State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, Beijing, Chinaa; College of Food Science and Technology,Huazhong Agricultural University, Wuhan, Hubei, Chinab; CAS Key Laboratory of Pathogenic Microbiology and Immunology, Institute of Microbiology, Chinese Academyof Sciences, Beijing, Chinac; and Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Harbin, Hei Long Jiang, Chinad
Streptococcus suis serotype 2 is a Gram-positive bacterium that causes sepsis and meningitis in piglets and humans. The mecha-nisms of S. suis serotype 2 invasive disease are not well understood. The surface proteins of pathogens usually play importantroles in infection and bacterium-host interactions. Here, we identified a novel surface protein that contributed significantly tothe virulence of S. suis serotype 2 in a piglet infection model. This protein showed little similarity to other reported proteins andexhibited strong binding activity to human factor H (hFH). It was designated Fhb (factor H-binding protein). The fhb genesfound in S. suis serotypes 1, 2, 4, 7, and 9 exhibited molecular polymorphism. Fhb possessed two proline-rich repeat sequencesand XPZ domains, and one repeat sequence exhibited a high homology to Bac, an IgA-binding protein of Streptococcus agalac-tiae. Evidence strongly indicated that fhb-deficient mutants had diminished phagocytosis resistance in bactericidal assays. Inaddition, Fhb plays important roles in complement-mediated immunity by interacting with hFH. These findings indicated thatFhb is a crucial surface protein contributing to the virulence of S. suis, with important functions in evading innate immune de-fenses by interaction with host complement regulatory factor hFH.
Streptococcus suis serotype 2 infection is one of the major causesof septicemia, arthritis, meningitis, and sudden death in pigs
(14, 55). It has also become a public health concern due to itszoonotic capability to cause severe infections in slaughterhouseworkers and those who handle infected pork (1, 25). S. suis infec-tions in humans have been reported sporadically worldwide (30,53, 54). However, two large-scale outbreaks of lethal S. suis sero-type 2 infections with a hallmark of streptococcal toxic shock syn-drome (STSS) emerged in China (one in Jiangsu Province in 1998and the other in Sichuan Province in 2005). These incidents drewclose attention to this pathogen (49). So far, the virulence factorsof S. suis serotype 2 have not been well characterized, and thereported virulence factors, such as muramidase-released protein(MRP), extracellular protein factor (EF), and suilysin (SLY), can-not explain the molecular mechanism underlying the high patho-genicity of this bacterium (7, 51). Knowledge of the pathogenesisof S. suis infection remains very limited, and one unresolved ques-tion is about the mechanisms used by the bacteria to survive in thehost bloodstream (24). To cause septicemia and meningitis, bac-terial pathogens need to evade innate immune defenses and main-tain a high level of bacteremia. One important component of hostimmunity to bacterial pathogens is the complement system. Anumber of cell surface proteins in pathogenic bacteria were iden-tified as antiphagocytic factors to inhibit complement activity,e.g., PspC protein in Streptococcus pneumoniae (17), M-relatedproteins and Scl1 protein in group A Streptococcus (11, 42), andcomplement regulator-acquiring surface proteins (CRASPs) ofBorrelia burgdorferi (26). However, the mechanisms used by S. suisto evade innate immune defenses remain unclear, except for cap-sular polysaccharide (CPS) and SLY, which were found to haveantiphagocytic activity (12, 34, 48).
Gram-positive pathogenic bacteria express specific surfaceproteins that can interact with the components of the host extra-cellular matrix (6, 23, 31), adhere to host cells (35, 47), invade, and
evade host defenses (9, 16, 18, 41). Cell wall-anchored surfaceproteins in streptococci usually contain a characteristic carboxy-terminal sorting signal made of a conserved LPXTG motif. Mostof them are substrates of the universal sortase SrtA (28, 32, 40). Insilico analysis of the genome of the Chinese S. suis serotype 2 ref-erence strain 05ZYH33 revealed 33 putative cell wall-anchoredproteins containing LPXTG or a related motif (60). In S. suis, MRPis a characterized marker of infection of this type of surface pro-tein (4, 50). More recently, several novel surface antigens with thisLPXTG motif were evaluated for their potential use as vaccineantigens, including Sao (36), HP0197 (66), and HP0272 (13, 22).However, it remains to be determined whether or not these vac-cine candidates and most other LPXTG-containing surface pro-teins play critical roles in the pathogenesis of S. suis.
HP0272, referred to as Fhb in the present study and also knownas translation initiation factor 2 (IF2), was identified in our previ-ous study, and antisera against this protein were found to promotethe killing of streptococci (22). This suggested that Fhb containedopsonic epitopes, and hence it was considered a potential novelvirulence factor. In the present study, the gene fhb was identified inS. suis serotype 2 as well as in serotypes 1, 7, and 9, and it was found
Received 13 December 2011 Returned for modification 4 January 2012Accepted 4 April 2012
to display molecular polymorphism. We also identified and char-acterized fhb as a gene encoding a novel human factor H (hFH)-binding protein and investigated the role of Fhb in bacterial com-plement-mediated innate immunity. We found that inactivationof fhb in S. suis serotype 2 significantly reduced virulence in a piginfection model and diminished phagocytosis resistance in hu-man blood and in purified polymorphonuclear leukocytes(PMNs) that were opsonized with nonimmune human serum. Weshow here that S. suis activates complement components in hu-man serum, mainly via the alternative pathway, and that Fhb-hFHinteraction inhibits complement deposition on S. suis. Our studyprovides the first evidence that Fhb protein contributes to S. suisresistance to phagocytosis and virulence by interaction with hFH.
MATERIALS AND METHODSStrains, plasmids, and culture conditions. S. suis serotype 2 strain05ZYH33, originally isolated from a dead STSS patient during an out-break in Sichuan, China, in 2005, was used in this study. The S. suis strainwas maintained on Columbia blood agar supplemented with 5% sheepblood, and the inoculum was cultured in Todd-Hewitt broth (THB) at37°C and harvested at stationary growth phase for experimentation. Atotal of 100 �g/ml spectinomycin (Spc) (Sigma), 5 �g/ml chloramphen-icol (Cm), and 8 �g/ml erythromycin (Em) was used for the S. suis trans-
formants, and 50 �g/ml of ampicillin (Amp) (Sigma) was used to screenEscherichia coli transformants. The commercial pMD18-T vector(TaKaRa) or pEASY-T1 (TransGen Biotech) was utilized to clone PCRfragments for direct sequencing of the fhb gene. E. coli DH5� cells weremaintained in Luria-Bertani (LB) broth or agar medium at 37°C for re-combinant plasmid amplification. The bacterial strains and plasmids usedin this study are listed in Table 1.
Identification of the fhb gene and bioinformatics analysis. S. suisserotype 2, 1, 7, and 9 genomic DNAs were extracted using the DNeasy DNAextraction kit (Qiagen). To amplify the entire fhb gene, gene-specific primers0272-F and 0272-R (Table 1) were designed according to the available se-quence information (accession number YP_001197640). The amplified PCRproducts were cloned into a pMD18-T vector (TaKaRa) following the man-ufacturer’s instructions. Unique clones were selected for direct DNA se-quencing with an ABI 3730 DNA sequencer (Perkin-Elmer Applied Biosys-tems). Multiple-sequence alignments of these genes were carried out with theaid of Vector NTI Suite 8.0. BLASTP, Interproscan (http://www.ebi.ac.uk/Tools), and SOPMA (http://www.expasy.org/tools) were used to analyze thestructure of the amino acid sequence of Fhb.
