Feline Immunodeficiency Virus Cell EntrySUSAN C. S. FREY,1 EDWARD A. HOOVER,2 AND JAMES I. MULLINS1,3*
Departments of Microbiology1 and Medicine,3 University of Washington, Seattle, Washington,and Department of Pathology, Colorado State University, Fort Collins, Colorado2
Received 3 November 2000/Accepted 14 March 2001
The process of feline immunodeficiency virus (FIV) cell entry was examined using assays for virus replicationintermediates. FIV subtype B was found to utilize the chemokine receptor CXCR4, but not CCR5, as a cellularreceptor. Zidovudine blocked formation of late viral replication products most effectively, including circularDNA genome intermediates. Our findings extend the role of CXCR4 as a primary receptor for CD4-indepen-dent cell entry by FIV.
The lentivirus feline immunodeficiency virus (FIV) infects abroad range of cell types, including CD41 and CD81 T lym-phocytes, B lymphocytes, and macrophages, and analogous tohuman immunodeficiency virus (HIV) infection of humans,often results in the progressive loss of CD41 T cells and theeventual development of immunodeficiency in infected cats (2,9, 21). HIV infection of T lymphocytes involves attachment ofthe viral envelope glycoprotein to the specific cellular receptorCD4 (5, 14). However, this is usually not sufficient to confersusceptibility to HIV infection (4, 17), and HIV requires amember of the chemokine receptor family as a coreceptor (6,7, 11). FIV does not utilize CD4 for entry (12, 18). However,FIV subtype A viruses adapted for growth in the feline CrFKcell line utilize CXCR4 as a receptor (23; B. J. Willett, M. J.Hosie, J. C. Neil, J. D. Turner, and J. A. Hoxie, Letter, Nature385:587, 1997). Human U87 cells expressing CXCR4 sup-ported the formation of syncytia when infected with FIV Peta-luma and FIV Glasgow-8 (30), but no productive infection wasdetected. Additionally, recent work indicates that at least someprimary FIV isolates use CXCR4 for cell entry (26). In thisstudy, we examined the receptor requirements and viral DNAreplication intermediates of FIV. Based on characteristicscommon to all retroviruses, including genomic organizationand the process of reverse transcription (8), we developed acell entry assay for FIV. The product of reverse transcriptionthat is preferentially integrated into the host chromosome toestablish a productive infection is a linear DNA molecule thatbegins with a 59 long terminal repeat (LTR) and ends with a 39LTR (3). However, two circular forms of unintegrated viralDNA are also found in the nucleus and serve as markers of aproductive infection (3, 28), those containing either one or twocopies of the viral LTR. FIV subtype A, B, and C entry wasexamined through the detection of early (LTR), intermediate(LTR-Gag), and late (circular) DNA products of reverse tran-scription. Like subtype A, FIV subtype B utilized the chemo-kine receptor CXCR4 for cell entry, whereas FIV-C did notenter these target cells at detectable levels. Subtype C virusesare rare, but subtype B viruses have a wide distribution and
have been identified in Italy, the United States, Canada, Japan,and Germany (1, 22).
FIV 34TF10 entry into CrFK cells. Infection of CrFK cellswith subtype A FIV 34TF10 was monitored over time by PCRamplification of viral genome fragments that represented early,intermediate, and late stages of the reverse transcription pro-cess (Table 1 and Fig. 1). The virus stock was generated bytransfection of the 34TF10 plasmid into CrFK cells, with thesupernatants being combined, filtered (0.45-mm-pore-size), ali-quoted, and stored at 280°C prior to use at a final dilution of70 50% tissue culture infective doses. b-actin gene amplifica-tion was included as a control for DNA quantitation and PCRefficiency, using primers designed as described previously (27)to amplify from both feline and human DNA. The b-actin PCRproducts were ;600 bp for human and ;1,000 bp for felineproducts. PCR (reagents and protocols from Bioline, Reno,Nev.) cycling parameters included denaturation for 3.5 min at94°C, followed by 35 cycles of 45 s at 94°C, 45 at 55°C (or 58°Cfor the LTR primer set or 50°C for the b-actin primers), and 1min at 72°C (the final incubation was for 10 min). The PCRproduct that represented an early product of reverse transcrip-tion was the LTR fragment, amplified with the LTR-F andLTR-R primers (Table 1 and Fig. 1). The intermediate productwas the LTR-Gag fragment, amplified with the LTR-F andGAG-R primers, and the late product was the circle junctionfragment, amplified with the ENV-F and GAG-R primers.These amplifications were carried out using the cell lines, virusstocks, and PCR controls shown in Table 2 as targets.
