Flocculation causes inhibitor tolerance in Saccharomyces 1
cerevisiae for 2nd generation bioethanol production 2
Running title: Inhibitor tolerance through flocculation 3
4
5
Johan O Westman1,2, Valeria Mapelli2, Mohammad J Taherzadeh1 and Carl Johan Franzén2,# 6
7
1School of Engineering, University of Borås, 501 90 Borås, Sweden 8
2Department of Chemical and Biological Engineering, Division of Life Sciences - Industrial 9
Biotechnology, Chalmers University of Technology, 412 96 Göteborg, Sweden 10
#Corresponding author: [email protected]
AEM Accepts, published online ahead of print on 29 August 2014Appl. Environ. Microbiol. doi:10.1128/AEM.01906-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Abstract 12
Yeast has long been considered the microorganism of choice for second generation bioethanol 13
production due to its fermentative capacity and ethanol tolerance. However, tolerance towards 14
inhibitors derived from lignocellulosic materials is still an issue. Flocculating yeast strains often 15
perform relatively well in inhibitory media, but inhibitor tolerance has never been clearly linked 16
to the actual flocculation ability per se. In this study, variants of the flocculation gene FLO1 were 17
transformed into the genome of the otherwise non-flocculating laboratory yeast strain 18
Saccharomyces cerevisiae CEN.PK 113-7D. Three mutants with distinct differences in 19
flocculation properties were isolated and characterised. The degree of flocculation and 20
hydrophobicity of the cells were correlated to the length of the gene variant. The effect of 21
different strength of flocculation on the fermentation performance of the strains was studied in 22
defined medium with and without fermentation inhibitors as well as in media based on dilute acid 23
spruce hydrolysate. Strong flocculation aided against the readily convertible inhibitor furfural, 24
but not against less convertible inhibitors, such as carboxylic acids. During fermentation of dilute 25
acid spruce hydrolysate, the most strongly flocculating mutant with dense cell flocs showed 26
significantly faster sugar consumption. The modified strain with the weakest flocculation showed 27
a hexose consumption profile similar to the non-transformed strain. These findings may explain 28
why flocculation has evolved as a stress response, and can find application in fermentation-based 29
biorefinery processes on lignocellulosic raw materials. 30
31
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Introduction 32
Despite the fact that the first large scale lignocellulosic ethanol plants are under development or 33
have recently become operational (1, 2), there are still major hurdles to overcome before this 34
second generation biofuel can become economically competitive. First, lignocellulosic feedstocks 35
contain significant amounts of pentose sugars originating from hemicelluloses, and second, the 36
harsh pretreatment methods that are often necessary lead to the creation of inhibitors that slow 37
down or even stop the subsequent fermentation (3). There are a number of different recombinant 38
yeast strains that can utilise the pentoses xylose and/or arabinose, as reviewed in (4). However, 39
most of these strains cannot efficiently co-utilise hexoses and pentoses, due to Saccharomyces 40
cerevisiae’s strong preference for glucose (5). In northern regions of the world, a lot of attention 41
is focused on ethanol production from spruce, as it is abundantly available. Spruce is often steam 42
pretreated with addition of SO2 or H2SO4, which can result in degradation products that will 43
inhibit the fermentation (6). The inhibitors are usually divided into the categories carboxylic 44
acids, furan aldehydes and phenolic compounds, and the respective amounts of these depend on 45
both the source of the raw material and its pretreatment and hydrolysis (3, 7, 8). The effects of the 46
inhibitors on the fermenting cells include e.g. direct inhibition of catabolic enzymes, generation 47
of reactive oxygen species (ROS), decreased intracellular pH, ATP depletion, toxic anion 48
accumulation and disturbance of membrane integrity (8). This can lead to increased lag time, 49
slower fermentation rate, decreased viability and, ultimately, stuck fermentation. Inhibitory 50
compounds can be further categorised into those that can be rapidly converted to less inhibitory 51
compounds, such as the furan aldehydes (9, 10), and those that are not converted, such as 52
carboxylic acids under anaerobic conditions (11). In the wide array of phenolic compounds there 53
are both convertible and non-convertible inhibitors (12). For in situ detoxification, it is necessary 54
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
that the inhibitors are kept at a low level, at least relative to the amount of metabolically active 55
cells: yeast at high cell density using a membrane bioreactor could tolerate high concentrations of 56
furfural (13). Other strategies to handle the toxicity of lignocellulosic hydrolysates involve e.g. 57
fed-batch processes, where the inhibitors can be kept at a low concentration inside the reactor 58
(14). Evolutionary engineering, as well as overexpression of specific genes, have also been 59
shown to increase the tolerance of yeast to toxic hydrolysates. The evolutionary engineering 60
strategies likely lead to beneficial mutations in genes important for the performance of the cells in 61
the hydrolysates (15). As a recent example of metabolic engineering, the overexpression of genes 62
leading to increased glutathione biosynthesis led to better performance of the cells in 63
simultaneous saccharification and fermentation of pretreated spruce (16). 64
It has recently been shown that the tolerance can be improved also at a low average cell 65
concentration without changes to the yeast cells. This happens if the cells are encapsulated inside 66
a semi-permeable membrane, giving a high local cell density (11). In this case, the increased 67
tolerance to inhibitors has two reasons. First, the cells experience a certain stress level due to the 68
encapsulated state where inner lying cells become nutrient limited (11, 17). The slight stress 69
response increases the ability of the cells to cope with the stress deriving from inhibitory 70
compounds (11) and even increases the thermotolerance of the cells (18). Second, it was shown 71