Generation of the S. suis serotype 2 05ZYH33 �Fhb mutant andC�Fhb complement. DNA fragments corresponding to the upstreamand downstream regions of the fhb gene were amplified using primer pairs0272KOP1/0272KOP2 and 0272KOP5/0272KOP6, respectively. The Cmcassette was amplified from plasmid pSET1 with primers CM-F and
TABLE 1 Bacterial strains, plasmids, and primers used in this study
Strain, plasmid, or primer Description or sequence (5= ¡ 3=)a
Source, reference, or PCRproduct
StrainsE. coli DH5� Host for cloning vectorS. suis
05ZYH33 Virulent Chinese serotype 2 strain isolated from a dead STSS patient inoutbreak in Sichuan, China, 2005
�Fhb Gene 0272 knockout mutant strain; Cmr This studyC�Fhb Complemented strain of �0272; Cmr Emr This study
PlasmidspMD18-T TA cloning vector; lacZ Ampr TaKaRapEASY-T1 TA cloning vector; lacZ Ampr TransGen BiotechpSET1 S. suis-E. coli shuttle vector; Cmr 52pSET4s Gene replacement vector with multiple cloning site of pUC19; Spcr 52pSET4s::0272 Gene 0272 knockout plasmid; Spcr Cmr This studypAT18 Complemented expression vector; Emr 56pAT18::0272 pAT18 containing the intact 0272 gene and its upstream promoter; Cmr Emr This study
Primers0272-F GTGGGAAAATGTATAAATCTATATTTTAAGAAGGAGCC ORF of 0272 gene0272-R CTATTCTTCTTTTTTGTTTTTGAATAGATACAAGCCTGTGG0272KOP1 CGCGGATCCGGATTCACAGATTGTCCC 0272 gene and its upstream
flanking regions0272KOP2 CCTCGGAACCCATCGAATTAGGACACAACTTTCTGCCM-F TAATTCGATGGGTTCCGAGGCTCAA Chloramphenicol resistance geneCM-R CACCGAACTAGAGCTTGATGAAAAT0272KOP5 CATCAAGCTCTAGTTCGGTGAAGCAAGTAGCGC 0272 gene and its downstream
flanking regions0272KOP6 CCGGAATTCGCTCATAATGTGCTCCSPC-F GTGTTCGTGAATACATGTTATA Spectinomycin resistance geneSPC-R GTTTTCTAAAATCTGATTACCAMRP-F GCCTGCAGGAAGCAGTTTATTAGCTAAC Fragment of mrp geneMRP-R ATGGATCCCAAATGCCAAAACCTATTCIN1 GAAGGCGGAAGAAGG Internal region of 0272 geneIN2 AAGGGTAATCTCACGTC�0272-F CGGAATTCAGGAAAAACCAGCCTTTGCG ORF of 0272 gene and its
CM-R. The primers pairs 0272KOP2/CM-F and CM-R/0272KOP5 weredesigned to be fused as an intact fragment by overlap extension PCR. PCRamplicons were cloned into the temperature-sensitive S. suis-E. coli shut-tle vector pSET4s, giving rise to the knockout vector pSET4s::0272. Theprocedures for the selection of mutants by double crossover were de-scribed previously (52). The resulting mutant strain was verified by PCRusing three pairs of primers, IN1/IN2, MRP-F/MRP-R, and 0272KOP1/0272KOP6 (Table 1), and direct DNA sequencing analysis of the mutationsites using genomic DNA as the template. For complementation assays,a DNA fragment containing the entire fhb gene and its upstream pro-moter was amplified using primers C�0272-F and C�0272-R. Theamplicon was subsequently cloned into the E. coli-S. suis shuttle vectorpAT18, resulting in the recombinant plasmid pAT18::0272. This plas-mid was transformed into the 05ZYH33 �Fhb mutant, and the com-plemented C�Fhb strain was screened on THB agar with selectivepressure of Em. Reverse transcription-PCR (RT-PCR) analysis of theC�Fhb, 05ZYH33, and 05ZYH33 �Fhb strains was used to furtheridentify the transcription of the gene fhb in C�Fhb.
Experimental infections of piglets. To evaluate the effects of deletionof the gene fhb on the virulence of 05ZYH33, 4-week-old specific-patho-gen-free (SPF) piglets (6 piglets/group) were challenged with the wild-type (WT) 05ZYH33, the 05ZYH33 �Fhb mutant, and its complementarystrain C�Fhb (dose of 2 � 108 CFU/piglet). Survival time, clinical signs,and bacterial counts in blood and tissue samples were recorded for 10 dayspostinoculation. When the infected piglets died or pigs were humanelysacrificed, colonization of bacteria in various tissues was analyzed by plat-ing on plates without antibiotics or with Cm as described previously (19).All animal experiments were performed in a biosafety level 3 (BSL3) fa-cility and were approved by the local ethics committee.
Bactericidal assays. To investigate the antiphagocytic ability of Fhb,bactericidal assays were used to compare WT and mutant growth in hu-man blood and PMNs. Lancefield bactericidal assays were performed asdescribed previously (63). Briefly, diluted cultures of the WT, mutant, andcomplemented strains (50 �l) were combined with fresh human blood(450 �l) and the mixtures were rotated at 37°C, after which aliquots wereincubated on ice for 20 min in a final concentration of 0.1% saponin–phosphate-buffered saline (PBS) to lyse eukaryotic cells. Viable cell countswere determined by plating diluted samples onto blood agar. The percent-age of live bacteria was subsequently calculated as (CFU on plate/CFU inoriginal inoculum) � 100%. The data are presented as means � standarddeviations (SD) from three separate experiments. In PMN killing assay,PMNs were isolated from heparinized venous blood as described by Bal-timore (3). Experiments investigating killing of S. suis serotype 2 by PMNswere carried out as described previously (59). PMNs were infected with S.suis serotype 2 at a multiplicity of infection (MOI) of 1:10 in 50% nonim-mune human serum and centrifuged at 380 � g for 5 min at 4°C. Theplates were incubated at 37°C under 5% CO2. Samples were taken at 0, 60,and 120 min and analyzed immediately. Colonies were counted, and thepercentage of surviving S. suis serotype 2 was calculated as (CFU withPMNs/CFU without PMNs) � 100%.
C3b/i C3b and i C3b deposition and FH binding assays. C3b/iC3band iC3b deposition on bacteria and FH binding in serum were assessedusing previously described flow cytometry assays (65). Briefly, S. suis waswashed in phosphate-buffered saline (PBS) and diluted to 1.5 � 107 CFU/ml. An aliquot (300 �l) of streptococci was added to 300 �l of normalhuman serum, incubated for 30 min at 37°C, and then washed with PBS.C3b/iC3b deposition was detected using a fluorescein isothiocyanate(FITC)-conjugated polyclonal goat anti-human C3 antibody(MP Bio-medicals, LLC) (1:5,000). IC3b deposition was detected using a monoclo-nal mouse anti-human iC3b antibody (GenWay Biotech, Inc.) (1:2,000)and an FITC-labeled rabbit anti-mouse IgG secondary antibody (IHCWorld, LLC) (1:100). FH binding was detected with FITC-labeled mouseanti-human monoclonal antibody (Cedarlane) (1:100).
