+ All Categories
Home > Documents > FFOREIGN TRADEOREIGN TRADE - korean-books.com.kp · Hungnam Industrial Development Park 8. 3D Laser...

FFOREIGN TRADEOREIGN TRADE - korean-books.com.kp · Hungnam Industrial Development Park 8. 3D Laser...

Date post: 17-Feb-2021
Category:
Upload: others
View: 1 times
Download: 0 times
Share this document with a friend
19
FOREIGN TRADE FOREIGN TRADE OF THE DEMOCRATIC PEOPLE’S REPUBLIC OF KOREA JUCHE 106 (2017) 2 2 @ FOREIGN TRADE PUBLISHING HOUSE 2017 ISSN 1727-916X
Transcript
  • FOREIGN TRADEFOREIGN TRADEOF THE DEMOCRATIC PEOPLE’S REPUBLIC OF KOREA

    JUCHE 106(2017) 22

    @ FOREIGN TRADE PUBLISHING HOUSE 2017 ISSN 1727-916X

  • THE CHAMBER OF COMMERCE OF THE DEMOCRATIC PEOPLE’S REPUBLIC OF KOREA

    P.O.Box 89 Add: Jungsong-dong, Central District, Pyongyang, DPR KoreaTel: 850-2-3815926 Fax: 850-2-3815827 E-mail: micom @ silibank.net.kpE-mail: micom @ star-co.net.kp

    Content sQUARTERLY JOURNALJuche 106 (2017) No. 2 (443)))

    Ryongaksan Soap Factory

    Editor: Kim Son OkPhoto: Kang Chol Song Jon Son Il Yun Kwang Hyok

    The quarterly journal “Foreign Trade of the DPRK” is available in English, Russian, French, Spanish, Chinese and Japanese versions.

    Please visit http://www.naenara.com.kp

    Published by the Foreign Trade Publishing HouseAdd: Sochon-dong, Sosong District, Pyongyang, DPR Korea

    FOREIGN TRADEOF THE DEMOCRATIC PEOPLE’S REPUBLIC OF KOREA

    44

    1414

    2828

    2. Ryongaksan Soap Factory

    4. Taean Friendship Glass Factory

    6. Munphyong Smeltery

    7. Economic Development Parks in Original Shape

    8. Hungnam Industrial Development Park

    8. 3D Laser Shape Meters

    9. Endoscope Products Win Favour

    10. Ryomyong Economic and Technology Corporation

    12. Wonder Medical Devices

    13. Komunssalchamnamuaek

    14. Jongsong General Pharmaceutical Factory

    16. Cable Factory Sets Higher Goal

    18. Pyongyang Kim Jong Suk Silk Mill

    20. Jaeryong Mine

    21. Green Epoxy Concrete

    Floor Paints

    22. Pyongyang Bag Factory

    24. Law of the Democratic

    People’s Republic of Korea

    on Economic Development

    Parks

    27. Honggok Powder

    27. Magnetization-based Water

    Manufacturer

    28. Pohyon Temple

    in Mt Myohyang

    30. Products of the Pyongyang

    Medical Appliances

    Technology Company

    32. Energy-saving Transformer

    Production Base

    SonSonnyonyo CosmeticsCosmeticsSSoonnnnyyo coosmmeetttiiiiiccccccsssss arreee mmmmmmmmmuuuuuuuuuuuuuulllllllltttttttttttiiiiiffffffuuunnccttiioonnaall annddd lllllleeeeessssssssssssssssssssss iiirrritattiinngg

    pprroodduccctttss ppreppppaaaarrreedddd bbbbyyyy mixxxiinnnnnggggggggg KKKKKKKKaaaaeeesong Kooryyoo insammmmmmmmmmm,, a sppppppeeeecccciiiiiiiiiaaalll d dd bb i ii KKKKKKKK K ii iiiii llppppppppppppppppprroodduucctt oooooooffffffffffffffffff KKKKKKKKKKKooooorreea, aannnndddd eeeeffffffffffffeeeecctivvveee ssubbsstaannces extrractedd fffffffffffffffffrrrrrrrrrrrrrooooooommm nnaattturrrrrrrraaaaaaaaaaaaalllllllllllll hhhhhhhhhhhhhhhheeeeeeeeerrrrrbbbbbbbbsss wwithh hhhyyaallllllllluuuuuuuuronic aciidd wwhhiicchhh iiiiiiiiissssssssssss aaaaaaaaaaa nnnnnnnnnnnaaaaaaaaaaattttttttttttuuuuuuuuuuurrrrrrraaaaall mooiissssstttttttuuuuuuuuuuuuuurrrriiiiiizzzzzzeeeeeerrrrrrr..

    MMMaadddee ffffroommmmmmmmm naturall rraaww mmaattttteeeeeeerrrriiaals, ttthhhee ccoossmmeetttiiiccss aaaaaaccccccctttttiiiivvvvvvvvaaaaaaaaaaattttttttttteeeeeeeeee mmmmmmmmmmmeeeeeeeeetttttttttttaaaaaaaaaabbbbbbbbbbbboooolllllliiiiiiiissmmmmmm ooooofffffffff ssssssssskkkkkkinn ceellllss. Theyyyy aaaaaaaaaaaaree eeffffffffeeectttiivee inn rrrrreeeeeetttttttaaaaarrrrrrdddddddiiiiinnnnnnnnggggggggggggg tttttttthhhhhhhhhheee aagggiinngg,, aaaannnnndddddddd wwwwwhhhhhiiittteeeennniiiiiiinnnngg anndd mmooiiissssttttttuuuuuurrrrriiiiiiiizzzziiiiinngggg tthhee skkkkkkiiiiiiinnnn bbbbbbyyyyyyyyy iiiiimmmmmmpppppprrrrroooooooovvvvvvvvvvviiiiinngggggg immmmmuuuunniiiittttttyyyy,, rrrrreeeeeessssttttrraaaiiinnniinnngggggg mmmmeeellaannnniiiinnnnn ggggrrrrooowwwwwwwttttthhhhh, pppprrreeevvveeennnttttiinnngggg oxiiddaattttttttiiiiiiooonnnnnn aaaannnnnddddddd suuupppppppplleeemmeeeennnnnttttiiiiinnnnnnnggggggggg nnnuuuttttrrriiiitttttiiiiiiioooooonnnn.

    TTTTThhheeee ccooooosssssmmmmmmmeeeeeeetttttttttiiiiiiicccs aaaaarrrrrreee gggggooooooddd fffffooooorrrrr ppprrrrreeeeevvvveeennnnnnntttttiiiiinnnnnngggg skin wriinnnnnkkklesss,, mmaaiiinnntttaaaiiinniiiiiiinnnnnnnnnggggggggg apppprrrrooooopppppprrrriiiiaaatttteeee mmmmmmoooiissssssttttttuuuurreee oonnnn ttttthhhhheeeeee sssskkkkkiinnnnn aaand mmakkiinnggg tthhhee ssskkkkin aallllwwwwwwaaaaayyyyyyyyyyyssssss wwwwwhhhiiitttee aanndddd eelllaassssstttttiiiicc.

    KaKaKaKangngnghuhuhuh nnnnngngnngnggg T TTTTTTeceececeececececchnhnhnhnhnhnh ololoooo ooggogggggyyyy y y yyyyy TTrTrrrTrrrradadaddadadadaddadadiininninininnnining gggg ggggg CCCCoCoCoC mpmpmpananyyyAdAdAdAddAddd:d:dd: S SSSSosososo oooonnnnnoo g g ggggg DiDiDDiiDiDDistststststsstriririirir cccctctcccttc , PPPyyyyP oonononono gygyggyyggg annanng,g,gg,g, D D DDDPPPRRRRPPRR KKKorreaeeaTeTTel:l: 8850500-2-2222---11818181888111111111-3-3-333-34141414441858588 44444444 F F FFFaxaxx: 8585850-0--2222-22-22--2 344343633 66666 3333E-EE-mmamamaiilil: : : aararraa irirriranannngigiiig p@p@p@p@[email protected] nenenen t.t.t.t.kpkpkppppkpkkp

  • 2 Foreign Trade of DPR Korea2 0 1 7 . N o . 2 3

    At theee f f fffoooooooot t of MMt t Ryonngagagak k kkk which is ffamamamammououo s in PPyPP ongyannnnnggg ggg foffor its beautiful scenery and crrrrrysyssysstatatatatal-l-clear water, Ryoyoyoyoyongngnnn akakakksasasss n n n Soap Factoryy pproduducecesss vavaririououss sos app proodudududuductctcc ss ofofofofo fifi fi nnee ququq alalitity.y.

    InIn l ine wiwiwiwiwithththtth t t tthehehehe ffeaatutureress fof produucicingn vvara ioususs l liqiquid andddd d d dddeteeeee ere geg nt, itt hhhas establishede an intet grgratateded

    ttturururrininninnngg gg syystststememm a a aaandndd reaeaalilll zeeed d d d at a higiiggh hhh leevel full onononno ooooof f f f aaala l ththtt e ee prrococo essessseseesesesess s innnclclcclcc udining ggg raraar www mateerir alalaal oooon,nn vvacaccuuuuu m m m emememuluulu sisisisiifi fi fi fi catititionon, waaww teter r treatmmtmennnnntt,t anananand ddd mixiiingngngngg, , fi fi filtlterererrrriniining,g,g,g,, mm matatattuururatata ioonn ana d d stororining,g,

    inninjejejectcttt niniiing g anananananndd ddd papapapap ckckckckkc agggininininng.g.g.g.gWoWoWoWooW rkrkrkkkplplplplplacaacaccesessees a a a aarererererre ddd ddususususuu tttt-t- a andndndd g ggerererrm-m-m-m-frfrfreeeeeeee a aaass ss s rerererequququuuuiririririredededed

    bybybybyy G G GG GMPMPMPMPMMM a a aa aandndnddnd h h h havavaava e ee bebeb enn fffurrurninini hhshshedddd w w wwitittitthhh h cuuuucuttttining-g-edededddgegegeggge aanaananalalala ysysysysyserererrs s s sss anananana d dd d ddd hyhyhygigigig enenene icicicc facacacillliitit eieieees s s s inininnn o o o ordrdrdrdrderereerer t t tto o o enenenene sususus rerere hyhyhygigigigienenenneniicicicic ss s afafffafa etetetyy.y.y.y

    ThThThT e e e fafafafaactctctctc orororo yy y dededeveveveelollololopspspspsp aaa andndndndd t tturuuru nsnss ooouututut m mmmmuuluulululu tititti-f-f-fffffununuuunuunuu ctcttc ioooionanananaan l l lliliquququqquidididd s sssoaoaoaoap p pp ananananddd vavavavaririririr ouuouououss ss s ssss dededededeeedeeedd teteteergrggrgeneneneentstststs ww w whihilelelee eee enhnhnhnhanananciicicingngngngn thththheieeir rr enenenriririchchchmemementntnt a aaaannndndnd e e ecooco-f-f-fffrrririiirieneendlddlyyy stststananandadaddardrdrds ss sosooso a a asss tototo kkekeepepep uu uppp wiwiwiththth tt thehehe dd deveveveveevveveveleleelleleloopopooooo iinngg gg rerereala ity.y

    ThT e producuctsts are vvararioiousu iin kindnd i incncnclulululudidididingngngng bbb bododododyyy y lootitioon, shshammpopoo,o, c conondidititiononerer, , liliququidid s soaoap p foforr clothes, ded tergent foforr didishshees,sooap powdederr anand d sosoon.

    Liquidd s soapss f fforro hahahaiirir aa dndnd s skikikinnn ththhattttttat aaa aa arerere added withh n natatururala functional sububststana cecess, bbioaactc ive materials and arommaticc e ssence are efeffifi cacious in moisturi-zingng, preventing of UVUV raradidiatatioion,n, r retarardidingngnng o oof f thththhe ee e agagining,g, wwhihittenininng,

    sosoapap andndnndnmamammm nunuunuufafafafaactctctauaauaua tooomamaamamam titititt ooprprp epeppepeparararararatatatata iiiiagagagagitititatatatatatininniing ggggininnjeejectctinininini gg

    Soap FactorySoap FactoryRYONGAKSAN RYONGAKSAN

    Ryongaksanan SSoaoap p FactoryyAdAdAdd:dd: MM Manangygyononongddgdg aeaea D Disistrtricict,t, P Pyoyongyang, , DPR Korea Fax: 008585-0-02-2-381-444410100/4/4/4414141666

    trt eattment of acne and alopecia, and preventing of sweating, deodoro ization and preventing of frostbite.