that conversion of the inhibiting compounds is necessary for the increased robustness, and a 72
model was proposed in which the cells close to the capsule membrane convert inhibitors, leaving 73
subinhibitory levels for inner lying cells (11). As an extension of this, it has also been shown that 74
the simultaneous glucose and xylose utilisation by a recombinant S. cerevisiae was improved by 75
encapsulation (19). Glucose is presumably consumed by cells close to the membrane, while 76
xylose is consumed by cells closer to the core (19).With this reasoning, the protective effect does 77
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
not mainly come from the membrane of the capsule, and hypothetically it would be observed also 78
if the cells were kept tightly together by other means. 79
Such tight agglomeration of cells can be achieved by flocculation, where cells are kept 80
together by lectin-like cell wall proteins, so called flocculins, that attach to carbohydrates in the 81
cell wall of neighbouring cells (20). Flocculation has since long been used in breweries and other 82
ethanol industries as a means of easy separation of the yeast at the end of the fermentation. In this 83
case the yeast cells do not flocculate during the batch, mainly due to the presence of sugars which 84
competitively inhibit the flocculation by binding to the flocculins (21). For microbiologists, 85
flocculation has often been considered a nuisance due to the difficulties of working with 86
heterogeneous cell suspensions rather than the homogenous ones given by non-flocculating cells. 87
Common lab strains, such as the sequenced S. cerevisiae S288c, do not flocculate. This can be 88
due to different reasons, such as a defective transcription factor controlling the flocculation genes 89
(22), or that the flocculation genes are simply missing. The latter is the case for the recently 90
sequenced S. cerevisiae CEN.PK 113-7D, where the major flocculation genes FLO1, FLO5 and 91
FLO9 are missing (23). However, naturally flocculating strains have been shown to be good at 92
fermenting inhibitory hydrolysates (24-26) and flocculation has also been shown to increase the 93
ethanol tolerance of S. cerevisiae (27, 28). Therefore, it is plausible that flocculation can indeed 94
be a beneficial trait in second generation bioethanol production. 95
In this study, we tested the hypothesis that strong flocculation would lead to improved 96
fermentation performance in lignocellulose-derived inhibitory media, by generation of clustered 97
cells. To this end we constructed strains constitutively expressing variants of FLO1 in CEN.PK 98
113-7D, resulting in different strength of flocculation, and investigated the effects on 99
fermentation of inhibitory media. 100
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
101
Materials and Methods 102
Saccharomyces cerevisiae strains. The three recombinant mutants used in this study all 103
originated from CEN.PK 113-7D (MATa, MAL2-8C, SUC2) (29) (kindly provided by Dr. Peter 104
Kötter, Biozentrum, Frankfurt, Germany), which was used as reference strain. Inoculations of 105
pre-cultures were done by picking a colony from fresh YPD agar plates (10 g/l of yeast extract 106
(Scharlau), 20 g/l of soy peptone (Fluka) and 20 g/l of glucose (Fisher Scientific)), prepared using 107
cells stored in glycerol at -80°C. 108
Construction of the flocculating yeast strains. The TDH3 promoter (TDH3p) was 109
amplified from genomic DNA of S. cerevisiae CEN.PK 113-7D by PCR using the primers 110
EcoRV_TDH3p_FW and SpeI_TDH3p-RV (Table 1) and cloned in the pUG6 vector (30). The 111
resulting vector was used as template for amplification of the kanMX-TDH3p cassette using the 112
primers SphI_KAN_FW and SalI_TDH3p-RV (Table 1). The cassette was cloned in Yiplac211 113
(31) and thereafter amplified by PCR using the primers HO_KAN-FW and TDH3p_FLO1-RV 114
(Table 1), giving flanking ends homologous to the HO-locus in S. cerevisiae CEN.PK 113-7D, 115
and to FLO1 from S. cerevisiae S288c [GenBank: NM_001178230.1], respectively. FLO1 was 116
amplified from S288c chromosomal DNA using the primers FLO1-FW and FLO1_HO-RV 117
(Table 1), giving a region homologous to the HO-locus in S. cerevisiae CEN.PK 113-7D. By 118
fusion PCR the kanMX-TDH3p cassette and the FLO1 gene were merged together and amplified 119
using the primers HO-FW and HO-RV (Table 1) in two PCR reactions. Specifically, in the first 120
step the FLO1 gene and the kanMX-TDH3p cassette were mixed in a single PCR reaction for 121
PCR-based fusion, using the Phusion polymerase (Thermo Scientific). The DNA fragment 122
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
resulting from the fusion was used as template for the second PCR reaction using the primers 123
HO-FW and HO-RV. This yielded a PCR product with flanking regions homologous to the HO-124
locus that was used for homologous recombination in CEN.PK 113-7D using the lithium acetate 125
based transformation method (32). Transformants were selected on YPD plates containing 200 126
µg/ml G 418 (Sigma-Aldrich), after replica plating once, and were tested for flocculation ability 127
in 4 ml YPD medium in 12 ml tubes, shaking over night. The correct integration into the HO-128
locus was confirmed by PCR using the primers SapI_KAN-RV and Ctrl_HO-FW (Table 1). The 129
nucleotide sequences of the recombinant genes were determined by cycle sequencing (Eurofins 130
MWG Operon, Ebersberg, Germany). 131
Media. Aerobic cultures for cell propagation were grown in 250 ml cotton-plugged conical 132
flasks in a shaker bath (125 rpm) at 30°C. The growth medium used for cell propagation for the 133
flocculation trials and the Microbial Adhesion To Hydrocarbons (MATH) test was yeast extract 134
peptone dextrose (YPD) medium containing 20 g/l glucose. The growth medium used for the 135
batch cultivations was a defined glucose medium (DGM) as previously reported (33), with the 136
additional supplementation of 1g/l CaCl2 to ensure that the degree of flocculation was not limited 137
by possible Ca2+ shortage. 138
The media for the anaerobic batch cultivations were designed to include both readily 139
convertible and non convertible inhibitors found in lignocellulosic hydrolysates, namely furan 140
aldehydes and carboxylic acids. The defined inhibitory media contained the same composition as 141
