–7.

Jasmin L., Burkey A.R., Card J.P. and Basbaum A.I. (1997). Transneuronal

labeling of a nociceptive pathway, the spino–(trigemino-) parabrachio-

amygdaloid, in the rat. J. Neuro. Sci. 17: 3751-3765.

Jiang X.L., He Z.M., Peng Z.Q., Qi Y., Chen Q. and Yu S.Y. (2007). Cholera toxin

B protein in transgenic tomato fruit induces systemic immune response in mice.

Transgenic Res. 16: 169–75.

Johnson R.T. (1965). Experimental rabies studies of cellular vulnerability and

pathogenesis using fluorescent antibody staining. J. Neuropathol. Exp. Neurol.

24: 662-674.

Joshi L. and Lopez L.C. (2005). Bioprospecting in plants for engineered proteins.

Curr. Opin. Plant Biol. 8: 223-6.

Joung Y.H., Youm J.W., Jeon J.H., Lee B.C., Ryu C.J. and Hong H.J. (2004).

Expression of the hepatitis B surface S and preS2 antigens in tubers of Solanum

tuberosum. Plant Cell Rep. 22: 925–30.

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Joshi%20L%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Lopez%20LC%22%5BAuthor%5D


Bibliography

90

Jul-Larsen A., Madhun A.S., Brokstad K.A., Montomoli E., Yusibov V. and Cox

R.J. (2012). The human potential of a recombinant pandemic influenza vaccine

produced in tobacco plants. Hum. Vaccin. Immunother. 8: 653-61.

Kalbina I., Engstrand L., Andersson S. and Strid A. (2010). Expression of

Helicobacter pylori TonB protein in transgenic Arabidopsis thaliana: toward

production of vaccine antigens in plants. Helicobacter 15:430-7.

Kalbina I., Wallin A., Lindh I., Engström P., Andersson S., Strid K. (2011). A

novel chimeric MOMP antigen expressed in Escherichia coli, Arabidopsis

thaliana, and Daucus carota as a potential Chlamydia trachomatis vaccine

candidate. Protein Expr. Purif. 80: 194-202.

Kang T.J., Han S.C. and Yang M.S. (2005). Expression of the B subunit of E. coli

heat-labile enterotoxin in tobacco using a herbicide resistance gene as a selection

marker. Plant Cell Tissue Organ Cult. 81: 165–74.

Kang T.J., Han S.C., Yang M.S. and Jang Y.S. (2006). Expression of synthetic

neutralizing epitope of porcine epidemic diarrhea virus fused with synthetic B

subunit of Escherichia coli heat-labile enterotoxin in tobacco. Protein Expr.

Purif. 46: 16-22.

Kang T.J., Lee W.S., Choi E.G., Kim J.W., Kim B.G. and Yang M.S. (2006b).

Mass production of somatic embryos expressing Escherichia coli heat-labile

enterotoxin B subunit in Siberian ginseng. J. Biotechnol. 121: 124–33.

Kapusta J., Modelska A., Figlerowicz M., Pniewski T., Letellier M. and Lisowa O.,

(1999). A plant derived edible vaccine against hepatitis B virus. FASEB J.

13: 1796-1799.

Khandelwal A., Sita G.L. and Shaila M.S. (2003). Oral immunization of cattle with

hemagglutinin protein of rinderpest virus expressed in transgenic peanut induces

specific immune responses. Vaccine 21: 3282–9.

Kieny M.P., Lathe R., Drillien R., Spehner D., Skory S., Schmitt D., Wiktor T.,

Koprowski H. and Lecocg J.-P. (1984). Expression of rabies virus glycoprotein

from a recombinant vaccinia virus. Nature 312: 163-166.

http://www.ncbi.nlm.nih.gov/pubmed?term=Kang%20TJ%5BAuthor%5D&cauthor=true&cauthor_uid=16174563

http://www.ncbi.nlm.nih.gov/pubmed?term=Han%20SC%5BAuthor%5D&cauthor=true&cauthor_uid=16174563

http://www.ncbi.nlm.nih.gov/pubmed?term=Yang%20MS%5BAuthor%5D&cauthor=true&cauthor_uid=16174563

http://www.ncbi.nlm.nih.gov/pubmed?term=Jang%20YS%5BAuthor%5D&cauthor=true&cauthor_uid=16174563

Bibliography

91

Kim T.G. and Langridge W.H.R. (2003a). Assembly of cholera toxin B subunit full-

length rotavirus NSP4 fusion protein oligomers in transgenic potato. Plant Cell

Rep. 21: 884–90.

Kim H.S., Euym J.W., Kim M.S., Lee B.C., Inhee M.J. and Jeon J.H. (2003b).

Expression of human amyloid peptide in transgenic potato. Plant Sci. 165: 1445–

51.

Kim T.G., Galloway D.R. and Langridge W.H.R. (2004). Synthesis and assembly of

anthrax lethal factor-cholera toxin B-subunit fusion protein in transgenic potato.

Mol. Biotechnol. 28: 175–183

Kim Y.S., Kang T.J., Jang Y.S. and Yang M.S. (2005). Expression of neutralizing

epitope of porcine epidemic diarrhea virus in potato plants. Plant Cell Tissue

Organ Cult. 82: 125–30.

Kim Y.S., Kim B.G., Kim T.G., Kang T.J. and Yang M.S. (2006). Expression of a

cholera toxin B subunit in transgenic lettuce (Lactuca sativa L.) using

Agrobacterium-mediated transformation system. Plant Cell Tissue Organ Cult.

87: 203–10.

King A. and Crick J. (1988). Rabies–related viruses In “Rabies” (J.B. Compbell and

K.M. Charlton, Eds.) Kluwer Academic Publishers, Boston. 177-199.

Kissi B., Tordo N. and Bourhy H. (1995). Genetic polymorphism in the rabies virus

nucleoprotein gene. Virology 209: 526-537.

Kissling R.E. (1958). Growth of rabies virus in non-nervous tissue culture. Proc. Soc.

Trop. Med. Hyg. 98: 223-225.

Klepfer S.R., Uffelman J., Jacobs P., Bollen A. and Jones E.V. (1993).

Characterization of rabies glycoprotein expressed in yeast. Arch. Virol. 128: 269-

286.

Ko S., Liu J.R., Yamakawa T. and Matsumoto Y. (2006). Expression of the antigen

(SpaA) in transgenic hairy roots of tobacco. Plant Mol. Biol. Rep. 24: 251–251.

Bibliography

92

Kohl T.O., Hitzeroth I.I., Christensen N.D. and Rybicki E.P. (2007). Expression of

HPV-11 L1 protein in transgenic Arabidopsis thaliana and Nicotiana tabacum.

BMC Biotechnol. 7: 56–69.

Komarnytsky S., Gaume A., Garvey A., Borisjuk N. and Raskin I. (2004). A quick

and efficient system for antibiotic-free expression of heterologous genes in

tobacco roots. Plant Cell Rep. 22: 765–73.

Kong Q., Richter L., Yang Y.F., Arntzen C.J., Mason H.S., Thanavala Y. (2001).

Oral immunization with hepatitis B surface antigen expressed in transgenic

plants. Proc. Natl. Acad. Sci., U.S.A. 98: 11539–44.

Koo M., Bendahmane M., Lettieri G.A., Paoletti A.D., Lane T.E., Fitchen J.H.,

Buchmeier M.J. and Beachy R.N. (1999). Protective immunity against murine

hepatitis virus (MHV) induced by intranasal or subcutaneous administration of

hybrids of tobacco mosaic virus that carries an MHV epitope. Proc. Natl. Acad.

Sci., U.S.A. 96: 7774-7779.

Koprowski H. (2005). Vaccines and sera through plant biotechnology. Vaccine 23:

1757-63.

Kumar G.B.S., Ganapathi T.R., Revathi C.J., Srinivas L., Bapat V.A. (2005a).

Expression of hepatitis B surface antigen in transgenic banana plants. Planta 222:

484–93.

Kumar G.B.S., Ganapathi T.R., Srinivas L., Revathi C.J., Bapat V.A. (2005b).

Secretion of hepatitis B surface antigen in transformed tobacco cell suspension

cultures. Biotechnol. Lett. 27: 927–32.

Kumar G.B.S., Ganapathi T.R., Srinivas L., Revathi C.J., Bapat V.A. (2006).

Expression of hepatitis B surface antigen in potato hairy roots. Plant Sci. 170:

918–25.

Kuroda K., Geyer H., Geyer R., Doerfler W. and Klenk H.D. (1990). The

oligosaccharides of influenza virus hemagglutinin expressed in insect cells by a

baculovirus vector. Virology 174: 418-429.


Bibliography

93

Kusandi A.R., Evangelista R.L., Hood E.E., Howard J.A. and Niklov Z.L. (1998).

Processing of transgenic corn seed and its effect on the recovery of the

recombinant ß-glucuronidase. Biotechnol. Bioeng. 60:44-52.

Kusnadi A.R., Nikolov Z.L. and Howard J. (1997). Production of recombinant

proteins in transgenic plants: practical considerations. Biotech. Bioeng. 56: 473-

484.