The sensitivity of each primer set was determined usingserial dilutions of p34TF10 and/or a plasmid containing thecircle junction fragment. The threshold for detection of the163-bp LTR product was 100 copies, and the threshold was 10copies for the 542-bp LTR-gag and 967-bp circle junction prod-ucts (data not shown). LTR and LTR-gag products werepresent at 6 h postinoculation (PI) (Fig. 1A) and becameprogressively stronger during the course of the experiment.The circle junction product was detected at 45 h PI and be-came stronger with time. Consistent b-actin levels were foundat 6, 20, 30, and 45 h PI, with lower levels present at 0 and 70h. This experiment shows that early and intermediate productsare detected soon after infection of CrFK cells with FIV34TF10 but that circular products are not detected until be-tween 30 and 45 h PI.
* Corressponding author. Mailing address: Department of Microbi-ology, Health Sciences Center, I264, University of Washington, Seat-tle, WA 98195-7472. Phone: (206) 616-1851. Fax: (360) 838-9259.E-mail: [email protected].
5433
Dow
nloa
ded
from
http
s://j
ourn
als.
asm
.org
/jour
nal/j
vi o
n 27
Dec
embe
r 20
21 b
y 21
1.21
9.23
4.18
7.
FIV 34TF10 one-LTR circle junction structure. Putative FIVcircle junction DNA from CrFK cells infected with FIV34TF10 was PCR amplified, cloned, sequenced, and identifiedas a one-LTR circle junction (Fig. 1C). A faint product mostlikely corresponding to a two-LTR circle junction was alsodetected in the PCR products analyzed. Our results are con-sistent with studies of HIV type 1 (HIV-1) infection thatshowed that the two-LTR form is less abundant than the one-LTR form in tissue culture (10, 20).
FIG. 1. CrFK cell infection with FIV 34TF10 and detection of viralreplication intermediates. (A) CrFK cells were infected with FIV 34TF10in replicate wells and harvested from one well at 0, 6, 20, 30, 45, and70 h PI. PCR was performed as described in the text, with FIV 2542-CRFK cellular DNA (FIV1) as the positive control and H2O plusreagents (H2O) as the negative control. The DNA marker is a 100-bpor 1-kb ladder, as indicated. PCR products were separated by agarosegel electrophoresis and visualized by ethidium bromide staining. (B)Schematic representation of primer positions for derivation of PCRproducts in FIV-infected cells derived from linear and circular viralDNA is shown. (C) One-LTR circle junction fragment homology(shaded segments) is indicated. As shown at the bottom of panel C, thefragments produced after FIV 34TF10 infection were colinear withthat expected from the FIV 34TF10 genome.
TABLE 1. PCR oligonucleotides used in this study
Name of primer Polarity Sequence (59 to 39) Nucleotide positionsa
LTR-F Plus GCGCTAGCAGCTGCTTAACCGCAAAACCAC 108–137LTR-R Minus GTATCTGTGGGAGCCTCAAGGGAGAACTC 240–269GAG-R Minus CGCCCCTGTCCATTCCCCATGTTGCTGTAGAATCTC 612–646ENV-F Plus GGCAATGTGGCATGTCTGAAAAAGAGGAGGAATGATG 8802–8839b-actin-F Plus ATGTGCAAGGCCGGCTTCG 119–137b-actin-R Minus TTAATGTCACGCACGATTTCC 691–711
a Nucleotide positions were based on the FIV Petaluma sequence (bases 1 to 9474) (19).