the DGM described above, with the addition of either 5 g/l furfural (Sigma-Aldrich) or 200 mM 142
of acetic (Sigma-Aldrich), formic (Sigma-Aldrich) and levulinic acid (Aldrich) (12.0, 9.2 and 143
23.2 g/l respectively). DGM was used for comparison, as well as a hydrolysate medium, diluted 144
to approximately 60% due to addition of salts, vitamins, trace metals and ergosterol (Sigma) as in 145
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
DGM, and the cell suspension from the precultivation. A more inhibitory hydrolysate medium 146
was achieved by adding 1.5 g/l furfural to the spruce hydrolysate medium. 147
All of the media, with the exception of the hydrolysate medium, had a final glucose 148
concentration of ~20-21 g/l. The pH of all media was adjusted to 5.5 with concentrated NaOH. 149
The hydrolysate was produced from spruce chips treated at pH 2.0 (by SO2 addition), 18 150
bar pressure for 5-7 minutes. The hydrolysate was stored refrigerated at low pH (<pH 2) until 151
use. Before use, the pH was adjusted to 5.5 with 10 M NaOH and the hydrolysate was autoclaved 152
followed by centrifugation to remove solid particles. The hydrolysate medium used for anaerobic 153
fermentations contained: glucose 9.0 ± 0.2 g/l, mannose 11.9 ± 0.1 g/l, galactose 2.5 ± 0.2 g/l, 154
xylose 5.3 ± 0.1g/l, arabinose 1.9 ± 0.1 g/l, acetic acid 2.4 ± 0.1 g/l, furfural 1.78 ± 0.05 g/l, 5-155
hydroxymethyl furfural 0.69 ± 0.03 g/l (n=16). 156
Flocculation trials. The flocculation trials were performed with stationary phase yeast 157
cells harvested 48 h after inoculation in YPD-medium according to a previously reported protocol 158
(26) with slight modifications. In short, EDTA (ethylenediaminetetraacetic acid) deflocculated 159
cells were heat killed and mixed at a concentration of approximately 1*108 cells/ml in citrate 160
buffer (50 mM, pH 4.5) containing 4 mM CaCl2 and various concentrations of the sugars tested 161
in a total volume of 2 ml placed in a 12 ml round bottom tube. The tubes were placed on an 162
orbital shaker and agitated at 160 rpm at 25°C, at an angle of approximately 30° for 4 hours to 163
ensure equilibrium. A sample of 150 µl was taken from just below the meniscus after the tubes 164
had been left stationary in a vertical position for 30 seconds. The sample was dispersed in 850 µl 165
of 100 mM EDTA solution and the cell concentration was measured as OD600. The flocculation is 166
presented as the percentage of free cells = OD600 of sampleOD600 of reference without CaCl2 100. 167
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Hydrophobicity test. The hydrophobicity of cells was tested by the Microbial Adhesion 168
To Hydrocarbons (MATH) assay according to Westman et al. (26). The hydrophobicity is 169
reported as the relative difference between the absorbance of the aqueous phase before and after 170
vortexing with octane: hydrophobicity = 1 OD600 after vortexingOD600 before vortexing 100. 171
Quantitative PCR. Yeast cells grown aerobically in YPD medium were harvested in the 172
expontential phase and total RNA was immediately isolated with the RNeasy kit (Qiagen) with 173
DNase treatment, according to the manufacturer’s protocol. The RNA was subjected to reverse 174
transcription to cDNA with the RevertAid H Minus First Strand cDNA Synthesis Kit (Thermo 175
Scientific), with 500 ng RNA in 20 µl reactions. The expressions of the FLO1 variants and the 176
reference gene TAF10, which showed a stable expression in all samples, were analysed by 177
quantitative PCR using Brilliant® II SYBRGreen QPCR Master Mix (Stratagene), 0.5 µM of 178
forward and reverse primer and 1 µl cDNA. The experiments were performed on a Stratagene 179
Mx3005P instrument, with an initial denaturation for 10 min at 95ºC and amplification using 40 180
cycles of 30 sec at 95ºC and 1 min at 60ºC. A denaturation curve analysis was included at the end 181
of the program to verify the specificity of the primers. The primers used were FLO1-FW and 182
FLO1-RV for the FLO gene variants and TAF10-FW and TAF10-RV for the TAF10 gene (34) 183
(Table 1). The relative expression was calculated from the threshold cycle (Ct) according to the 184
formula: relative gene expression 2 TAF10 FLO1 . 185
Batch cultivations with inhibitors. Due to inherent difficulties of cultivating a 186
flocculating yeast strain reproducibly (growth cannot be monitored by OD600 measurements or 187
withdrawal of samples for dry weight determination), a previously developed cultivation method 188
was used (26), in order to avoid deflocculation of the cells with e.g. EDTA. Hence, the entire 189
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
precultivations were used as inocula for the batch cultivations in order to get reproducible data. 190
Separate precultivations were performed for analysis of the initial biomass amounts. Yields were 191
calculated from data at the end of the cultivations, where all biomass could be subjected to dry 192
weight determination. 193
The batch cultivations were carried out in 250 ml conical flasks, cotton plugged for aerobic 194
cultivation and equipped with rubber stoppers fitted with stainless steel capillaries and a glass 195
tube with a loop trap for anaerobic cultivations as previously described (35). Sterile water was 196
used in the loop traps to permit produced CO2 to leave the flasks. The cultivations were started 197
with a 36 h aerobic cultivation in 40 ml DGM containing 25 g/l glucose, in a shaker bath (125 198
rpm) at 30°C. The anaerobic cultivations were subsequently started by addition of 80 ml of fresh 199
medium of different compositions, giving a total volume of ~120 ml and the desired 200
concentrations. Samples of the medium for analysis of extracellular medium by HPLC were 201
taken through the steel capillaries. 202
Analytical methods. The concentrations of metabolites and inhibitors were quantified by 203
HPLC using an Aminex HPX-87H column (Bio-Rad) at 60°C with 5 mM H2SO4 as eluent at a 204
flow rate of 0.6 ml/min. A refractive index detector was used for glucose, formic acid, acetic 205
acid, levulinic acid, glycerol, ethanol, furfural and HMF. For the hydrolysate samples, an Aminex 206
HPX-87P (Bio-Rad) column at 85°C with ultrapure water as eluent at a flow rate of 0.6 ml/min 207
was also used to analyse the glucose, xylose, arabinose, galactose and mannose concentrations, 208