Lafay F., Benomonsour A., Chebli K. and Flamand A. (1996). Immunodominant

epitopes defined by a yeast – expressed library of random fragments of the rabies

glycoprotein map outside major antigenic sites. Journal of General Virology 77:

339-346.

Lafay F., Coulon P., Astic L., Saucier D., Riche D., Holley A. and Flamand A.

(1991). Spread of the CVS strain of rabies virus and of the avirulent mutant

AvO1 along the olfactory pathways of the mouse after intranasal inoculation.

Virology 183: 320-330.

Lafon M., Wiktor T. and MacFarlan R. (1983). Antigenic sites on the CVS rabies

virus glycoprotein: analysis with monoclonal antibodies. Journal of General

Virology 64: 843-845.

Lafon M. and Wiktor T. (1985). Antigenic sites on the ERA rabies virus

nucleoprotein and non-structural protein. Journal of General Virology 66: 2125-

2133.

Lafon M., Perrin P., Versmisse P. and Sureau P. (1985b). Use of a monoclonal

antibody for quantitation of rabies vaccine glycoprotein by enzyme immunoassay.

J. Biol. Stand. 13: 295-301.

Lafon M., Lafage M., Martinezarends A., Ramirez R., Vuillier F., Charron D.,

Lotteau V. and Scottalgara D. (1992). Evidence for a viral super antigen in

humans. Nature 358: 507-510.

Lai C.Y. and Dietzschold B. (1981). Amino acid composition and terminal sequence

analysis of the rabies virus glycoprotein: identification of the reading frame on

the cDNA sequence. Biochem. Biophys. Res. Comm. 103: 536-542.

Bibliography

94

Lal P., Ramachandran V.G., Goyal R., Sharma R. (2007). Edible vaccines: current

status and future. Ind. J. Med. Microbiol. 25: 93-102.

Lambert J.M., Goldmacher V.S., Collision A.R., Nadler L.M., Blattler W.A.

(1991). An immunotoxin prepared with blocked ricin: a natural plant toxin

adapted for therapeutic use. Cancer Res. 51: 6236–6242.

Lamphear B.J., Streatfield S.J., Jilka J.M., Brooks C.A., Barker D.K., Turner

D.D. (2002). Delivery of subunit vaccines in maize seed. J. Control Release

85:169-80.

Lathe R.F., Kieny M.P., Schmitt D., Curtis P. and Lecocq J.P. (1984). M13

bacteriophage vectors for the expression of foreign proteins in Escherichia coli:

the rabies glycoprotein. J. Mol. Appl. Gen. 2: 331-342.

Lau O.S., Ng D.W., Chan W.W., Chang S.P. and Sun S.S. (2010). Production of the

42-kDa fragment of Plasmodium falciparum merozoite surface protein 1, a

leading malaria vaccine antigen, in Arabidopsis thaliana seeds. Plant Biotechnol.

J. 8: 994-1004.

Lauterslager T.G.M., Florack D.E.A., van der Wal T.J., Molthoff J.W., Langeveld

J.P.M. and Bosch D. (2001). Oral immunization of naive and primed animals

with transgenic potato tubers expressing LT-B. Vaccine 19: 2749–55.

Lee R.W.H., Strommer J., Hodgins D., Shewen P.E., Niu Y., Lo R.Y.C. (2001).

Towards development of an edible vaccine against bovine pneumonic

pasteurellosis using transgenic white clover expressing a Mannheimia

haemolytica A1 lkt50 fusion protein. Infect. Immun. 69: 5786–93.

Lees C.Y., Briggs D.J., Wu X., Davis R.D., Moore S.M., Gordon C., Xiang Z., Ertl

H.C.J., Tang de C.C. and Fu Z.F. (2002). Induction of protective immunity by

topic application of a recombinant adenovirus expressing rabies virus

glycoprotein. Veterinary Microbiology 85: 295-303.

Lefebvre D.D., Miki B.L. and Laliberte J.F. (1987). Mammalian metallothionein

functions in plants. BioTechnology 5: 1053-1056.

Bibliography

95

Lefrancois L. (1984). Protection against lethal viral infection by neutralizing and

nonneutralizing monoclonal antibodies: distinct mechanisms of action. J. Virol.

51:208-214.

Lentz T., Burrage T.G., Smith A.L., Crick J. and Tignor G.H. (1982). Is the

acetylcholine receptor a rabies virus receptor? Science 215: 182-184.

Lentz T.L., Benson R.J.J., Klimowicz D., Wilson P.T. and Hawrot E. (1986).

Binding of rabies virus to purified Torpedo acetylcholine receptor. Mol. Brain

Res. 1: 211-219.

Lentz T.L., Hawrot E. and Wilson P.T. (1987). Synthetic peptides corresponding to

sequences of snake venom neurotoxins and rabies virus glycoprotein bind to the

nicotinic acetylcholine receptor. Proteins Struct. Funct. Genet. 2: 298-307.

Lentz T.L., Wilson P.T., Howrot E. and Speicher D.W. (1984). Amino acid

sequence similarity between rabies virus glycoprotein and snake curaremimetic

neurotoxins. Science 226: 847-848.

Li D., O’Leary J., Huang Y., Huner N.P.A., Jevnikar A.M. and Ma S. (2006).

Expression of cholera toxin B subunit and the B chain of human insulin as a

fusion protein in transgenic tobacco plants. Plant Cell Rep. 25: 417–424

Li J.T., Fei L., Mou Z.R., Wei J., Tang Y., He H.Y. (2006a). Immunogenicity of a

plant-derived edible rotavirus subunit vaccine transformed over fifty generations.

Virology 356: 171–8.

Li H.Y., Ramalingam S.K. and Chye M.L. (2006b). Accumulation of recombinant

SARS-CoVspike protein in plant cytosol and chloroplasts indicate potential for

development of plant derived oral vaccines. Exp. Biol. Med. 231: 1346–52.

Liu C., Towler M.J., Medrano G., Cramer C.L., Weathers P.J. (2009) Production

of Mouse Interleukin- 12 Is Greater in Tobacco Hairy Roots Grown in a Mist

Reactor Than in an Airlift Reactor. Biotechnol. Bioeng. 102: 1074-1086.

Lodmell D.L., Exposito J. and Ewalt L. (1993). Rabies virus anti-nucleoprotein

antibody protects against rabies virus challenge in vivo and inhibits rabies virus

replication in vitro. J. Virol. 67: 6080-6086.

Bibliography

96

Lodmell D.L., Parnell M.J., Weyhrich J.T. and Ewalt L. (2003). Canine rabies DNA

vaccination: a single-dose intradermal injection into ear pinnae elicits elevated

and persistent levels of neuroimaging antibody. Vaccine 21: 3998-4002.

Lodmell D.L., Sumner J., Esposito J., Bellini W. and Ewalt L. (1991). Racoon

poxivirus recombinants expressing the rabies virus nucleoprotein protect mice

against lethal rabies virus infection. J. Virol. 65: 3400-3405.

Lou X.M., Yao Q.H., Zhang Z., Peng R.H., Xiong A.S. and Wang H.K. (2007).

Expression of the human hepatitis B virus large surface antigen gene in transgenic

tomato plants. Clin. Vaccine Immunol. 14: 464–9.

Lu Z., Lee K.J., Shao Y., Lee J.H., So Y., Choo Y.K., Oh D.B., Hwang K.A., Oh

S.H., Han Y.S. and Ko K. (2012). Expression of GA733-Fc fusion protein as a

vaccine candidate for colorectal cancer in transgenic plants. J. Biomed.

Biotechnol. 2012: 364240.

Luchakivskaia Iu.S., Olevinskaia Z.M., Kishchenko E.M., Spivak N.Ia., Kuchuk

N.V. (2012). Obtaining of hairy-root, callus and suspension carrot culture

(Daucus carota L.) able to accumulate human interferon alpha-2b. Tsitol.

Genet. 46:18-26.

Lynch J.C., Hoover J.E. and Strick P.L. (1994). In put to the primate frontal eye field

from the substantia nigra, superior colliculus, and dentate nucleus demonstrated

by transneuronal transport. Exp. Brain Res. 100: 181-186.

Ma J.K.C. and Hein M.B. (1995a). Immunotherapeutic potential of antibodies

produced in plants. TIBTECH. 13: 522-527.

Ma J.K.C., Hiatt A., Hein M., Vine N.D., Wang F., Stabila P., Van Dolleweerd C.,

Mostov K. and Lehner T. (1995b). Generation and assembly of secretory

antibodies in plants. Science 268: 716-719.

