www.elsevier.com/locate/vetimm

Veterinary Immunology and Immunopathology 104 (2005) 117–127

Expression patterns of chicken Toll-like receptor mRNA

in tissues, immune cell subsets and cell lines

Muhammad Iqbal, Victoria J. Philbin, Adrian L. Smith*

Enteric Immunology Group, G2D Stewart Building, Division of Immunology and Pathology, Institute for Animal Health,

Compton Laboratory, Compton, Newbury, Berkshire, RG20 7NN, UK

Received 3 May 2004; received in revised form 13 October 2004; accepted 8 November 2004

Abstract

The Toll-like receptor (TLR) family of cell surface molecules represent a major component of the pattern recognition

system, which enables both vertebrates and invertebrates to detect invading microorganisms and mount an anti-microbial

response. The TLR repertoire of mouse and man has been intensively studied and in this manuscript we report the identification

of ESTs with homology to chTLR5 and chTLR7, and independently confirm the identification of chTLR 1/6/10 and 3 in the EST

databases. We have determined the mRNA expression patterns for seven chicken TLRs (chTLR) in a wide range of chicken

tissues, isolated immune cell types and cultured cells. Some of the chTLR were expressed in most tissues (chTLR1/6/10,

chTLR3, chTLR4 and chTLR5), whereas others exhibited more restricted expression patterns (chTLR2 type 1, type 2 and

chTLR7). Similarly distinct patterns of chTLR expression were seen with innate and adaptive immune cell types isolated from

peripheral blood or spleen and with cultured cells of somatic or immunological origin. An understanding of the TLR repertoire

for different tissues, immune cell subsets and cultured cell types allows more refined interpretation of immune induction in

response to chicken pathogens.

# 2004 Elsevier B.V. All rights reserved.

Keywords: Toll-like receptors; Innate immunity; Chickens

1. Introduction

Toll-like receptors (TLRs) are well recognized as

major components of the pattern recognition receptor

Abbreviations: chTLR, chicken Toll-like receptor; EST,

expressed sequence tag

* Corresponding author. Tel.: +44 1635 577293;

fax: +44 1635 577263.

E-mail address: adrian.smith@bbsrc.ac.uk (A.L. Smith).

0165-2427/$ – see front matter # 2004 Elsevier B.V. All rights reserved

doi:10.1016/j.vetimm.2004.11.003

system (Medzhitov and Janeway, 2000; Akira, 2004;

Beutler, 2004) that detects invading pathogens by

virtue of a series of conserved molecular structures

known as pathogen associated molecular patterns

(PAMPs). The importance of TLR function is evident

by their role in the immune system of organisms as

diverse as Drosophila and man. Although studies of

TLR immune function are most advanced in mouse

and man, a series of TLRs have been identified in other

vertebrates including fish (Oshiumi et al., 2003;

.

M. Iqbal et al. / Veterinary Immunology and Immunopathology 104 (2005) 117–127118

Hirono et al., 2004; Jault et al., 2004; Meijer et al.,

2004), chickens (Fukui et al., 2001; Leveque et al.,

2003) and cattle (Werling and Jungi, 2003).

Toll-like receptors are type 1 transmembrane

proteins with N-terminal extracytoplasmic leucine-

rich repeat (LRR) domains and an intracytoplasmic

conserved region called the TIR (Toll/IL1-R) domain,

with homology to the mammalian interleukin 1

receptor (IL1-R) and plant disease resistance genes

(Rock et al., 1998). TLRs induce signals through TIR

domains that interact with different adapter proteins

such as MyD88, resulting in the activation of nuclear

factor kB (NF-kB) and the mitogen-activated protein

kinase signaling cascade (Barton and Medzhitov,

2003).

The TLRs have distinct specificity, with particular

PAMPs acting as agonists for different TLRs. These

agonists (and their associated TLR) include lipopo-

lysaccharide (LPS) from gram negative bacteria

(TLR4), lipoprotein and peptidoglycan from gram

positive bacteria (TLR1, 2 and 6), flagellin (TLR5),

double stranded RNA (TLR3), unmethylated CpG

dinucleotide motifs (TLR9), single stranded uridine

rich RNA (TLR7) and the synthetic antiviral

compound R-848 (TLR7 and TLR8). Upon activation

with an appropriate ligand, TLRs induce a range of

responses including cell proliferation or maturation

and the production of various cytokines, chemokines

or effector molecules, including nitric oxide and

reactive oxygen intermediates (e.g., Thoma-Uszynski

et al., 2000; Hemmi et al., 2002; Smith et al., 2003).

Signalling through TLRs leads to widespread immune

induction of the cellular components of the innate and

adaptive immune systems as well as directing the host

response into particular differentiation pathways.

In the chicken, TLR2 and TLR4 have been

identified and characterised at molecular and func-

tional levels (Boyd et al., 2001; Fukui et al., 2001;

Leveque et al., 2003). Interestingly, Fukui et al. (2001)

identified two types of chicken TLR2 and mapped

them both to the same chromosomal location on

chicken chromosome 4, suggesting that they arose by

gene duplication (Fukui et al., 2001). Chicken ESTs

have been identified with highest homology to

mammalian TLR 1, 6 or 10 and TLR3 (Lynn et al.,

2003). We have independently identified these ESTs

and also identified ESTs with high homology to TLR5

and TLR7 (this paper). Moreover, chicken ESTs have

been identified with homology to many components of

the known TLR signaling pathways (Lynn et al., 2003)

suggesting there are considerable similarities between

the mammalian and chicken TLR systems.