    ThThhee onone foor r clccclotooo hes that are added with solventbioooorgrgananicic enznzymyme,e, foaamsms w well in cololo dd d water, dissolvesanannnnndd ddddd removes spspotots on clotheses, mamakikingng t them soft andclcllc eaeaeaaaan.

    TThThTheee faffafactc ory yy paays pp ppririmaamm ryry attentitionon ttoo rerelyining onon l lococalallyy-avava aiaiaiaiailalalalablblblblee rararr w w w w maateteeriririalalaaalss aanand inininnccrcc eaaeaeaasisisis ngngngng t t theeheheh v v varara ieietyy ooooff f prp oducucucctstststs ww w whhileee c c c cconononono dudududud ctctctctctinini g teteeetechhchhchnicacall exexxxchchchhanananngegegeee w w wititittth h h hfofoorererereigigign nn n cococounununu trtrtrieieiesss.ss

  • 4 Foreign Trade of DPR Korea2 0 1 7 . N o . 2 555

    Taean Friendship Glass Factory

    The Taean FrFriei ndndndshshshshipip GGGlaassssss FF acactotoryry is a comprehensive glass prprproddododuucuctststs mmakaka ererr w whiichch turns out glass producctsts ooff mamaannyny k kkinindsds bbyy relying on locally abbunundadantnt r rawaw materiaials with goood qualitative innddicces..

    Fuulllly y eqquipppeded w ith plaate gglasss produucttiionnonoo prprocess andd secondarry y prp oocesseed gllasa s s prododuuccctstsss maamamanufaactctuuring and raw maateerials pproduccttiionon b baassseses,, ,,ittitt f ffococococuseses o n making plaate gglalassss wwhih lee pproduucccinggg ototheherrr kikikikikindnn s ofof g gglass proroduducts.s.

    ThThThee e plpllatataaate e glasss s productionon ppppprroroceceesssss, , wwhwhicch iss cocontn roollleded bbbby yyyy an intteegrated manunufafafaf ctc ururiningg syysstsssteme , isis f fulullyly a aututomomommatatatttede , sttrer amlined annd d d rooobobob tizedd,, frommm sandd selectitionoon ttto ooo o rarr w w mam teterials s mixtuurre,e mmelltitingng, ,momoululdidingng,, ggradadddddduauauauuuuaual l cococoololollinninini g,g, cuttinng aand ppacca kakak ging. It has a daily ppppppproror dud cttioioioon nn cacapapaciityty oof ff tetensnss of ththouousasandndss ofof s sququarararre ee metrreeesess o off plplaatee glass..

    PlPlatate lglass proddo uucuccuu eededeeee h heerre is ttraransparentnt, , verry clleaean onon thehe sururfacece aaanndndd 3 3 --1221 mmm thhicck.

    ThThThT e ee seseecocondndnddararary y yyy prprprp ococococcesse seses dd glglass prp odducuctss mammaamanunnufaffafa ttctcc uruu iniinng gg babbaaassesese t t tururrru nsnsnssss ooo oututttut ggg lalalassss fi xxtutureres,s wiwiwiw ndndndowowoows ss fofoor r roroadadad aaandnddd o ooooththhht ererrr vv vvvehehhehicicici lelees,s,s ll ama inatatededed glglglglllglasaasass,s,s,s, sss sssililililveveveveryryryryyy, , , , sisisisilvlvvlvlvl erererer-gg-g-g-grererererey,y,yy bb bbb bbluulululuuluueeee eee e anananaana d d otooto heher rr heheheatat rrayaya s srereerereeflflfl flflexexexexiioiooion nnn glglglglasasasasasasasseses,s,s,, ccururrveveveveved d dd susuuuuurfrfrfrfrfacaacaace glglglggglglglglgg asasaaasa s,ss,s ff froror sttstededd gllgg aasasasass,s,s,s, o o ooornrnrnr amammmameeeennntatat l l l ggglgglasass s s wwiwiw ththh p p pppicicicictutututut rereerr aaaa andndnn ppp lalalastsstici wwiwiwwiwww ndndndnndnn owowwows sss wiwiwithhthth tt tttttememeeee peeeperererered d glgllglasasasassssess.s.. T TT TTTheheeheh y yyy ararre ee popopop pupup lal r r wiwiiwwwittthththhhht ttthehehe cccc cc lolo leel agggggggguueues s innnnn tttthee rreeleleelaatateded pppprooroororodudud ctctctttctcts-s-s--s maaamamm kkikikingnngng anana d d consnstrt ucu tiionoon sseccttotorsrs f for theh ririr h igiggiggghh h hhhh quququququququaalaalalaa iti y.y.yy

    GlGlasa swswara e e prprododo ucuctiionon bbase mam nnnunufafafactctctctcturururuuruu eesessee mm mmanany ykikikikindnddndndnndddss ssss fofoffofof ggggg g gglalaaalal sssssssss bbbbbb bootoototototottltltlttltltleseseseses, , didididddididiishshshsheseses a aaa andnn hhanananannndididiicrcrc aafafa tstss,, whwhwhwhwhwhososososososoosse eee dedededemammaamaamandndnn iis s ononononon tt he rrissssee.eee

    PPllPPPPPlaaattaata ee gllglasssassssss ss sss ananndd d totototoothhehhhh r prrododododdoducu ts aaaaarereerereerere eeexpporororororteteteeted d d dddd tototttoto seseeveeeeerrrraall l counnnunttrtrrttrtriees.s

    KKooKooKorrerrea GlGllassassss ss ExExxpopoppopopopoportrtrtrtrtrtrtrrtrt a dddndn II IImpmpmpmpmpmporoorororttttt tt CCCCoCCCoCoCoooompmpmppmpmpmpmmpaananananyyyyAddAdddddd:d:d T Tongdgdddaeaeaeaeewon DiDiststststststss rrirrir ct, , PyyPyonononono ggyggggg anng,g, DDDDPPPRPRP KKKorororeaeaeaeaeaTeTTeTTeelll::l:ll 888 88885005050 222-2 111-181818181188 111111111111 33-33818181 88-88414141441414 4444444FaFaFaFaFaaFFaxx:::xxxxxxxx 88888885050505050-2-2-2-3-3-38181811181--4-44-4-4-44141414100E-E-E mmaaaammaaiililil::: kpkpkpppglglglasasasss@s@s@s@@ss@s@@stststararar c-c-co.oo.o.nenneeeenettt.kpkpkp

  • 6 Foreign Trade of DPR Korea2 0 1 7 . N o . 2 7

    MUNPHYONG Smelteryp y g y ,Munphyong Smelteryrr situaaated in Munnchchon,

    Kangwon Province, is taking gg the papart ooof f anonferrous metal production bbabasese, , asass i i itt hahas s enhanced the inddepe endedeentntnt cchahahaarararactctctere in prp oductionn andndn m mmmododododerererernnininizezezed ddd its sss inninninfrfrfrf asasa trrtrucucuctuttuurere..

    ThT erre ee aarararee sususuchchch bb bassasicic p pproroduductctc ioioon n unununitititss s asasaswoworkrkrkrk hshshhoppopops ss fofoforr reefi fi niningng a andndnd eelelelectctctrorolylyyzizingng leaeae danannddd zizincc, ana d d otheer r woworkrkshshs opops s fofofor r ininpuputtttinini g g raraaw w ww mamateterialala s s anand d fufuelel, , andd foor r rerepapairir a andndmamaaininteenanancce e ofof eeququipipmementnt, and inindud sttririallaaaboob ratototoryry.

    AAlA l l thhthe e e prrp ododuccucttionon pprrocec ssseseses rannnngig ngng ffrorom mraaaww w mammateterrir als fefeeededdiing tototo p paca kkak gigingg a areer rrrununn bb by y yauuuttotomamamatiticc c cooontttn rrol ll syysys stemememm..

    ItII cccononno sosooooliililidateees sss mateterriirrialaal f foooundnndndatationssfoooorrr r prododucuu tion aaaaa and introodudddduceces sss adadvavancnccceedddddtetetetechchchchnnnononollolologigigig esesesees a a a aass s rererequuquuquiriririrededed bb bb byyyy y y ththe eee dededeededed vvevevvelolollooloopippip ngngggggggreeeallalalitititity.yyyy.

    IItItIttttIIt hhhh asassssas nnn nnnnewewewewwewewlylylyylyyy ss sssetetetetetee uu uuuup pppp p aa a aaaaaaaa prpprprrprpprprprocococoocoococcoccesesesesesese ss ss s s ofofofoffofofofo ee e ee eleelelleleeleectctttctctctctrororororoolylyyylyylyylylyyziziziz ngnggggngggg llelelelel adadadad o o o oof fff huhuhuhuhhundndndndrereeeredsdsdsdsds o ooo o offf ff ff tototototototonsnsnsnsnsnnsnsns aaaaa andndndndndddd a a a aa p p pp ppprorororororoor dududududuuuuuctctctctctcctctccc ioiooooioiooonnnnnnnnnn ppprprprpprprprpp ococococococooocccesesesesesessesesese sssssssss wiiwiwiwiwiwiwiwiththththtttthououououououoo t t t t ususuusssuususinininninnng g gg g gg g cocooococoooc kikkikikiingngngngngngngnggngggg ccc ccc cccccoaoaoaoaoaoaoaalll,ll,l,l, ttt ttt t tttthuhuhuhuhuuhuhuhuhuhuhuhuuusssssss s mmimiimimimimimimmmimmimmm niniininininininininininininimimmimmimimimimmiimiimiim zizzizizizzizzizzzzizizzzz ngngngngngngngnggg iiiiiiii i i iiiiii nvnvnvvvnvnvnvvnnn esesesesesesesesessesesesstmtmtmtmtmmttmtmmtmtmeneneneneneneneneneennnnnnnttt t t tt tttttt anananannaananannnaaanddd dd d d dd mmmamaaammammmmamaaxixixixiximimimimimimmmimiimmm zzziizizizizziz ngnnnnnngngngnnngngngnggngg t t tttt ttthehehehehehehehehhhehhhhhhhhh prprprprprprprprpprrrrp odododododododdodoo ucucucucucucccccccccctititittttttiittiononononononononononnononn o oo o o o o o ff ffffff f lellelelleeeel adadadadadadadadadadad a aaaaanndndndndndddnddddndddnddndd zz zz zzzininininni c.c.cc.ccc.

    InInInInInInInInnntrtrtrtrtrtrtrtrtrodododododododooddoddducucuccucucuucucucucucucuccctitittiititititititttt oononnnnonononoono o o o oo o off f fff ananananaananananannnnna a aa aaadvdvdvdvdvddvddvaananannanananancceccecececeeccecedd d ddd teteteteteteetetetetttechchchchchhhhchhchchchchhhhnonnonononononnnn lolololooloooooolooogygygygygygyyggygyggggggggyyy whwwhwhwhwhhhwhwhwhwwhwhicicicicicicicicccicchh hh hhhhhh rererererererererrerrrerr ququququuququququququuqqqqqu rririririiriiiriririiri eesesesesseseseseseeeeses n nnnnnoo o oo o ooooooo hehheheheheeehehheheeeavavaaavavaavaavavvvavavvy y y y yyy oiiooiooiil ll inininninniinnn fi fi fififififififififififi r r r r rrrinininiiiiinnnngg g g gggggg thtthththththththtthhtttthttheeeeee ee e eee e uuuuuufufufufufufufuufufufufuffuf rnrnnrnrnrnrnrnrnrnnrnrrrnrrrnnnrrnacacacccacacaacaaaccacacaaacacccaaca ee e eeee eeeeee hehehehheheehheheheheheheehhelplplplplplplplpplps s s s ssss ssssisssssississsisigngngngngngngngngnggggnngggg ifiifiifiifiififififififiifiifiifiifiififififificcccccccccc cccccaaanananananannananaananaaanananaanantlttltltltltltltltltltltlttlltlyyyyyyyyyyyyyyyyyyy yyyy rererereereerrererereeererer uuduuudududdududududduddududd ceccecececceccceccecee t tt t ttheheheheheheheheeeheh fifi fififififi rr rrrrrrrrrrrrr nininininininninnggg g gg g g gg tititititititittititttttimmemmmeememememm aa aaaa a dndndndnndddndndnndn mamamamamamammmamamammamammammmaanpnpnpnpnpnpnpnppnnnpnpnpppnpnpppppppowowowowwowowowwowowowowowwererererereerererererer aa aaaaa a aa aaaaass ssss wewwewewwewewewewewewewwwwelllllllllllll aaaa a aa aa asssssssss ss ss ppprprprpprppprprppr ddododdodododooooddoducucucucucucucucccccuuctittititttitittititititiitionononononnoooonnonoooon ccccc ccc c c cosossosososososo tstststststststtssstt ....