Ma J.K.C., Hikmat B., Wycoff K., Vine N., Chargelegue D., Yu L., Hein M. and

Lehner T. (1998). Characterization of a recombinant plant monoclonal secretory

antibody and preventive immunotherapy in human. Nat. Med. 4: 601-606.

http://www.ncbi.nlm.nih.gov/pubmed?term=Luchakivskaia%20IuS%5BAuthor%5D&cauthor=true&cauthor_uid=22420216

http://www.ncbi.nlm.nih.gov/pubmed?term=Olevinskaia%20ZM%5BAuthor%5D&cauthor=true&cauthor_uid=22420216

http://www.ncbi.nlm.nih.gov/pubmed?term=Kishchenko%20EM%5BAuthor%5D&cauthor=true&cauthor_uid=22420216

http://www.ncbi.nlm.nih.gov/pubmed?term=Spivak%20NIa%5BAuthor%5D&cauthor=true&cauthor_uid=22420216

http://www.ncbi.nlm.nih.gov/pubmed?term=Kuchuk%20NV%5BAuthor%5D&cauthor=true&cauthor_uid=22420216

http://www.ncbi.nlm.nih.gov/pubmed?term=Kuchuk%20NV%5BAuthor%5D&cauthor=true&cauthor_uid=22420216

http://www.ncbi.nlm.nih.gov/pubmed/?term=Luchakivskaia+2012

http://www.ncbi.nlm.nih.gov/pubmed/?term=Luchakivskaia+2012

Bibliography

97

Ma J.K.C., Pascal M.W.D. and Christou P. (2003). The production of recombinant

pharmaceutical proteins in plants. Nature 4: 794-805.

Ma J.K.C., Barros E., Bock R., Christou P., Dale P.J., Dix P.J., Fischer R., Irwin

J., Mahoney R., Pezzotti M. (2005). Molecular farming for new drugs and

vaccines: Current perspectives on the production of pharmaceuticals in transgenic

plants. EMBO Rep. 6: 593–599.

Macfarlan R., Dietzschold B., Wiktor T., Kiel M., Houghten R., Lerner R.,

Sutcliffe G. and Koprowski H. (1984). T cell responses to cleaved rabies virus

glycoprotein and to synthetic peptides. J. Immunol. 133:2748-2752.

Macfarlan R., Dietzschold B. and Koprowski H. (1986). Stimulation of cytotoxic T

lymphocyte response by rabies virus glycoprotein and identification of an

immunodominant domain. Mol. Immunol. 23: 733-741.

Marquet-Blouin E., Bouche F.B., Steinmetz A., Muller C.P. (2003). Neutralizing

immunogenicity of transgenic carrot (Daucus carota L.) derived measles virus

hemagglutinin. Plant Mol. Biol. 51: 459–69.

Martín-Alonso J.M., Castañón S., Alonso P., Parra F., Ordás R. (2003). Oral

immunization using tuber extracts from transgenic potato plants expressing rabbit

hemorrhagic disease virus capsid protein. Transgenic Res. 12: 127–30.

Mason H.S., Lam D.M. and Arntzen C.J. (1992). Expression of hepatitis B surface

antigen in transgenic plants. Proc. Natl. Acad. Sci., U.S.A. 89: 11745-11749.

Mason H.S. and Arntzen C.J. (1995). Transgenic plants as vaccine production

systems. Trends Biotechnol. 13: 388-392.

Mason H.S., Ball J.M., Shi J.J., Jiang X., Estes M.K. and Arntzen C.J. (1996).

Expression of the Norwalk virus capsid protein in transgenic tobacco and its

immunogenicity in plants. Proc. Natl. Acad. Sci., U.S.A. 93: 5335-5340.

Mason H., Haq T., Clements J. and Arntzen C. (1998). Edible vaccine protects mice

against Escherichia coli heat-labile enterotoxin (LT): potatoes expressing a

synthetic LT-B gene. Vaccine 16: 1336-1343.

Bibliography

98

Matsui T., Asao H., Ki M., Sawada K. and Kato K. (2009). Transgenic lettuce

producing a candidate protein for vaccine against edema disease. Biosci.

Biotechnol. Biochem. 73: 1628-34.

Matsumoto Y., Suzuki S., Nozoye T., Yamakawa T., Takashima Y., Arakawa T.,

Tsuji N., Takaiwa F. and Hayashi Y. (2009). Oral immunogenicity and

protective efficacy in mice of transgenic rice plants producing a vaccine

candidate antigen (As16) of Ascaris suum fused with cholera toxin B subunit.

Transgenic Res. 18: 185-92.

Matsumura T., Itchoda N. and Tsunemitsu H. (2002). Production of immunogenic

VP6 protein of bovine group A rotavirus in transgenic potato plants. Arch. Virol.

147: 1263–70.

McGarvey P.B., Hammond J., Dienelt M.M., Hooper D.C., Fu Z.F., Dietzschold B.

(1995). Expression of the rabies virus glycoprotein in transgenic tomatoes.

Biotechnology 13: 1484-1487.

McGehee D.S. and Lorca L.W. (1995). Physiological diversity of nicotinic

acetylcholine receptors expressed by vertebrate cells. Annu. Rev. Physiol. 57:

521-546.

McKenzie S.J. and Halsey J.F. (1984). Cholera toxin B subunit as a carrier protein to

stimulate a mucosal immune response. J. Immunol. 133:1818–1824.

Mebatsion R., Konig M. and Conzelmann K.K. (1996). Budding of rabies virus

particles in the absence of the spike glycoprotein. Cell 84: 941-951.

Mebatsion T., Weiland F. and Conzelmann K.K. (1999). Matrix protein of rabies

virus is responsible for the assembly and budding of bullet shaped particles and

interacts with the transmembrane spike glycoprotein G. J. Virol. 73: 242-250.

Medina-Bolivar F., Wright R., Funk V., Sentz D., Barroso L., Wilkins T.D., Petri

W. and Cramer C.L. (2003). A non-toxic lectin for antigen delivery of plant

based mucosal. Vaccines 21: 997–1005.

Meslin F.X., Fishbein D.B. and Matter H.C. (1994). Rationale and prospects for

rabies elimination in developing countries. In: Lyssaviruses, Rupprecht C.E.,

Bibliography

99

Dietzschold B., Koprowski H. (Eds.), Berlin: Springer, 1-26. Springer-Verlag,

Berlin, Heidelberg, New York.

Meslin F.X. and Stohr K. (1997). Prospects for immunization against rabies in

developing countries. In: Dodet B. and Meslin F.X. (Eds.), Rabies Control in

Asia. 15-18.

Meyers A., Chakauya E., Shephard E., Tanzer F.L., Maclean J. and Lynch A.

(2008). Expression of HIV-1 antigens in plants as potential subunit vaccines.

BMC Biotechnol. 8: 1-15.

Middelton F.A. and Strick P.L. (1996). The temporal lobe is the target of output from

the basal ganglia. Proc. Natl Acad. Sci., U.S.A. 93: 8683-8687.

Mifune K., Ohuchi M. and Mannen K. (1982). Hemolysis and cell fusion by

rhabdoviruses. FEBS Lett. 137: 293-297.

Mirjalili H, Fakhr-Tabatabaei S, Bonfill M, Alizadeh H, Cusido R, Ghassempour

A, Palazon J. (2009) Morphology and withanolide production of Withania

coagulans hairy root cultures. Eng. Life Sci. 9: 197–204.

Mishra S., Yadav D.K., Tuli R. (2006). Ubiquitin fusion enhances cholera toxin B

subunit expression in transgenic plants and the plant-expressed protein binds

GM1 receptors more efficiently. J. Biotechnol. 127: 95-108.

Mishra N., Gupta P.N., Khatri K., Goyal A.K., Vyas S.P. (2008). Edible vaccines: a

new approach to oral immunization. Ind. J. Biotechnol. 7: 283–94.

Modelska A., Dietzschold B., Sleysh N., Fu Z.F., Steplewski K., Hooper D.C.,

Koprowski H. and Yusibov V. (1998). Immunization against rabies with plant-

derived antigen. Proc. Natl. Acad. Sci. USA. 95: 2481-2485.

Molina A., Hervás-Stubbs S., Daniell H., Mingo-Castel A.M. and Veramendi J.

(2004). High-yield expression of a viral peptide animal vaccine in transgenic

tobacco chloroplasts. Plant Biotechnol. J. 2:141–53.

Mor T.S., Sternfeld M., Arntzen C.J., Soreq H. and Mason H.S. (2001). Expression

of recombinant human acetylcholinesterase in transgenic tomato plants.

Biotechnol. Bioeng. 75: 259–66.

Bibliography

100

Moravec T., Schmidt M.A., Herman E.M. and Woodford-Thomas T. (2007).

Production of Escherichia coli heat labile toxin (LT) B subunit in soybean seed

and analysis of its immunogenicity as an oral vaccine. Vaccine 25: 1647–57.

Morgenfeld M., Segretin M.E., Wirth S., Lentz E., Zelada A., Mentaberry A.,

Gissmann L. and Bravo-Almonacid F. (2009). Potato virus X coat protein

fusion to human papillomavirus 16 E7 oncoprotein enhance antigen stability and

accumulation in tobacco chloroplast. Mol. Biotechnol. 43: 243-9.

Morimoto K., Foley H.D., McGettigon J.P., Schnell M.J. and Dietzschold B.

(2000). Reinvestigation of the role of the rabies virus glycoprotein in viral

pathogenesis using a reverse genetics approach. J. Neurol. Virol. 6: 373-381.

Morimoto K., Hooper D.C., Spitsin S., Koprowski H. and Dietzschold B. (1999).