In a complement pathway determination assay, activation of the clas-sical pathway was blocked with 10 mM EGTA plus 2.5 mM MgCl2 or 0.5
mM lysine, and EDTA (10 mM) was used to block both the classical andalternative pathways of activation. The alternative pathway was blockedwith zymosan to absorb the C3b in serum as described previously (61)with modifications. Briefly, 450 �l (15 mg/ml) of the zymosan stock so-lution was centrifuged at 16,000 � g for 5 min, and the zymosan pellet wasresuspended in 300 �l of human serum. After preincubation at 25°C for30 min, the zymosan in the reaction medium was removed by centrifuga-tion. The resulting human serum was mixed with 300 �l of S. suis suspen-sion and incubated at 37°C for 30 min, and the C3b/iC3b deposition on S.suis was tested as described above.
In a specific anti-hFH antibody blocking assay, goat anti-human FHIgG (Sigma) and normal goat IgG (2.5 �g/ml) were incubated with serumfor 20 min at room temperature, and then bacteria were added. The foldincrease of C3b/iC3b deposition was defined as specific goat anti-hFHIgG/normal goat IgG.
Samples were analyzed with a FACSCalibur flow cytometer (BD Bio-sciences), using forward and side scatter parameters to gate on at least30,000 positive bacteria. The threshold was set using the negative control.Results were compared using the fluorescence index (FI) (defined as theproportion of bacteria positive for C3b/iC3b, iC3b, or FH multiplied bythe geometric mean fluorescence intensity [GMF]).
Preparation of Fhb recombinant proteins. To express proteins in E.coli, the PCR-amplified fhb gene (accession no.YP_001197640) wascloned into the pMD-18T vector (TaKaRa, Japan) and transformed intoE. coli strain DH5�. The cloned gene sequences were confirmed by DNAsequencing. For protein expression, the inserts were subcloned intopET28a(�) (Novagen) and transformed into E. coli strain BL21(DE3).Positive clones were screened on LB-kanamycin medium (100 mg/ml)and confirmed by restriction enzyme digestion. The positive E. coli straincontaining the selected construct was incubated at 37°C to an opticaldensity (OD) of 0.6 at 600 nm. Recombinant protein expression was in-duced by treatment with 1 mM isopropyl-�-D-thiogalactopyranoside(IPTG) for 3 h at 37°C. The protein was purified by immobilized metalchelate affinity chromatography (GE Healthcare) in accordance with themanufacturer’s instructions.
Ligand blotting. Ligand blot analysis was performed as described previ-ously (38). Briefly, recombinant proteins were separated by electrophoresison 10% SDS-polyacrylamide gels and then transferred to polyvinylidene di-fluoride (PVDF) membranes (Millipore). The membranes were blocked with5% (wt/vol) nonfat dry milk at 4°C for 12 h, incubated with 10% humanserum for 1 h, washed three times with Tris-buffered saline plus Tween 20(TBST), and incubated with goat anti-human FH polyclonal antibody (1:5,000) and subsequently with horseradish peroxidase-labeled mouse anti-goat IgG (1:20,000). Bands were detected by using ECL Western blottingdetection reagents (Thermo Scientific) and exposing the membrane to X-rayfilm (Fuji photo film) at room temperature for 120 s.
Statistics. Unless otherwise specified, all the data are expressed asmeans � standard deviations. Differences between the wild-type strainand the complemented strain or isogenic mutant were analyzed using theunpaired two-tailed Student t test. For in vivo piglet infection experi-ments, survival was analyzed with the log rank test. For all tests, a P valueof �0.05 was considered the threshold for significance. All statistical testswere carried out using SPSS 15.0.
RESULTSDistribution of fhb gene in S. suis strains. In this work, the genefhb was investigated in 17 different S. suis strains covering serotypes 1,2, 7, and 9. In the virulent strain 05ZYH33, the open reading frame(ORF) of fhb was 2,094 bp in size. In PCR analysis, fhb was found in alltested strains, though in variable sizes (Fig. 1A). DNA sequence anal-ysis showed that the sequence of the fhb gene was more consistentacross serotype 2 strains (Fig. 1B) but varied significantly in serotypes1, 7, and 9 (see Fig. S1 in the supplemental material). In S. suis sero-type 2, alignment analysis indicated that one characteristic of the Fhbprotein is the presence of two different repeats of a 57-amino-acid
FIG 1 Distribution of fhb in S. suis and bioinformatic analysis of Fhb. (A) The gene coding for the Fhb protein in various S. suis strains. S. suis strains 606, 607, NJ, 1940,1941, 4, 5, 05ZYH33, SUN, 200601, T15, S735, 4005, and 1330 belong to serotype 2, S1 belongs to serotype 1, S7 belongs to serotype 7, and S9 belongs to serotype 9. Formore strain details, see reference 22. (B) Multiple-sequence alignment of the repeated regions from different Fhb proteins. Sequence from three strains (S. suis 05ZYH33,S. suis 606, and S. suis 607) were aligned using the software of Vector NTI Suite 8.0. The N-terminal and C-terminal sequences were found to be nearly identical, whilethe middle regions were discontinuously well matched with repeated regions RD1 and RD2. The protein secondary structure of Fhb consists mainly of 13 �-helices (�1to �13) and16 �-sheets (�1 to �16). The shaded background indicates the three-residue XPZ motifs, which are located in the C-terminal part of the protein. LPXTGindicate the conserved residues, which are recognized by sortase. (C) Alignment of the Pro-rich repeat domains from S. suis Fhb (RD1) and S. agalactiae Bac. Identicalamino acids are shown in bold, and similar amino acids are indicated by �. Prolines (P) are indicated by a shaded background.
sequence (RD1) and a 53-amino-acid sequence (RD2) in strain S. suis606. Alignment of the DNA sequence showed a deletion of a 243-bpnucleotide sequence, most of it corresponding to RD1, in strains 607and 05ZYH33 (Fig. 1B).
Bioinformatic analysis of the fhb gene. In the genome of the S.suis serotype 2 strain 05ZYH33, the gene fhb has been assigned acces-sion number YP_001197640. The ID of gene fhb was 05SSU_0272 inthis genome, with annotation as translation initiation factor 2 (IF2).However, when its amino acid sequence was analyzed using Inter-proscan, it exhibited a classical architecture showing the following cellwall-attached protein motifs: the consensus sequence LPXTG at theC terminus for its recognition by a sortase, a signal peptide at the Nterminus with a cleavage site between residues 44 to 45, and twohydrophobic regions for transmembrane (TM) spanning of the im-mature form at residues 20 to 42 and residues 674 to 692, which wasdownstream of the LPXTG sequence.
Like most surface proteins of group B streptococci (GBS) andother Gram-positive bacteria (39, 62), Fhb contains a proline-richsequence that mainly covers the two repeat regions. The proline-rich sequence includes many XPZ motifs, in which the first residue(X) is invariably uncharged, the second residue (P) is proline, andthe third residue (Z) is almost invariably charged (Fig. 1B). Asecondary structure analysis using the SOPMA analysis systempredicted that Fhb was a protein consisting of 12.03% �-helixesand 9.03% �-sheets and that the �-helixes of Fhb would be presentmainly in the N-terminal regions (Fig. 1B). A homology search ofone of the two repeat domains using the DDBJ/EMBL/GenBankdatabase demonstrated RD1 to have a high degree of similarity(66%) with Bac, an IgA-binding protein of Streptococcus agalactiae(Fig. 1C). However, only a low level of similarity (�30%) wasfound between full-length Fhb protein and Bac or other IgA-bind-ing proteins, such as the M-related protein Enn in Streptococcuspyogenes, the PspC protein in Streptococcus pneumoniae, or theMig protein in Streptococcus dysgalactiae. This suggests that Fhbhas a novel function and can be considered an unknown surfaceprotein with a misleading annotation, IF2, in S. suis 05ZYH33.