using a refractive index detector. 209
The cell dry weight was measured in predried and preweighed glass tubes. The cells were 210
washed with ultrapure water before drying for 24 h at 105°C. 211
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Statistics, yields, rates and elemental balance calculations. The biomass and 212
metabolite yields were calculated from the concentrations determined at the beginning and the 213
end of the anaerobic fermentations. Produced carbon dioxide was considered to be at the same 214
molar ratio as ethanol and acetate. The biomass composition CH1.76O0.56N0.17 (36) was used in the 215
carbon balance calculations. The consumption and production rates, qS, were calculated 216
according to the formula: 217
qS S SX
where S is the concentration of substrate or product consumed or produced at the time point , 218
and X is the estimated biomass concentration in the middle of the time interval, assuming a 219
linear relationship between ethanol and biomass production. 220
Error intervals are shown as ± one standard deviation unless otherwise mentioned. 221
Statistical tests were performed using two-tailed t-test assuming unequal variance, which is 222
stricter than assuming equal variance. 223
Results and discussion 224
Flocculating mutants constitutively expressing FLO1 variants. The major flocculation gene, 225
FLO1 (20), and the TDH3 promoter region were isolated from genomic DNA of S. cerevisiae 226
S288c and CEN.PK 113-7D, respectively, and merged together with the kanMX selectable 227
marker (37) cloned from pUG6 (30) to yield an integration cassette flanked by regions 228
homologous to the HO-locus, which would lead to integration of the recombinant construct into 229
the HO-locus. Despite numerous attempts, a PCR protocol yielding a single PCR product of the 230
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
kanMX-TDH3p cassette with the native, full length FLO1, could not be developed. Subcloning of 231
the FLO1 gene in Escherichia coli was also unsuccessful, as has been observed before (38). 232
Nevertheless, the obtained partial gene PCR products were used for transformation and 233
integration into the S. cerevisiae CEN.PK 113-7D genome. This resulted in several transformants 234
that were selected and grown in liquid YPD medium, whereby mutants with different degrees of 235
flocculation could be isolated (Figure 1A). Three mutants were chosen for further analysis. 236
Below, these are referred to as weakly, intermediately and strongly flocculating, depending on 237
the size of the flocs formed. The strongly flocculating mutant formed the largest and most 238
compact flocs. 239
Longer FLO-gene gives stronger flocculation. Amplification of the integrated TDH3p-240
FLO1 by PCR using the primers EcoRV_TDH3p-FW and HO-RV (Table 1) confirmed that the 241
gene products in the three selected transformants were of different lengths (Figure 1B). The gene 242
region(s) missing in the recombinant versions of FLO1 was narrowed down by restriction 243
analysis of the TDH3p-FLO1 products using the enzymes AccI and ScaI (Figure 1 C,D). 244
Sequencing of the TDH3p-FLO1 products showed that the missing regions were different 245
portions of the previously described internal repeats (39) and that a few point mutations occurred 246
with only minor differences in the amino acid sequences (Table 2, Supplementary material S1). 247
The nucleotide sequences were deposited in GenBank with the accession numbers KM366093, 248
KM366094, and KM366095 for the weakly, intermediately and strongly flocculating FLO1 249
variant, respectively. There were no changes in the TDH3 promoter sequence between the three 250
mutants. Quantitative PCR analysis showed that there were no significant differences in 251
expression of the different flocculation genes (Figure 2).The only difference between the FLO 252
genes in the N-terminal part of the sequence, which is responsible for the carbohydrate binding 253
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
(40), was a single silent mutation in the intermediately flocculating mutant (Supplementary 254
material S1). The deleted regions were multiples of 135 bp, translating to 45 amino acids, (Table 255
2), which has been reported to be the length of the repeats (41). These are strong indications that 256
the differences in flocculation strength between the mutants depended solely on the number of 257
repeats in the middle region of the proteins, which has also been suggested previously (39). 258
Differences in protein concentration and localisation are also potential reasons for the differences 259
in flocculation strength, but analysis of this lay beyond the scope of this study. 260
Treating the mutant flocculating strains with the chelating agent EDTA effectively and 261
reversibly deflocculated the cells by removal of Ca2+, showing the expected Ca2+-dependence of 262
the flocculation (42). 263
The flocculation ability in the presence of different sugars was studied for the constructed 264
flocculating mutants (Figure 3). With no sugars present, the levels of free cells were 54 ± 6.0%, 265
5.7 ± 2.5% and 2.5 ± 1.7% (n=4) for the weakly, intermediately and strongly flocculating 266
mutants, respectively. The flocculation of the strongly flocculating mutant was inhibited only by 267
mannose, which was expected since the inserted gene was based on FLO1 (43). For the 268
intermediately flocculating mutant a slight inhibition was also observed at the highest 269
concentration of sucrose (Figure 3). The flocculation of the weakly flocculating mutant was 270
inhibited by all sugars tested. Mannose-dependent inhibition of the flocculation could potentially 271
be a problem in high gravity spruce hydrolysates, which usually contain relatively high amounts 272
of mannose (7). However, this is not a major issue, since at 0.8 M (144 g/l) mannose, the fraction 273
of free cells was still below 50% for the strongly flocculating mutant. 274
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Longer flocculins increase the cell surface hydrophobicity. The flocculating mutants 275
all showed significantly higher cell wall hydrophobicity compared to the non-flocculating strain 276
and the hydrophobicity also varied amongst each other (p < 0.063, two-tailed t-test assuming 277