Pathogenicity of different rabies virus variants inversely correlates with apoptosis

and rabies virus glycoprotein expression in infected primary neuron culture. J.

Virol. 73: 510-517.

Morimoto K., Ni Y.J. and Kawai A. (1992). Syncytium formation is induced in the

murine neuroblastoma cell cultures which produce pathogenic type G proteins of

the rabies virus. Virology 189: 203-216.

Morimoto K., Patel M., Corisdeo S., Hooper D.C., Fu Z.F., Rupprecht C.E.,

Koprowski H. and Dietzschold B. (1996). Characterization of a unique variant

of bat rabies virus responsible for newly emerging human cases in North

America. Proc. Natl. Acad. Sci., USA. 93: 5653-5658.

Mortimer E., Maclean J.M., Mbewana S., Buys A., Williamson A.L., Hitzeroth I.I.

and Rybicki E.P. (2012). Setting up a platform for plant-based influenza virus

vaccine production in South Africa. BMC Biotechnol 12: 14.

Murphy F.A., Bauer S.P., Harrison A.K. and Winn W.C. (1973). Comparative

pathogenesis of rabies and rabies-like viruses: viral infection and transit from

inoculation site to the central nervous system. Lab. Invest. 28: 361-376.

Bibliography

101

Murphy F.A. and Bauer S.P. (1974). Early street rabies virus infection in striated

muscle and later progression to the central nervous system. Intervirology.

3: 256-268.

Murphy F.A. (1977). Rabies pathogenesis. Arch. Virol. 54: 279-297.

Nadin-Davis S.A., Casey G.A. and Wandeler A. (1993). Identification of regional

variants of the rabies virus within the Canadian province of Ontario. Journal of

General Virology. 74: 829-837.

Nadin-Davis S.A., Casey G.A. and Wandeler A. (1994). A molecular

epidemiological study of rabies virus in central Ontario and Western Quebec.

Journal of General Virology 75: 2575-2583.

Nadin-Davis S.A., Sampath M.I., Casey G.A., TinLine R.R. and Wandeler A.

(1999). Phylogeographic patterns exhibited by Ontario rabies virus variants.

Epidemiology and infection 123:325-336.

Nadin-Davis S.A., Sheen M., Abdul-Malik M., Elmgren L., Armstrong J. and

Wandeler A.I. (2000). A Panel of MAB targeting the phosphoprotein identifies a

highly variable epitope of value for sensitive strain discrimination. J. Clinical

Microbiology 38:1397-1403.

Nashar T.O., Webb H.M., Eaglestone S., Williams N.A., Hirst T.R. (1996). Potent

immunogenicity of the B subunits of Escherichia coli heat-labile enterotoxin:

receptor binding is essential and induces differential modulation of lymphocyte

subsets. Proc. Natl. Acad. Sci., U.S.A. 93: 226–230.

Nelson G., Marconi P., Periolo O., La Torre J. and Alvarez M.A. (2012). Immuno-

competent truncated E2 glycoprotein of bovine viral diarrhea virus (BVDV)

expressed in Nicotiana tabacum plants: a candidate antigen for new generation of

veterinary vaccines. Vaccine 30: 4499-504.

Ni Y., Tominaga Y., Honda Y., Morimoto K., Sakamoto S. and Kawai A. (1995).

Mapping and characterization of a sequential epitope on the rabies virus

glycoprotein which is recognized by a neutralizing monoclonal antibody, Rg 719.

Microbiol. Immunol. 39:693-702.

Bibliography

102

Nochi T., Takagi H., Yuki Y., Yang L., Masumura T. and Mejima M. (2007). Rice-

based mucosal vaccine as a global strategy for cold-chain and needle-free

vaccination. Proc. Natl. Acad. Sci., U.S.A.104: 10986–91.

O’Donnell P., Lavin A., Enquist L.W., Grace A.A. and Card J.P. (1997). Inter

connected parallel circuits between rat nucleus accumbens and thalamus revealed

by retrograde transynaptic transport of pseudorabies virus. J. Neurosci. 17: 2143-

2167.

Oszvald M., Kang T.J., Tomoskozi S., Jenes B., Kim T.G. and Cha Y.S. (2008).

Expression of cholera toxin B subunit in transgenic rice endosperm. Mol.

Biotechnol. 40: 261–8.

Oth D., Mercier G., Perrin P., Joffret M.L., Sureau P. and Thibodeau L. (1987).

The association of the rabies glycoprotein with liposome (immunosome) induces

as in vitro specific release of Interleukin-2. Cell. Immunol. 108: 220-226.

Pak C.C., Puri A. and Blumenthal R. (1997). Conformational changes and fusion

activity of vesicular stomatitis virus glycoprotein: [125I] iodonaphthyl azide

photolabeling studies in biological membranes. Biochem. 36: 8890-8896.

Pasteur L. (1885). Methode pour prevenir la rage après morsure. Compt. Rendus.

Acad. Sci., Paris 101: 765-774.

Peach C. and Velten J. (1991). Expression variability (position effect) of CAT and

GUS reporter genes driven by linked divergent T-DNA promoters. Plant Mol.

Biol. 17 49-60.

Pennica D., Holloway B.P., Heyward J.T. and Obijeski J.F. (1980). In vitro

translation of rabies virus messenger RNAs. Virology 103: 517-521.

Perrin P. and Atanasiu P. (1980). Partial structural study of oligosides of rabies virus

glycoprotein. Microbiological 3: 57-74.

Perrin P. and Atanasiu P. (1981). Rabies glycoprotein affinity for lipids. I. Structural

study of different types of spontaneous and induced associations.

Microbiological 4: 231-247.

Bibliography

103

Perrin P., Thibodeau L., Dauguet C., Fritsch A. and Sureau, P. (1984).

Amplification expression vectors: the requirements for high level expression of

proteins, including glycoproteins. Journal of General Virology 68: 1233-1250.

Perrin P., Sureau P. and Thibodeau L. (1985a). Rabies immunosomes efficiency in

pre and post-exposure vaccinations: role of liposomes in glycoprotein

conformation and immunogenicity. In “Synthetic immunomodulators and

vaccines”, Zaoral M. (Eds.). 252-271.

Perrin P., Thibodeau L. and Sureau P. (1985b). Rabies immunosomes (subunit

vaccine) structure and immunogenicity. Pre- and post-exposure protection

studies. Vaccine 3: 325-332.

Perrin P., Joffret M.L., Leclerc C., Oth D., Sureau P. and Thibodeau L. (1988a).

Interleukin-2 increases protection against experimental rabies. Immunobiol 177:

199.

Perrin P., Joffret M.-L., Oth D., Leclerc C., Sureau P. and Thibodeau L. (1988b).

Interleukin-2 production in vitro: a new approach to the study of rabies vaccine

immunogenicity as appraised by testing different glycoprotein presentations.

Vaccine 6: 331.

Perrin P., Lafon M. and Sureau P. (1990). Rabies vaccines from Pasteur’s time up to

experimental subunit vaccines today. Adv. Biotechnol. Process 14: 325-345.

Plotkin S. (1993). Vaccination in the 21 st century. J. Infect. Dis. 168: 29-37.

Pogrebnyak N., Markley K., Smirnov Y., Brodzik R., Bandurska K. and

Koprowski H. (2006). Collard and cauliflower as a base for production of

recombinant antigens. Plant Sci. 171: 677–85.

Prehaud C., Coulon P., Lafay F., Thiers C. and Flamand A. (1988). Antigenic site

II of the rabies virus glycoprotein: structure and role in viral virulence. J. Virol.

62: 1-7.

Prehaud C., Takehara K., Flamand A. and Bishop D.H.L. (1989). Immunogenic

and protective properties of rabies virus glycoprotein expressed by baculovirus

vectors. Virology 173: 390-399.

Bibliography

104

Prevec L., Campbell J.B., Christie B.S., Belbeck L. and Graham F.L. (1990). A

recombinant human adenovirus vaccine against rabies. J. inf. Dis. 161: 27.

Proudfoot N.J. and Brownlee G.G. (1976). 3’ non-coding region sequences in

eukaryotic messenger RNA. Nature 263: 211-214.

Qian B., Shen H., Liang W., Guo X., Zhang C., Wang Y., Li G., Wu A., Cao K.

and Zhang D. (2008). Immunogenicity of recombinant hepatitis B virus surface

antigen fused with preS1 epitopes expressed in rice seeds. Transgenic Res. 17:

621-31.

Ramírez Y.J.P., Tasciotti E., Gutierrez-Ortega A., Torres A.J.D., Flores M.T.O.

and Giacca M. (2007). Fruit-specific expression of the human immunodeficiency

virus type 1 tat gene intomato plants and its immunogenic potential in mice. Clin.

Vaccine Immunol. 14: 685–92.

Raux H., Coulon P., Lafay F. and Flamand A. (1995). Monoclonal antibodies which

recognize the acidic configuration of the rabies glycoprotein at the surface of the

virion can be neutralizing. J. Virol. 210: 400-408.