The tissue and cell distribution is an important

characteristic of TLR function since it influences the

capacity to detect different microorganisms during

their entry via, and growth in, different tissues. The

distribution of mammalian TLRs has revealed

characteristic patterns of expression for each TLR

(e.g., Sebastiani et al., 2000; Rehli, 2002; Zarember

and Godowski, 2002; Zhang et al., 2004) and in this

manuscript we have determined the distribution of

chTLR mRNA in tissues, immune cell subsets and in a

variety of chicken cell lines. A number of studies have

defined the response of cultured chicken cells after

exposure to a variety of challenges with microorgan-

isms or their products (e.g., Zhang et al., 1995; Kaiser

et al., 2000; Dil and Qureshi, 2002a; Farnell et al.,

2003; Kogut et al., 2003). We used RT-PCR to

determine the TLR repertoire of chicken tissues, ex

vivo sorted cell populations and commonly used

cultured cell types. Understanding the distribution

patterns of chTLR will enable more defined inter-

pretation of immune induction and the host-pathogen

relationships that define infectious disease biology in

the chicken.

2. Materials and methods

2.1. Experimental animals

Specific-pathogen-free inbred Line 72 (White

Leghorn) and Rhode Island Red chickens were

maintained by the Poultry Production Unit of the

Institute for Animal Health (IAH), Compton Labora-

tory. The birds did not receive any vaccination and

were reared in wire cages and given ad libitum access

to water and a vegetable-based protein diet (Special

Diet Services, Witham, UK).

2.2. Database mining

Chicken EST databases were screened with DNA

sequences from human TLR1-10 deposited in EMBL

(http://www.ebi.ac.uk; see Table 1 for the relevant

accession numbers) and by key word searches, in the

M. Iqbal et al. / Veterinary Immunology and Immunopathology 104 (2005) 117–127 119

Table 1

Sequence of primers used in RT-PCR

Primer Sequence Accession number

TLR1/6/10 F CGGAAAGCCTATCATTGTCA BQ484541/BU471924

TLR1/6/10 R TTTGTCTGCGTCCACTGC BQ484541/BU471924

TLR2 type1 F TTAAAAGGGTGTGCCAGGAG AB050005

TLR2 type1 R GTCCAAACCCATGAAAGAGC AB050005

TLR2 type2 F AGGCACTTGAGATGGAGCAC AB046533

TLR2 type2 R CCTGTTATGGGCCAGGTTTA AB046533

TLR3 F CCACTCTGGAAGAAAATGAGC BI066273

TLR3 R TCATTCTCACCGCTTTTCAG BI066273

TLR4 F AGTCTGAAATTGCTGAGCTCAAAT AY064697

TLR4 R GCGACGTTAAGCCATGGAAG AY064697

TLR5 F TGCACATGTTTTCTCCTAGGT AJ626848

TLR5 R CCACATCTGACTTCTGCCTTT AJ626848

TLR7 F GCCTCAAGGAAGTCCCCAGA AJ632302

TLR7 R AAGAAACATTGCATGGATTACGG AJ632302

b-Actin F TGCTGTGTTCCCATCTATCG L08165

b-Actin R TTGGTGACAATACCGTGTTCA L08165

period between January 2001 and April 2002. The

databases contained sequences originating from bursal

cell cDNA library (Buerstedde et al., 2002) or from a

range of control and infected chicken tissues

(Tirunagaru et al., 2000). All sequences corresponding

to potential chicken TLRs were re-screened against

mammalian sequence databases to identify or confirm

the mammalian TLR with the highest degree of

sequence similarity.

2.3. Tissue collection, cell isolation and cell cultures

All tissue samples were obtained from inbred 8-

week-old Line 72 (White Leghorn) chickens main-

tained under SPF conditions at the IAH, Compton.

Chicken tissues were immediately placed in RNA later

(Qiagen) and stored temporarily in the fridge before

longer term storage at �20 8C according to manu-

facturer’s instructions.

Splenic B cells, CD4+, CD8+, TCR1, TCR2 and

TCR3 were enriched by sorting with magnetic beads

(Miltenyi) using the AutoMACSTM system, according

to manufacturer’s instructions. Briefly, spleens were

disrupted by passage through a coarse sieve and

lymphocytes isolated using Ficoll-PaqueTM Plus

(Amersham Biosciences). The spleen cell suspension

was incubated with primary antibodies (all obtained

from Southern Biotechnology) against B cells or T cell

subsets as follows: anti-Bu-1 PE, anti-CD4 FITC, anti-

CD8a PE, anti-TCR1 (IgG1; TCRgd) or anti-TCR3

(IgG1; TCRab2) at 200 ml/108 cells or TCR2 PE

(TCRab1) at 500 ml/108 PBS- 0.5% BSA diluent for

15 min on ice. Following washing by centrifugation

and resuspension of the cell pellet in PBS-0.5% BSA,

different cell populations were isolated by positive

selection using anti-fluorochrome or rat anti-mouse

IgG1 conjugated paramagnetic beads (Miltenyi

Biotech) after 15 min incubation on ice using the

AutoMACSTM system (Miltenyi Biotech). The sorted

cell populations were enriched to 90% or greater

purity, except for the CD4+ cell population, which was

71%, as measured by FACS analysis. Peripheral blood

monocyte-derived macrophages were obtained from

Line 72 chickens according to the methodology of

(Wigley et al., 2002). Heterophils were isolated from

peripheral blood as described by (Kogut et al., 1995)

and were in excess of 90% purity by microscopic

analysis of hematoxylin/eosin stained cytospin pre-

parations.