    ThTThThTThhThThThTThThTThThhThThe e ee eeeeeee eeeeee smsmmsmsmmmmmsmmsss eleelelelelelelllleltetteteteteteeteteeteryryryryryyyyryryryyryry h hhhhhhhhhhhhhhaasasasasaasasassssss iiiiii iinsnsnssnsssnnssttatataaattatataatatatat lllllllllll ededddedededededdeddddddd dd d dd dd d dddusususususuuuusust t tttt tt cococococcoccccococc llllllllllllllleceecccccecececececttotoototottotooootott rsrrssrsrssrsrrsrrrsrsrsanananannananaaanandddd d ddd d d ddddd ssseseseseesesssesseeeeseesettt tt ttttt upupupupupuupuppuppppuppppp aaaaaaaaaaaa aaa www ww wwww wwaaasasasasasasasastetetetetetetetetetet tt tt t ttttrerererererereee tataattaataaataaaaa mmemeeemememememeementntnntntntntnt p p ppppp ppppprrroooroorororrorocecececeececeeceeeeeec ssssssssssssssssssssssssssss , , ,, ,, thththththththththhththhhusuusussssusususususuuuuss prprprprprprrrprprprprprrpp eveeevevevvveveveveeveeveevvevenenenennenennnenene tititittttttititiit nngngngngngngnngn eeeeeee e eeenvnvnvnvnvnvnvnvn iiriririririirononoonononoonoononnno mememmemememememmm tntntntntnttntnttalaalalaalalal p p p pppp pp ppoolololololooololooolooolololoollulluluuuluuluululululululuuluutttitittitttitititittitit ononononononooononnonoononoononnnooonoo aaaaa aa aaaa ndndddndnddddndnndndndn rerereerrereecycycycycyyyyyyclcllclclclcclcc ininiininni g g g g g g g a a a aa aa a aaaa cococococococococccoc nsnsnsnsnsnsnsnsn ididididididi eererererererererababbababababbabaaaabaablleleleleeleleee aa aa a aaaaaaaaaammmmomomomomoomomoommmmomoununununununununnununununnunnnt tt ttttttttttt tt ffffofofofofofoffo l lll l ll lleaeaeaeaaeaeaeaaeaaeaaaaddddddd d dd ananananananaananananaa ddddd dd d ddd ziziziziziziziz ncncncncnccnnncncn ..

    A A AA AA AA AA A AA prppprprprprprppp ococococccesesesesesesesesesess s sss s s s isisisisisiss a aaa aaaa aaaddddddddddddddddddddddddd edededededdedededededed tt t ttt too oooo ooo o ooo tththththththhtthhhhththhee ee eeeeee e rerererererererereereresssississisisssidddddudududddddudududddudududuuesesessseseseesesesess ww w wwwwwwororororrorooro ksksksksksksksksk hohohohohohohooop p ppppptotttototototoototo p pp ppppppppp p prororororororoororor dududududududududdududuuucecececceeceecececccccc sss ss s ss lliillillvvvvvevevvvev r anannnnnanannanddd d dd d d dd ootoototototototottoototoooo heehehhehehehhehhheeeeerrrrr r rrr pprrprprppprprprprrprpprpppprprprppp ecececececeece iioioioioioioousususuusususs m m mmmmm tteeteteteteteteetetetalalalaaaa sss.s.s.ss.s.

    IttItIItItts s s ssss leleleleeleleeleadadadadadadadadaaad a aaa ndndndnddndndddd zz zz zz zzzzzziniininininnniiii c c cccc ccc prprpprprprrprprrpprprprprprrpp odoodododododooododoodducucucucccuccccuuccccccucctttststttststsss wwwww wwititititittitittitittti hhhhhhhh hhhhh ththththththththheee e e eeeeee ee pppppuupupuupupuupupuup riririririiritytytytytytytytytyyyy o o oooooooooooofffff 999999999999 77.7.77.7777%%%%%% % %% % arararararararaaa eee ee eee dededededdeededeededdedeemmmamamamammaaamaamamandndnddndndndndnndedededeeeeee iiiin n n lalalalalaalalaaaaargrgrgggrgrrrrgrgrgrgggerereeerererer aa a a aaa momomomooomoommm uuunununuunnununnuntstststssstsssts bbb b bbbb bbbby y y y yy yy thththttthththththtthttheeeeee ee nanaananananaaatitittitititittit oonononononoonalalalaalaalalalal ee ee eee ccococococccononononomimimiimmmimimm cc ccc sesesesesseectctccccttorororrrrrrro sssss ananananaanandddddddd dd ththththththheeeee eeee ininnnninini tetettteteeernrnrnrnrnrnrnrnrnrnrnatatatatataa ioioiooioioioionananananannan llll lmarrkrkkkkkkkrkkkrkrketeeeeeteteteteeeee s, as wewewweweweewewellllllllllll .

    KKKoKoKoKooKooKKKKKK rerrererereeeaaaaaaaaa a a KwKwKwKwKwKwKwKwKwKKK anaanannnananaannanangogogogogoogogogogogoogoogoppppppppppp ppp pp TrTrTTTTrTrTrT adadaa ing Corpor tattatattiioooiioioioonnnnnnnnAdAdAdAdAdAdAdAAdAdAdAdAAdAdAAAddAAAAAAAA d:d:d::d:d:dddd:ddd:d:d PPPP PPPP PPPPoototoottottooottoootttoo hhhohohohohhhhohohhhhhhhohhhhohhongngngngnggagagagaggagaangnggngngngngg DDDDD DD Diisissssisisisiisstrtrtrtrtrtrtrrrrtrrttrrrrrttt icicicccicicicciiciciciciicicciicct,ttttt,ttttttttt,ttttt PPPPPPPP PPPPPPPP PP PPPPPPPyoyoyooyoyoyoyooyyyoyoooooyooyoyyoyoyyoyongnngngnngngngngngnggngggngngnngnggyayayayayayyayayayayaaayyy ngngngnngngngngngggg, ,, DPDDPPDPDPDD RRRRR RR KKooKoooKoK reeerereerereeeaaaaaaaaaaFaFFaFaFaFaFaFFF x:x:x:x:x:xxx 00000 000080808080808085-5-5-5-5-5-5-55-02020202020020000 -4-4-4-4-44414141414116,66,6, 44444 4441414141144144 0000000TeTTeTeTeTeTeeeTel::l:l:l:l:l:l:: 000 0 00000000800808080808885555-5-5-5-5-5-555-5--5--5-5--5-0002002020202200000202-3-3-3-33-381818181818181-1-1-1-1---18181811818181818 111111111111 ( ( ( (((((eexexexexexe t-t-tt-t-t-t-t--tt 828282828282828222202020020202020)))))))))E-E-EE-E-mamamaaamammaailillllli :: : :::: : kkkkkkmkmkmmmkmkk iniiininininnnn@s@s@@s@s@s@s@@s@stattataatar-r-r-cocoococoo.n.nnn.nnn.n.neeteeteteteteett.k.k.kkkkkkkkkppppppppp

    Economic Development Parks in Original Shapehe government of the Democratic People’s Republic of Korea set up economic development parks and is

    accelerating their development in its own way to promote external economic relations and improve the people’s living standards.

    In establishing economic development parks primary attention is paid to the effort to lay legal foundations suited to the world standard of management of special economic parks. The Socialist Constitution of the DPRK stipulates in Article 37 that the State shall encourage institutions, enterprises and organizations in the country to conduct equity or contractual joint ventures with foreign corporations and individuals, and to establish and operate enterprises of various kinds in special economic parks.

    According to special State laws and regulations foreign-invested businesses in the economic development parks of Korea receive preferential treatment in their economic activities such as investment, production, trade and service. The DPRK has laws governing special economic parks, for example, the Law on Foreign Investment, the Law on the Rason Economic and Trade Zone, the Law on Hwanggumphyong and Wihwado Economic Zone and the Law on Economic Development Parks, and assures guarantee for protection of the legal right and interest of the foreign investors through relevant regulations for the enforcement of the laws.

    The DPRK levies eight kinds of taxes such as income tax, transaction tax and resource tax, which means it imposes much fewer taxes than those charged by most of foreign countries. The tax rate is also very low. The enterprise income tax rate is 14% of the net profi t, and that in the priority sector is 10% of the net profi t. Besides, a lot of preferences are provided in terms of imposition of preferential tariff, preferential treatment in use of land and preferential offer of bank loan. The enterprises developing infrastructure are specially treated; their property, infrastructure facilities and operation of public establishments are tax-free, and a privilege is given in the matter of acquiring the right of tourism, hotel and other businesses.

    Typical of the special economic parks in the DPRK are the Rason Economic and Trade Zone, the Wonsan-Mt. Kumgang International Tourist Park, the Hwanggumphyong and Wihwado Economic Zone, the Sinuiju International Economic Park, the Kangnyong International Model Green Park, the Unjong Hi-Tech Development Park and the Mubong Special Park for International Tour. The Rason Economic and Trade Zone, which is located on the lower reaches of the Tuman River, is bounded by Hunchun City, Jilin Province, China, and by Khassan, Russia. It is playing an important role in the regional economic development of Northeast Asia.

    Its development started in 1991, and now there are a hundred and scores of foreign-invested businesses including contractual

    joint ventures, equity joint ventures and wholly foreign-owned enterprises. The zone is connected to China through a land transportation route starting from Rajin Port, and to Russia by a railway. It also provides international telecommunications, satellite television, Internet and other services for communication. The foods from aquatic products factories in Rason are in high demand in the international market, and pollution-free bathing resorts are a great favourite with tourists. According to the master plan of the development of the zone, infrastructure projects are now going on in real earnest, bringing proper features to the economic and trade zone.

    The Wonsan-Mt. Kumgang International Tourist Park centring on Mt. Kumgang, a celebrated mountain of Korea, has many unique tourist attractions, so it is called pearl in the East Sea of Korea coast. Based on the tourist potentialities the park will become a model for development of tourist parks with a complex of curiosities—sea, mountain, ravine, lake and urban community. It will bring a great economic profi t to those who invest in the development.

    The Hwanggumphyong and Wihwado Economic Zone (Hwanggumphyong and Wihwado are islets in the lower Amnok River, on the boundary between Korea and China) has emerged as a new arena of economic cooperation in the Northeast Asian region, and is drawing the interest of investors for its prospect of development as a base of processing trade and freight distribution. The inauguration ceremony of the development project was held in June 2011, and the construction of the offi ce building of the zone management committee was completed. At present the development project is in full swing.

    The development of Sinuiju, a border city in west Korea, is aimed at constructing a complex economic development park for tourism, trade, hi-tech industry, bonded processing, fi nance and the IT industry. For its advantageous physiographical position facing Dandong, Liaoning Province, China, across the Amnok River, Sinuiju is drawing the interest of foreign investors. A joint venture corporation was established for the development of the park, which is now leading development projects.

    The green environment-oriented Kangnyong International Model Green Park is under development in Kangnyong County, South Hwanghae Province, which has rich marine resources, favourable marine conditions for trepang and abalone farming, and a clean ecological environment of the sea

    In the science park of Unjong District, Pyongyang, is the Unjong Hi-Tech Development Park whose main job is to research and develop science and technology.

    The economic development parks in all provinces, which have been set up in areas with favourable conditions in accord with provincial features, topographical conditions and economic development foundations, in

    particular, are hopefully expected to become areas for international investment and render a unique service to improve the local living standard and develop the local economy.

    Great efforts are channeled into the campaign for economic development parks, attracting interests of investors. Typical of the parks are the Amnokgang Economic Development Park in North Phyongan Province, which is comprised of islets in the upper reaches of the Amnok River across from Dandong City, Liaoning Province, China; Jagang Province’s Manpho Economic Development Park which is worth developing as base of international tourist and trade service and modern green farming, and the province’s Wiwon Industrial Development Park whosemain enterprises will be processing of mineral resources, wood and agricultural produce and manufacture of mechanical facilities; theChongnam Industrial Development Park in South Phyongan Province with the focus on manufacture of mining machines and production and export of chemical products made fromcoal; the Hyondong Industrial Development Park in Kangwon Province which is to support development of the Wonsan-Mt. Kumgang International Tourist Park by dint of IT and light industries and production of souvenirs for tourists; the Hungnam Industrial Development Park in South Hamgyong Province which comprises Hungnam Port and giant bases of chemical and machine-building industries;the Chongjin Economic Development Park in North Hamgyong Province which is proud of rich deposits of iron ores and marine resources and a large-scale ferrous metallurgical industrial base; Nampho City’s Waudo and Jindo export processing parks which are next to a trade port and rely on advanced development and operation techniques; the Songnim Export Processing Park in North Hwanghae Province;the Pukchong Agricultural Development Park in South Hamgyong Province; the Orang Agricultural Development Park in North Hamgyong Province; the Sukchon AgriculturalDevelopment Park in South Phyongan Province.