Richter L.J., Thanavala Y., Arntzen C.J. and Mason H.S. (2000). Production of

hepatitis B surface antigen in transgenic plants for oral immunization. Nat.

Biotechnol. 18: 1167–71.

Rigano M.M., Alvarez M.L., Pinkhasov J., Jin Y., Sala F. and Arntzen C.J. (2004).

Production of a fusion protein consisting of the enterotoxigenic Escherichia coli

heat-labile toxin B subunit and a tuberculosis antigen in Arabidopsis thaliana.

Plant Cell Rep. 22: 502–8.

Roberta M.K. and Peter L.S. (2000). Rabies as a transneuronal tracer of circuits in the

central nervous system. J. Neuro. Sci. Meth. 103: 63-71.

Rosales-Mendoza S., Soria-Guerra R.E., López-Revilla R., Moreno-Fierros L. and

Alpuche-Solís A.G. (2008). Ingestion of transgenic carrots expressing the

Escherichia coli heat-labile enterotoxin B subunit protects mice against cholera

toxin challenge. Plant Cell Rep. 27: 79–84.

Bibliography

105

Rosales-Mendoza S., Alpuche-Solıs A.G., Soria-Guerra R.E., Moreno-Fierros L.,

MartnezGonzalez L. and Herrera-Dıaz A. (2009). Expression of an

Escherichia coli antigenic fusion protein comprising the heat labile toxin B

subunit and the heat stable toxin, and its assembly as a functional oligomer in

transplastomic tobacco plants. Plant J. 57: 45–54.

Rosales-Mendoza S., Soria-Guerra R.E., Moreno-Fierros L., Alpuche-Solís A.G.,

Martínez-González L. and Korban S.S. (2010). Expression of an immunogenic

F1-V fusion protein in lettuce as a plant-based vaccine against plague. Planta 232:

409-16.

Rose J.K. (1980). Complete intergenic and flanking gene sequences from the genome

of vesicular stomatitis virus. Cell 19: 415-421.

Rose J.K., Doolittle R.F., Anilionis A., Curtis P.J. and Wunner W.H. (1982).

Homology between the glycoproteins of vesicular stomatitis virus and rabies

virus. J. Virol. 43: 361-364.

Roy S., Tyagi A., Tiwari S., Singh A., Singh P.K., Sawant S.V. and Tuli R. (2010).

Rabies glycoprotein fused with B subunit of cholera toxin is expressed at high

level in tobacco plants and folds into biologically active pentameric protein.

Protein Expr. Purif. 70: 184-90.

Rubio-Infante N., Govea-Alonso D.O., Alpuche-Solís Á.G., García-Hernández

A.L., Soria-Guerra R.E., Paz-Maldonado L.M., Ilhuicatzi-Alvarado D.,

Varona-Santos J.T., Verdín-Terán L., Korban S.S., Moreno-Fierros L. and

Rosales-Mendoza S. (2012). A chloroplast-derived C4V3 polypeptide from the

human immuno-deficiency virus (HIV) is orally immunogenic in mice. Plant

Mol. Biol. 78: 337-49.

Rupprecht C.E., Hanlon C.A. and Hemachudha T. (2002). Rabies re-examined. The

Lancet Infect. Dis. 2: 327-343.

Rupprecht C.E., Smith J.S., Fekadu M. and Childs J.E. (1995). The ascension of

wildlife rabies: a cause for public health concern or intervention? Emerg. Infect.

Dis. 1: 107-114.

Bibliography

107

Scotti N., Alagna F., Ferraiolo E., Formisano G., Sannino L., Buonaguro L., De

Stradis A., Vitale A., Monti L., Grillo S., Buonaguro F.M. and Cardi T.

(2009). High-level expression of the HIV-1 Pr55gag polyprotein in transgenic

tobacco chloroplasts. Planta 229: 1109-22.

Seif I., Coulon P., Rollin P.E. and Flamand A. (1985). Rabies virulence: effect on

pathogenicity and sequence characterization of rabies virus mutations affecting

antigenic site III of the glycoprotein. J. Virol. 53: 926-34.

Sharma M.K., Singh N.K., Jani D., Sisodia R., Thungapathra M. and Gautam J.K.

(2008). Expression of toxin co-regulated pilus subunit A (TCPA) of Vibrio

cholerae and its immunogenic epitopes fused to choleratoxin B subunit in

transgenic tomato (Solanum lycopersicum). Plant Cell Rep. 27: 307-18.

Sharp J.M. and Doran P.M. (1999). Effect of bacitracin on growth and monoclonal

antibody production by tobacco hairy roots and cell suspensions. Biotechnol.

Bioprocess Eng. 4: 253-258.

Shchelkunov S.N., Salyaev R.K., Pozdnyakov S.G., Rekoslavskaya N.I., Nesterov

A.E. and Ryzhova T.S. (2006). Immunogenicity of a novel, bivalent, plant-based

oral vaccine against hepatitis B and human immunodeficiency viruses. Biotechnol

Lett. 28: 959–67.

Shevchuk N.A., Bryksin A.V., Nusinovich Y.A., Cabello F.C., Sutherland M. and

Ladisch S. (2004). Construction of long DNA molecules using long PCR-based

fusion of several fragments simultaneously. Nucleic Acids Res. 32: e19.

Shin M.K., Jung M.H., Lee W.J., Choi P.S., Jang Y.S. and Yoo H.S. (2011).

Generation of transgenic corn-derived Actinobacillus pleuropneumoniae ApxIIA

fused with the cholera toxin B subunit as a vaccine candidate. J. Vet. Sci. 12:

401-3.

Shoji Y., Chichester J.A., Jones M., Manceva S.D., Damon E., Mett V., Musiychuk

K., Bi H., Farrance C., Shamloul M., Kushnir N., Sharma S. and Yusibov V.

(2011). Plant-based rapid production of recombinant subunit hemagglutinin

vaccines targeting H1N1 and H5N1 influenza. Hum. Vaccine 7: 41-50.

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC373371/?tool=pmcentrez

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC373371/?tool=pmcentrez

Bibliography

108

Singh A., Yadav D., Rai K.M., Srivastava M., Verma P.C., Singh P.K. and Tuli R.

(2012). Enhanced expression of rabies virus surface G-protein in Escherichia coli

using SUMO fusion. Protein J. 31: 68-74.

Smith G.L., Mackett M. and Moss B. (1983a). Infectious vaccinia virus recombinants

that express hepatitis B virus surface antigen. Nature 302: 490-495.

Smith G.L., Murphy B.R. and Moss B. (1983b). Construction and characterization of

an infectious vaccinia virus recombinant that expresses the influenza

hemagglutinin gene and induces resistance to influenza virus infection in

hamsters. Proc. Natl. Acad. Sci., U.S.A. 80: 7155-7159.

Smith J.S., Orciari L.A., Yager P.A., Seidel H. D. and Warner C.K. (1992).

Epidemiologic and historic relationships among 87 rabies virus isolates as

determined by limited sequence analysis. J. Infect. Dis. 166: 296-307.

Smith J.S. (1996). New aspects of rabies with emphasis on epidemiology, diagnosis

and prevention of the disease in the United States. Clin. Microbiol. Rev. 9: 166-

176.

Smith M.L., Keegan M.E., Mason H.S. and Shuler M.L. (2002a). Factors important

in the extraction, stability and in vitro assembly of the hepatitis B surface antigen

derived from recombinant plant systems. Biotechnol. Prog. 18: 538–50.

Smith M.L., Mason H.S. and Shuler M.L. (2002b). Hepatitis B surface antigen

(HbsAg) expression in plant cell culture: kinetics of antigen accumulation in

batch culture and its intracellular form. Biotechnol. Bioeng. 80: 812–22.

Sojikul P., Buehner N. and Mason H.S. (2003). A plant signal peptide hepatitis B

surface antigen fusion protein with enhanced stability and immunogenicity

expressed in plant cells. Proc. Natl. Acad. Sci., U.S.A. 100: 2209–14.

Sokol F. and Clark F. (1973). Phosphoproteins, structural components of

rhabdoviruses. Virology 52: 246-263.

Soria-Guerra R.E., Rosales-Mendoza S., Márquez-Mercado C., López-Revilla R.,

Castillo-Collazo R. and Alpuche-Solís A.G. (2007). Transgenic tomatoes

http://www.ncbi.nlm.nih.gov/pubmed?term=Singh%20A%5BAuthor%5D&cauthor=true&cauthor_uid=22134654

http://www.ncbi.nlm.nih.gov/pubmed?term=Yadav%20D%5BAuthor%5D&cauthor=true&cauthor_uid=22134654

http://www.ncbi.nlm.nih.gov/pubmed?term=Rai%20KM%5BAuthor%5D&cauthor=true&cauthor_uid=22134654

http://www.ncbi.nlm.nih.gov/pubmed?term=Srivastava%20M%5BAuthor%5D&cauthor=true&cauthor_uid=22134654

http://www.ncbi.nlm.nih.gov/pubmed?term=Verma%20PC%5BAuthor%5D&cauthor=true&cauthor_uid=22134654


http://www.ncbi.nlm.nih.gov/pubmed?term=Tuli%20R%5BAuthor%5D&cauthor=true&cauthor_uid=22134654


Bibliography

109

express an antigenic polypeptide containing epitopes of the diphtheria, pertussis

and tetanus exotoxins, encoded by a synthetic gene. Plant Cell Rep. 26: 961–8.