Primary cell cultures of chicken kidney (2-week-old

chickens) and embryonic fibroblasts (10 day embryos)

were prepared by the IAH cell culture service

according to standard techniques. All cells were

cultured in RPMI 1640 medium supplemented with

penicillin/streptomycin, 7% foetal calf serum and 3%

chicken serum (complete medium) at 41 8C, 5% CO2.

The macrophage-like HD11 cell line (Beug et al., 1979)

and the bursal B cell-like lymphoma DT40 (ATCC:-

CRL2111) were grown in 80 cm2 tissue culture flasks

with complete medium at 41 8C, 5% CO2.

M. Iqbal et al. / Veterinary Immunology and Immunopathology 104 (2005) 117–127120

Isolated cell subsets or cultured cells were

disrupted directly in RLT buffer (Qiagen) and frozen

at �20 8C until RNA extraction.

2.4. RNA extraction

Chicken tissues were disrupted by homogenisation

using a mini-bead beater (Biospec products). RNA

was extracted, from tissue homogenates or disrupted

cells, in the presence of buffer containing b-

merceptoethanol and guanidine by using RNeasy

Mini Kit (Qiagen) following manufacturer’s instruc-

tions. To avoid contamination with DNA the samples

were exposed to an on-column treatment with RNase-

Free DNase 1 (Qiagen) for 90 min at room tempera-

ture (20–25 8C). The column was washed with RW1

and RWP buffers and the RNA eluted with RNase free

water.

2.5. RT-PCR

The extracted RNA was reverse transcribed using

the Promega Reverse Transcription kit (Promega)

according to manufacturer’s instructions. Briefly,

oligo dT primer (0.5 mg) was used to reverse

transcribe 1 mg of respective RNA in the presence

of dNTP’s (250 mM), reverse transcriptase buffer

(10 mM Tris–HCl, 50 mM KCl, 0.1% TritonR-X-100),

AMV Reverse Transcriptase High Conc. (15 units/mg)

and RNasin Ribonuclease inhibitor (1 unit/ml) at

42 8C for 60 min following inactivation at 99 8C for

5 min.

All RNA preparations were standardised by RT-

PCR for b-Actin (see Table 1 for primer sequences)

and were free from DNA contamination as judged by a

lack of signal from non-reverse transcribed RNA with

all primer sets (data not shown).

Polymerase chain reactions (PCR) were performed

according to standard protocols with primers indicated

in Table 1. Briefly, cDNA (3 ml) was reacted with

200 mM dNTPs, 1 � reaction buffer (Promega),

forward and reverse primers (5 pM) and 0.5 units

Taq polymerase (Promega) in 50 ml final reaction

volume. PCR conditions were as follows, 1 cycle,

95 8C for 2 min followed by 30 cycles of 30 s at 95 8C,

58 8C for 1 min and 72 8C for 2 min followed by 1

cycle at 72 8C for 10 min using a iCycler (BIO RAD).

The amplified products were analysed by agarose gel

(2%) electrophoresis in 0.5� TBE buffer at 50 mA for

1 h and products visualised by staining with ethidium

bromide.

3. Results and discussion

The TLRs represent an evolutionary highly

conserved group of pattern recognition receptors,

involved in the induction of anti-microbial responses

in species as diverse as flies, fish, mouse and man.

Although the TLRs are germ-line encoded and can be

considered receptors of the innate immune system,

TLR-mediated signals are central players in the

induction and differentiation of adaptive immune

responses.

To date, homologues of TLR2 and TLR4 have been

characterised in the best-studied avian genome, the

chicken, Gallus gallus domesticus. Interestingly,

chTLR2 genes have been described which co-localise

to a region on chicken chromosome 4, suggesting that

they arose by gene duplication (Fukui et al., 2001).

Although type 1 chTLR2 and type 2 chTLR2 share

88.5% nucleic acid homology with each other, only

chTLR2 type 2 mediates a strong response to classical

mammalian TLR2 agonists (Fukui et al., 2001). There

is a single TLR2 gene in mammals although two other

sets of mammalian TLRs seem to have arisen by local

gene duplication. TLR1, 6 and 10 lie adjacent to each

other on human chromosome 4 (Takeuchi et al., 1999)

and TLR7 and TLR8 lie adjacent to each other on the

X chromosome (Du et al., 2000). Evidence for similar

duplication events can be found with zebrafish TLR4

and TLR8 genes (Jault et al., 2004; Meijer et al.,

2004). Chicken TLR4 has also been cloned and

mapped to a region associated with susceptibility to

Salmonella infection in some inbred chicken lines

(Leveque et al., 2003). Chicken TLR2 and TLR4 share

52 and 46% overall identity with human TLR2 and

TLR4, respectively at the protein level, with the

greatest degree of homology being seen in the TIR

domain. The homology and mapping data indicate that

TLR2 and TLR4 were distinct entities before the

divergence of birds and mammals over 300 million

years ago.