    A stable socio-political environment, multifarious economic and technical foundations and potentials, an infrastructure which can fully support business activities, topographical conditions for access to large consumer markets, productive labour force, training of capable businessmen and professionals, asmaller number of tax kinds and a lower tax rate, and rich natural resources—these come as main factors of security of foreign investment and larger profi ts.

    At present many investment businesses areengaged in the development projects with keen interest.

    The DPRK government will remain committed to the ideals of independence, peace and friendship, expand and develop the relations of good-neighbourliness, friendship and cooperation with those countries championing independence.

  • 8 Foreign Trade of DPR Korea2 0 1 7 . N o . 2 9999999

    3D Laser Shape Meters

    The Hungnam Industrial Development Park includes part of Tokphung-dong, Haean District, Hamhung, South Hamgyong Province.

    It is situated 0.5 km away from the port of Hungnam, capable of dealing with and storing bulk and other goods, and over 10 km away from the Hungnam Railway Station and Wonsan-Hamhung motorway. All these are favourable for taking in and out materials.

    Power is supplied by the large-scale Jangjingang, Hochongang and Pujongang power stations and water by the Songchon River. As it is situated near the Majon Bathing Resort and Majon Hotel, it has favourable conditions for tourism.

    The land is fl at, with a gradient under 5°.For the fi rst stage, the development

    area is 2.2 sq km.As the park is located near the port

    of Hungnam and the country’s leading bases for chemical industry and machine-building industry, it plans to establish an industrial development park with the main stress on bonded processing, machine building, and production of catalyst, building materials, medicines and chemical goods.

    The Ryongsong Machine Complex, February 8 Vinalon Complex, Hungnam Fertilizer Complex, Hamhung Wood-Processing Mill, Hamhung Silica Brick Factory and other factories and enterprises in Hamhung can turn out equipment, raw and other materials and processed products to order needed in the park.

    Products from the park will be exported to foreign countries or used for meeting the domestic demands.

    The development park will be developed jointly by the DPRK investor and foreign investor or individually by the DPRK investor or foreign investor.

    The period of development will be 50 years.

    Economic Development Association of the DPRK

    Add: Taedonggang District, Pyongyang, DPR KoreaTel: 0085-2-381-5912Fax: 0085-2-381-5889E-mail: [email protected]

    Hungnam Industrial

    Development Park

    The 3D lasere sshahapepe mete eeeeerssss s arare e usused fforoororr pppp prereererereeciciccicisisisiononooon m mmmeaeaaaeaaaeaaaasussuusus rerereeremememememmm ntnt oooo f ff shappes inn sesevveral l sesectctorors s innnncludd ning g machine-buildingg, buuubuilddding mm mmaaata ere iaaaalsssss shappees iinn sesevveverall sesectctororss ininnnclududu iningg machine-bub ildiingng, bbuuuiilldiddingg mmmmmatataaataa ereriaaiaaaalsssslana d lighghgg t t ininduduststtriiririeseseses a a aa dnddn s spoop rtrttts s fififi fi eleleeeeeeldd.d

    TeTeTeTeTTechchchchchninininininicacaccacallll spsssspspspececececifi cations-3D annnththththrororopopomemetteteterrMaaaxxiiximmuumm m wowoworkrking space (lengtgth h ×× wiiwiwidtddtdtdthhh h ×× ×× heeheheehheheheehh iggggiggiggiggghthththththth ):):):)) 1 1 0 00000 ×× ×1 1 000000 ×× × 22 2 2 000000000000000 mmmmmmmmmmmmMeeasasurinng g acaccucuraracycy:: 101000 ~~ 1 000000 0 0 0 μμmμmμmData pproroccesssining g titimememememe::::: 88888 mimimimiminnnnn-33DD rorottataryryryyyy bbbbboododododyyy y mememeteteterrMMaMaMaMaaaMaxixxixxixix mmmmumummmumumm mmm wowoworkking g spspace (d(diaiamemeteter × × heheheheigiggightht): 5 500 ××× 5 0000 m mmmMeMMeasasurururininng g acaccucucucuraraaracycyyyyy: : 20202 ~ ~ 11100000000000 μμμ μmmmmmmDaDaDatataataa pp ppp pppppprororororororororoceccececeececc sssssssssssing g timeeme:: 2220202020 mm m mininininn33-3-3-3-3-3-33-333DDDDDDDD D sasasasaninninin tattaatataryryryry w ww wararrara e ee ee e memmemememeteteterr

    MaMMMaMaaM xxixixixxximumumummummumumumuummmmmmmm m wwwowwwowwowoowowowoorkkkrkrkrrkkrkrkkrkininninnninininng ggg ggg g spspsppsppacacaca ee e (l(l(lenenngtgttgg hhh h × × wiwwiiw dtdtdtdth hhh ××× × × hehehhheheeheeeeigggigiggggiggggghththththththhthhhtht):):):)::):)))):)) 80808088008000000 0 ×5×55×5×55500000000000000000 ×××××××× 4 4 4 44 4444400000000000000000000 m m m mmmmmmmmmmmmmmmMMMMeM asuring accuraracycy: : 770 ~ 1000000000 μμμ μμμμμμμmmmmmmmmmmmmmmmmmmmmmmmData proceessssinng time: 10 min-3D miminunutete parts meterMaMaxiximumuummm m mmm wowowowowowowwoorkrkrkrkrkrkrkininnininnnnnnngg gg gg ggg spspspspsspspspspspppacacacacacaacaacacaaacee eee e (l(l((((( enenengtgtgtgthh h h ××× × wiwidth × × heheheheheeeehheeeeheheeeigigiggiggigggghthhhhthhthht):):)::)):):)::: 5 55 555 5 5550 00000 00000 ×5×5×5×5××555×5×5×5× 000000000 000 0 000000 ××××××××××××× × 1101010110111001 0000 0 mmmmmmmmmmmmmmmmmmmmmmmmmmmmMeMeeeMeMeMeMeeaassaaasuuring g acaacacacaccccucucucucuc rarararaaraacyccccy:: 666 ~~~ 1010 ㎛㎛㎛㎛㎛㎛㎛㎛DaDaaaDaaDatatataataaata p p ppp ppprorororoorororocecececececceccecessssssssssssss ininnininii g gg gg tititittimememememem : 1010111010011 mmmminininnin

    KaKaKaKaKK ngngngnngghuhuhuhuhungngngngg T TTT Tececececechnhnhnhnhnolooooooo ogogogogggy yyyy y TrTrTrTTrTrTrTT adadadaddadda ininnininngg gggg CoCoCoCCoCoCCoCoC mpmpmpmpmmmpananaannnanananyyyyyyyyyAdAdAdd:d:d: S S Sososonononng g gg DiDisttstriririctctct,, , PyPPyPyyyonoonongygygygyanang,g,gg, D DDDDDDDPRPRPRPPPPPPPPP KKKorororeaeaeaTel: 850-2-111181811111-((ExExt.t.)3333418544Faax:x 885050-2- -3-3-- 434 666663E-E mail: arirranaanggip@sttara -cc-co.o.nen t.t kp

    Endoscope Products Win Favour

    yy gygy g pp g g yThThee PyPyonongygyanng EnEndodoscscopope Technological Exchhanangeg Company hahh s ded veelopeed d a a vavaririetety y ofo enddoscopes fof r indud strial and meddiciccalallaususu ee.

    ThThThosososee fofor r inininduddud sststririalal u usese c c cananan rr reaeaeadididilyllyy dd d disisisasasassesesembmbmbllele a andndnd c c cchheheheeckckkck tttttheheheininnteteriiriorororss s ofofof p p pararartstst o offf aiaiaircrcrcrararaftftft, shshshipipipss, a aututomomobbobbilililessesese , , hyhyhydrdrdrauauaulilililicc c c aananana ddd d gegegeegegeeneenenerararatititingngngnggeqeqeq iiuiuipmpmmmpmp eneenntt t ananananddd ototothehhehersrsrs. ThThThheyeyeyey a a alllslso o hhehelplplp ss savavaveee thththeee exexexpepepensnsnsnseseeseeses o o offff chchchhheccceeeckkk kk ananandd prprprprololololoononongg g ththhtheee tetetetechhccchniniccall lilifefe o off eqeq iuippmpmenent.t.

    ThThThThososooseee e fofofoforrr memmemedididididicacacacallll ususuuseee arararareeee ususussedeeded ff ffororoor tt thehehe eeexaaxaxammimimiminanananatittitionononon a a andndnd t t ttrrerereaatatatatatmmemeementntntntnnt oo ooofffff stststststtomomomomomaacacaach,h,h brbbrbronnnonon hchchcc usus a a andndnd o o oothththerererss s asasas w w lelellll asas f foror u unnopep nenedd sususurgrgrgererery y y y oofofo chesttst a andnd b belellyly..

    AlAAll fofof t t theheemmm arararee e ofofof eelelectctroroninic c imi aggagee scscrerereennenenn m m mmmmmodododoode eee bybbby CCDCDD cchihhhip.p.p.ThThhThhheyeyey r r receccecorororrddd wiwiwiw ththth s stattatititiccc ananandd d ddydyynananamiimic c imii agagesee aandd ccanann b bbe e e cocooococonnnnnnnnnnnecececececece tteteteeed dd d dd

    totooo c comommpupuuteeterssrs..

    1.1. EEnddossosscoccocopepepee f ororororr i ii i nddndnn usu trtrtriaiai ll ususseee

    1)1)11) HHaraarard ddd enennendodododoscscsccopopopopeeeeNuNNuNumbmbbmberererer:::: VIVIVV HRHRHRHR-D-D-D-9-9-9-90-00-0-10101010-5-55000000-9-9990000TeTeTeTechchchchnininiicacacacall l l spspsps ecececifiifiifiifi c c c catatatatioioioionsnsnsnsFiFiFF eleleld d d d didididirerereectctctctioioioon:n:n:n 9 9 990 0 00 dedededegrgrgrgreeeeeessssDiDiDiamama eteteteterr oooof f ff wowowoorkrkrkrkininini g g gg papapapartrtrt:: :: 10101010mmmmmmmmLeLengngththth oooof fff wowooorkrkrkrkininnng g g g papapapartrtt: :: 505050500m0m0m0mmmmmSiSizezee o o oof f scscscrereenen:: 4.44 3i3i3iinnnnInteernr alalal m m mmemememmoro y:y: 8 GBGBGBAVV-O-OUT: : NNNTN SCSCSCC,, , PAPAPAALL2)222) Haraaard curveddd ee e endddn ososososcococoopepepNumbere : VIVVV HR-R-55-1001010-5-5-- 505050-9-9-9-90000Technical specififififi ccccata ionsFiFF eld diireectcttioiioon: 55 555 ded grreeee sDiametter of wowww rkkr ing papp rtrt:: 101 mmmmLength oof wow rking ggg papp rttt: : 500m0mmmmFiele d anaanangle: 9990 000 deegrgrg eeeeessSizez of screeen: 4.4 3i3iinnInternal memmmmmoooroo y: 888GBGBGBBAV-OUT: NTSC, PAL3) Flexible endosccccopooopoo eNumber: VIV FR-55-100100-1- 000-0Technical spece ifi ccataaa ionsField directiooon:nn 55 degreesDiD ameter of woorking partr : 10mmLeLLenggggth of working part: 1 000m0mmField ana gle: 0 degreeSize of screen: 4.3inInternal memorory:yyy 8GBAV-OUTU : NTSCC, PAL

    2.2.2.22.2 E EE Endndososcocopepee ff fororo m mmedededicicicalal u uusseses

    1) EEleleleectctrorooonnin c c imimagagee ststomomomacacach h hhendoscoppeeeTechnical specififi ccatationsnssDiameter of working part: 100mmmmmLength of working part: 1 000-1 10000mmmmRange of clear vision: 0.5-120mmmm

    DiDiDDiD amamaammammm teteeetetete erererereerer o o ooo oofffff f f opopopopoooo enenennininii g g fofooforr r fofoforcrceppepe s:s: 11.222-2-2.8.88mmmmmmmmmFiFFiFiFieelellld d d ananannggle:e:e: 1111000000 d d degeggrereese2)2)2)2 LLLapaparararrosossscococoopepepepepeTeTeechchchc ninicacaacacc l ll spspsppececececifiifiifiifi c catatatioioiionsnsnsssDiDiDiamamammetetette ererereree o oo oof f f f wowooworkrkrkrkrkiniinining papartrttt: : 1010110mmmmmmmFiFiFiFielelele dddd d anananaa glglg e:ee:e: 77 775 5 5 55 ddededededed grgrgrgg eeeesssRaRaRaRaangngnggngge ee ee ofofof cccleeleararara vv vvvissisissisioioioiioonn:n: 55-3-3000000mmmmFiFiFiiFielelee d dd dd dididid rerererectcttioiioi n:nn: 0 000 d dd ddegegegegeggrerererereee,e,eee 3 3330 0 0 dedegrgrg eeeees,s,,s, 6 6 660 0 0 00 dededeeeeggrgrgrg eeeeeeeeess

    Pyongyang Endoscope Technological Exchange

    Company A A Adddddd: : MMaMangngngyoyoyoy ngngn dadaadae ee DiDiDistststs ririririctctctctct, , P Pyoyoyongngngyayayaayangngngngg, , DPDPD R R KoKoKorereereaaaaa T Telel: : 000008585-0-0-002-22-2 3838381-1-11 595928282822 FFaxax:: 0000858585-0-0-02-2-2-3838881-11--1 4646464 929229 E -mmaia l:l: ddusussononong@g@g@g stststararararr-c-c-co.ooo.nenennen tt.tt.t kpkpkkpkpkp

  • 10 Foreign Trade of DPR Korea2 0 1 7 . N o . 2 11

    Ryomyong Economic and Technology Corporation

    FoFoundeded dd in 1995, tthehee Ryoyomyong EEconomic and Tecechnologo yCoCoorporatatatioioon nn deveeloll psps a aanddnd mmakes pproroducts with ccomompep titiveveededgeg iinnn ininni tternatttioii nanal ll mmamam krkett by reelylyini g g onnn a bubunddana t locacalnatuurararal l reresosos uru ces s aana d eexexpopop rtrts themem to ototheh r coununtrt ies.