TABLE 2. Cell lines, viral stocks, and PCR controlsutilized in this study
Cell linesCrFKU87-T4U87-T4-CCR5U87-T4-CXCR4
Viral stocksFIV-A from CrFK cellsFIV-B from CrFK cellsFIV-B from PBMCFIV-C from PBMCFIV 34TF10
Lack of FIV DNA in viral stocks. Detection of LTR prod-ucts early in infection could be due to new synthesis of viralDNA upon cell entry or to incomplete viral transcripts car-ried in the FIV particle (16). The DNase treatment weemployed would eliminate DNA present in the supernatantbut not from within the viral particle. We therefore exam-ined viral inocula for the presence of viral DNA. Peripheralblood mononuclear cell (PBMC) viral stocks were derivedby coculture of PBMC from uninfected cats and specific-pathogen-free capture cats infected with FIV field isolates2546 (FIV-A) or 2542 (FIV-B) (1). CrFK-grown subtype A
and B viruses were derived from chronically infected CrFKcells infected by coculture with supernatant from FIV-pos-itive PBMC cultures. An equivalent amount of virus, quan-titated using p24 antigen, was used for each infection. PCRon the viral inoculum did not result in detectable product(Fig. 2A); hence, the PCR signal detected in the entry assaycould be not be attributed to DNA present in the viralinoculum. Consistent with our results, less than 1% of theHIV-1 (2) single-stranded DNA found in infected cells canbe attributed to DNA carried into the cell inside the viralparticle (25).
FIG. 2. Lack of FIV DNA in viral stocks and impact of AZT on the production of viral DNA intermediates. (A) Viral inocula were examinedfor the presence of viral DNA by PCR. Viral stocks corresponded to FIV-A grown in CrFK cells (AC), FIV-B grown in CrFK cells (BC), FIV-Bgrown in PBMC (BP), FIV-C grown in PBMC (CP), and FIV 34TF10 (34) grown in CrFK cells. FIV1 corresponds to a positive control(FIV-infected CrFK DNA). (B) CrFK cells were infected with FIV 34TF10 in replicate wells, differing only by the addition of AZT-1MP. Cellswere harvested at 0, 24, 72, and 144 h and immediately lysed and stored for subsequent DNA extraction. PCR was performed using 50 ng of DNAas a template. PCRs were separated by agarose gel electrophoresis and visualized by ethidium bromide staining (10 ml per sample). The marker(MW) for the LTR and LTR-gag fragments was a 100-bp ladder and for the circle and b-actin fragments was a 1-kB ladder. Controls were H2Oplus reagents (H2O), CrFK DNA (CrFK), FIV 34TF10-infected CRFK DNA (FIV1), and p34TF10.
VOL. 75, 2001 NOTES 5435
Dow
nloa
ded
from
http
s://j
ourn
als.
asm
.org
/jour
nal/j
vi o
n 27
Dec
embe
r 20
21 b
y 21
1.21
9.23
4.18
7.
FIG. 3. AZT can block circle formation in CrFK and U87-T4-CXCR4 cells infected with CrFK-derived FIV-A or FIV-B. FIV subtype A or FIVsubtype B was used to infect CrFK, U87-T4, U87-T4-CCR5, and U87-T4-CXCR4 cell lines in replicate wells differing only by the addition of AZT.Cells were harvested, and viral sequences were PCR amplified and visualized as described in the legend to Fig. 2. The figure depicts the LTR PCR(A), the LTR-Gag PCR (B), the circle fragment PCR (C), and the b-actin PCR (D). The PCR for each fragment was performed concurrently forall four cell lines. Four controls were included for each amplification and were run in lane 2 (PCR CNTL) of the four gels in each panel, with thefirst gel of each panel containing the H2O control, the second gel containing the CrFK control, the third gel containing the 34TF10 CrFK control,and the fourth gel containing the 34TF10 plasmid. AC, FIV-A grown in CrFK cells; BC, FIV-B grown in CrFK cells.