unequal variance, n=3) (Figure 4). The higher hydrophobicity observed in the flocculating 278
mutants is likely to be caused by the flocculins (44). In this way, the proteins would act in two 279
ways to promote flocculation: by direct binding to carbohydrates and by hydrophobic interactions 280
(45, 46). None of the mutants exhibited adhesive or invasive growth on YPD agar plates. 281
Flocculation improves fermentation performance in inhibitory media. In order to 282
further investigate our hypothesis that high local cell density increases the tolerance towards 283
convertible inhibitory compounds such as furfural (11), the new flocculating mutants and the 284
non-flocculating parental strain were tested for their ability to ferment different media. The batch 285
cultivations were started with a 36 h aerobic pre-cultivation step in 40 ml of defined medium 286
containing 25 g/l glucose in 250 ml E-flasks. In this setup, none of the mutants created large 287
dense cell flocs during the pre-cultivation and all mutants hence exhibited similar growth, as seen 288
by the measured biomass and metabolites at the start of the anaerobic cultivations. Separate 289
experiments using different volume of medium showed that more than 40 ml of medium was 290
required for formation of larger flocs. The anaerobic batch fermentations were initiated by 291
addition of 80 ml of medium, giving the final concentrations in the media as mentioned in the 292
Materials and Methods section. The starting cell concentrations in the batches were 886 ± 3, 867 293
± 22, 833 ± 2 and 831 ± 19 mg dry weight/l (n=3) for the non-flocculating, weakly, 294
intermediately and strongly flocculating mutants, respectively. The starting cell concentration 295
was hence slightly lower for the two most strongly flocculating mutants than for the wild type 296
strain, due to a lower biomass yield during the aerobic pre-cultivation. After the start of the 297
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
fermentations, it took a few hours before the dense cell flocs were formed for the strongly 298
flocculating mutant, and longer still for the intermediately flocculating mutant. However, it was 299
clear that constitutive flocculation occurred for all flocculating strains. 300
In non-inhibitory defined glucose medium, the flocculating mutants had slower glucose 301
consumption rate the stronger the flocculation (Figure 5A, Table 3). This was most likely due to 302
mass transfer limitations of nutrients to cells inside the flocs and the slightly lower initial biomass 303
amount. Another contributing factor may have been the increased metabolic burden of the 304
constitutive expression of the flocculin, leading to slower growth rates (27). However, the similar 305
biomass yields indicate that the extra metabolic burden was very small (Table 3). 306
In an initial test of the ability to ferment a toxic medium, the non-flocculating strain and the 307
strongest flocculating mutant were cultivated in a complete spruce hydrolysate, containing 0.21 ± 308
0.00 g/l furfural, 0.73 ± 0.00 g/l HMF and 2.4 ± 0.1 g/l acetic acid (n=4). The flocculation clearly 309
increased the robustness of the strain, enabling it to utilise the glucose and mannose in the 310
hydrolysate faster than the non-flocculating strain, despite the higher initial concentration of 311
biomass for the non-flocculating strain (Figure 5B). Since the spruce hydrolysate was not 312
severely inhibiting even for the non-flocculating strain, 1.5 g/l furfural was added to increase the 313
toxicity of the medium. In this medium, the differences between the strongly flocculating mutant 314
and the non-flocculating parental strain became even clearer. The intermediately flocculating 315
mutant, which formed less dense cell flocs, had only a slightly increased robustness, and the 316
weakly flocculating mutant did not show any significant difference in sugar consumption from 317
the non-flocculating strain (Figure 5C,D). The superior performance of the strongly flocculating 318
cells was also reflected in a significantly higher ethanol production rate compared to the other 319
strains (Table 3). This shows that dense cell flocs are required for the increased robustness of 320
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
flocculating strains, as lower levels of flocculation were not effective in increasing yeast 321
robustness under the tested conditions. 322
To further characterise the increased tolerance arising from strong flocculation, the strains 323
were cultivated in defined media containing the readily convertible inhibitor furfural, and a mix 324
of the not readily convertible inhibitors formic, acetic and levulinic acid. Flocculation did not 325
increase the tolerance towards the acids, which cannot be converted anaerobically by the yeast 326
(Figure 5E). Instead, the differences between the strains were similar to those observed in the 327
non-inhibitory medium. On the other hand, in the furfural-supplemented medium, the strongly 328
flocculating mutant was significantly faster at consuming the glucose (Table 3), while the other 329
strains were unable to complete the fermentations (Figure 5F). The intermediately flocculating 330
mutant also showed an improved performance compared to the non-flocculating yeast, whereas 331
the weakly flocculating mutant did not show a significant improvement. Despite the differences 332
in sugar consumption, all strains were able to convert roughly all furfural within 48 hours (Figure 333
6C). 334
Product yields. In all inhibitory media, the ethanol yields were significantly higher (p < 335
0.05) for the strongly flocculating than for the non-flocculating strain (Table 3). This could be a 336
consequence of a potentially altered energy requirement due to flocculation, requiring higher 337
ATP production compared to the non-flocculating cells. Tentatively this was an effect of a higher 338
requirement for maintenance energy by cells in the interior of the flocs, leading to more of the 339
glucose being directed to ethanol production. 340
In the non-inhibitory defined glucose medium, flocculation caused a slight increase in the 341
glycerol yield. The reason for this is unknown and the effect was not observed in the other media. 342
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
A decreased yield has been reported for encapsulated yeast, where the cells are also packed 343