    It hasasas o ooveveer r r a a aa dod zeen n trtradadiningg companiees s includinngg tthhe PPyono gyyannngg RyRyRyomomommyoyoy ngg CC omompapanyny and Amisan TTradaddiingg Coompmpanany,yy mmoderrnn nn naanononootechcchnoololloggyy R &D&D andnd K Kaea songg K KKororyoinsaaaamm ((g(giininsesengggg) ) ) ppprprp odododucctitionono basess aandd Ranngngnang Fuurnnr iiture eFaaactctctctorororo y.yy.

    ThThT e e corporatatttioioioon igivees s s s prprp iorityy to the dded velopmpmmenenttt offfo cucuttttining-g edge sciciciiience aandnndn tttececechnnhnoooloo ogy. Fuuurrnishededede ww iti h a a nanannotechcchnoonoolololoogygygygyg rrrreseeseseseaeaeaeaarcrrrcrcrchh hhh tteteteteamamamam s s sstatatataffffffffedededed w w wwitititith hhhh cococoompmpmpmpeteteteteneneent ttscieientn isistst andndndd rr rresessese eaearcrchehehersrsrss aa andndnd a a f f fululululllll sesesettt fofoff a aaddvdvdvvannancecedd ananannnanallaalysysysisssanand pprodducu tionnn faccilliti ieees,ssss it deveeeellops anddd makes vvvvara iousususnananannanononon tetettteechchchcchnononolloloologygygygygyyy-a-a- pppppplililliedededd p pprororoduuctctctss s lliiikekekeke ccararbooonnn n nano-pipppppeses.

    CuCuCuultltltivivivatatioi n ooooofo KKaeaesoooongnnggn Kororyoyo insn am andndnn its proocccecessssededprrprododucuctts are ttthhhehe mmajajajorororr iittteteteemsmsms oo of ff thhthhhee ee e e cococorpororraatttta ioiooi n..n.

    SuSuSuSuchchch K Kaeaesosongng KKorororyoyoyo i insnsamam p p prorodududucttc s s asas K Kaea soongng K Kororryoyoyoo iinnssammam, ,anaanaananannddddd d ddd itititititititsssss s s prprprprprprprprocococococococesesesesesese seseseseseseeddddd d dd prrprprprprp odoodoododucucucucuctststststs cc—c—c—cofofofofoffefefefefeee,e, jj j jelelelellylylyly aa andndndnd t t teaeaeaea—aarereree m mmadade inin dododoozezezensnsns o o of ff hehehectctctarareseses w w widididee ininsasam m cuculttltivivivatatatioioion nn ananand d prp ocessing basasssseeeeee innininnin KaKaessonong,g w wididele y y knknowownn asas a a c culultit vavatitionon ggrororoununund d d oofoff KKK aeesoos ng KKorororyyoyo insaam.mm.

    AsAsAs t theheey y y arara ee e mmamaddede bby y cocombmbbbinininngg ggg trtrradaadaditititioioionnanal l prprococesesessissingnnggg tt tecececechnhnhnhniqqiquuueeesss ssssswiwithth ll latatatesesesttt sccscscscieeieiencncncnceee e anandd tetechchchchnonononololologygygygygygy,, , thththththeyeyeye aa rere u uunininiquququqqueeee ininininin ttt t tasasassasa tetetetete a aandndndddd flflfl fl avavavavavouououourr rr whwhwhw ililee pprprpreseseseeererviviv nggngg mmm maiain n ininnggredededieentts s s ofof KKaeaesoongng KK KKKororroro yoyyoyoyo ininsasasaaamm.m.m.m

    ThThe e e cococorprprppororatattioioion n n exexpopop rtrts s hhuuh ndndreredsds oof f ththhouousasandndn s s oofof tons ofofo qquaualilityty bbrbriiqiqueueuetttttteseses aa annnnnnuauauallllllly y anand d mamakekekekessss crcrcrcrededededitititit c card, ID D caacaardrdrdrd, , seseseservrvrviciciccee ee cacardrdd aand d totthehheersrsrsrs iiii innnn liliililinenenenen w w wititi hh ininteternrnnattatattiioioioionanaanalllll tstststs ananana dadardrds.s

    ItIt alsso o mamanunufafafactctc urureses furu ninitututurerere aa anndndnd fi fifix xxtutut reres s ofof a alll kkkinini dsdsdsds, , ppapackckaagaga ining gmaate irialalals,ss,s, ppp ppllalalaststststicicicic g g gooooodsdss, , fofofoododododssss anananana ddd d prrprprococo esessesedd d mamamamariririneeneenene pppp prororor dududdductctcts s ss aana d d aa vvaarietety yy of otthheerr p prorodducctts.s

    ItIt d dirirecectsts aa g grereatat d deaeal l ofofof e enenenergrggieiei s s toto thee dddeve elelopoppmememementnt ooo fffff ff pprrp ococessssisinggg t ttraadeddd .

    ItIt p proorocecececessssssssesesese c c chohoking ccooioill,l ee eleleleectctctc roronin c c coconnnnneccecectitititingngng l l linininesess aandndndd shshieielddeded wwiri ess, aand manufacturrese a vvararieietyy o of f gagarmmenentsts to orrrdedededer ffoforr r vavaririouous s cocoununtrtries.

    ItttItI eencn ouurageges eqquiityty and cconontrtracactutualal j joiointtn vvenentutureres inn servicee, roror adddaa vehehiciclele ppror duducctiion annd d oto her fi elds to memeete tthehee r reqequiremementnts s ofoffo t thhheheh ddevele oping reality.y

    Itt hhhhasasa settt dddevevelelopopmementnt o off f neneww prprooducts, ququalalitity y cocontntrorolll ananand d crcrcrredededededitit-fi firssstt pprprrp ini ciple asa iitss mmananaga emmenent t strategy aannd mmakakeses ccreeredidditwwororththhhhyyy y y ytrttrtranannsasaactions with differenent cocooununu trtrtrieiei sss of tthehehehe w w woroo ld.

    Add: Rangnang District, Pyongyang, DPR Korea Tel: 0085-02-341-5942 Fax: 0085-02-381-5842 E-mail: DAWN481@ star-co. net. kp

  • 12 Foreign Trade of DPR Korea2 0 1 7 . N o . 2 13

    Wonder Medical DevicesKuKuKuKuKuKuKKKKuK mjmjmjm inininn mmmmmededdededededeedee icicicicciicicicicici ininininnnnininnnnnni alalallalallalalal ssssssss tooototooootot neneneneeneneneennnennenn tt t tt ttttthehehehehheehhhee

    KKKuKuKuuuuKuKuKKumjjjjmmjmmmm ininiininnnn R R esesssssssssseaeaaaaaeaearcrcrcrccccrcrccccchhhh hhhhhhhh InInInnInnInnInInInststststsstsss itttititiiti utututuutututtuutu e eeeeee eee hahhah s sdedeed veveeeelolloololololol pepepep d ddd bybybybyybybybybybybyyy aaaa a ppppppppppppppplylyyyylylyyylyyyinininininiiniing ggg g gg gg g cucucuucucuuucuucucutttttttttttt iinnninniing-g-gggg dededededeededeedeedgegeggeg teteecchchnooloooolololloooggigigiigigigigiggigg eseseses m mmmm mmaaaiaiaiaiaaaa nlnnlnllnlnlllnnlyy yyyy yyyyy yy cccococooococoocoocccoocc nsnsnsnsnsnssssississsisissii stststststsststs ooooo o o oooo ooff fffffnaananonono-e-elelelemmementntttttttnttssssssss s s ofofofofofofooo b bbbbb b bbbblalaaaaaaalaalaackckkckckckckckckckckcckk p pp p ppppp p ppppeeaeeaeaeaeeeeaee rlrlrlr , , raaraaaaaaaaaaarerereererereererererrreee eaeaeaeartrtrtrrthhshshh , feferrrrititee,e, s ssilillillillili vevevevevevvvv r,rrrrr,rrrr tttttttttttt ttitititititititititttanaananananananananananaaaanna iuiuuiuuuumm m mm mmmmmm ananananana d dd ddddd ddddziz rcconononononnnniuiium.mmm.

    For r ththhhhhtht e e acaactitit onon oof ff ititts ss elelleleeee eeeececececceectrtrtrtrtrttrtrtrtrrrrtromomomomomomomomommommomomomomagagagagagagaaaaaa neneneneeneen ttittitiitic cccwaaveees s s ooofof d dififfeferererererentnt b bananddsdsdssdsdsdss,, fafafafaaaafafaafaafaaarrr r rrrrrrr inininninininiiiniinnnfrfrfrfrfraararraa ededededdedeed raraysyss, anananannnioion n anannnnd d dddd mamagnnnngnneteeteteticicicccccccccc fififififi fi fi fififi eeeee eldldddld, , iitttittit genen rateeeeesss vivvvv brbratatioion n ananannd dddddd rrrereeeesososssososossosooonananaaaaaancccnccncnce eeee e ini the tisssssusuesesesse a ndn iintntterere nananaanaall ll oorororo gagaggaaaagagaansnsnsnssnn ofof human bb odddodody y y anand d hhahahahas s ss s stststststttrrororoongngnggggngg sts eerilizing, aaantnti-ininflfl amammammamm toryryryryyy aaaaaandnddndn sesesedadad tive effecctst , thererebeby yy quiickenniiniiin ngngnngngg thhtthheeeee cicircrcrcr uulata ioi n n oof blooodd a ndndnnddd lll lymmmymmmymmy phphhphp ananand dd d cucu iririir ngngn iillllnenessssses.

    WiWithtth thihiiih s s s stsstone, m m orore e ththththann t tenenen kikikik ndnds off pporortatatatablbblblee meeemedidid cacal dedded viicceces s have b beeenn mamadede fforo thee t treatmeentn oof fillnesses in thee hheart and prostate, womemen’n’s s aiailmlmenentst aandnd p piles to suit the special features of the points of applicattiion and d paththogogenenesesisis.

    The device for the treatment oof fheh artt didiseseasaseses e emits 1/f fractal wobble electromagnetic wave which puts to rights thhe abnbnorormamal lelectromagnetic wave to cure the ilillnlnesesses.