5436 NOTES J. VIROL.
Dow
nloa
ded
from
http
s://j
ourn
als.
asm
.org
/jour
nal/j
vi o
n 27
Dec
embe
r 20
21 b
y 21
1.21
9.23
4.18
7.
AZT blocked circle formation in CrFK cells infected with34TF10. We monitored the production of viral DNA followingFIV 34TF10 infection of CrFK cells in the presence of zidovu-dine (AZT-1MP) (Sigma; A6806; 10 mg/ml), a nucleoside an-alogue inhibitor of reverse transcription, or Dulbecco’s modi-fied Eagle’s medium alone as a control (Fig. 2B). For theexperiments shown in Fig. 2B and 3, cells were seeded with 23
AZT-1MP or Dulbecco’s modified Eagle’s medium alone andincubated for 1 h to allow cells to convert AZT to the triphos-phate form. Prior to infection, viral stocks were DNase Itreated and filtered (15). The LTR fragment was present at 0 hPI and the signal increased with time for all samples (Fig. 2B).The intensity of the LTR-gag product also increased over timein untreated cells but was less intense, especially at later time
FIG. 3—Continued.
VOL. 75, 2001 NOTES 5437
Dow
nloa
ded
from
http
s://j
ourn
als.
asm
.org
/jour
nal/j
vi o
n 27
Dec
embe
r 20
21 b
y 21
1.21
9.23
4.18
7.
points, for the AZT group. Circle junction products were de-tected by 72 h PI in the untreated sample but were not detectedfor the AZT-treated group up to 144 h PI. Our results wereconsistent with previous studies showing that inhibitors of re-verse transcription are most effective against long products ofreverse transcription (24, 25, 29, 31).
FIV-B utilizes CXCR4 for entry and AZT blocks circle for-mation. We next sought to determine whether CrFK cell line-adapted FIV with envelope sequence subtype B, as with sub-type A (23, 30; Willett et al., letter), used CXCR4 for viralentry (Fig. 3). We infected CrFK, U87-T4, U87-T4-CCR5, andU87-T4-CXCR4 cell lines with FIV subtype A or B virus and
monitored the production of viral DNA in replicate wells in thepresence of AZT or medium alone. Chemokine receptor ex-pression was verified by staining with fluorescently labeledantibodies specific for CXCR4 (12G5 CXCR4-PE) or CCR5(2D7 CCR5-FITC) prior to infection (Pharmingen, San Diego,Calif.) (27). Fluorescein isothiocyanate- and phycoerythrin-mouse immunoglobulin G2a kappa-isotype control antibodiesG155-178-FITC and G155-178-PE (PharMingen) were used ascontrols for nonspecific binding. Cells were then analyzed bycytofluorometry using a FACScan flow cytometer and Cell-Quest software (Becton Dickinson Immunocytometry Systems).To show that the CCR5-expressing cell line was functional and
FIG. 4. FIV antigen production corresponds to circle formation during FIV infection. Lysed cells and supernatants were examined at days 10and 17 PI. (A) Circle and b-actin fragment PCR results from days 10 and 17 PI. The positive control was 34TF10 CrFK DNA and the negativecontrol was an H2O reagent control. The PCR controls were run in lane 2 (PCR CNTL), with the H2O reagent control on the top gel for eachfragment and the positive control on the bottom gel for each fragment. The DNA marker was the 1-kb ladder. (B) Results from the enzyme-linkedimmunosorbent assays for FIV antigen. T4, U87-T4 cells; R5, U87-T4-CCR5 cells; X4, U87-T4-CXCR4 cells. Virus designations are defined inthe legend to Fig. 2.