Role of Fhb in virulence. To assess the roles of Fhb in viru-lence, we performed experimental infections in SPF piglets. In thefirst experiment, groups of six piglets were challenged intrave-nously (i.v.) with either the WT strain 05ZYH33, the �Fhb mu-tant, or the complemented strain C�Fhb. We observed that all sixpiglets infected with 05ZYH33 developed most of the typical dis-ease symptoms, including high fever, limping, swollen joints,shivering, and central nervous system failure within 24 h. Two ofthem died within 24 h of infection, another two died within 36 h,and the last two died within 96 h. However, all piglets challengedwith the �Fhb mutant survived, and no obvious signs of disease,such as limping and central nervous system failure, were notedduring the entire experiment. In addition, one of the piglets in-FIG 2 Role of Fhb in virulence in piglet infection model. (A) Survival curve of
pigs challenged by S. suis. Pigs were inoculated with the WT 05ZYH33, the�Fhb mutant, and the complemented strain C�Fhb. An i.v. challenge with 2 �108 CFU of bacteria was administered to each animal (n 6 piglets per group).Survival was analyzed with the log rank test. Significant differences in survivalwere seen between the WT and the mutant (P 0.011) and between thecomplemented strain and the mutant (P 0.011). (B and C) Bacterial out-growth in blood (B) and in organs (C) after i.v. challenge. Results from indi-vidual piglets are shown as log10 bacterial counts (CFU/ml). Each symbolrepresents the WT 05ZYH33, �Fhb mutant, or complemented C�Fhb bacte-ria recovered from the blood of one piglet. The horizontal lines indicate themean for each group. Unpaired Student t tests were used for statistical analysis.Significant differences in isolation from blood were found between the WTand the mutant from day 12 h to 72 h (P12 h 3.44e007, P24 h 4.69e006,
P36 h 0.00037, P48 h 0.032, P60 h 0.004, and P72 h 0.00018). Significantdifferences were found between the complemented strain and the mutant from12 h to 24 h (P12 h 0.002, P24 h 0.004, P36 h 0.149, P48 h 0.175, P60 h 0.113, and P72 h 0.457). Significant differences in isolation from organs werefound between the WT and the mutant in tonsil (P 0.00046), CSF (P 0.023), brain (P 0.018), heart (P 0.012), kidney (P 0.010), and lymph(P 0.031); Significant differences in isolation from organs were found be-tween the complemented strain and the mutant in tonsil (P 0.004), joint(P 0.003), CSF (P 0.009), brain (P 0.001), heart (P 0.006), lung (P 0.002), kidney (P 0.007), and lymph (P 0.038). Ssfhb, S. suis Fhb.
fected with the complemented strain C�Fhb died at about 24 hpostinfection, another died within 36 h, and two others diedwithin 48 h (Fig. 2A). From the dead piglets and living pigletssacrificed for analysis after 10 days, bacteria were recoveredfrom blood (until 72 h), cerebrospinal fluid (CSF), and certainorganic tissues, such as those of the heart, lung, liver, joints,brain, spleen, kidney, lymph, and tonsils. The efficiency of col-onization of WT 05ZYH33 in blood was much higher than thatof the �Fhb mutant from 12 h to 72 h, and this difference wasalso seen between the complemented C�Fhb and the mutantfrom 12 h to 24 h (Fig. 2B). Additionally, significant differencesin isolation of bacteria from organs were found between theWT and the mutant in tonsil, CSF, brain, heart, kidney, andlymph, which were also found between the complementedstrain and the mutant (Fig. 2C). The data indicate that the�Fhb mutant decreased substantially in virulence in this infec-tion model and suggest that Fhb plays a specific role in an-tiphagocytosis, contributing to enhanced survival in blood.
Fhb possesses antiphagocytotic activity. To investigate thefunction of Fhb, we performed two bactericidal assays to test forthe growth of the WT and fhb mutant strains in healthy nonim-mune human blood from different donors. The �Fhb mutantstrain was recovered at a lower level than the WT (05ZYH33) andcomplemented (C�Fhb) strains (Fig. 3A). Moreover, the mutantstrain grew at a rate similar to those of the wild-type and comple-mented strains after 60 min, which is possibly because S. suis couldbe phagocytosed and killed before 30 min by PMN cells (data notshown) (12). This suggests that Fhb possesses antiphagocytic ac-tivity. This was further verified in the PMN-mediated killing as-says. In the purified human PMNs opsonized with 50% serum, thesurvival rates of the WT and complemented strains increased sig-nificantly relative to that of the �Fhb mutant strain after 1 h ofcoculturing. This difference was also observable at 2 h, althoughall strains displayed lower survival rates than at 1 h (Fig. 3B).PMNs opsonized with heat-inactivated serum (IS) could not killany of the strains (survival rate of �100%) (data not shown). Fhbseemed to be involved in resistance to phagocytosis by PMNs, andthe bactericidal activity of PMNs is dependent on the complementin serum. Compared to survival in whole human blood, the rate ofsurvival in PMNs decreased with incubation time, which is possi-bly because fibrinogen (Fg) in plasma could increase the antiphago-cytosis of pathogens by binding to bacterial surface proteins to de-crease the complement deposition on pathogens (10, 15).
Activation of human complement by S. suis mainly via thealternative pathway. Because of the central role of complementand phagocytosis in innate immunity to pathogens, the pathwaysof complement activation by S. suis remain unclear. Thus, a con-crete pathway was determined by examining the effects of specificinhibitors (for the classical pathway and the alternative pathway)on C3b/iC3b deposition on S. suis (Fig. 4). The complement wasactivated by S. suis in heat-inactivated serum (IS), used as a nega-tive control. The data showed that the deposition of complementcomponents on S. suis was not blocked by the classical pathwayinhibitors Mg-EGTA and lysine (Fig. 4A and B). It has been shownthat C3b can covalently bind to zymosan particles (20, 21), and thedata indicated that the S. suis-mediated complement activationpathway can be selectively inhibited by zymosan pretreatment ofhealthy human serum. Moreover, the complement activationcould be completely blocked by EDTA (to a level similar to that forthe negative control) (Fig. 4A and C). These data suggest that S.
suis can activate the complement system in healthy human serum,mainly via the alternative pathway.