    If you put the deviice ovver t thehe ppoiointnt ofof tthehe hheaeartrt, itit w wililll hahaveve r rememarkable cuccucccc ratitiveve e effffeccectstts fff foror ii irrrrrrregegegeguluululararar p ppululsesess in aaa aaabobbb utut 330 0 miminunutetes and angina ppepepepeepeppepepepeeeppepepeepeppepppp ttttctctctcctcctctttctctcctccctctctccctcttttccctcttorororororoorrororororororororroroororooorroororiiiisisisssisissiisisiississssss aaaaaaaaaaaaa aaaaaaa aaaaandnnndndndndnddndnndndnddndndndnndndnddndndndddddnndddnd mmmmmmmmmmmmmm mmmmmmmmmmmm mmyyoyyoyoyoyyoyoyoyoyoyoyoyoyyoyooyoyyyooyoyoyoyoyyyooooyoyocacacacacaaaaaccaccacacacacacacaacacacaac rdrdrdrdrr iaiial infarction iniininnnninininninnninininininnnnn a a aaaaaaaaa a aa aaaa www w w wwwwwwwwwwwwwwweeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeekkkkkkkkkkkkkkkkk.k

    ThThThhhTTThThTThTThThThTThThThThTheeeeeeeeee ee onononononononneeeeeee e ffofofofoffofofofofofoff rr r r rrrrrrrr trtrtrrrrrtrttrrtttrrtrttreaeaeaeaaaeaeaaaeaeaeaeaeaaeaeaeeeaeeatittitittiititititiiitttittittt ngngngngngnggggngngnggnngnggngngggg ppp rostatism rerereeereeeeeeeeeereeeeeeeeereereeeeer mememememmemmmmmemememememmmmmememmmmemmememmmmemmmm didididdid eseseses uuu uu urirriririnananananaaatitititittttttittitititttittiooononnooonnnooonnnnnnonnnn ttttttttttttttttttrororororororoooorroorororoorooorrrr uubbuuuuuu lele a ndd hyhyhyhhhyyyhyyhhhyhhhyyyhyhyhyhhyhyhyhyypppopopopopopppppopopoppppopppppppppppp ggggooooogoggogoooogooggogogooooggogggoog nanananaaannananannanannaaaannnanaan diididddiddiddidiididdiddiddididididismsmsmssmmsmmsmmssmsmm i iii in n nnnnnn n n twtwwwwwwwwwwtwtwtwtwwtwttttwtwtwwwwwwwwooo o oo oooooo o ooooo ooo momomomoomommontntnthshshshs anananannaaaaaaaaaaaa dd ddddddddd dd dddddddd pprprprprrprrprprprprprppprprprprpprpprprprrrp evevevevevvvvvevevevvveveeeve eneneneneenenenenenenenenenneeene tstststss p p pp prororoororoststststststtststssststssssttssssttsstttatattatattatttattattattee e e ee ee e eeeeeee eeeeeeeee tuuuutttttt momourururruru fofooffofooffffofofor r rrrr tththhthththththhhthhe e e e sysysysysysyneneneneergrgrgrgisisisism m m mm bbbbeebebeeeeebeeebbbebeeeebbbeeebebb twwwwwwwtwwtwwwwwwwweeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeee nnn nnnnnnnnnnn tht e cococococococoocoooococoocompmpmpmpmpmpmpmpmpmpmmpmpmpmpmppmpmmmpmponononononononoonooonnonnononeneneneneeneneneeenennenenenenenn ststststststststststsstsstt o oooo o oo oo oooooff fffff fff ffff hththththththhhhhththhhhhthhhhthe e e e e ee memememememmemedidididiiidididdicccicicciccciccccccccccccc nanananaaaaananaaanaaaan llll l lllllll lll sssststststtsssstsststss ononoooo e eanananananananananaanannananaannnandddddd ddddd dd itittittitittittitittsss s ssssssssssssss ststststststs erererrrrerere ililiililillililiillizizizziziziziizzzizizzinininninninnininininng g g g g gg g ggg g efefeffefefefefefefeffefeffffefefefefefefefectctctctctctccccccctccts.s.s.s.s.

    ThThThThThThThThhThThThThThTheeeeee e e dededededeeevivivivivvvvicececececececeeececee ffff f fff forororororrooorrrororror wwwwwwww wwwwwwwwwwwomomomommmomomomommommmmmmomomeneneneneenenenenneneenn’s’s’s’s’s’s’’’sssss d d dddddd ddddiisisisisisisiiisiisissiseeaeaeaeaeaaaeaeeaaaaeaeaasesesesseseeesssesesesses s ss ssssprprprprrpprprrprprpp omomomomoomommomommmo otototototototototo eseseseseesesesesesesseses tt ttt hehehehe c ccciriirircucucuculalalatititiononono o o of fff ff bllblblblblbbbb ooooooooooooooooooooo ddd dddd ddwiwiw ththth s strtrrononong g gggg stststts ereererrerililillizizizzi ininininnnng,gg,gg,gg,gg a aaaaa aaaaa aanntntntntnnttnnn i-i-i-i-i-iininiininiini flflflfl flfl flamamamamamamammammamamamamamatotototototototot ryryryryryy a aa aa andndndndndnd vvvv vvibibibibbbrararararaaatitititittt oonononono e eefffff ecececccttstststt ,, ,

    Komunssalchamnamuaek

    Komunssalchamnamuaek is a health food made from ten odd natural medicinal materials including black rice, oak extract, fruit of Schizandra chinensis and Acanthopanax tea.

    It contains acetic, propionic and other acetic acids, germanium, selenium, zinc and other microelements and such natural active materials as vitamins B group (B1, B2, B3, B5, B6 and B12), A, D, E and C that purifi es the blood, raises the immunity and maintains the balance of human body.

    It is effi cacious for treating digestive and liver diseases, neutralizing medicinal poisons, curing diabetic complications and retarding ageing.

    Korea Industrial Art Trading CompanyAdd: Phyongchon District, Pyongyang, DPR KoreaTel: 850-2-18111(ext) 341-8149Fax: 850-2-381-4410E-mail: [email protected]

    ccucucuuuuuucuuuuriririiririringngngngngngnggngngnggnngnnn d dd iffifiiffffefefeefefefefefefeffeeeef rerereeererrrrrr ntntnntntntnnnnnnn kk kk kkkininininndsdsssdsdddsdssddd ooo f ff ffff vavavavavavavavagigig nininnniiitittittitiitiss sssaanana d d pprprprprprprpp ofofoofoooooo ussssusussse eeeeeeee e fl flflflflflflfl flflowowowowwwwooowo oooooooooofff ffff lololoooolooooocchchchchchchchch aiaiaiaiaiiaiaaa ii i nn n awwwwewewwwwwwww ekkekkekkekekekkk, papppp innnnfufufuffufufufufuff l l llll lll l memmememememeemmemm nsnstrttrrtrtttruuuuauauuaaau tititttit ononn i iinnn n a aaamomomommomomomomomomomommmmm ntntntntntntntntntnntttntthhhh h h hhhhhhh aaaanananaaaaaananana dd d d d dddd dddd popopopopopoppoopoopop ssstssstssttss papaaaaaaaapaaartrrttrttrtttrtumumumuuu d dd disisiseeaaseseeeses ininnnntwtwtwtwwoooooooo oooo orororororrorororrrroorrr t tttttt ttttt thrhrhhrhrhrhrhrhhreeeeeeeeeeeeeeeeeeeeee mmmmm mmmmmmmmmonnonononononononononoonthhhhhhthhthhsss.ss.

    ThThTThTThThThThTTTThThT e e e ee e e e eee oooonononononoononoonononeeeeeeeeeee e e fofofofofor rr rrr ppipippipipiipipipp llleelleleleees s s s hahahahahhas s s sss mamamamamamamamm rkrkrkrkkededededeedcuccucucucucucucuuucuccuccuc rarrararaarararaaaraaaaaratititititititit vvvevveveveevevevvvveve ee e effffffffffffffecececececcctststststsstsststt f ff f fffforororororoo s s ss sererererererererioioioiooioiousuussussususu eee eeeeeextxttxtxtxtxxterereererrnanananall l lanananananananannananannddddd ddddd innninteeeernrnrnrnrnrnnrnnnaaalalaalaaaall h hhh h hh hhaaeaeaeaeaeaa mmoomomoomoorrrrrrrrrrhohhohohohohhohoiididididididdids s s inininnnn ttttt enenenenenenne ddddaddddaddd ysysyssss a a a a aaaandndndnndndddndd hh hhh hh hhaaeaeaeaaaa momomomomoomom rrrrrrrrrrrrrrhohohohoohohohoooh iidididididddalalaalaaa b bbbbleleleeeedededinni g gggaaanannananaanand dd dddddd pepepepepeppepepepeririririirirr prprprprprpprrrococococcocococo titittitt sssisisiisisis s s s ss ininininnnin oooooonenene o ooor rr twtwo odadadadadadadaaaaysysysysysysysysysys. .

    TThThThThhThhhee eeeee e ononononooonone eeeee e fofofoffofoffoofor rrrr mamammamaststststtopopopoopatatathyhyhyy ii impmprrovev s thththtththtt e ee e iciiircrcrcrcccrrcrcuululululluululattatataatioioioonnn nnn ofofofof bbbbbloooloododoodo aandnd lymphphtotototototoo d d d ddisissisissosooosolvllvvlve e eee thththhe ee aabbaa scscese ses onon thebrbrbrreaeaaeaaststststs s s ss anannaa d d hhelp relieevevve p pain anddedededd vvvveelol p p the e brbb eaeastststs.s

    The e prprrododucucts madde e wiw th the stonealalsoso c comoo e in pillow, p illowcase,

    yybaackkckrerestst a andnd h heaeaadrdreesst.t. T Thehey y didilalatetethththhthththeeeee ee blblbllooooooood dd d vvevess lels ininnin tt tthehehehe bbb raraaraininininn tot i iimpmpmmppprororoororooroooororovevevvvvevee t thehe b blolooodod fl ow and ststststststts rerrererengngthhtheenenee t heeheheheheheheeee c c celellululalaaaal r r fuunctionons sofofofof t ttthehh brain. SoSo ttheheeey yyyyyyyyyy heheeehhhhhhhh plpllplplp t tt reatt a aaandndndndndndprppreveeveneentt cecererebrbralal t thrhrommombobobobobobobboboooboooo isissisissss ssss and dcoc ntnntususioi n, sleep disturbances sss ananaaaaaaa dd ddidizzzzininess and thereby they promoteteeeeeeeehehehehealaalthth a ndd are good for long life.ThT ey also quicken the circulation of blood and lymph and keep pyruvicacid that is generated in the processof metabolism from accumulatingto make the user relaxed. They areespecially popular among drivers.

    The warming cushion (power DC 12v and AC 220v) is good for the treatment and prevention of

    scscscsccsscciaiaiaiaai tittititicacacacaaca, , anal disseeaeae se, neuralgia anananddd d vavavvavarrir ous other diddd seases and ininininvivivivigogoraraaates the users.

    ThThThThThT ee ee e wawaawateteteteer did sinfeccectatataantn made of thhthththhisisisisis mm m m ddededicinnala sstotonenenene p pururifiifi e es s anandd sttererililizizees ddriinkking waw tter, makes iitt taste good and inhibits the growth

    fofof c cololonon b bacacililillilili a a dndnd o othththerer g gerrermsmsms.. InInIn p p pararartititicucuculalalarr,r, tt thehehe uu usesesersrsrs cc cananan aa alwlwlwayayyss drdrininkk clcleaeann wawateterr inin s sulultrtryy y susummmmerer.

    These products are sought-after asasas tt thheheyy hhehellplp p pururifififyy ananddd mamakkeke bb blololoododod,, improve microcirculation, have sedative, anti-infl ammatory and other biological and curative effects, have a long serviceable life and are hahahhhhhhh ndy.

    Kuryyyyyyyononooooooooononggg ang Trading CompanyAdd: MMMMMooorooooroooroo anbong District, Pyongngngngngnnnggggggyayy ng, DPR KoreaTel: 0085-022-1111-1-1-1-111818 11(ext) 8989Fax: 0085-02-33818181818188181888811-4410

  • 14 Foreign Trade of DPR Korea2 0 1 7 . N o . 2 1115

    JJONGSONGONGSONG General General Pharmaceutical Pharmaceutical Factory Factory

    hehe J Jonongsgsg onononong g g GeGGeneneerarall PhPhPhararmamaceceututicicalalal F F Facactotooryryy i i iss s aaa cocompmpprereeheheensnsiivivee phphphaararmammaceceututicic lal base well known athohomeme aandnd a abroad.

    It has some affi liated factories designed as requiredby the GMP and furnished with GMP-based facilities—abiomedicine factory, a transfusion medicine factory,an injection factory and a Koryo medicine and healthfoododd ffacactotototoryryryy a—aandndnd aa a m m medededicicinnine e reeesesesearara chc institute, a drugexexexexaamamamininininatatatatioioioion centtntntrereee, a a hohohosppss itititalalal f ffororor clinical examination,n,n, a aandndndnd aaaa drdrug store.