5438 NOTES J. VIROL.
Dow
nloa
ded
from
http
s://j
ourn
als.
asm
.org
/jour
nal/j
vi o
n 27
Dec
embe
r 20
21 b
y 21
1.21
9.23
4.18
7.
competent for viral infection, we infected the U87-T4-CCR5cell line with simian immunodeficiency virus isolate 239 (SIV-239), and the resulting supernatant tested positive for SIVantigen (p27) at days 10 and 14 PI (data not shown). Cells wereharvested at 0, 24, 72, and 144 h PI and immediately lysed andstored for subsequent DNA extraction and PCR amplification.Cells were harvested for the 0-h time point and lysed afterexposure to virus within 10 min. However, this brief exposureof cells to virus resulted in the production of reverse transcrip-tion products detectable at 0 h PI in some samples. The LTR(Fig. 3A) and LTR-Gag (Fig. 3B) PCR products were detectedfor both of the viral subtypes in CrFK and U87-T4-CXCR4cells but not in the U87-T4 or U87-T4-CCR5 cells. AZT par-tially inhibited formation of both the LTR and LTR-Gag frag-ments in CrFK and U87-T4-CXCR4 cells. Differences werealso evident between the susceptible cell lines, as productswere present at 0 h in CrFK but not in U87-T4-CXCR4 cells.The PCR signal was stronger for the samples without AZTthan for those incubated with AZT for both cell lines and bothviral subtypes. The signal for CrFK cells increased with time,while infected U87-T4-CXCR4 cells showed a strong and con-tinuing signal beginning at 24 h PI. Circle formation was de-tected only in the absence of AZT and was detected earlierin the U87-T4-CXCR4 cells than in the CrFK cells for boththe FIV-A and FIV-B infections (Fig. 3C). The signal forthe b-actin fragment was consistent overall (Fig. 3D). Thisexperiment demonstrates that early and intermediate viralDNA products are formed in permissive cells even in thepresence of AZT but that late viral DNA products are onlyformed at appreciable levels in permissive cells in the ab-sence of AZT.
FIV-B antigen production in CXCR4-transfected cells. Weobserved the production of syncytia by day 12 of the FIV-B2542 infection (;10/well) in U87-T4-CXCR4 cells, massivecytopathic effects and many large floating syncytia were pres-ent on day 13 (;90/well), and the cultures were terminated dueto cytopathic efects on day 14 (data not shown). This demon-strated that FIV subtype B can utilize CXCR4 for cell entryand demonstrated productive infection of FIV-B in U87-T4-CXCR4 cells.
FIV antigen production corresponds to circle formationduring FIV infection. We next determined if productive FIVinfection, as indicated by the presence of FIV p24 Gag antigen,corresponded to circle formation during FIV infection (Fig. 4).Viruses were used to infect CrFK, U87-T4, U87-T4-CCR5,and U87-T4-CXCR4 cell lines. Cellular DNA and culture su-pernatants were harvested on days 10 and 17 PI. The cellularDNA was used for PCR and the culture supernatants weretested for FIV antigen using the FIV PetChek enzyme-linkedimmunosorbent assay kit (Idexx Laboratories, Westbrook,Maine). The samples positive for p24 antigen were the sameones in which circular viral DNA was detected (Fig. 4). ThePBMC-derived subtype B and C FIVs were negative for bothviral DNA intermediates and antigen in the cell lines tested.We did not observe circle formation or FIV antigen for any ofour experiments that used PBMC-derived FIV-B or FIV-C,indicating that the block to replication in cell lines is notovercome by the transfection of CXCR4 alone. Most primaryisolates of FIV infect PBMC, but only subsets have beenadapted to infect CrFK cells, including the FIV-B PBMC-