Effects of loss of Fhb on C3b/iC3b deposition. It may be thatFhb is involved in complement-mediated phagocytosis of S. suisserotype 2. To evaluate this possibility, the amount of C3b/iC3bbound to the surface of S. suis incubated in fresh human serumwas determined by fluorescence-activated cell sorter (FACS) anal-yses. There was an increase in the amount of C3b/iC3b bound tothe �Fhb mutant relative to WT 05ZYH33. In addition, the levelsof C3b/iC3b deposited on the WT were similar to those seen withthe complemented C�Fhb (Fig. 5A). These data suggest that Fhbplays an important role in the inhibition of C3b/iC3b depositionon S. suis. In addition, iC3b deposition on the surface of the �Fhbmutant was reduced relative to that on the WT and complemented(C�Fhb) strains (Fig. 5B and C). Factor H, a negative regulator ofcomplement activation in serum, can accelerate the decay of the
FIG 3 Fhb possesses antiphagocytotic activity. (A) Decreased ability of fhbmutant bacteria to survive in whole human blood. Bacteria (50 �l, �1 � 104
CFU)were added to heparinized whole blood (450 �l) and then gently mixedfor 60 min, 120 min, and 180 min at 37°C. The mixture was serially diluted andplated on THB agar. After incubation, the number of CFU was determined.The data reflect the means � SD from at least three separate experiments usingdifferent donors. (B) Decreased resistance of Fhb to PMN-mediated killing. S.suis serotype 2 WT strain 05ZYH33, the C�Fhb complemented strain, and the�Fhb mutant strain were coincubated with human neutrophils (PMNs) at anMOI of 1:10 (PMNs to bacteria) in 50% serum. At each interval, PMNs werelysed and bacteria were plated on solid agar medium. The relative number ofbacteria killed was calculated. Data are expressed as the means � SD fromthree independent experiments, and unpaired Student t tests were used forstatistical analysis.
Surface Protein Fhb Contributes to S. suis Virulence
C3Bb convertase of the alternative complement pathway, result-ing in decreased activation of this pathway (33). As a cofactor offactor I, hFH can also cleave C3b to iC3b (11). In S. pneumoniae,loss of PspC (an hFH-binding surface protein) can cause reducediC3b and increased C3b/iC3b (compatible with reduced C3 con-vertase activity) deposition on strains (37, 45), which is similar toour data that loss of Fhb could increase C3b/iC3b and reduce iC3bdeposition on the mutant. We hypothesized that Fhb could inter-act with hFH to inhibit activation of the alternative complementpathway by S. suis.
Fhb is a novel hFH-binding protein of S. suis. To verify thehypothesis that Fhb could interact with hFH, ligand blot analysiswas performed. Recombinant Fhb (rFhb) was purified using im-mobilized metal chelate affinity chromatography followed bySDS-PAGE (Fig. 6A, lane 1). The molecular size of rFhb was de-termined to be 130 kDa, which was larger than that calculatedfrom the putative amino acid sequence (77.0 kDa). This is consis-tent with a report stating that proline-rich proteins migrate moreslowly in SDS-PAGE (44). rFhb was then subjected to SDS-PAGEand transferred to a PVDF membrane, followed by incubationwith 10% human serum. rFhb reacted with hFH in serum (Fig. 6A,lane 3). This result was verified by FACS analysis of various S. suis
strains. When FITC-labeled mouse anti-hFH monoclonal anti-body was added to detect the hFH bound to the surface of thebacterial strains, there was a lower level of hFH binding in serumto the �Fhb mutant than to the WT and C�Fhb strains (Fig. 6Cand D). These results indicate clearly that Fhb is a novel hFH-binding protein of S. suis.
hFH bound to the Fhb protein inhibits complement activa-tion. To analyze the means by which hFH bound to Fhb proteininhibits deposition, we examined surface deposition of C3b/iC3b,the C3 breakdown products of the C3 convertase that are depos-ited on bacterial surfaces. The results (Fig. 7) indicate that thepresence of anti-hFH polyclonal antibody strongly increased de-position of C3b/iC3b on WT bacteria (2.2-fold increase) and oncomplemented C�Fhb bacteria (2.6-fold increase) but not on�Fhb bacteria. These data confirm that Fhb-bound hFH inhibitsdeposition by inhibiting formation of the alternative C3 conver-tase. They also suggest that Fhb is the major hFH-binding proteinof S. suis, because the loss of Fhb inhibits the binding of hFH to S.suis, and hence the presence of anti-hFH polyclonal antibody hasno effect on the deposition of C3b/iC3b on �Fhb bacteria (0.94-fold increase).
FIG 4 Activation of complement by S. suis mainly via the alternative pathway. (A) Fluorescence index (FI) of the C3b/iC3b deposition on S. suis in thepresence of inhibitors. The complement activated by S. suis in heat-inactivated serum (IS) was used as a negative control. Significant differences in FI werefound between alone serum (S) and with the alternative pathway inhibitors (S-zymosan and S-EDTA) The data reflect the means � SD from three separateexperiments, and unpaired Student t tests were used for statistical analysis. (B) Representative histograms for the FI of C3b/iC3b deposition on S. suistreated with classical pathway inhibitors. (C) Representative histograms for the FI of the C3b/iC3b deposition on S. suis treated with alternative pathwayinhibitors.
Gram-positive pathogenic bacteria have various surface pro-teins, most of which determine their virulence and are involvedin pathogen-host interactions, such as attachment, multiplica-tion, invasion, and evasion of the host immune system. SomeLPXTG-containing surface proteins have been characterized asvirulence factors in S. suis. These include the opacity factor (5),the virulence marker MRP (50), and a surface protein associ-ated with invasion of porcine brain endothelial cells (58). Todate, the functions of most of the LPXTG-containing proteinsin S. suis are unknown.
A cell wall surface antigen, HP0272, annotated as translationinitiation factor 2 (IF2) in S. suis 05ZYH33, was identified in ourprevious study. Antisera against this protein can promote killingof the streptococci (22). This suggests that opsonic epitopes maybe present in HP0272, and it is a possible novel virulence factor. Inthe present study, we found that Fhb is a human factor H-bindingprotein (Fig. 6), so we named it Fhb. To determine the role of Fhbin S. suis, we constructed a �Fhb mutant without remarkable phe-notypic changes (such as increased hemolytic activity) and with agrowth curve comparable to that of the WT (data not shown). Thecontribution of Fhb to virulence was investigated in a piglet infec-tion model. We found that the deletion of Fhb led to elimination
of the lethality of this pathogen. Colonization analysis also re-vealed the inability of the fhb mutant to colonize any susceptibletissue of piglets when administered alone. The contribution ofFhb to the survival ability of S. suis in the blood of piglets suggeststhat Fhb is involved in bacterial resistance to phagocytosis. Thishypothesis was verified in bactericidal assays in human blood andpurified PMNs with serum opsonization (Fig. 3). To date, exceptfor SLY and CPS (12, 34, 48), the proteins utilized by S. suis toescape phagocytosis remain unclear. These results clearly indicatethat Fhb plays a critical role in the pathogenicity of S. suis serotype2. The reduction in virulence was mostly restored in a comple-mented strain, C�Fhb, also suggesting that the S. suis Fhb surfaceprotein is a novel determinant of virulence.