tightly together, why the reason for the increased yield in the current case remains elusive (17). 344
The glycerol yields were significantly lower in the two furfural-containing media. Furfural is 345
known to act as a redox sink, and can replace glycerol for reoxidation of excess NADH formed 346
in, e.g., biosynthetic reactions or due to acid formation (47). 347
The biomass yields were lower in all inhibitory media than in the non-inhibitory medium 348
(Table 3). In the inhibitory media, it could also be observed that the biomass yields were higher 349
for the flocculating than for the non-flocculating strain. However, because the flocculating cells 350
were not equally dispersed in the medium, sampling during the fermentation caused a decrease in 351
the volume without decreasing the content of flocculating cells. Therefore, the cell yields of the 352
strongly flocculating mutants were most likely overestimated. 353
High local cell density for increased robustness. The results obtained for the strongly 354
flocculating yeast are similar to what has been observed for a non-flocculating yeast strain which 355
was encapsulated in a semi-permeable gel membrane of alginate and chitosan (11). In that study, 356
it was concluded that the tightly packed cell community created by the encapsulation of the cells 357
increases the overall robustness of the yeast by letting cells close to the membrane convert 358
inhibitors, allowing inner lying cells to ferment sugars because of lower inhibitor concentrations. 359
By computer simulations, it has been shown that diffusion limitations in the encapsulated cell 360
pellet lead to concentration gradients of both nutrients and convertible inhibitors (19). It has also 361
been shown, that encapsulation of yeast induces a starvation stress response which increases the 362
robustness of the yeast community (11, 17). The fact that the cells grow rather slowly inside the 363
capsules might also aid in increasing the robustness, as slow-growing cells have been shown to 364
have increased stress tolerance (48). 365
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Strong flocculation is similar to encapsulation in the sense that it also leads to high local 366
cell concentrations. As in the case of encapsulated yeast, genes involved in stress resistance are 367
upregulated in cells flocculating strongly because of FLO1 expression (27). Furthermore, 368
diffusion limitations in yeast flocs have been observed previously. For example, Ge and Bai(49) 369
showed that mass transfer limits the rates of growth and ethanol formation in flocs larger than 370
100 µm, i.e. significantly smaller than for the strongly flocculating mutant in the current 371
study.Therefore, it is likely that the increased robustness of the flocculating yeast observed in this 372
study can be attributed to similar phenomena as were concluded for the encapsulated yeast. When 373
the cells flocculate strongly and form dense cell flocs up to several mm in diameter, the cells 374
closest to the surface of the floc face the harshest conditions in a medium containing inhibitors. 375
With convertible inhibitors, cells closer to the core experience lower levels, due to coupled 376
diffusion and conversion reactions that cause radial concentration gradients in the floc. However, 377
they also have access to sugars that the outer lying cells cannot utilise. As a whole, the cell 378
community will thus be able to ferment media that are too inhibitory for non-flocculating strains, 379
where all cells are exposed to the same inhibitor concentrations. Moreover, even after complete 380
conversion of the inhibitors, the whole non-flocculating cell population may be severely affected 381
by long-lasting effects of the inhibitors, e.g. a lack of energy reserves. In contrast, flocculating 382
populations may contain cells that are still unaffected by the inhibitors, and are able to ferment 383
the medium. This is illustrated by the significantly different fermentative performance of the 384
different strains (Figure 5F), despite very similar furfural conversion (Figure 6C). In a more 385
complex medium, such as the spruce hydrolysate used, additional inhibitory compounds likely 386
play a role in increasing the difference between the strains, so that the non-flocculating and 387
weakly flocculating cells cannot convert nearly as much of the furan aldehydes as the mutants 388
forming dense cell flocs (Figure 6A,B). However, flocculation does not protect against inhibitors 389
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
that are not converted. For example, carboxylic acids can diffuse through the cell flocs without 390
being converted and will therefore, eventually, be present at the same concentration around all 391
cells. This also holds for encapsulated cells, unless the capsule membrane itself can stop diffusion 392
of the inhibitor, as in the case of the hydrophobic inhibitor limonene (11, 50). 393
Another interesting observation made from the fermentation of the hydrolysate was that the 394
rate of mannose consumption was 100% higher in the strongly flocculating mutant than in the 395
non-flocculating strain (Figure 5D, Table 3). Similar effects have recently been shown by 396
encapsulation of a xylose-fermenting yeast, which led to improved simultaneous consumption of 397
glucose, mannose, galactose and xylose (19). This can be explained by the same reasoning as for 398
the increased inhibitor tolerance. Mannose and glucose compete for the same transporter proteins, 399
and because the cells in the periphery of the flocs utilise glucose, the competitive inhibition of 400
mannose uptake by glucose is relieved for the cells closer to the core of the dense cell flocs (51). 401
In wild yeast strains, flocculation is an evolved trait that causes a large number of 402
individual cells to form a community, mimicking multicellular organisms. As we have shown in 403
our experiments, this enables fermentation of otherwise toxic media, likely through protection of 404
part of the community of cells through sacrifice of the outer layer of cells while cells can divide 405
inside the flocs. Furthermore, it has been shown that in a mixture of FLO1-expressing cells and 406
cells that do not express FLO1, the latter cells will make up the outer layer of cells in the yeast 407