derived virus used in this study. It is not clear why someprimary isolates grown only in PBMC, such as the FIV-CPBMC-derived virus used in this study, cannot efficiently beadapted to grow in CrFK cells, given that CrFK cells have beenshown to express CXCR4 mRNA (30) and some primary iso-lates have been shown to use CXCR4 for entry (26). It may bethat some FIV strains use a receptor other than CXCR4, butwhen they are adapted to grow in CrFK cells, the receptorusage switches to CXCR4 in a manner parallel to HIV adap-tation for growth in T-cell lines. All three CrFK-derived virusestested (FIV-A, FIV-B, and 34TF10) were positive for bothcircle formation and viral antigen when infecting CrFK orU87-T4-CXCR4 cells but not U87-T4 or U87-T4-CCR5 cells.The only exception was that FIV 34TF10 was positive for circleformation in the U87-T4-CXCR4 cells, but viral antigen wasnot detected (although p24 was detected in other experiments[data not shown]). The presence of HIV-1 circles has beensuggested to be a molecular indicator of the disease progres-sion of HIV-1 (13, 32). Hence, the assessment of circle forma-tion as a predictor of FIV disease progression could be eval-uated using the procedures described here for future studies.
The entry assay was adapted to the FIV system with helpful advicefrom Edward Clark and Patricia Polacino (University of Washington,Seattle, Wash.). We thank Luis Giavedoni (Southwest Foundation forBiomedical Research, San Antonio, Tex.) for his continued supportand for the gift of the SIV-239 viral stock. We thank Vida Hodara andLaura Parodi (Southwest Foundation for Biomedical Research) forassistance with the SIV work, Aniko Fekete (University of Washing-ton) for assistance with DNA sequencing, and Maria Velasquillo(Southwest Foundation for Biomedical Research) for assistance withthe flow cytometry experiments. We thank James Hoxie (University ofPennsylvania, Philadelphia, Pa.) for the gift of the 12G5 antibody,Candace Mathiason-DuBard (Colorado State University, Fort Collins,Colo.) for preparation of the FIV stocks, Dan Littman (New YorkUniversity Medical Center, New York, N.Y.) for the gift of the U87cell lines, and Tom North (University of Montana, Missoula, Mont.)for the gift of the CrFK cells.
This work was supported by Public Health Service grants CA59042(to J.I.M.) and AI33773 to (E.A.H.).
REFERENCES
1. Bachmann, M. H., C. Mathiason-Dubard, G. H. Learn, A. G. Rodrigo, D. L.Sodora, P. Mazzetti, E. A. Hoover, and J. I. Mullins. 1997. Genetic diversityof feline immunodeficiency virus: dual infection, recombination, and distinctevolutionary rates among envelope sequence clades. J. Virol. 71:4241–4253.
2. Brown, W. C., L. Bissey, K. S. Logan, N. C. Pedersen, J. H. Elder, and E. W.Collisson. 1991. Feline immunodeficiency virus infects both CD41 andCD81 T lymphocytes. J. Virol. 65:3359–3364.
3. Cara, A., and M. S. Reitz, Jr. 1997. New insight on the role of extrachro-mosomal retroviral DNA. Leukemia 11:1395–1399.
4. Clapham, P. R., D. Blanc, and R. A. Weiss. 1991. Specific cell surfacerequirements for the infection of CD4-positive cells by human immunode-ficiency virus types 1 and 2 and by simian immunodeficiency virus. Virology181:703–715.
5. Dalgleish, A. G., P. C. Beverley, P. R. Clapham, D. H. Crawford, M. F.Greaves, and R. A. Weiss. 1984. The CD4 (T4) antigen is an essentialcomponent of the receptor for the AIDS retrovirus. Nature 312:763–767.