We also identified the fhb gene in S. suis serotype 2 as well as inserotypes 1, 7 and 9. BLASTP showed that Fhb had little similarityto proteins with known functions, but it possessed the classical archi-tecture of cell wall-attached proteins. The surface location of Fhb hasbeen verified recently (13). The analysis of the secondary structure ofFhb showed the �-helical portions in the N-terminal region of Fhbto be conserved among the different S. suis serotype 2 strains (Fig.1A), whereas the C-terminal region of Fhb in different S. suis serotype2 strains displayed molecular polymorphisms caused by repeatsequences. Fhb in strain S. suis 606 contains two different repeat
FIG 5 Role of Fhb in inhibition of complement activation. (A) Fluorescence index (FI) of C3b/iC3b deposition on the parent strain WT, the �Fhb mutant strain,and the C�Fhb complemented strain. The data reflect the means � SD from three separate experiments. Unpaired Student t tests were used for statistical analysis.Significant differences in FI were found between the WT and the mutant in 50% serum to 100% serum (P50% 0.048, P70% 0.017, P100% 0.006, P10% 0.786,and P25% 0.091) and were found between the complemented strain and the mutant in 50% serum to 100% serum (P50% 0.035, P70% 0.022, P100% 0.003,P10% 0.265, and P25% 0.096). (B) FI of iC3b deposition on the parent WT strain, the �Fhb mutant strain, and the C�Fhb complemented strain. FI wasdetermined by FACS analyses. The data reflect the means � SD from three separate experiments, and unpaired Student t tests were used for statistical analysis.IC-05ZYH33 (isotype control for strain 05ZYH33) was used as a negative control. (C) Representative histograms for the FI of the iC3b deposition on strain05ZYH33, the C�Fhb complemented strain, and the �Fhb mutant.
Surface Protein Fhb Contributes to S. suis Virulence
sequences(RD1 and RD2). RD1 shared 69% similarity to Bac, anIgA-binding protein of S. agalactiae (27). Although only a low degreeof similarity (10.9%) was found between the whole proteins Fhb andBac, Fhb was found to share characteristics with Bac, including aproline-rich content and XPZ motifs. Immunochemical analysis hasdemonstrated that Bac has separate binding sites for human IgA-Fc(43) and the complement regulator factor H, which may allow Bac tointerfere with complement-mediated opsonization (2). Above all,Fhb was not likely to be, as in a previous genome annotation of Fhb(gene ID SSU05_0272), translation initiation factor 2 (IF2) in S. suis05ZYH33. The process of overcoming function annotation errors inStreptococcus suis has been undertaken by a proteomics-driven ap-proach in recent years (46).
Avoiding phagocytosis is an important pathway used by extra-cellular bacteria to survive in the host. In S. pyogenes and S. pneu-moniae, a number of surface proteins are expressed and play acrucial role in antiphagocytic activities (8, 57, 64). In S. pneu-moniae, the surface protein PspC plays important roles in control-ling C3b deposition via an alternative pathway on the surface andescapes opsonophagocytosis by binding of hFH (20, 21). One re-port indicates that fibrinogen bound to S. pyogenes M protein can
inhibit complement deposition via the classical pathway in non-immune human serum, suggesting that the blood of donors maycontain antibodies induced by prior streptococcal infections thatcould bind to M protein (15). We found that in nonimmune hu-man serum, S. suis activates the complement system mainly via thealternative pathway. This difference in the complement-activatingpathway between S. pyogenes and S. suis may be caused by the factthat the S. suis infection rate is much lower than that of S. pyogenesin healthy people. Therefore, the blood of donors may not containspecific antibodies against S. suis. Our data indicate that Fhb is amajor antiphagocytic factor, as it prevents C3b deposition bybinding hFH and blocking activation of the alternative pathway ofthe complement system. This concept is supported by the follow-ing findings: (i) the activation of the complement by S. suis occursmainly via the alternative pathway in nonimmune human serum,(ii) there was an increase in the amount of C3b/iC3b bound to the�Fhb mutant relative to WT 05ZYH33, (iii) iC3b deposition wasreduced on the surface of the �Fhb mutant relative to the WT andcomplemented C�Fhb strains, and (iv) the presence of FH anti-body strongly increased deposition of C3b/iC3b on WT bacteriabut not on �Fhb bacteria. So far, the mechanism utilized by S. suis
FIG 6 Fhb protein binds to human factor H. (A) Ligand blotting of Fhb and hFH. rFhb from S. suis was separated by SDS-PAGE and then transferred to PVDFmembrane. Lane 1 was stained with Coomassie brilliant blue (CBB). Lane 2 was incubated with TBST followed by goat anti-human FH polyclonal antibody(1:5,000) and subsequently horseradish peroxidase-labeled mouse anti-goat IgG (1:20,000). Lane 3 was incubated with 10% human serum followed by goatanti-human FH polyclonal antibody (1:5,000) and subsequently horseradish peroxidase-labeled mouse anti-goat IgG (1:20,000). Lane 4 was incubated with 10%human serum and subsequently horseradish peroxidase-labeled mouse anti-goat IgG (1:20,000) alone. Bound hFH was detected with ECL reagents.(B) Bindingactivities of live S. suis with hFH in serum detected by FACS analysis. A comparison of the FIs of hFH binding of the WT, �Fhb, and C�Fhb strains incubated in50% human serum and of wild-type bacteria incubated in PBS alone as a negative control for gating is shown. The data reflect the means � SD from three separateexperiments, and unpaired Student t tests were used for statistical analysis. IC, isotype control 05ZYH33. (C) Representative histograms for the FI of hFH bindingto S. suis. IC-05ZYH33 (isotype control for strain 05ZYH33) was used as a negative control.
to escape phagocytosis by complement-mediated immunity re-mains unclear.
In conclusion, our analysis identified a novel virulence factor,Fhb, in Chinese isolates of highly pathogenic S. suis serotype 2.Prior to this study, Fhb was known only to be a surface protectiveantigen in S. suis (13), but had not yet been linked to the determi-nation of bacterial virulence. Our data confirm, for the first time,that Fhb is absolutely indispensable for the full virulence of theChinese highly invasive S. suis serotype 2 strains. We have shownthat Fhb-hFH interactions inhibit activation of the alternativepathway of the complement system. In addition, the gene fhb wasidentified in serotypes 1, 7, and 9 as well as 2, with molecularpolymorphism in the C-terminal region. Not only does this inves-tigation provide novel insights into the infectious disease patho-genesis of S. suis serotype 2, but it adds evidence that Fhb may bean attractive candidate for a component of a protein-based S. suisvaccine.
ACKNOWLEDGMENTS
We thank Xinming Song (University of Saskatchewan) for critical readingof the manuscript and Jianan Wu, Yonggang Liu, and Wenda Shi forhelpful operation of the pig infection model. We also thank JunhongWang for statistical analysis of all data.
This work was supported by grants from the National Basic ResearchProgram (973) of China (2012CB518804), the National Natural ScienceFoundation of China (30870091 and 81171528), and the Mega-Projects ofScience Research for the 11th 5-Year Plan (2012ZX10004-502).
REFERENCES1. Arends JP, Zanen HC. 1988. Meningitis caused by Streptococcus suis in
humans. Rev. Infect. Dis. 10:131–137.
2. Areschoug T, Stalhammar-Carlemalm M, Karlsson I, Lindahl G. 2002.Streptococcal beta protein has separate binding sites for human factor Hand IgA-Fc. J. Biol. Chem. 277:12642–12648.
3. Baltimore RS, Kasper DL, Baker CJ, Goroff DK. 1977. Antigenic spec-ificity of opsonophagocytic antibodies in rabbit anti-sera to group B strep-tococci. J. Immunol. 118:673– 678.
4. Baums CG, Valentin-Weigand P. 2009. Surface-associated and secretedfactors of Streptococcus suis in epidemiology, pathogenesis and vaccinedevelopment. Anim. Health Res. Rev. 10:65– 83.