Analysis of various databases revealed the exis-

tence of chicken ESTs with highest sequence

homology to human TLR1, TLR2, TLR3, TLR4,

M. Iqbal et al. / Veterinary Immunology and Immunopathology 104 (2005) 117–127 121

TLR5, TLR6 and TLR7 (Table 1). Lynn et al. (2003)

reported the identification of ESTs with sequence

homology to human TLR1, 6 or 10 and TLR3, our

independent analysis confirmed these findings and

identified further ESTs with sequence similarity to

TLR5 and TLR7 (Table 1). The genomic localisation

for chTLR3 (chromosome 4), chTLR5 (chromosome

3) and chTLR7 (chromosome 1) has been identified

experimentally and these TLRs have been subjected to

detailed functional analysis (manuscript in prepara-

tion). Two non-overlapping EST with similarity to

TLR1, 6 or 10 were identified but RT-PCR revealed

that these two EST represent a single RNA species,

which was confirmed by sequence of the RT-PCR

product (data not shown). Hence, we have only

performed RT-PCR with primers designed to

amplify the longer product and the extra sequence

that we obtained also failed to discriminate between

TLR1, 6 or 10 as the orthologous sequence. Indeed,

molecular evolutionary analysis of TLR1, 6 and 10

TIR sequences suggest that the ancestral TLR first

duplicated in mammals at around the time of

divergence from birds (�300 million years ago)

followed by a later duplication at �130 million

years ago (Beutler and Rehli, 2002). Detailed analysis

of the genomic region containing chTLR7 has

revealed that chTLR8 is disrupted (manuscript in

preparation). We were unable to identify any EST

with sequence homology to human TLR9 or mouse

TLR11.

In order to define the cell and tissue distribution for

the chTLR mRNAs we designed primers using the

available EST sequences, the coding sequence for

chTLR5 and chTLR7 that we have obtained (manu-

scripts in preparation) or previously published coding

sequences to generate chTLR-specific RT-PCR pro-

ducts. Tissue-specific expression of TLRs has been

assessed in man, mouse and fish (e.g., Sebastiani et al.,

2000; Zarember and Godowski, 2002; Jault et al.,

2004; Meijer et al., 2004; Zhang et al., 2004) revealing

distinct distribution patterns for each TLR. Tissue-

specific expression of the chTLR mRNA was assessed

in 18 different tissues obtained from 8-week-old Line

72 chickens. The tissues included those with primary

immunological function (thymus, bursa of Fabricius,

bone marrow and spleen), dominated by epithelial

cells (kidney, liver), neurological (brain), muscle

(skeletal and heart) as well as tissues that interface

with the internal (various regions of the small and

large intestine) and external (skin) milieu.

To allow comparison of the expression of chTLRs

between different tissues the chicken tissue cDNA

pools were normalised by RT-PCR to the house

keeping gene b-actin. All RNA samples used for

cDNA synthesis were demonstrated to be free from

genomic DNA contamination by the absence of

product on non-reverse transcribed samples (data

not shown). Although the analysis is not strictly

quantitative, all RT-PCRs were performed in parallel

with a non-saturating number of cycles therefore,

comparison of the levels of signal give a guide of

relative tissue expression of the respective TLR

mRNA.

A broad pattern of tissue expression was obtained

for chTLR1/6/10, chTLR3, chTLR4 and chTLR5

mRNA in tissues that comprise either a large or

minimal immunological compartment (Fig. 1). For

example, chTLR1/6/10 mRNA was expressed at

reasonably high levels in the spleen and in the kidney,

the latter a tissue without an organised immune

compartment. The breadth of tissue expression for

chTLR1/6/10 is in contrast with humans in where the

three similar TLRs are mostly expressed in the spleen

and peripheral blood lymphocytes (Zarember and

Godowski, 2002). Similarly, the expression patterns of

chTLR3, 4 and 5 share some aspects of tissue

expression patterns with humans but there are also

significant differences in the levels of expression in

different tissues (for example, compare our data with

that of Rock et al., 1998; Zarember and Godowski,

2002). With chTLR4 the level of mRNA appears to be

highest in tissues that have relatively high numbers of

macrophages or macrophage-like cells, including the

liver which is populated by large numbers of Kupffer

cells.

The expression of chTLR2 type 1, chTLR2 type 2

and TLR7 was more restricted than that seen with the

other chTLRs and highest levels of expression were

found in tissues with large immunological compart-

ments. Chicken TLR2 type 1 had a much more

restricted tissue expression than chTLR2 type 2, with

the former only being expressed at moderate levels in

the spleen, caecal tonsil and liver samples. These data

are in agreement with that of Fukui et al. (2001)

although we have extended analysis to a broader range

of tissues. A range of tissues derived from different

M. Iqbal et al. / Veterinary Immunology and Immunopathology 104 (2005) 117–127122

Fig. 1. Tissue expression of chTLR mRNA. Tissues obtained from 8-week-old Line 72 chickens and subjected to RT-PCR using primers as

indicated in Table 1. RT-ve, PCR with non-reverse transcribed RNA. The data are representative of three replicate experiments.

parts of the chicken gut were strongly positive for all

of the chTLR, a finding which may reflect the

complexity of this tissue that has large somatic and

immunological components. Moreover, enterocytes

that interface with the contents of the gut lumen have

been shown to express a range of TLR in mammalian

species (Gewirtz et al., 2001; Hausmann et al., 2002)

probably reflecting their role in early detection of

invading microorganisms. For clarity, a summary of

the relative expression of different chicken TLR

mRNA in various tissues is depicted in Table 2.