Sphyris N., Lord J.M., Wales R. and Roberts L.M. (1995). Mutational analysis of

the Ricinus lectin B-chains. J. Biol. Chem. 270: 20292–20297.

Spitsin S., Andrianov V., Pogrebnyak N., Smirnov Y., Borisjuk N. and

Portocarrero C. (2009). Immunological assessment of plant-derived avian flu

H5/HA1 variants. Vaccine 27: 1289–92.

Steeves R.M., Denton M.E., Barnard F.C., Henry A. and Lambert J.M. (1999).

Identification of three oligosaccharide binding sites in ricin. Biochemistry 38:

11677–11685.

Strack A.M. and Loewy A.D. (1990). Pseudorabies virus: A highly specific trans

neuronal cell body marker in the sympathetic nervous system. J. Neurosci. 10:

2139-47.

Streatfield S.J., Jilka J.M., Hood E.E., Turner D.D., Bailey M.R. and Mayor J.M.

(2001). Plant-based vaccines: unique advantages. Vaccine 19: 2742–8.

Streatfield S.J., Lane J.R., Brooks C.A., Barker D.K. Poage M.L., Mayor J.M.,

Lamphear B.J., Drees C.F., Jilka J.M., Hood E.E. and Howard J.A. (2003).

Corn as a production system for human and animal vaccines. Vaccine 21: 812-

815.

Sumner J., Fekadu M., Shaddock J., Esposito. and Bellini W. (1991). Protection of

mice with vaccinia virus recombinants that express the rabies nucleoprotein.

Virology 183: 703-710.

Sun N., Cassell M.D. and Perlman S. (1996). Anterograde, transneuronal transport of

herpes simplex virus type 1 strain HI29 in the murine visual system. J. Virol. 70:

5405-13.

Superti F., Derer M. and Tsiang H. (1984a). Mechanism of rabies virus entry into

CER cell. Journal of General Virology 65: 781-789.

Superti F., Seganti L., Tsiang H. and Orsi N. (1984b). Role of phospholipids in

rhabdovirus attachment to CER cells. Arch. Virol. 81: 321-328.

Bibliography

110

Superti F., Hauttecoeur B., Morelec M.J., Goldoni P., Bizzini B. and Tsiang H.

(1986). Involvement of gangliosides in rabies virus infection. Journal of General

Virology 67: 47-56.

Swimmer C., Lehar S.M., McCafferty J., Chiswell D.J., Blättler W.A. and Guild

B.C. (1992). Phage display of ricin B chain and its single binding domains:

system for screening galactose-binding mutants. Proc. Natl. Acad. Sci., U.S.A.

89: 3756–3760.

Tackaberry E.S., Dudani A.K. Prior F., Tocchi M., Sardana R., Altosaar I. and

Ganz P.R. (1999). Developemnt of biopharmaceuticals in plant expression

systems: cloning, expression and immunological reactivity of human

cytomegalovirus glycoprotein B (UL55) in seeds of transgenic tobacco. Vaccine

17: 3020-3029.

Tackett C.O., Mason H.S., Losonsky G., Clements J.D., Levine M.M. and Arntzen

C.J. (1998). Immunogenicity in humans of a recombinant bacterial antigen

delivered in transgenic potato. Natl. Med. 4: 607-609.

Tackett C.O., Mason H.S., Losonsky G., Estes M.K., Levin M.M. and Arntzen C.J.

(2000). Human immune responses to a novel Norwalk virus vaccine delivered in

transgenic potatoes. J. Infect. Dis. 182: 302-305.

Tagge E.P., Chandler J., Harris B., Czako M., Marton L., Willingham M.C.,

Burbage C., Afrin L. and Frankel A.E. (1996). Preproricin expressed in

Nicotiana tabacum cells in vitro is fully processed and biologically active. Protein

Expr. Purif. 8: 109–118.

Takita-Sonada Y., Fujii H., Mifune K., Ito Y., Hiraga M., Nishizono A., Mannen

K. and Minamoto N. (1993). Resistance of mice vaccinated with rabies virus

internal structural proteins to lethal infection. Arch. Virol. 132: 51-65.

Tang Y., Rampin O., Giuliano R. and Ugolini G. (1999). Spinal and brain circuits to

motoneurons of the bulbospongiosus muscle: Retrograde transneuronal tracing

with rabies virus. J. Comp. Neurol. 414: 167-192.

http://www.ncbi.nlm.nih.gov/pubmed?term=Swimmer%20C%5BAuthor%5D&cauthor=true&cauthor_uid=1373889

http://www.ncbi.nlm.nih.gov/pubmed?term=Lehar%20SM%5BAuthor%5D&cauthor=true&cauthor_uid=1373889

http://www.ncbi.nlm.nih.gov/pubmed?term=McCafferty%20J%5BAuthor%5D&cauthor=true&cauthor_uid=1373889

http://www.ncbi.nlm.nih.gov/pubmed?term=Chiswell%20DJ%5BAuthor%5D&cauthor=true&cauthor_uid=1373889

http://www.ncbi.nlm.nih.gov/pubmed?term=Bl%C3%A4ttler%20WA%5BAuthor%5D&cauthor=true&cauthor_uid=1373889

http://www.ncbi.nlm.nih.gov/pubmed?term=Guild%20BC%5BAuthor%5D&cauthor=true&cauthor_uid=1373889

http://www.ncbi.nlm.nih.gov/pubmed?term=Guild%20BC%5BAuthor%5D&cauthor=true&cauthor_uid=1373889

Bibliography

111

Taylor J., Meignier B., Tartaglia J., Languet B., VanderHoeven J., Franchini G.,

Trimarchi C. and Paoletti E. (1995). Biological and immunogenic properties of

a canary-rabies recombinant, ALVAC-RG (vCP65) in non-avian species. Vaccine

13: 539-549.

Thanavala Y., Yang Y.F., Lyons P., Mason H.S. and Arntzen C. (1995).

Immunogenicity of transgenic plantderived hepatitis B surface antigen. Proc.

Natl. Acad. Sci., U.S.A. 92: 3358–61.

Thoulouze M. I., Lafage M., Sahachmer M., Hartmann U., Cremer H. and Lafon

M. (1998). The neural cell adhesion molecule is a receptor for rabies virus. J.

Virol. 72: 7181-7190.

Tiwari S., Mishra D.K., Roy S., Singh A., Singh P.K and Tuli R. (2009a). High

level expression of a functionally active cholera toxin B: rabies glycoprotein

fusion protein in tobacco seeds. Plant Cell Rep. 28: 1827-36.

Tiwari S., Verma P.C., Singh P.K. and Tuli R. (2009b). Plants as bioreactors for the

production of vaccine antigens. Biotech. Adv. 27: 449–467.

Tonevitsky A., Toptygin A., Agapov I., Pfueller U. and Frankel A. (1994).

Renatured ricin toxin B chain made in Escherichia coli is soluble, stable and

biologically active. Biochem. Mol. Biol. Int. 32: 1139–1146.

Tordo N., Poch O., Ermine A. and Keith G. (1986a). Primary structure of leader

RNA and nucleoprotein genes of the rabies genome: segmented homology with

VSV. Nucleic Acids Research 14: 2671-2683.

Tordo N., Poch O., Ermine A., Keith G. and Rougeon F. (1986b). Walking along

the rabies genome: Is the large G-L intergenic region a reminant gene? Proc. Natl.

Acad. Sci., U.S.A. 83: 3914-3918.

Tordo N. and Poch O. (1988). Structure of rabies virus. In: Rabies, Campbell J.B. and

Charlton K.M. (Eds.), Boston, Kluwer Academic Press. 25-45.

Tordo N., Poch O., Ermine A., Keith G. and Rougeon F. (1988). Completion of the

rabies virus genome sequence determination: Highly conserved domains among

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Tiwari%20S%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Mishra%20DK%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Roy%20S%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Singh%20A%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Singh%20PK%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Tuli%20R%22%5BAuthor%5D

Bibliography

112

the L (Polymerase) proteins of unsegmented negative–strand RNA viruses.

Virology 165: 565-567.

Tordo N., Bardane H., Bourhy H. and Sacramento D. (1993). Molecular

epidemiology of lyssaviruses. Focus on the glycoprotein and pseudogenes.

Onderstepoort Journal of Veterinary Research 60: 315-323.

Tordo N. and Kouknetzoff A. (1993). The rabies virus genome: an overview.

Onderstepoort Journal of Veterinary Research 60: 263-269.

Tregoning J.S., Nixon P., Kuroda H., Svab Z., Clare S. and Bowe F. (2003).

Expression of tetanus toxin Fragment C in tobacco chloroplasts. Nucleic Acids

Res 31: 1174–9.

Tsiang H., Koulakoff A., Bizzini B. and Berwald-Nettter Y. (1983). Neurotropism of

rabies virus.An in vitro study. J. Neuropath. Exp. Neurol. 42: 439-452.