5. Baums CG, et al. 2006. Identification of a novel virulence determinantwith serum opacification activity in Streptococcus suis. Infect. Immun.74:6154 – 6162.
6. Beg AM, Jones MN, Miller-Torbert T, Holt RG. 2002. Binding ofStreptococcus mutans to extracellular matrix molecules and fibrinogen.Biochem. Biophys. Res. Commun. 298:75–79.
7. Berthelot-Herault F, Gottschalk M, Morvan H, Kobisch M. 2005.Dilemma of virulence of Streptococcus suis: Canadian isolate 89-1591characterized as a virulent strain using a standardized experimental modelin pigs. Can. J. Vet. Res. 69:236 –240.
8. Bisno AL, Brito MO, Collins CM. 2003. Molecular basis of group Astreptococcal virulence. Lancet Infect. Dis. 3:191–200.
9. Campos IB, et al. 2008. Nasal immunization of mice with Lactobacilluscasei expressing the pneumococcal surface protein A: induction of anti-bodies, complement deposition and partial protection against Streptococ-cus pneumoniae challenge. Microbes Infect. 10:481– 488.
10. Carlsson F, Sandin C, Lindahl G. 2005. Human fibrinogen bound toStreptococcus pyogenes M protein inhibits complement deposition viathe classical pathway. Mol. Microbiol. 56:28 –39.
11. Caswell CC, et al. 2008. The Scl1 protein of M6-type group A Strepto-coccus binds the human complement regulatory protein, factor H, andinhibits the alternative pathway of complement. Mol. Microbiol. 67:584 –596.
12. Chabot-Roy G, Willson P, Segura M, Lacouture S, Gottschalk M. 2006.Phagocytosis and killing of Streptococcus suis by porcine neutrophils.Microb. Pathog. 41:21–32.
13. Chen B, et al. 2010. Evaluation of the protective efficacy of a newly
FIG 7 Factor H bound to the Fhb protein inhibits formation of the C3 convertase on the bacterial surface. (A) The WT, complemented (C�Fhb), andFhb-negative (�Fhb) strains were incubated in nonimmune human serum at 37°C for 30 min, with and without the addition of specific anti-hFH IgG or normalIgG as a control (2.5 �g/ml) to block the binding of hFH to surface proteins on S. suis. The bacteria were analyzed for surface deposition of the C3b/iC3b fragment,which reflects formation of the C3 convertase. This caused a 2.2-fold (mean) increase in C3b/iC3b deposition on the WT and a 2.6-fold (mean) increase on thecomplemented strain, but almost no increase in C3b/iC3b deposition was observed on the �Fhb strain. The results (means � SD) from three experiments withdifferent serum donors are shown. (B) Representative histograms for the WT 05ZYH33. (C) Representative histograms for the �Fhb mutant. (D) Representativehistograms for the C�Fhb complemented strain. IS (heat-inactivated serum) was used as a negative control. The fold increase was defined as specific goatanti-hFH IgG (SIgG)/normal goat IgG (NIgG).
Surface Protein Fhb Contributes to S. suis Virulence
identified immunogenic protein, HP0272, of Streptococcus suis. FEMSMicrobiol. Lett. 307:12–18.
14. Clifton-Hadley FA. 1983. Streptococcus suis type 2 infections. Br Vet. J.139:1–5.
15. Courtney HS, Hasty DL, Dale JB. 2006. Anti-phagocytic mechanisms ofStreptococcus pyogenes: binding of fibrinogen to M-related protein. Mol.Microbiol. 59:936 –947.
16. Cron LE, et al. 2009. Surface-associated lipoprotein PpmA of Streptococ-cus pneumoniae is involved in colonization in a strain-specific manner.Microbiology 155:2401–2410.
17. Dave S, Pangburn MK, Pruitt C, McDaniel LS. 2004. Interaction ofhuman factor H with PspC of Streptococcus pneumoniae. Indian J. Med.Res. 119(Suppl):66 –73.
18. Dave S, Carmicle S, Hammerschmidt S, Pangburn MK, McDaniel LS.2004. Dual roles of PspC, a surface protein of Streptococcus pneumoniae,in binding human secretory IgA and factor H. J. Immunol. 173:471– 477.
19. de Greeff A, et al. 2002. Contribution of fibronectin-binding protein topathogenesis of Streptococcus suis serotype 2. Infect. Immun. 70:1319 –1325.
20. DiScipio RG. 1981. The binding of human complement proteins C5,factor B, beta 1H and properdin to complement fragment C3b on zymo-san. Biochem. J. 199:485– 496.
21. Gaither TA, Hammer CH, Frank MM. 1979. Studies of the molecularmechanisms of C3b inactivation and a simplified assay of �1H and theC3b inactivator (C3bINA). J. Immunol. 123:1195–1204.
22. Geng H, et al. 2008. Identification and characterization of novel immu-nogenic proteins of Streptococcus suis serotype 2. J. Proteome Res.7:4132– 4142.
23. Gilbert FB, Luther DA, Oliver SP. 1997. Induction of surface-associatedproteins of Streptococcus uberis by cultivation with extracellular matrixcomponents and bovine mammary epithelial cells. FEMS Microbiol. Lett.156:161–164.
24. Gottschalk M, Segura M. 2000. The pathogenesis of the meningitiscaused by Streptococcus suis: the unresolved questions. Vet. Microbiol.76:259 –272.
25. Halaby T, et al. 2000. Streptococcus suis meningitis, a poacher’s risk. Eur.J. Clin. Microbiol. Infect. Dis. 19:943–945.
26. Haupt K, et al. 2007. Binding of human factor H-related protein 1 toserum-resistant Borrelia burgdorferi is mediated by borrelial complementregulator-acquiring surface proteins. J. Infect. Dis. 196:124 –133.
27. Heden LO, Frithz E, Lindahl G. 1991. Molecular characterization of anIgA receptor from group B streptococci: sequence of the gene, identifica-tion of a proline-rich region with unique structure and isolation of N-ter-minal fragments with IgA-binding capacity. Eur. J. Immunol. 21:1481–1490.
28. Igarashi T, Asaga E, Goto N. 2003. The sortase of Streptococcus mutansmediates cell wall anchoring of a surface protein antigen. Oral Microbiol.Immunol. 18:266 –269.
29. Jarva H, et al. 2002. Streptococcus pneumoniae evades complementattack and opsonophagocytosis by expressing the pspC locus-encoded Hicprotein that binds to short consensus repeats 8 –11 of factor H. J. Immu-nol. 168:1886 –1894.
30. Kay R, Cheng AF, Tse CY. 1995. Streptococcus suis infection in HongKong. QJM 88:39 – 47.
31. Kreikemeyer B, Klenk M, Podbielski A. 2004. The intracellular status ofStreptococcus pyogenes: role of extracellular matrix-binding proteins andtheir regulation. Int. J. Med. Microbiol. 294:177–188.
32. Lalioui L, et al. 2005. The SrtA Sortase of Streptococcus agalactiae isrequired for cell wall anchoring of proteins containing the LPXTG motif,for adhesion to epithelial cells, and for colonization of the mouse intestine.Infect. Immun. 73:3342–3350.
33. Lambris JD, Sahu A, Wetsel RA. 1998. The chemistry and biology of C3,C4, and C5, p 83–118. In Volanakis JE, Frank MM (ed), The humancomplement system in health and disease. Marcel Dekker, New York, NY
34. Lecours MP, et al. 2011. Critical role for Streptococcus suis cell wallmodifications and suilysin in resistance to complement-dependent killingby dendritic cells. J. Infect. Dis. 204:919 –929.