The distribution of mRNA for chTLRs was also

assessed on a range of immunological cell subsets

including macrophages, heterophils and magnetically

enriched splenic B and T cell subsets (Fig. 2a and

Table 2). With some chTLRs (TLR1/6/10, TLR3,

TLR4 and TLR5) specific RT-PCR products were

detected in all immune cell populations although the

level of expression was different for the different cell

subsets. Briefly, for chTLR1/6/10 expression was

highest in the heterophil and B cell enriched fractions.

Chicken TLR2 type 2 mRNA was detected with most

cell subsets and was highest in B cell and CD8+

fractions. In contrast, chTLR2 type 1 was expressed on

a more restricted subset of cell populations (hetero-

phils and TCRab+ T cell subsets) with the highest

signal detected within the heterophil fraction. A broad

range of cell populations expressed chTLR3 mRNA

but the CD8a and TCR1 (TCRgd) enriched fractions

gave the highest levels of RT-PCR signal with no

signal being detected in peripheral blood monocyte-

derived macrophages. Similarly, chTLR5 expression

was low on macrophages compared with most other

cell subsets and most highly represented in hetero-

phils. In contrast, chTLR4 mRNA was more highly

represented in macrophages and heterophils than with

M. Iqbal et al. / Veterinary Immunology and Immunopathology 104 (2005) 117–127 123

Table 2

Summary of chTLR mRNA expression

TLR1/6/10 TLR2 Type1 TLR2 Type2 TLR3 TLR4 TLR5 TLR7

Tissues

Duodenum +++ + + ++++ ++ ++ +

Jejunum +++ + + ++++ ++ ++ +

Ileum +++ + + ++++ ++ ++ +

Caecum +++ + + ++++ ++ ++ +

Colon +++ + + ++++ ++ ++ +

Thymus +++ + + +++ ++ ++ +

Spleen +++ ++ ++ +++ ++ ++ +

Ceacal tonsil +++ ++ ++ ++++ +++ ++ ++

Bursa +++ + ++ + +/� + +

Lung +++ +/� +/� +++ + ++ +

Liver +++ ++ ++ ++++ ++ ++ +

Kidney + � + ++++ + ++ +

Brain + � + ++ + + �Testes + � + +++ + ++ �Heart + � + ++ + ++ +/�Bone marrow + � + + + + +

Muscle + � +/� +/� � + �Skin + � � � � + �

Cultured cells

CKC � + � + + ++ �CEF + + � ++ + +++ +/�DT-40 ++ ++ +++ + + +/� ++

HD11 +++ ++ + + +++ + ++++

Immune cell subsets

Macrophages + � + � ++++ + +

Heterophils +/� ++ + + ++++ +++ +/�B cells ++ +/� +++ + ++ ++ ++++

CD4+ ++ � + + + + +++

CD8+ ++ + ++ +++ ++ ++ ++

TCR1 (gd) + � + ++ + + +

TCR2 (ab1) + + + + + + +

TCR3 (ab2) + + + + + + +

Relative level of RT-PCR product denoted on a � (undetectable signal) to ++++ (strong signal) scale. Total RNAwas isolated from tissues, blood

monocyte derived macrophages, blood heterophils, magnetically sorted spleen cell subpopulations and cultured cells. These data summarise RT-

PCR presented in Figs. 1 and 2. CKC, chicken kidney cells; CEF, chicken embryo fibroblasts and has been constructed from three independent

experiments for each sample set.

other immune cell populations. As is the case with

mammalian TLR7, chTLR7 was expressed predomi-

nantly within the B cell fraction but was also detected

on various T cell subsets. We also detected a faint

signal within the polymorphonuclear cell fraction

(heterophils), which is similar to that reported with

murine eosinophils and neutrophils (Nagase et al.,

2003).

When chTLR expression is assessed in various cell

fractions it is clear that some cell subsets expressed a

greater repertoire of chTLR than other cell types. Most

notably, peripheral blood monocyte-derived macro-

phages expressed considerable levels of chTLR4 and

chTLR1/6/10, moderate levels of chTLR2 type 2, low

but detectable levels of chTLR5 and chTLR7 and no

chTLR3 or chTLR2 type 1 message. Heterophils

expressed message for all of the known chTLRs with

chTLR1/6/10, chTLR2, chTLR4 and chTLR5 most

prominent, moderate expression for chTLR3 and low

but detectable levels for chTLR7. These patterns of

chTLR mRNA expression in immune cell subsets are

broadly similar to those detected in mammalian

species (Applequist et al., 2002; Hornung et al., 2002;

Zarember and Godowski, 2002) with the broadest

M. Iqbal et al. / Veterinary Immunology and Immunopathology 104 (2005) 117–127124

Fig. 2. Expression of chTLR mRNA in immune cell populations and cultured cells. (a) Total RNA was isolated from blood monocyte derived

macrophages, blood heterophils and magnetically sorted spleen cell subpopulations. (b) Total RNA was isolated from cultured cell types. CKC,

chicken kidney cells; CEF, chicken embryo fibroblasts; DT-40 (B cell-like cell line); HD11 (chicken macrophage-like cell line). RT-ve, PCR with

non-reverse transcribed RNA. The data are representative of three replicate experiments.

range of TLR expression on cell subsets representing

the innate immune system.