6. Deng, H., R. Liu, W. Ellmeier, S. Choe, D. Unutmaz, M. Burkhart, P. DiMarzio, S. Marmon, R. E. Sutton, C. M. Hill, C. B. Davis, S. C. Peiper, T. J.Schall, D. R. Littman, and N. R. Landau. 1996. Identification of a majorco-receptor for primary isolates of HIV-1. Nature 381:661–666.
7. Dragic, T., V. Litwin, G. P. Allaway, S. R. Martin, Y. Huang, K. A. Na-gashima, C. Cayanan, P. J. Maddon, R. A. Koup, J. P. Moore, and W. A.Paxton. 1996. HIV-1 entry into CD41 cells is mediated by the chemokinereceptor CC-CKR-5. Nature 381:667–673.
8. Elder, J. H., and T. R. Phillips. 1993. Molecular properties of feline immu-nodeficiency virus (FIV). Infect. Agents Dis. 2:361–374.
9. English, R. V., C. M. Johnson, D. H. Gebhard, and M. B. Tompkins. 1993.In vivo lymphocyte tropism of feline immunodeficiency virus. J. Virol. 67:5175–5186.
10. Farnet, C. M., and W. A. Haseltine. 1991. Circularization of human immu-
VOL. 75, 2001 NOTES 5439
Dow
nloa
ded
from
http
s://j
ourn
als.
asm
.org
/jour
nal/j
vi o
n 27
Dec
embe
r 20
21 b
y 21
1.21
9.23
4.18
7.
nodeficiency virus type 1 DNA in vitro. J. Virol. 65:6942–6952.11. Feng, Y., C. C. Broder, P. E. Kennedy, and E. A. Berger. 1996. HIV-1 entry
cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor. Science 272:872–877.
12. Hosie, M. J., B. J. Willett, T. H. Dunsford, O. Jarrett, and J. C. Neil. 1993.A monoclonal antibody which blocks infection with feline immunodeficiencyvirus identifies a possible non-CD4 receptor. J. Virol. 67:1667–1671.
13. Jurriaans, S., A. de Ronde, J. Dekker, M. Cornelissen, and J. Goudsmit.1995. Increased number of single-LTR HIV-1 DNA junctions correlates withHIV-1 antigen expression and CD41 cell decline in vivo. J. Med. Virol. 45:91–98.
14. Klatzmann, D., E. Champagne, S. Chamaret, J. Gruest, D. Guetard, T.Hercend, J. C. Gluckman, and L. Montagnier. 1984. T-lymphocyte T4 mol-ecule behaves as the receptor for human retrovirus LAV. Nature 312:767–768.
15. Kootstra, N. A., B. M. Zwart, and H. Schuitemaker. 2000. Diminishedhuman immunodeficiency virus type 1 reverse transcription and nucleartransport in primary macrophages arrested in early G1 phase of the cell cycle.J. Virol. 74:1712–1717.
16. Lori, F., F. di Marzo Veronese, A. L. de Vico, P. Lusso, M. S. Reitz, Jr., andR. C. Gallo. 1992. Viral DNA carried by human immunodeficiency virus type1 virions. J. Virol. 66:5067–5074.
17. Maddon, P. J., A. G. Dalgleish, J. S. McDougal, P. R. Clapham, R. A. Weiss,and R. Axel. 1986. The T4 gene encodes the AIDS virus receptor and isexpressed in the immune system and the brain. Cell 47:333–348.
18. Norimine, J., T. Miyazawa, Y. Kawaguchi, K. Tomonaga, Y. S. Shin, T.Toyosaki, M. Kohmoto, M. Niikura, Y. Tohya, and T. Mikami. 1993. FelineCD4 molecules expressed on feline non-lymphoid cell lines are not enoughfor productive infection of highly lymphotropic feline immunodeficiencyvirus isolates. Arch. Virol. 130:171–178.
19. Olmsted, R. A., V. M. Hirsch, R. H. Purcell, and P. R. Johnson. 1989.Nucleotide sequence analysis of feline immunodeficiency virus: genome or-ganization and relationship to other lentiviruses. Proc. Natl. Acad. Sci. USA86:8088–8092.