    All prpprrp ododododuuucu tion processsses o o oooff f f momomomomomomoulululuulu dididingngngngngngngnng,,, , fi fi fi llllllining, jj joioioinin ng, loooadaddadiinnining,g,g,g, ssteeeteriliziiingggganannnddddd d d papapaapaackckckckckckckiniinininggg gg g araraa e ee oonono an n auuaua tototootomamamamm tet d aaanaaand d ststtttstrererrr amamliiinenn d babababab siis,s,s, a aandnnnn hhigh---quququuuuaalaaa itty yyy memememedidididiciciiciic neneeees ssss aare e e tutuuuurnrnrnrnedd o o ooutututuuu wwith efefefffeffffefefefefef ctctccctiviviveeeeenee ess, sssececcuururitityy,y sssstatatatatabbbiib lliityty andnddddd ununifififfoorororormimimiimitytytytytytytyyy. .

    FFFuFuFuFFuuFuFFurnrnrnnnnisisisisissheheheheed d dddd d wiwwwwiwwithhththth mm m moddodereerere n nn ananananananalalalalalalalallaa ysyssysysysyssy iininiininning g g g anannnand dddd mmememememeeeaasaaaaa uruurinininnng g faaafafaccccicililiiititit eesesesese lll l ikikkke a aaa wawawwaawaawawaaw tetetetetttett rrr rr rrrsssoooosoluluuuuuuubbllbllleee e e pppaaaaapp rrrttrtrticiciciclee ddddeeteteteecee tooorrr,, a aaaaa g ggg g ggeneneenenene eeeerreee aalalalalaaal aaa a a amimimimimimmm nonnonononoo a a acicciiddd d ananananala ysyssseererer aandndndndndndndnddd aaaa aa annnn n n innininnninnfrfrfrfrfrfrfraaraaarararededededededsppspspspspsppececeececcece trtrrtrrtrrttrt uuumuummum mmmmmmmmeaeaeaeae susuurirringggg ii nsnsnsnsssttrtrtrrrumumuumu enenenenene tt,t,t,t ttt theheheheh fffacacacacacccttototoryryy enssurururesse tttthheeeee ssssssttatatatatatandnddnnddaaraarrdd quququuquuquaalalalaaliitttii yyy y y y

    ofoff ggooooddddsddd in allll l thhhhe ppprococese sees s fffrfrfrfromomomomomom rrr rawaawawawwawaw mmatatereriaialslsprprprpreepparrratattatatattioioii n n tototooto t ttthehehehhh fi fififififififi nnnn issisissssissshihihihhh ngngggggg..

    Thhe e ee e eee gegegegeeegegennnnenen rrararaal ffaaafacctctc ororoororrro y prprprprp odododduuuuccese vvaarrioousss kkkkk kkininininini dsdddsdsdsssd oooo offf f ininiii jectttcttiioionsnssslliikke theheeeheeeee 1 1 111 10 00 0 00 000000000000-0-0-0-0-0-,, ,, 1101010101000000000 0 00000000 0-0-00 a a aa nd 5550000 0 0000000--0-0 uuuuununununitititttitit UU UUUUU Urrokinnananan seeeininjeeccttiooioooonnnnsnsnnn , , glg ucossee ee iininiininjjejectctctioionsn , lactcttctiicc aaaacid d RRRRiR nngngggnnggnggererrerer’’s’s’s’s’ ssssololololutututuutioioioionn nnaandd geeg neneneneeeeeraraal aminno o aca idd iinjjece tionnss.s TThhhehe U UUrorokikkikik nnnanananan sse injnjeectionisi uulttrrappure with ititits sppeecciifi c actctctctiivivitty ata 1001 0 000 00000000 unit per mimim lliggrrarammm m of pproroteeinn. OrOral ddrruugs aaandnd mmeeediccccalaaaaa supplies

    T including sticking plaster for a single use, cottonbatting, bandage and sterilizing alcohol for surgicaltreatment are also produced.In addition, the general factory produces tens of

    kinds of health foods and effective Koryo medicinessuch as the Eleutherococcus senticosus essence andbarrenwort essence, and, particularly, a kind of cancer killer made from dozens of kinds of rare natural herbsin primeval forest of Mt. Paektu.

    All the production processes have been authenticated for tht e DPRK GMP.

    The general faff ctctoro y is also engaged inin a dmirable traransactions with foreign phphphhararara mamaceceuticicicalalal ccororppoporations.s

    Jongsong Trading CompanyAdAdd:: RRRanna gng anananana g g gg DiDiDiststststrririctct, , PPyPyPyoono gyaanangg,g, DD D DPPRPRP KKorreaeaTel:l: 0 00888085-5---022202-1-1-1-1-1818181111111 ((8888888888 ))FaFaFaxx:x 000080 555-02222-3-3-- 8181-4-469692/2 4652E-maail: busosongngg@s@@ tar-co.net.kp

  • 16 Foreign Trade of DPR Korea2 0 1 7 . N o . 2 17

    Cable Factory Sets Higher Goal

    ononongygygyanananggg OpOptticaall FiFibrbree Thhee ee PyPyyooooosituated in MangyongdaeFaactorry isi sngyang, and it specializesDiD strict, Pyo

    ng optical fi bre cables,in producinon cables and network communicatio

    cables.oll off the production linesProducts roan integrated manufacturingcontrolled by

    system. Among the main products are stranded,Among the

    centtraral,l, aandnd fi fi g gurure-e-8 8 seselflf-s-supuppoportrtining g ststtrarandndeded lloooosese t tububee cacablbleses, asas w welelll asasunderwater installation and emergencycables. In addition, there are different cords, especially for patch, and citycommunication cables.

    WiWiWiW ththth a aallllll tt thehhee p productspapassssining g through strict quality control in accordancewith ISO and ITU, they areregarded as endurable inview of technical stabilityand favoured by customers.

    In line with the globaltrend of information and communication technology,ththee fafactctorory y sesetsts s sigighthtss onon m mororee ququalalitity y cacablbleses w whihilele p proromomotitingng t tecechnhnicicalal exchange with foreign partners.

    Korea Chesin Trading Company Add: Central District, Pyongyang, DPR KoreaTele: 850-2-341-3180Fax: 850-2-381-4418E-mail: [email protected]

  • 18 Foreign Trade of DPR Korea2 0 1 7 . N o . 2 19

    The Pyongyang Kim Jong Suk Silk Mill has furnished state-of-the-art quilt production processes with a hugecapacity and produces various kinds of quality quilts.

    The mill is equipped with embroidery machines, single-and multiple-needle quilting machines, cloth spreadingmachines and sewing machines, and turns out a great number of quilts for each season, newly-weds and bedclothes.

    Such raw materials as silk cloth, silk cotton, compressed cottonand thread are all supplied by the Pyongyang Kim Jong Suk Textile Mill and Nyongbyon Silk Mill in the country.

    The Kumgangsan-brand quilts are diverse in size, style,

    Pyongyang Kim Jong Suk

    Silk Mill

    colour and pattern by age groups and seasons. As they are light, soft and warm, they are favoured by the locals.

    The mill keeps production going on a high level by directing efforts into developing programs for a variety and a better quality of its products.

    Korea Pidan Trading CompanyAdd: Pothonggang District, Pyongyang, DPR KoreaTel: 0085-02-381-8348Fax: 0085-02-381-4410E-mail: silk@ star-co.net.kp

  • 20 Foreign Trade of DPR Korea2 0 1 7 . N o . 2 21

    JAERYONG MINE JAERYONG MINE The Jaeryoy ngg Mine located in

    JJaeryong County, South Hwanghae PProvince, is one of the country s PrProvovinincece isis oonene ooff ththee cocoununtrtry’y ssleading iron ore producers.

    It has several mining areas including Sungni and Kumsan, as well as a repair and maintenance workshop.

    All the lines from production to shipment are equipped with modern and large machinery. Diversifi cation in means of transport helps the mine to lay a sound foundation in cutting and carrying ore in bulk.

    The mine has set up a high-level integrated manufacturing system and renovated a 30-ton winch, high-pressure pump and other facilities

    technically,y, impprovingg its earth-removing capacity and boosting output. ououtptputut

    It has introduced latest science and technology and installed a two-stage separator and other machines to enhance the grades of limonite and hematite. And it also magnetizes and roasts siderite to produce magnetic iron.

    Efforts are being made to secure more iron ore deposits in a far-sighted way.

    The mine is attracting many customers for its high-grade products and concentrated deposits which are essential to effectiveness of investment.

    Ferrous Metal Trading Company Add: Pothonggang District, Pyongyang, DPR KoreaTel: 0085-02-18111-8078Fax: 0085-02-381-4581E-mail: [email protected]

    The Korea Ragwon Trading Corporation produces green epoxy concrete fl oor paints with bright colours and various properties.

    Highly resistant to friction, pressure, impact, water, acid, alkaline and high-pressure steam, they are of excellent adhesive quality with no harmful gas.

    Technical specifi cationsAdhesion ratio: 100% Intensity of beating: over 50kg x cmHiding power: 70g/m2 Inner detergency: more than 10 000 timesParticle size: smaller than 40㎛ Surface hardening time: one dayComplete hardening time: 7 days Water proofi ng: over 72 hours

    Korea Ragwon Trading CorporationAdd: Pothonggang District, Pyongyang, DPR KoreaTel: 0085-02-18111-8218Fax: 0085-02-381-4410/4416E-mail: [email protected]

  • 22 Foreign Trade of DPR Korea2 0 1 7 . N o . 2 23

    PYONGYANG Bag Factory

    The Pyongyang Bag Factory in Thongil Street,Pyongyang, is a comprehensive bag producer with alarge production capacity.

    It has established an integrated manufacturingsystem in keeping with its specifi c conditions, andits production lines ranging from cutting to sewing,printing and fi nish are equipped with modern machinesincluding laser cutter.

    It turns out bags for students in various shapes andcolours to suit the liking and aesthetic tastes of childrenand students with domestically-made canvas and othere maateeeerir als.s

    StStSttafafaffaa fefefeff d dd with comomommmomompeppetetentnt dd dese iggneneersrsrss a a ndnd o thththththher ddedddddd veeelololl persssss, , itititiit ii i iintntntntntntenenennenene iissisis fififififi fi eseseses r rr resesesessseseaeaeaeaeaeaeearcrcrcrchhh iininn order to stststtananananandadadardrdrddizizebbabbabababaabaaagsgsgsgg i iiiin nnnnn coccconfnforororrmimimimitytyttyy witttithh h ththththe aaga es a dndd cononnnststss itittuututuuu ioooonaalfeeeataataa uuurureseseses o ooofffff users.

    Its s ss rurrururrrucksasasasaackcckckckss fofforr stststtudududenenenttsts a arere dd desiigneddd ininininin l line wwiwwww thhtheir r phphphphphhysyysysysysy icicalal s shapes, so they are useseseseer-r-rr-frfrff ieiendndnnndn ly. ThThhheyyare hih ghghghhgh yylylylylylyly w ww watataterereer-rrese istant, strong and durableee.

    With ggrerereeereataaa stitching intensity they yy y y doododdod n notot cc cchahahahaangnnn e in shshshhshshhhhapaa e evenenn ii iiiffff ffff bubububub lkklkky y lololol adadadsss aree pupuut ini too t tthehehemmm.

    Bags for kindergarteners and primary school children have various decorations to suit their mind as well as luminous tapes for preventing traffi c accident.

    The factory channels big efforts into diversifying tht e prprp odo ucts in terms of kinnnd,dd shape and colour and imimimprprprovovovinining g g thththeieir r quualalitity.y.yy

    Korea Paengnihyang Trading CompanyAdd: Sosong District, Pyyonnnngggyang, DPR KorreaeaTel: 0085-02-18111-3411-8121122666Fax: 0085-02-341-44100E-mail: [email protected] kp

  • 24 Foreign Trade of DPR Korea2 0 1 7 . N o . 2 25

    LAW OF THE DEMOCRATIC PEOPLE’S REPUBLIC OF KOREA ON ECONOMIC DEVELOPMENT PARKS

    Adopted by Decree No. 3 192 of the Presidium of the Supreme People’s Assembly on May 29, 2013 Chapter 1 Fundamentals

    Article 1 (Objective)This Law is enacted for the purpose of establishing proper order and

    discipline in the establishment, development and management of the economic development parks, thereby contributing to the promotion of external economic cooperation and exchange, developing the national economy and improving the people’s standard of living.

    Article 2 (Defi nition and types of economic development parks)

    Economic Development Parks (EDPs) are special economic areas where preferential treatment is accorded to economic activities pursuant to the special laws and regulations enacted by the State.

    EDPs shall include industrial development parks, agricultural development parks, tourism development parks, exports processing parks, hi-tech development parks and others in the fi elds of the economy, science and technology.