Two widely used primary cell culture systems were

selected for analysis, representing somatic cells of

predominantly epithelial (chicken kidney; CKC) or

fibroblast (chicken embryo fibroblasts; CEF) origin.

Two established cell lines, both of immunological cell

derivation (DT40 and HD11), were also assessed for

their chTLR repertoire. The DT40 cell line

(ATCC:CRL2111) is derived from an avian leukosis

virus-transformed pre-B-cell, whereas the HD11 cell

line (Beug et al., 1979) is a retrovirally transformed

macrophage-like cell line. These four cell culture

systems have proven valuable tools for studies of the

interaction of cells with pathogens or pathogen-

derived products (e.g., Zhang et al., 1995; Kaiser et al.,

2000; Farnell et al., 2003; Kogut et al., 2003) and

determination of the TLR repertoires would allow

more refined interpretation of such studies in the

future. For example, Kaiser et al. (2000) documented

the differential production of pro-inflammatory

cytokines after exposure of CKC to the Salmonella

enterica serovars Typhimurium, Enteritidis and

Gallinarum. One obvious difference in TLR agonists

is the flagella status of these organisms, S. Gallinarum

is an aflagellate serovar, which obviously has

implications for TLR5 signalling since CKC are

TLR5 positive (see below).

Although most of the chTLRs (chTLR1/6/10,

chTLR2 type 1, chTLR3, 4 and 5) could be detected

in all four cultured cell types chTLR2 type 2 was only

detected in the cultured cell lines of immunological

origin (DT-40 and HD11). Chicken TLR7 mRNA was

principally detected in the immune-derived cell lines

although a very faint RT-PCR product was detected in

the CEF cell cultures. Nonetheless, the relative

M. Iqbal et al. / Veterinary Immunology and Immunopathology 104 (2005) 117–127 125

intensity of the chTLR PCR products differed

considerably between the cultured cell types. Briefly,

of the broadly expressed chTLRs, chTLR3 and

chTLR5 were expressed at higher levels in somatic

cell cultures (CKC and CEF), whereas chTLR1/6/10,

chTLR2 type 1 and chTLR4 were expressed in at

higher levels in one, or both (chTLR1/6/10), of the

immune derived cell lines. The RT-PCR product for

chTLR2 type 2 was most intense in the DT40 cells (B

cell-like) and the chTLR4 product was most intense in

the macrophage-like cell line (HD11). A summary of

the expression patterns is depicted in Table 2.

The high expression of chTLR7 mRNA in the

HD11 cell line may be considered surprising (ex vivo,

TLR7 expression is highest in B cells and dendritic

cell subsets) but many murine macrophage-like cell

lines including J774 cells express TLR7 message at

high levels (Applequist et al., 2002). Moreover, we

have determined that the chTLR7 found in HD11 cells

is functional and exposure to imadazoquinoline

agonists stimulates upregulation of cytokine mRNA

(manuscript in preparation). The high levels of chTLR

expression in the primary somatic cell dominated

cultures (CKC and CEF) indicate the importance of

epithelial and fibroblastic cell types in the sensing of

microbial invasion. The role of some epithelial cell

subsets in induction of immunity is becoming more

apparent, particularly with reference to the gut

enterocytes (e.g., Cario and Podolsky, 2000; Gewirtz

et al., 2001).

In this report, we have documented the expression

of chTLR mRNA in a broad range of tissues, isolated

immune cell subsets and cultured cell populations.

While many of the patterns of chTLR expression are

broadly comparable to that found for mammalian

TLRs there do appear to be some significant

differences that are specific to the chicken. It is of

note that there are also substantial differences in the

patterns of TLR expression between mouse and man

(Rehli, 2002) indicating the importance of determin-

ing the distribution of TLR in the target species. More

detailed analysis of the regulation of expression of

TLR in a non-mammalian system, especially one

with well documented patterns of pathogen challenge

(e.g. the chicken), may offer opportunities to

define evolutionarily important components in the

regulation of TLR expression. We recognise that the

expression profiles documented in this manuscript

only represent a starting point in the analysis of chTLR

since there may be differences associated with host

genetics (e.g., with TLR4 polymorphism (Leveque

et al., 2003); or expression levels, (Dil and Qureshi,

2002a,b) or environmental factors (e.g., the presence

of challenge infections). Nevertheless, the work

presented represents an important contribution to

understanding the induction of avian immune

responses and disease processes and may ultimately

lead to the formulation of rational immunological

intervention strategies.

Acknowledgements

The authors wish to acknowledge the input of Dr.

Yvonne Boyd for discussions and comment on the

manuscript. The work was supported by the BBSRC

Grant numbers 201/S15839 and 02/A1/S/08451, and

the IAH.

References

Akira, S., 2004. Toll receptor families: structure and function.

Semin. Immunol. 16, 1–2.

Applequist, S.E., Wallin, R.P., Ljunggren, H.G., 2002. Variable

expression of Toll-like receptor in murine innate and adaptive

immune cell lines. Int. Immunol. 14, 1065–1074.

Barton, G.M., Medzhitov, R., 2003. Toll-like receptor signaling

pathways. Science 300, 1524–1525.