20. Pauza, C. D., J. E. Galindo, and D. D. Richman. 1990. Reinfection results inaccumulation of unintegrated viral DNA in cytopathic and persistent humanimmunodeficiency virus type 1 infection of CEM cells. J. Exp. Med. 172:1035–1042.
21. Pedersen, N. C., E. W. Ho, M. L. Brown, and J. K. Yamamoto. 1987. Isolationof a T-lymphotropic virus from domestic cats with an immunodeficiency-likesyndrome. Science 235:790–793.
22. Pistello, M., G. Cammarota, E. Nicoletti, D. Matteucci, M. Curcio, D. DelMauro, and M. Bendinelli. 1997. Analysis of the genetic diversity and phy-logenetic relationship of Italian isolates of feline immunodeficiency virusindicates a high prevalence and heterogeneity of subtype B. J. Gen. Virol. 78:2247–2257.
23. Poeschla, E. M., and D. J. Looney. 1998. CXCR4 is required by a nonprimatelentivirus: heterologous expression of feline immunodeficiency virus in hu-man, rodent, and feline cells. J. Virol. 72:6858–6866.
24. Polacino, P. S., H. A. Liang, E. J. Firpo, and E. A. Clark. 1993. T-cellactivation influences initial DNA synthesis of simian immunodeficiency virusin resting T lymphocytes from macaques. J. Virol. 67:7008–7016.
25. Quan, Y., L. Rong, C. Liang, and M. A. Wainberg. 1999. Reverse transcrip-tase inhibitors can selectively block the synthesis of differently sized viralDNA transcripts in cells acutely infected with human immunodeficiencyvirus type 1. J. Virol. 73:6700–6707.
26. Richardson, J., G. Pancino, R. Merat, T. Leste-Lasserre, A. Moraillon, J.Schneider-Mergener, M. Alizon, P. Sonigo, and N. Heveker. 1999. Sharedusage of the chemokine receptor CXCR4 by primary and laboratory-adaptedstrains of feline immunodeficiency virus. J. Virol. 73:3661–3671.
27. Rottman, J. B., E. B. Freeman, S. Tonkonogy, and M. B. Tompkins. 1995. Areverse transcription-polymerase chain reaction technique to detect felinecytokine genes. Vet. Immunol. Immunopathol. 45:1–18.
28. Teo, I., C. Veryard, H. Barnes, S. F. An, M. Jones, P. L. Lantos, P. Luthert,and S. Shaunak. 1997. Circular forms of unintegrated human immunodefi-ciency virus type 1 DNA and high levels of viral protein expression: associ-ation with dementia and multinucleated giant cells in the brains of patientswith AIDS. J. Virol. 71:2928–2933.
29. Trono, D. 1992. Partial reverse transcripts in virions from human immuno-deficiency and murine leukemia viruses. J. Virol. 66:4893–4900.
30. Willett, B. J., L. Picard, M. J. Hosie, J. D. Turner, K. Adema, and P. R.Clapham. 1997. Shared usage of the chemokine receptor CXCR4 by thefeline and human immunodeficiency viruses. J. Virol. 71:6407–6415.
31. Zack, J. A., A. M. Haislip, P. Krogstad, and I. S. Chen. 1992. Incompletelyreverse-transcribed human immunodeficiency virus type 1 genomes in qui-escent cells can function as intermediates in the retroviral life cycle. J. Virol.66:1717–1725.
32. Zazzi, M., L. Romano, M. Catucci, G. Venturi, A. De Milito, P. Almi, A.Gonnelli, M. Rubino, U. Occhini, and P. E. Valensin. 1997. Evaluation of thepresence of 2-LTR HIV-1 unintegrated DNA as a simple molecular predic-tor of disease progression. J. Med. Virol. 52:20–25.