Tsiang H. (1993). Pathophysiology of rabies virus infection of the nervous system.

Adv. Virus Research. 42: 375-412.

Tuboly T., Yu W., Bailey A., Degrandis S., Du S. and Erickson L. (2000).

Immunogenicity of porcine transmissible gastroenteritis virus spike protein

expressed in plants. Vaccine 18: 2023–8.

Tuchiya K., Matsuura Y., Kawai A., Ishihama A. and Ueda S. (1992).

Characterization of rabies virus glycoprotein expressed by recombinant

baculoviruses. Virus Res. 25: 1-13.

Tuffereau C., Leblois H., Benejean J., Coulon P., Lafay F. and Flamand A. (1989).

Arginine or lysine in Position 333 of ERA and CVS glycoprotein is necessary for

rabies virulence in adult mice. Virology 172: 206-212.

Tuffereau C., Benejean J., Blondel D., Kieffer B. and Flammand A. (1998a). Low–

affinity nerve growth factor receptor (P7 SNTR) can serve as a receptor for rabies

virus. EMBO J. 17: 7250-7259.

Tuffereau C., Benejean J., Roque Alfonso A.M., Flamand A. and Fishman M.C.

(1998b). Neronal cell surface molecules mediates specific binding to rabies virus

Bibliography

113

glycoprotein expressed by a recombinant baculovirus on the surface of

lepiodopteran cells. J. Virol. 72: 1085-1091.

Udomsuk L., Jarukamjorn K., Tanaka H. and Putalun W. (2009). Isoflavonoid

production in a hairy roots culture of Pueraria candollei. Z. Naturforsch. C. 64:

687-91.

Ugolini G., Kuypers H.G.J.M. and Strick P.L. (1989). Transneuronal transfer of

herpes virus from peripheral nerves to cortex and brainstem. Science 243: 89-91.

Verma P.C. (2003). Biotechnological approaches for in vitro production of picroliv

from Agrobacterium rhizogenes mediated hairy root cultures of Picrorhiza

kurroa Royle ex Benth. PhD Thesis, Lucknow University, Lucknow.

Verma P.C., Trivedi I., Singh H., Shukla A.K., Kumar M., Upadhyay S.K.,

Pandey P., Hans A.L. and Singh P.K. (2009). Efficient production of gossypol

from hairy root cultures of cotton (Gossypium hirsutum L.). Curr. Pharm.

Biotechnol. 10: 691-700.

Vishwanath R.L., Katz F.N., Lodish H.F. and Blobel G. (1978). A signal sequence

for the insertion of a transmembrane glycoprotein. J. Biol. Chem. 253: 8667-

8670.

Vitetta E. and Yen N. (1990). Expression and functional properties of genetically

engineered ricin B chain lacking galactose-binding activity. Biochim. Biophys.

Acta. 1049: 151–157.

Von Teichman B.F., Thomson G.R., Meredith C.D. and Nel L.H. (1995). Molecular

epidemiology of rabies virus in South Africa: evidence for two distinct virus

groups. Journal of General Virology 76: 73-82.

Waheed M.T., Thönes N., Müller M., Hassan S.W., Gottschamel J., Lössl E., Kaul

H.P. and Lössl A.G. (2011). Plastid expression of a double pentameric vaccine

candidate containing human papillomavirus-16 L1 antigen fused with LTB as

adjuvant: transplastomic plants show pleiotropic phenotypes. Plant Biotechnol. J.

9: 651-60.

http://www.ncbi.nlm.nih.gov/pubmed?term=Udomsuk%20L%5BAuthor%5D&cauthor=true&cauthor_uid=19957437

http://www.ncbi.nlm.nih.gov/pubmed?term=Jarukamjorn%20K%5BAuthor%5D&cauthor=true&cauthor_uid=19957437

http://www.ncbi.nlm.nih.gov/pubmed?term=Tanaka%20H%5BAuthor%5D&cauthor=true&cauthor_uid=19957437

http://www.ncbi.nlm.nih.gov/pubmed?term=Putalun%20W%5BAuthor%5D&cauthor=true&cauthor_uid=19957437

http://www.ncbi.nlm.nih.gov/pubmed?term=Isoflavonoid%20production%20in%20a%20hairy%20roots%20culture%20of%20Pueraria%20candollei.

http://www.ncbi.nlm.nih.gov/pubmed?term=Verma%20PC%5BAuthor%5D&cauthor=true&cauthor_uid=19751178

http://www.ncbi.nlm.nih.gov/pubmed?term=Trivedi%20I%5BAuthor%5D&cauthor=true&cauthor_uid=19751178

http://www.ncbi.nlm.nih.gov/pubmed?term=Singh%20H%5BAuthor%5D&cauthor=true&cauthor_uid=19751178

http://www.ncbi.nlm.nih.gov/pubmed?term=Shukla%20AK%5BAuthor%5D&cauthor=true&cauthor_uid=19751178

http://www.ncbi.nlm.nih.gov/pubmed?term=Kumar%20M%5BAuthor%5D&cauthor=true&cauthor_uid=19751178

http://www.ncbi.nlm.nih.gov/pubmed?term=Upadhyay%20SK%5BAuthor%5D&cauthor=true&cauthor_uid=19751178

http://www.ncbi.nlm.nih.gov/pubmed?term=Pandey%20P%5BAuthor%5D&cauthor=true&cauthor_uid=19751178

http://www.ncbi.nlm.nih.gov/pubmed?term=Hans%20AL%5BAuthor%5D&cauthor=true&cauthor_uid=19751178




Bibliography

114

Wales R., Richardson P., Roberts L., Woodland H. and Lord J. (1991). Mutational

analysis of the galactose binding activity of recombinant ricin B chain. J. Biol.

Chem. 266: 19172–19179.

Walmsley A.M. and Arntzen C.J. (2000). Plants for delivery of edible vaccines. Curr.

Opin. Biotechno. 11: 126-129.

Walmsley A.M., Alvarez M.L., Jin Y., Kirk D.D., Lee S.M. and Pinkhasov J.

(2003). Expression of the B subunit of Escherichia coli heat-labile enterotoxin as

a fusion protein in transgenic tomato. Plant Cell. Rep. 21: 1020–6.

Wang T., Chen J.P., Li H., Zhi K.Q., Zhang L., Yang C.L. and Tao D.C. (2005).

Co-expression and immunity of Legionella pneumophila mip gene and

immunoadjuvant ctxB gene. Acta. Biochim. Biophys. Sin. (Shanghai). 37: 199-

204.

Warner C.K., Schurr T.G. and Fekadu M. (1996). Molecular characterization of

carrier rabies isolates. Virus Research 41: 133-140.

Warzecha H., Mason H.S., Lane C., Tryggvesson A., Rybicki E. and Williamson

A.L. (2003). Oral immunogenicity of human papillomavirus-like particles

expressed in potato. J. Virol. 77: 8702–11.

Webster D.E., Cooney M.L., Huang Z., Drew D.R., Ramshaw I.A. and Dry I.B.

(2002) Successful boosting of a DNA measles immunization with an oral plant-

derived measles virus vaccine. J. Virol. 76: 7910–2

Webster D.E., Thomasc M.C., Huang Z. and Wesselingh S.L. (2005). The

development of a plant-based vaccine for measles. Vaccine 23: 1859–65.

Weiss R.A. and Bennet P.L.P. (1980). Assembly of membrane glycoproteins studied

by phenotypic mixing between mutants of vesicular stomatitis virus and

retroviruses. Virology 100: 252-274.

Whitt M., Buonocore L., Prehaud C. and Rose J. (1991). Membrane fusion activity,

oligomerization, and assembly of the rabies virus glycoprotein. Virology 185:

681-688.

http://www.ncbi.nlm.nih.gov/pubmed?term=Wang%20T%5BAuthor%5D&cauthor=true&cauthor_uid=15756423

http://www.ncbi.nlm.nih.gov/pubmed?term=Chen%20JP%5BAuthor%5D&cauthor=true&cauthor_uid=15756423

http://www.ncbi.nlm.nih.gov/pubmed?term=Li%20H%5BAuthor%5D&cauthor=true&cauthor_uid=15756423

http://www.ncbi.nlm.nih.gov/pubmed?term=Zhi%20KQ%5BAuthor%5D&cauthor=true&cauthor_uid=15756423

http://www.ncbi.nlm.nih.gov/pubmed?term=Zhang%20L%5BAuthor%5D&cauthor=true&cauthor_uid=15756423

http://www.ncbi.nlm.nih.gov/pubmed?term=Yang%20CL%5BAuthor%5D&cauthor=true&cauthor_uid=15756423

http://www.ncbi.nlm.nih.gov/pubmed?term=Tao%20DC%5BAuthor%5D&cauthor=true&cauthor_uid=15756423

http://www.ncbi.nlm.nih.gov/pubmed/?term=Co-expression+and+immunity+of+Legionella+pneumophila+mip+gene

Bibliography

115

Wigdorovitz A.W., Carrillo C., Dus Santos M.J., Trono K., Peralta A., Gomez

M.C., Rios R.D., Franzone P.M., Sadir A.M., Escribano J.M. and Borca

M.V. (1999). Induction of a protective antibody response to foot and mouth

disease virus in mice following oral or parental immunization with alfalfa

transgenic plants expressing the viral structural protein VP 1. Virology 255: 347-

353.