    Article 3 (Classifi cation of EDPs depending on their affi liation)

    EDPs shall be classifi ed into local-level and central-level parks depending on their affi liation.

    The names and affi liation of the EDPs shall be decided by the non-standing State screening committee.

    Article 4 (Authority in charge of establishment of EDPs) Work relating to the establishment of EDPs in the DPRK shall be

    placed under the unifi ed administration of the central guidance organ of special economic zones.

    The State shall ensure that all matters arising at home and abroad in connection with the establishment of EDPs are handled exclusively by the central guidance organ of special economic zones.

    Article 5 (Preferential treatment to investors) EDPs shall be open for investment by corporate bodies, natural

    persons and economic organizations of foreign countries, and overseas Koreans, and they may set up enterprises, branches and offi ces in the EDPs and freely conduct economic activities.

    The State shall ensure that investors are provided with preferential conditions for economic activities in such areas as land use, employment and tax payment.

    Article 6 (Priority sectors, prohibition and restriction)The State shall particularly encourage investment in the EDPs for

    the construction of infrastructure, introduction of advanced science and technology and production of internationally competitive goods.

    Projects that are detrimental to national security, public health, sound social and moral life and environmental conservation and those that are outdated from the viewpoint of the economy and technology shall be prohibited or restricted.

    Article 7 (Protection of investors’ rights and interests) The vested rights, invested property and legitimate income of

    investors in the EDPs shall be protected by law.The State shall not nationalize or expropriate the property of

    investors. Where an investor’s property is, under unavoidable circumstances, to be expropriated or used temporarily for public interest, notifi cation thereof shall be made in advance and suffi cient compensation for its value shall be made in time.

    Article 8 (Protection of personal safety) Personal safety in the EDPs shall be protected by the law of the

    DPRK.No one shall be detained or arrested, nor his place of residence be

    searched without a legal warrant. Any treaty concluded between the DPRK and a foreign country in

    respect of personal safety shall take precedence. Article 9 (Applicable laws and regulations)Applicable to the development and management of the EDPs,

    business operation and other economic activities therein shall be this Law, and its implementing regulations and rules.

    Chapter 2 Establishment of EDPs Article 10 (Grounds for establishment of EDPs)EDPs shall be established in accordance with the State economic

    development strategy. Article 11 (Principle of designating an area as an EDP)The following areas shall be designated as EDPs:

    1. Areas favourable for external economic cooperation and exchange; 2. Areas conducive to the development of the national economy, science and technology;3. Areas that are separated from residential quarters by certain distance; and 4. Areas that do not belong to State-designated reserves.

    Article 12 (Handling of matters arising in connection with EDPs) Where a foreign investor raises questions as to the establishment

    and development of an EDP, the institution, enterprise andorganization concerned shall prepare a written document thereof andsubmit it to the central guidance organ of special economic zones.

    The central guidance organ of special economic zones shallcarefully screen and verify the submitted document and make adecision thereon.

    Article 13 (Approval of government concerned, notifi cation thereof)A foreign investor who wishes to make investment in an EDP shall

    obtain approval thereof from the government of his/her country, andnotify the relevant institution of the DPRK of the result in writing.

    Such notifi cation shall not be necessary where the law of thecountry concerned does not require obtaining such approval.

    Article 14 (Submission of application for establishment of alocal-level EDP)

    Application for the establishment of a local-level EDP shall besubmitted by the provincial (municipal) people’s committee concernedto the central guidance organ of special economic zones. In this casedocuments concerning agreement of the institutions concerned shallbe attached.

    Article 15 (Submission of application for establishment of acentral-level EDP)

    Application for the establishment of a central-level EDP shall,according to the prescribed procedures, be prepared by the institutionconcerned for submission to the central guidance organ of specialeconomic zones. In this case document concerning agreement of theinstitutions concerned shall be attached.

    Article 16 (Consultation with relevant institutions) The central guidance organ of special economic zones shall

    hold full consultation with the relevant central institutions beforesubmitting the document on establishment of EDPs for screening tothe non-standing State screening committee.

    Article 17 (Approval of establishment of EDPs)Approval of establishment of EDPs shall be granted by the non-

    standing State screening committee.The central guidance organ of special economic zones shall, when

    submitting the document on establishment of EDPs for screening tothe non-standing State screening committee, attach the documentsof agreement of relevant central institutions.

    Article 18 (Promulgation of establishment of EDPs)The decision of the State on the establishment of EDPs shall be

    promulgated by the Presidium of the Supreme People’s Assembly.

    Chapter 3 Development of Economic Development ParksArticle 19 (Principle of development)EDPs shall be developed on the principle of:

    1. Making development stage by stage in accordance with a plan; 2. Diversifying investment attraction; 3. Conserving the natural ecological environment of the EDPs and their surrounding areas; 4. Making rational use of land and resources;

    5. Raising international competitiveness of production and service;6. Ensuring the convenience of economic activities and public interest on an equal basis; and 7. Ensuring sustainable and balanced development of the EDPs concerned.

    Article 20 (Developer) A foreign investor may, subject to approval, undertake development

    of an EDP either jointly or solely. Institutions and enterprises of the DPRK may, subject to approval,

    also undertake development of EDPs.Article 21 (Approval of developer)Approval of developer shall be granted by the central guidance

    organ of special economic zones.The central guidance organ of special economic zones shall register

    the developer and issue a letter of approval of development right.Article 22 (Formulation and approval of development plan) The master plan and detailed plan for the EDPs shall be worked

    out by the institution concerned or the developer on the basis of themaster plan of regional land development.

    Approval of master plan shall be granted by the Cabinet and thedetailed plan by the central guidance organ of special economic zones.

    Approval of modifi ed development plan shall be granted by theinstitution that approved the plan concerned.

    Article 23 (Mode of development)The mode of development shall be determined in such a rational way

    that it is suitable to the features of the EDP concerned and developmentconditions, and conducive to the national economic development.

    Article 24 (Land lease contract)A developer who wishes to rent land shall enter into a contract with

    the land management institution concerned.The contract shall specify the term of lease, area, compartment,

    purpose of use, period and method of rent payment, and other matters as may be required.

    The land management institution concerned shall issue a letter of land use to the enterprise upon the latter’s payment of rent asspecifi ed in the contract.

    Article 25 (Term of land lease, extension thereof) The term of land lease in the EDPs shall be 50 years at maximum,

    which shall run from the date of issuance of a letter of land use to theenterprise concerned.

    An enterprise may, upon expiry of the term of lease, re-enter into acontract for the continued use of the leased land.

    Article 26 (Contribution of land use right) Where an institution, enterprise or organization wishes to set up

    developer enterprise jointly with a foreign investor, land use right maybe contributed according to prescribed rates.

    Article 27 (Bearing of expenses for removal and relocation of buildings and attachments)

    Expenses for the removal and relocation of buildings andattachments and moving of residents in the EDPs shall be borne bythe developer.

    Article 28 (Construction of infrastructure and public facilities)Construction of infrastructure and public facilities in the EDPs shall

    be undertaken by the developer. The developer may, according to the prescribed procedures, invite

    other enterprise to participate in the construction of infrastructure andpublic facilities.

    Article 29 (Price of buying, selling or re-leasing land use rightand buildings)

    An enterprise may buy, sell, re-lease, donate, inherit or mortgagethe land use right and building ownership.

    Price of buying, selling or re-leasing the right to use developed landand buildings shall be set by the developer.

    Article 30 (Registration of land use right and building ownership) An enterprise shall, upon acquiring land use right or building

    ownership, have it registered with the management committee andhave a certifi cate thereof issued.

    In case of any change to the land use right or building ownership, theparticulars of change shall be registered and a new certifi cate issued.

    Chapter 4 Management of EDPsArticle 31 (Institution in charge of management) Management of an EDP shall be undertaken by the EDP

    management body under the guidance and assistance of the centralguidance organ of special economic zones and the provincial(municipal) people’s committee concerned.

    The management body may, in consideration of the specifi cconditions of the EDP concerned, be named management committee,management offi ce or the like.

    Article 32 (Principle of management of EDPs) EDPs shall be managed on the principle of:

    1. Strictly observing and executing laws and regulations;2. Ensuring independence of enterprises;3. According preferential treatment to economic activities; and 4. Referring to international practices.

    Article 33 (Functions of the central guidance organ of specialeconomic zones)

    The central guidance organ of special economic zones shallperform the following functions: 1. To formulate the State development strategy related to EDPs; 2. To engage in cooperation with foreign governments and attraction of investment in EDPs; 3. To work with commissions, ministries and national agencies in connection with EDPs; 4. To render assistance in the work of the management body;5. To review and approve the screening criteria for incorporation in the EDPs;6. To administer tax affairs of EDPs; and7. To perform such other functions as may be assigned to it by the State.

    Article 34 (Functions of provincial (municipal) people’scommittee)

    The provincial (municipal) people’s committee shall performfollowing functions in respect of the EDPs under their control: 1. To organize the management body; 2. To prepare and issue instruments of State administration concerning

    the work of the EDPs such as the implementing rules of the lawand regulations on the EDPs;

    3. To render assistance in the work of the management body;4. To provide labour needed for the management of the EDPs and needed by enterprises; and5. To discharge such other functions as may be assigned to it by the State.

    Article 35 (Composition and chief of management body) The management body shall consist of such members as are

    necessary to suit the actual conditions of the EDP concerned and toensure the profi tability thereof. The chief shall be the chairman of themanagement committee or the head of the management offi ce.

    The chief shall represent the management body and takeresponsibility for the work thereof.

    Article 36 (Functions of management body)The management body shall:

    1. Work out rules for the development and management of the EDPs; 2. Create investment climate and attract investment;3. Grant approval of establishment of enterprises, and undertake their registration and licensing; 4. Grant permission of the ordered construction projects and conduct inspection of the completion of construction work; 5. Take custody of designs of the ordered projects; 6. Register land use rights and building ownership;7. Render cooperation in the management of enterprises; 8. Undertake supervision of and cooperation in the construction of infrastructure and public facilities and their management;9. Take measures for environmental conservation and fi re-fi ghting;10. Prepare articles of association of the management body; and11. Perform other functions assigned to it by the central guidance

    organ of special economic zones and provincial (municipal)people’s committee.

    Article 37 (Compilation and execution of budget bymanagement body)

    The management body shall compile and execute its own budget. Inthis case documents concerning the compilation and execution of budgetshall, through due procedures, be submitted to the people’s committeeconcerned or the central guidance organ of special economic zones.

    Chapter 5 Economic Activities in EDPsArticle 38 (Application for establishment of an enterprise)An investor who wishes to establish an enterprise in the EDPs shall

    submit an application document to that effect to the management body.

  • 26 Foreign Trade of DPR Korea2 0 1 7 . N o . 2 27

    Honggok Powder HoHonggok powder wwas madde e by mmiicrobiololoogicci alalThhee Hnt of the naturalal m medicinal herbs.trtreeatmtmencludes anththraquinone e dderivaatitive, vavariouuuss naturalIt inc

    physiological acacttivators, fatty acidid, ergoststeerol,, r-r-aminobutyricacid, alkaaloloiid and so ono .

    It is s good for treating g hhyperlipipemmiaia, cerebral thrombosisanandd hypertene sis on aandnd otherer circuucullatory diseases, diabetes,obesity,y, h ormonene defi cieenncy y bebecause of menopausal disorder,prosstatism aannd spoontntaneoeous gangrene.

    You aare recoommmenendded to take 1.5 grams in a dose, once or twwicice a daay,y, foror 3 3-6 months.

    It is s frfree ffrrom toxicity and side effects.

    Magnetization-based Water Manufacturer

    Technical specifi cations:• It sterilizes or purifi es water with the turbidity less than 0.5 by means of iodo-activated charcoal.• It produces mini-molecular water with the use of rare-earth permanent magnet and far infrared rays.• It is simple in structure, operates without power, and its life span is ten years.

    The magnetization-based water helps remove effete and toxic matters from human body and promote digestion and absorption.

    It is also helpful to improving the taste and quality of food and extending the food storage period.

    It enhances immunity of animals and plants, increases their weights and promotes growth.

    General Bureau of Invention of the DPRK Add: Moranbong District, Pyongyang, DPR Korea Tel: 0085-02-18111-381-8544Fax: 0085-02-381-4410

    Upon receipt of an application document the management body shall, within 10 days, approve or reject it and notify the result to the applicant.

    Article 39 (Streamlining of formalities)The central guidance organ of special economic zones, the

    provincial (municipal) people’s committee and the management body shall streamline formalities for the establishment of an enterprise such as application, screening, approval and registration.

    Article 40 (Registration, legal capacity)Upon obtaining approva


Recommended