Beug, H., von Kirchbach, A., Doderlein, G., Conscience, J.F., Graf,

T., 1979. Chicken hematopoietic cells transformed by seven

strains of defective avian leukemia viruses display three distinct

phenotypes of differentiation. Cell 18, 375–390.

Beutler, B., 2004. Innate immunity: an overview. Mol. Immunol. 40,

845–859.

Beutler, B., Rehli, M., 2002. Evolution of the TIR, tolls and TLRs:

functional inferences from computational biology. Curr. Top.

Microbiol. Immunol. 270, 1–21.

Boyd, Y., Goodchild, M., Morroll, S., Bumstead, N., 2001. Mapping

of the chicken and mouse genes for toll-like receptor 2 (TLR2) to

an evolutionarily conserved chromosomal segment. Immunoge-

netics 52, 294–298.

Buerstedde, J.M., Arakawa, H., Watahiki, A., Carninci, P.P., Haya-

shizaki, Y.Y., Korn, B., Plachy, J., 2002. The DT40 web site:

sampling and connecting the genes of a B cell line. Nucleic

Acids Res. 30, 230–231.

Cario, E., Podolsky, D.K., 2000. Differential alteration in intestinal

epithelial cell expression of toll-like receptor 3 (TLR3) and

TLR4 in inflammatory bowel disease. Infect. Immun. 68, 7010–

7017.

M. Iqbal et al. / Veterinary Immunology and Immunopathology 104 (2005) 117–127126

Dil, N., Qureshi, M.A., 2002a. Differential expression of inducible

nitric oxide synthase is associated with differential Toll-like

receptor-4 expression in chicken macrophages from different

genetic backgrounds. Vet. Immunol. Immunopathol. 84, 191–

207.

Dil, N., Qureshi, M.A., 2002b. Involvement of lipopolysaccharide

related receptors and nuclear factor kappa B in differential

expression of inducible nitric oxide synthase in chicken macro-

phages from different genetic backgrounds. Vet. Immunol.

Immunopathol. 88, 149–161.

Du, X., Poltorak, A., Wei, Y., Beutler, B., 2000. Three novel

mammalian toll-like receptors: gene structure, expression, and

evolution. Eur. Cytokine Netw. 11, 362–371.

Farnell, M.B., Crippen, T.L., He, H., Swaggerty, C.L., Kogut, M.H.,

2003. Oxidative burst mediated by toll like receptors (TLR) and

CD14 on avian heterophils stimulated with bacterial toll ago-

nists. Dev. Comp. Immunol. 27, 423–429.

Fukui, A., Inoue, N., Matsumoto, M., Nomura, M., Yamada, K.,

Matsuda, Y., Toyoshima, K., Seya, T., 2001. Molecular cloning

and functional characterization of chicken toll-like receptors. A

single chicken toll covers multiple molecular patterns. J. Biol.

Chem. 276, 47143–47149.

Gewirtz, A.T., Navas, T.A., Lyons, S., Godowski, P.J., Madara, J.L.,

2001. Cutting edge: bacterial flagellin activates basolaterally

expressed TLR5 to induce epithelial proinflammatory gene

expression. J. Immunol. 167, 1882–1885.

Hausmann, M., Kiessling, S., Mestermann, S., Webb, G., Spottl, T.,

Andus, T., Scholmerich, J., Herfarth, H., Ray, K., Falk, W.,

Rogler, G., 2002. Toll-like receptors 2 and 4 are up-regulated

during intestinal inflammation. Gastroenterology 122, 1987–

2000.

Hemmi, H., Kaisho, T., Takeuchi, O., Sato, S., Sanjo, H., Hoshino,

K., Horiuchi, T., Tomizawa, H., Takeda, K., Akira, S., 2002.

Small anti-viral compounds activate immune cells via the TLR7

MyD88-dependent signaling pathway. Nat. Immunol. 3, 196–

200.

Hirono, I., Takami, M., Miyata, M., Miyazaki, T., Han, H.J., Takano,

T., Endo, M., Aoki, T., 2004. Characterization of gene structure

and expression of two toll-like receptors from Japanese flounder.

Paralichthys olivaceus. Immunogenetics 56, 38–46.

Hornung, V., Rothenfusser, S., Britsch, S., Krug, A., Jahrsdorfer, B.,

Giese, T., Endres, S., Hartmann, G., 2002. Quantitative expres-

sion of toll-like receptor 1-10 mRNA in cellular subsets of

human peripheral blood mononuclear cells and sensitivity to

CpG oligodeoxynucleotides. J. Immunol. 168, 4531–4537.

Jault, C., Pichon, L., Chluba, J., 2004. Toll-like receptor gene family

and TIR-domain adapters in Danio rerio. Mol. Immunol. 40,

759–771.

Kaiser, P., Rothwell, L., Galyov, E.E., Barrow, P.A., Burnside, J.,

Wigley, P., 2000. Differential cytokine expression in avian cells

in response to invasion by Salmonella Typhimurium, Salmonella

Enteritidis and Salmonella Gallinarum. Microbiology 146 (Pt

12), 3217–3226.

Kogut, M.H., McGruder, E.D., Hargis, B.M., Corrier, D.E.,

DeLoach, J.R., 1995. In vivo activation of heterophil function

in chickens following injection with Salmonella enteritidis-

immune lymphokines. J. Leukoc. Biol. 57, 56–62.