Wigdorovitz A., Mozgovoj M., Dus Santos M.J., Parreño V., Gómez C. and Pérez-

Filgueira D.M. (2004). Protective lactogenic immunity conferred by an edible

peptide vaccine to bovine rotavirus produced in transgenic plants. J. Gen. Virol.

85: 1825–32.

Wiktor T., Fernodes M.V. and Koprowski H. (1964). Cultivation of rabies virus in

human diploid cell strain WI–38. J. Immunol. 93: 353-366.

Wiktor T., Lerner R. and Koprowski H. (1971). Inhibitory effect of passive antibody

on active immunity induced against rabies by vaccination. Bull. Wld. Hlth. Org.

45: 747-753.

Wiktor T., Gyorgy E., Schlumberger H.D., Sokol F. and Koprowski H. (1973).

Antigenic properties of rabies virus components. J. Immunol. 110: 269-276.

Wiktor T. and Koprowski H. (1978). Monoclonal antibodies against rabies virus

produced by somatic cell hybridization: detection of antigenic variants. Proc.

Natl. Acad. Sci., U.S.A. 75: 3938-3942.

Wiktor T. and Koprowski H. (1980). Antigenic variants of rabies virus. J. Exp. Med.

152: 99-112.

Wiktor T., MaCFarlan R.T., Reagan K., Dietzschold B., Curtis P.J., Wunner

W.H., Kieny M.P., Lathe R., Lecocg J.P., Mackett M., Moss B. and

Koprowski H. (1984). Protection from rabies by a vaccinia virus recombinant

containing the rabies virus glycoprotein gene. Proc. Natl. Acad. Sci., U.S.A.

81: 7194-7198.

Bibliography

116

Wiktor T., Plotkin S. and Koprowski H. (1988). Rabies vaccine. In “Vaccines”,

Plotkin S. and Mortimer E. (Eds.), W.B. Saunders Company, Philadelphia,

London, Toronto. 474-491.

Witcher D.R., Hood E.E., Peterson D., Bailey M., Marshall L., Bond D., Ritland

D., Kusnadi A., Evangelista R., Nikolov Z., Wooge C., Mehigh R., Kappel B.,

Register J. and Howard J. (1998). Commercial production of -glucuronidase

(GUS): a novel system for the production of proteins in plants. Mol. Breed. 4:

301-312.

Woffenden B.J., Nopo L.H., Cramer C.L., Dolan M.C., Medina-Bolivar F. (2008).

Expression of a ricin B: F1: V fusion protein in tobacco hairy roots: steps toward

a novel pneumonic plague vaccine. Elect. Journ. Integrat. Biosci. 3: 10-19.

Wojczyk B., Shakin-Eshleman S.H., Doms R.W., Zhi-Quan X, Ertl. H.C.J.,

Wunner W.H. and Spitalnik S.L. (1995). Stable secretion of a soluble,

oligomeric form of rabies virus glycoprotein: influence of N-glycan processing on

secretion. Biochemistry 34: 2599-2609.

Wojczyk B.S., Stwora-Wojczyk M., Shakin-Eshleman S., Wunner W.H. and

Spitalnik S.L. (1998). The role of site-specific N-glycosylation in secretion of

soluble forms of rabies virus glycoprotein. Glycobiology 8:121-30.

Wongsamuth R. and Doran P.M. (1997). Hairy roots as an expression system for the

production of antibodies. In: Doran P.M. (Ed.), Hairy roots: culture and

application. Amstardam: Harwood Academic. 89-97.

World Health Organisation (WHO), 1984. Expert Committee on Rabies, 7th

Report.

WHO Tech. Rep. Ser. 709:9.

World Health Organisation (WHO), 1992. Expert Committee on Rabies. VIII

Report, WHO Technical Report. WHO Tech. Rep. Ser. 824.

World Health Organisation (WHO), 1994. Report of a WHO Workshop on

Prevention and Control of Rabies in Baltic Countries. Tallinn, Estonia, February

14-15. WHO/CDS/VPH/94.133. WHO, Geneva. 17.

http://www.ncbi.nlm.nih.gov/pubmed?term=Wojczyk%20BS%5BAuthor%5D&cauthor=true&cauthor_uid=9451021

http://www.ncbi.nlm.nih.gov/pubmed?term=Stwora-Wojczyk%20M%5BAuthor%5D&cauthor=true&cauthor_uid=9451021

http://www.ncbi.nlm.nih.gov/pubmed?term=Shakin-Eshleman%20S%5BAuthor%5D&cauthor=true&cauthor_uid=9451021

http://www.ncbi.nlm.nih.gov/pubmed?term=Wunner%20WH%5BAuthor%5D&cauthor=true&cauthor_uid=9451021

http://www.ncbi.nlm.nih.gov/pubmed?term=Spitalnik%20SL%5BAuthor%5D&cauthor=true&cauthor_uid=9451021


Bibliography

117

World Health Organisation (WHO), 1996. The World Health Report 1996. Fighting

disease Fostering development. WHO, Geneva. 57-58.

Wu Y.Z., Li J.T., Mou Z.R., Fei L., Ni B. and Geng M. (2003). Oral immunization

with rotavirus VP7 expressed in transgenic potatoes induced high titers of

mucosal neutralizing IgA. Virology 313: 337–42.

Wunner W.H., Curtis P.J. and Wiktor T.J. (1980). Rabies mRNA translation in

Xenopus laevis oocytes. J. Virol. 36: 133-142.

Wunner W.H., Reagan K.J. and Koprowski H. (1984). Characterization of saturable

binding sites for rabies virus. J. Virol. 50:691-697.

Wunner W., Dietzschold B., Smith C., Lafon M. and Golub E. (1985a). Antigenic

variants of CVS rabies virus with altered glycosylation sites. Virology 140: 1-12.

Wunner W., Dietzschold B., MaCfarlan R., Smith C., Golub E. and Wiktor T.

(1985b). Localization of immunogenic domains on the rabies virus glycoprotein.

Ann. Inst. Pasteur. 136E: 353-362.

Wunner W., Larson J.K., Dietzschold B. and Smith C. (1988). The molecular

biology of rabies viruses. Rev. Infect. Dis. 10:771-783.

Wunner W. (1991). The chemical composition and structure of rabies viruses. In: The

Natural History of Rabies, Baer G.M. and Boca Raton F.L. (Eds.), CRC Press.

31-67.

Xiang Z., Spitalnik S., Tran M., Wunner W., Chen J. and Ertl H. (1994).

Vaccination with a plasmid vector carrying the rabies virus glycoprotein gene

induces protective immunity against rabies virus. Virology 199: 132-140.

Xiang Z., Kwowles B., McCarrick J. and Ertl H. (1995b). Immune effector

mechanisms required for protection to rabies virus. Virology 214: 398-404.

Xiang Z., Spitalnik S., Cheng J., Erikson J., Wojczyk B. and Ertl H. (1995a).

Immune responses to nucleic acid vaccines to rabies virus. Virology 209: 569-

579.

List of Publications

Publications

119

List of publications

1. Singh A, Verma PC, Mishra DK, Srivastava S, Chouksey A, Roy

S, Singh

PK,

Saxena G and Tuli R. (2013) Expression of Rabies glycoprotein and Ricin toxin B

chain (RGP-RTB) fusion protein in tomato hairy roots: A step for Oral Vaccination

for rabies. Journal of Biotechnology (communicated)

2. Singh A, Yadav D, Rai KM, Srivastava M, Verma PC, Singh PK and Tuli R. (2012)

Enhanced expression of rabies virus surface G-protein in E. coli using SUMO fusion.

Protein J; 31: 68-64.

3. Roy S, Tyagi A, Tiwari S, Singh A, Singh PK, Sawant SV and Tuli R. (2010) Rabies

glycoprotein fused with B subunit of cholera toxin is expressed at high level in

tobacco plants and folds into biologically active pentameric protein. Protein Expr

Purif; 70(2): 184-90.

4. Tiwari S, Mishra DK, Roy S, Singh A, Singh PK, Tuli R. (2009) High level

expression of a functionally active cholera toxin B: rabies glycoprotein fusion protein

in tobacco seeds. Plant Cell Rep; 28(12):1827-36.


http://www.ncbi.nlm.nih.gov/pubmed?term=%22Tiwari%20S%22%5BAuthor%5D


http://www.ncbi.nlm.nih.gov/pubmed?term=%22Roy%20S%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Singh%20A%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Singh%20PK%22%5BAuthor%5D

http://www.ncbi.nlm.nih.gov/pubmed?term=%22Tuli%20R%22%5BAuthor%5D

Date post:	27-May-2018
Category:	Documents
Upload:	vuthien
View:	221 times
Download:	0 times

Expression of rabies virus coat protein in plants and its...

Documents