35. Lee SF, Boran TL. 2003. Roles of sortase in surface expression of the majorprotein adhesin P1, saliva-induced aggregation and adherence, and cario-genicity of Streptococcus mutans. Infect. Immun. 71:676 – 681.
36. Li Y, et al. 2007. Immunization with recombinant Sao protein confersprotection against Streptococcus suis infection. Clin. Vaccine Immunol.14:937–943.
37. Lu L, Ma Y, Zhang JR. 2006. Streptococcus pneumoniae recruits com-plement factor H through the amino terminus of CbpA. J. Biol. Chem.281:15464 –15474.
38. Nagano N, Nagano Y, Nakano R, Okamoto R, Inoue M. 2006. Geneticdiversity of the C protein beta-antigen gene and its upstream regionswithin clonally related groups of type Ia and Ib group B streptococci.Microbiology 152:771–778.
39. Navarre WW, Schneewind O. 1999. Surface proteins of gram-positivebacteria and mechanisms of their targeting to the cell wall envelope. Mi-crobiol. Mol. Biol. Rev. 63:174 –229.
40. Osaki M, Takamatsu D, Shimoji Y, Sekizaki T. 2002. Characterization ofStreptococcus suis genes encoding proteins homologous to sortase ofgram-positive bacteria. J. Bacteriol. 184:971–982.
41. Peppoloni S, et al. 2006. The lack of pneumococcal surface protein C(PspC) increases the susceptibility of Streptococcus pneumoniae to thekilling by microglia. Med. Microbiol. Immunol. 195:21–28.
42. Perez-Caballero D, et al. 2004. Interaction between complement regula-tors and Streptococcus pyogenes: binding of C4b-binding protein andfactor H/factor H-like protein 1 to M18 strains involves two different cellsurface molecules. J. Immunol. 173:6899 – 6904.
43. Pleass RJ, Areschoug T, Lindahl G, Woof JM. 2001. StreptococcalIgA-binding proteins bind in the Calpha 2-Calpha 3 interdomain regionand inhibit binding of IgA to human CD89. J. Biol. Chem. 276:8197– 8204.
44. Podbielski A, Woischnik M, Pohl B, Schmidt KH. 1996. What is the sizeof the group A streptococcal vir regulon? The Mga regulator affects ex-pression of secreted and surface virulence factors. Med. Microbiol. Immu-nol. 185:171–181.
45. Quin LR, Moore QC III, McDaniel LS. 2007. Pneumolysin, PspA, andPspC contribute to pneumococcal evasion of early innate immune re-sponses during bacteremia in mice. Infect. Immun. 75:2067–2070.
46. Rodriguez-Ortega MJ, Luque I, Tarradas C, Barcena JA. 2008. Over-coming function annotation errors in the Gram-positive pathogen Strep-tococcus suis by a proteomics-driven approach. BMC Genomics 9:588.
47. Samen U, Eikmanns BJ, Reinscheid DJ, Borges F. 2007. The surfaceprotein Srr-1 of Streptococcus agalactiae binds human keratin 4 and pro-motes adherence to epithelial HEp-2 cells. Infect. Immun. 75:5405–5414.
48. Segura M, Gottschalk M, Olivier M. 2004. Encapsulated Streptococcussuis inhibits activation of signaling pathways involved in phagocytosis.Infect. Immun. 72:5322–5330.
49. Sriskandan S, Slater JD. 2006. Invasive disease and toxic shock due tozoonotic Streptococcus suis: an emerging infection in the East? PLoS Med.3:e187. doi:10.1371/journal.pmed.0030187.
50. Staats JJ, Plattner BL, Stewart GC, Changappa MM. 1999. Presence ofthe Streptococcus suis suilysin gene and expression of MRP and EF corre-lates with high virulence in Streptococcus suis type 2 isolates. Vet. Micro-biol. 70:201–211.
51. Staats JJ, Feder I, Okwumabua O, Chengappa MM. 1997. Streptococcussuis: past and present. Vet. Res. Commun. 21:381– 407.
52. Takamatsu D, Osaki M, Sekizaki T. 2001. Thermosensitive suicide vec-tors for gene replacement in Streptococcus suis. Plasmid 46:140 –148.
53. Tang J, et al. 2006. Streptococcal toxic shock syndrome caused by Strep-tococcus suis serotype 2. PLoS Med. 3:e151. doi:10.1371/journal.pmed.0030151.
54. Tarradas C, et al. 2001. Epidemiological relationship of human and swineStreptococcus suis isolates. J. Vet. Med. B Infect. Dis. Vet. Public Health48:347–355.
55. Touil F, Higgins R, Nadeau M. 1988. Isolation of Streptococcus suis fromdiseased pigs in Canada. Vet. Microbiol. 17:171–177.
56. Trieu-Cuot P, Carlier C, Poyart-Salmeron C, Courvalin P. 1991. Shuttlevectors containing a multiple cloning site and a lacZ alpha gene for con-jugal transfer of DNA from Escherichia coli to gram-positive bacteria.Gene 102:99 –104.
57. Urban CF, Lourido S, Zychlinsky A. 2006. How do microbes evadeneutrophil killing? Cell. Microbiol. 8:1687–1696.
58. Vanier G, et al. 2009. New putative virulence factors of Streptococcus suisinvolved in invasion of porcine brain microvascular endothelial cells. Mi-crob. Pathog. 46:13–20.
59. Voyich JM, et al. 2003. Genome-wide protective response used by groupA Streptococcus to evade destruction by human polymorphonuclear leu-kocytes. Proc. Natl. Acad. Sci. U. S. A. 100:1996 –2001.
60. Wang C, et al. 2009. The involvement of sortase A in high virulence ofSTSS-causing Streptococcus suis serotype 2. Arch. Microbiol. 191:23–33.
61. Wang Z, Zhang S, Wang G, An Y. 2008. Complement activity in the eggcytosol of zebrafish Danio rerio: evidence for the defense role of maternalcomplement components. PLoS One 3:e1463. doi:10.1371/journal.pone.0001463.
62. Wastfelt M, Stalhammar-Carlemalm M, Delisse AM, Cabezon T, Lin-dahl G. 1996. Identification of a family of streptococcal surface proteinswith extremely repetitive structure. J. Biol. Chem. 271:18892–18897.
63. Yamaguchi M, et al. 2006. Role of Streptococcus sanguinis sortase A inbacterial colonization. Microbes Infect. 8:2791–2796.
64. Yamaguchi M, Terao Y, Mori Y, Hamada S, Kawabata S. 2008. PfbA, anovel plasmin- and fibronectin-binding protein of Streptococcus pneu-moniae, contributes to fibronectin-dependent adhesion and antiphagocy-tosis. J. Biol. Chem. 283:36272–36279.
65. Yuste J, Botto M, Paton JC, Holden DW, Brown JS. 2005. Additiveinhibition of complement deposition by pneumolysin and PspA facilitatesStreptococcus pneumoniae septicemia. J. Immunol. 175:1813–1819.
66. Zhang A, et al. 2009. Identification of a surface protective antigen,HP0197 of Streptococcus suis serotype 2. Vaccine 27:5209 –5213.
Surface Protein Fhb Contributes to S. suis Virulence