flocs (27). This occurs since all cells have the mannose residues in their cell walls that are 408
necessary for binding by flocculins, but the cells lacking FLO1 expression lack the ability to bind 409
to an additional layer of non-flocculating cells. In a toxic medium, the strongest flocculating cells 410
will thus be even better protected in a mixture of cells with different flocculation ability, driving 411
evolution towards survival of the flocculin-expressing cells. 412
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
It has been shown previously that flocculation increases the ethanol tolerance of the yeast 413
(27, 28). That strong flocculation, in itself, also increases fermentation rates of toxic 414
lignocellulosic hydrolysates and, specifically, limits the inhibitory effect of high concentration of 415
furfural on yeast fermentation performance is of great potential importance for second generation 416
ethanol production. Since the occurrence of dense cell flocs proved necessary for increased 417
robustness, it is important to consider the reactor design and choice of operational parameters for 418
good performance of a flocculating strain in such applications. Yeast flocs are sensitive to shear 419
forces and it is thus likely that too rapid stirring would lead to disruption of the flocs and 420
abolished inhibitor tolerance. It is clear that further experiments are necessary for assessing the 421
feasibility of using flocculation to improve the fermentation of toxic lignocellulose hydrolysates 422
in large scale bioreactors. 423
Acknowledgements 424
The authors thank Dr. Tomas Brandberg at SEKAB AB, Sweden, for providing the spruce 425
hydrolysate. We are grateful to Oskar Henriksson for performing initial trials. This work was 426
supported by the Swedish Research Council (grant no. 2009-4514) and the Chalmers Energy 427
Initiative (http://www.chalmers.se/en/areas-of-advance/energy/cei/). 428
Competing interests 429
The authors declare that they have no competing interests. 430
References 431
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
1. Brown TR, Brown RC. 2013. A review of cellulosic biofuel commercial-scale projects 432
in the United States. Biofuel. Bioprod. Bioref. 7:235-245. doi:10.1002/bbb.1387. 433
2. Larsen J, Haven MØ, Thirup L. 2013. Inbicon makes lignocellulosic ethanol a 434
commercial reality. Biomass Bioenergy 46:36-45. doi:10.1016/j.biombioe.2012.03.033. 435
3. Klinke HB, Thomsen AB, Ahring BK. 2004. Inhibition of ethanol-producing yeast and 436
bacteria by degradation products produced during pre-treatment of biomass. Appl. 437
Microbiol. Biotechnol. 66:10-26. doi:10.1007/s00253-004-1642-2. 438
4. Laluce C, Schenberg ACG, Gallardo JCM, Coradello LFC, Pombeiro-Sponchiado 439
SR. 2012. Advances and Developments in Strategies to Improve Strains of 440
Saccharomyces cerevisiae and Processes to Obtain the Lignocellulosic Ethanol-A 441
Review. Appl. Biochem. Biotechnol. 166:1908-1926. doi:10.1007/s12010-012-9619-6. 442
5. Bertilsson M, Andersson J, Lidén G. 2008. Modeling simultaneous glucose and xylose 443
uptake in Saccharomyces cerevisiae from kinetics and gene expression of sugar 444
transporters. Bioprocess Biosyst. Eng. 31:369-377. doi:10.1007/s00449-007-0169-1. 445
6. Stenberg K, Tengborg C, Galbe M, Zacchi G. 1998. Optimisation of steam 446
pretreatment of SO2-impregnated mixed softwoods for ethanol production. J. Chem. 447
Technol. Biotechnol. 71:299-308. doi:10.1002/(sici)1097-4660(199804)71:4<299::aid-448
jctb858>3.0.co;2-z. 449
7. Taherzadeh MJ, Eklund R, Gustafsson L, Niklasson C, Liden G. 1997. 450
Characterization and fermentation of dilute-acid hydrolyzates from wood. Ind. Eng. 451
Chem. Res. 36:4659-4665. doi:10.1021/ie9700831. 452
8. Almeida JRM, Modig T, Petersson A, Hähn-Hägerdal B, Lidén G, Gorwa-453
Grauslund MF. 2007. Increased tolerance and conversion of inhibitors in lignocellulosic 454
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
hydrolysates by Saccharomyces cerevisiae. J. Chem. Technol. Biotechnol. 82:340-349. 455
doi:10.1002/jctb.1676. 456
9. Taherzadeh MJ, Gustafsson L, Niklasson C, Lidén G. 1999. Conversion of furfural in 457
aerobic and anaerobic batch fermentation of glucose by Saccharomyces cerevisiae. J. 458
Biosci. Bioeng. 87:169-174. doi:10.1016/S1389-1723(99)89007-0. 459
10. Taherzadeh MJ, Gustafsson L, Niklasson C, Lidén G. 2000. Physiological effects of 5-460
hydroxymethylfurfural on Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 461
53:701-708. doi:10.1007/s002530000328. 462
11. Westman JO, Manikondu RB, Franzén CJ, Taherzadeh MJ. 2012. Encapsulation-463
Induced Stress Helps Saccharomyces cerevisiae Resist Convertible Lignocellulose 464
Derived Inhibitors. Int. J. Mol. Sci. 13:11881-11894. doi:10.3390/ijms130911881. 465
12. Klinke HB, Olsson L, Thomsen AB, Ahring BK. 2003. Potential inhibitors from wet 466
oxidation of wheat straw and their effect on ethanol production of Saccharomyces 467
cerevisiae: Wet oxidation and fermentation by yeast. Biotechnol. Bioeng. 81:738-747. 468
doi:10.1002/bit.10523. 469
13. Ylitervo P, Franzén C, Taherzadeh M. 2013. Impact of Furfural on Rapid Ethanol 470
Production Using a Membrane Bioreactor. Energies 6:1604-1617. 471
doi:10.3390/en6031604. 472
14. Taherzadeh MJ, Niklasson C, Liden G. 1999. Conversion of dilute-acid hydrolyzates of 473
spruce and birch to ethanol by fed-batch fermentation. Bioresour. Technol. 69:59-66. 474
doi:10.1016/S0960-8524(98)00169-2. 475
15. Koppram R, Albers E, Olsson L. 2012. Evolutionary engineering strategies to enhance 476
tolerance of xylose utilizing recombinant yeast to inhibitors derived from spruce biomass. 477
Biotechnol. Biofuels 5:32. doi:10.1186/1754-6834-5-32. 478
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
16. Ask M, Mapelli V, Hock H, Olsson L, Bettiga M. 2013. Engineering glutathione 479
biosynthesis of Saccharomyces cerevisiae increases robustness to inhibitors in pretreated 480
lignocellulosic materials. Microb. Cell. Fact. 12:87. doi:10.1186/1475-2859-12-87. 481
17. Westman JO, Taherzadeh MJ, Franzén CJ. 2012. Proteomic Analysis of the Increased 482
Stress Tolerance of Saccharomyces cerevisiae Encapsulated in Liquid Core Alginate-483
Chitosan Capsules. PLoS ONE 7:e49335. doi:10.1371/journal.pone.0049335. 484
18. Ylitervo P, Franzén CJ, Taherzadeh MJ. 2011. Ethanol production at elevated 485