Kogut, M.H., Rothwell, L., Kaiser, P., 2003. Differential regulation

of cytokine gene expression by avian heterophils during recep-

tor-mediated phagocytosis of opsonized and nonopsonized Sal-

monella enteritidis. J. Interferon Cytokine Res. 23, 319–327.

Leveque, G., Forgetta, V., Morroll, S., Smith, A.L., Bumstead, N.,

Barrow, P., Loredo-Osti, J.C., Morgan, K., Malo, D., 2003.

Allelic variation in TLR4 is linked to susceptibility to Salmo-

nella enterica serovar Typhimurium infection in chickens.

Infect. Immun. 71, 1116–1124.

Lynn, D.J., Lloyd, A.T., O’Farrelly, C., 2003. In silico identification

of components of the Toll-like receptor (TLR) signaling path-

way in clustered chicken expressed sequence tags (ESTs). Vet.

Immunol. Immunopathol. 93, 177–184.

Medzhitov, R., Janeway Jr., C.A., 2000. How does the immune

system distinguish self from nonself? Semin. Immunol. 12,

185–188, discussion 257–344.

Meijer, A.H., Gabby Krens, S.F., Medina Rodriguez, I.A., He, S.,

Bitter, W., Ewa Snaar-Jagalska, B., Spaink, H.P., 2004. Expres-

sion analysis of the Toll-like receptor and TIR domain adaptor

families of zebrafish. Mol. Immunol. 40, 773–783.

Nagase, H., Okugawa, S., Ota, Y., Yamaguchi, M., Tomizawa, H.,

Matsushima, K., Ohta, K., Yamamoto, K., Hirai, K., 2003.

Expression and function of Toll-like receptors in eosinophils:

activation by Toll-like receptor 7 ligand. J. Immunol. 171, 3977–

3982.

Oshiumi, H., Tsujita, T., Shida, K., Matsumoto, M., Ikeo, K., Seya,

T., 2003. Prediction of the prototype of the human Toll-like

receptor gene family from the pufferfish, Fugu rubripes, gen-

ome. Immunogenetics 54, 791–800.

Rehli, M., 2002. Of mice and men: species variations of Toll-like

receptor expression. Trends Immunol. 23, 375–378.

Rock, F.L., Hardiman, G., Timans, J.C., Kastelein, R.A., Bazan, J.F.,

1998. A family of human receptors structurally related to

Drosophila Toll. Proc. Natl. Acad. Sci. USA 95, 588–593.

Sebastiani, G., Leveque, G., Lariviere, L., Laroche, L., Skamene, E.,

Gros, P., Malo, D., 2000. Cloning and characterization of the

murine toll-like receptor 5 (Tlr5) gene: sequence and mRNA

expression studies in Salmonella-susceptible MOLF/Ei mice.

Genomics 64, 230–240.

Smith Jr., M.F., Mitchell, A., Li, G., Ding, S., Fitzmaurice, A.M.,

Ryan, K., Crowe, S., Goldberg, J.B., 2003. Toll-like receptor

(TLR) 2 and TLR5, but not TLR4, are required for Helicobacter

pylori-induced NF-kappa B activation and chemokine expres-

sion by epithelial cells. J. Biol. Chem. 278, 32552–32560.

Takeuchi, O., Kawai, T., Sanjo, H., Copeland, N.G., Gilbert, D.J.,

Jenkins, N.A., Takeda, K., Akira, S., 1999. TLR6: A novel

member of an expanding toll-like receptor family. Gene 231, 59–

65.

Thoma-Uszynski, S., Kiertscher, S.M., Ochoa, M.T., Bouis, D.A.,

Norgard, M.V., Miyake, K., Godowski, P.J., Roth, M.D., Modlin,

R.L., 2000. Activation of toll-like receptor 2 on human dendritic

cells triggers induction of IL-12, but not IL-10. J. Immunol. 165,

3804–3810.

Tirunagaru, V.G., Sofer, L., Cui, J., Burnside, J., 2000. An expressed

sequence tag database of T-cell-enriched activated chicken

splenocytes: sequence analysis of 5251 clones. Genomics 66,

144–151.

M. Iqbal et al. / Veterinary Immunology and Immunopathology 104 (2005) 117–127 127

Werling, D., Jungi, T.W., 2003. TOLL-like receptors linking innate

and adaptive immune response. Vet. Immunol. Immunopathol.

91, 1–12.

Wigley, P., Hulme, S.D., Bumstead, N., Barrow, P.A., 2002. In vivo

and in vitro studies of genetic resistance to systemic salmonel-

losis in the chicken encoded by the SAL1 locus. Microbes Infect.

4, 1111–1120.

Zarember, K.A., Godowski, P.J., 2002. Tissue expression of human

Toll-like receptors and differential regulation of Toll-like recep-

tor mRNAs in leukocytes in response to microbes, their pro-

ducts, and cytokines. J. Immunol. 168, 554–561.

Zhang, D., Zhang, G., Hayden, M.S., Greenblatt, M.B., Bussey, C.,

Flavell, R.A., Ghosh, S., 2004. A toll-like receptor that prevents

infection by uropathogenic bacteria. Science 303, 1522–1526.

Zhang, S., Lillehoj, H.S., Ruff, M.D., 1995. Chicken tumor necrosis-

like factor. I. In vitro production by macrophages stimulated

with Eimeria tenella or bacterial lipopolysaccharide. Poult. Sci.

74, 1304–1310.