temperatures using encapsulation of yeast. J. Biotechnol. 156:22-29. 486
doi:10.1016/j.jbiotec.2011.07.018. 487
19. Westman J, Bonander N, Taherzadeh M, Franzén CJ. 2014. Improved sugar co-488
utilisation by encapsulation of a recombinant Saccharomyces cerevisiae strain in alginate-489
chitosan capsules. Biotechnol. Biofuels 7:102. 490
20. Miki BLA, Poon NH, James AP, Seligy VL. 1982. Possible mechanism for flocculation 491
interactions governed by gene FLO1 in Saccharomyces cerevisiae. J. Bacteriol. 150:878-492
889. 493
21. Verstrepen KJ, Derdelinckx G, Verachtert H, Delvaux FR. 2003. Yeast flocculation: 494
what brewers should know. Appl. Microbiol. Biotechnol. 61:197-205. 495
doi:10.1007/s00253-002-1200-8. 496
22. Liu H, Styles CA, Fink GR. 1996. Saccharomyces cerevisiae S288C has a mutation in 497
FLO8, a gene required for filamentous growth. Genetics 144:967-978. 498
23. Nijkamp J, van den Broek M, Datema E, de Kok S, Bosman L, Luttik M, Daran-499
Lapujade P, Vongsangnak W, Nielsen J, Heijne W, Klaassen P, Paddon C, Platt D, 500
Kotter P, van Ham R, Reinders M, Pronk J, de Ridder D, Daran J-M. 2012. De novo 501
sequencing, assembly and analysis of the genome of the laboratory strain Saccharomyces 502
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
cerevisiae CEN.PK113-7D, a model for modern industrial biotechnology. Microb. Cell. 503
Fact. 11:36. doi:10.1186/1475-2859-11-36. 504
24. Sanchez i Nogue V, Bettiga M, Gorwa-Grauslund M. 2012. Isolation and 505
characterization of a resident tolerant Saccharomyces cerevisiae strain from a spent sulfite 506
liquor fermentation plant. AMB Express 2:68. doi:10.1186/2191-0855-2-68. 507
25. Matsushika A, Inoue H, Murakami K, Takimura O, Sawayama S. 2009. Bioethanol 508
production performance of five recombinant strains of laboratory and industrial xylose-509
fermenting Saccharomyces cerevisiae. Bioresour. Technol. 100:2392-2398. 510
doi:10.1016/j.biortech.2008.11.047. 511
26. Westman JO, Taherzadeh MJ, Franzén CJ. 2012. Inhibitor tolerance and flocculation 512
of a yeast strain suitable for 2nd generation bioethanol production. Electron. J. 513
Biotechnol. 15. doi:10.2225/vol15-issue3-fulltext-8. 514
27. Smukalla S, Caldara M, Pochet N, Beauvais A, Guadagnini S, Yan C, Vinces MD, 515
Jansen A, Prevost MC, Latgé J-P, Fink GR, Foster KR, Verstrepen KJ. 2008. FLO1 516
is a variable green beard gene that drives biofilm-like cooperation in budding yeast. Cell 517
135:726-737. doi:10.1016/j.cell.2008.09.037. 518
28. Xue C, Zhao XQ, Bai FW. 2010. Effect of the size of yeast flocs and zinc 519
supplementation on continuous ethanol fermentation performance and metabolic flux 520
distribution under very high concentration conditions. Biotechnol. Bioeng. 105:935-944. 521
doi:10.1002/bit.22610. 522
29. van Dijken JP, Bauer J, Brambilla L, Duboc P, Francois JM, Gancedo C, Giuseppin 523
MLF, Heijnen JJ, Hoare M, Lange HC, Madden EA, Niederberger P, Nielsen J, 524
Parrou JL, Petit T, Porro D, Reuss M, van Riel N, Rizzi M, Steensma HY, Verrips 525
CT, Vindeløv J, Pronk JT. 2000. An interlaboratory comparison of physiological and 526
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
genetic properties of four Saccharomyces cerevisiae strains. Enzyme Microb. Technol. 527
26:706-714. doi:10.1016/S0141-0229(00)00162-9. 528
30. Güldener U, Heck S, Fiedler T, Beinhauer J, Hegemann JH. 1996. A New Efficient 529
Gene Disruption Cassette for Repeated Use in Budding Yeast. Nucleic Acids Res. 530
24:2519-2524. doi:10.1093/nar/24.13.2519. 531
31. Gietz RD, Akio S. 1988. New yeast-Escherichia coli shuttle vectors constructed with in 532
vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74:527-534. 533
doi:10.1016/0378-1119(88)90185-0. 534
32. Gietz RD, Woods RA. 2002. Transformation of yeast by lithium acetate/single-stranded 535
carrier DNA/polyethylene glycol method. Methods Enzymol. 350:87-96. 536
doi:10.1016/S0076-6879(02)50957-5. 537
33. Taherzadeh MJ, Lidén G, Gustafsson L, Niklasson C. 1996. The effects of 538
pantothenate deficiency and acetate addition on anaerobic batch fermentation of glucose 539
by Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol. 46:176-182. 540
doi:10.1007/s002530050801. 541
34. Teste M-A, Duquenne M, Francois JM, Parrou J-L. 2009. Validation of reference 542
genes for quantitative expression analysis by real-time RT-PCR in Saccharomyces 543
cerevisiae. BMC Molecular Biology 10:99. 544
35. Taherzadeh MJ, Niklasson C, Lidén G. 1997. Acetic acid-friend or foe in anaerobic 545
batch conversion of glucose to ethanol by Saccharomyces cerevisiae? Chem. Eng. Sci. 546
52:2653-2659. doi:10.1016/S0009-2509(97)00080-8. 547
36. Verduyn C, Postma E, Scheffers WA, van Dijken JP. 1990. Physiology of 548
Saccharomyces cerevisiae in anaerobic glucose-limited chemostat cultures. J. Gen. 549
Microbiol. 136:395-403. doi:10.1099/00221287-136-3-395. 550
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
37. Wach A, Brachat A, Pohlmann R, Philippsen P. 1994. New heterologous modules for 551
classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10:1793-552
1808. doi:10.1002/yea.320101310. 553
38. Teunissen AW, van den Berg JA, Steensma HY. 1993. Physical localization of the 554
flocculation gene FLO1 on chromosome I of Saccharomyces cerevisiae. Yeast 9:1-10. 555
doi:10.1002/yea.320090102. 556
39. Verstrepen KJ, Jansen A, Lewitter F, Fink GR. 2005. Intragenic tandem repeats 557
generate functional variability. Nat. Genet. 37:986-990. doi:10.1038/ng1618. 558
40. Kobayashi O, Hayashi N, Kuroki R, Sone H. 1998. Region of Flo1 Proteins 559
Responsible for Sugar Recognition. J. Bacteriol. 180:6503-6510. 560
41. Goossens K, Willaert R. 2010. Flocculation protein structure and cell-cell adhesion 561
mechanism in Saccharomyces cerevisiae. Biotechnol. Lett. 32:1571-1585. 562
doi:10.1007/s10529-010-0352-3. 563
42. Stratford M. 1989. Yeast flocculation: calcium specificity. Yeast 5:487-496. 564
doi:10.1002/yea.320050608. 565
43. Stratford M, Assinder S. 1991. Yeast flocculation: Flo 1 and NewFlo phenotypes and 566
receptor structure. Yeast 7:559-574. doi:10.1002/yea.320070604. 567
44. Straver MH, Smit G, Kijne JW. 1994. Purification and partial characterization of a 568
flocculin from brewer's yeast. Appl. Environ. Microbiol. 60:2754-2758. 569
45. van Mulders SE, Christianen E, Saerens SMG, Daenen L, Verbelen PJ, Willaert R, 570
Verstrepen KJ, Delvaux FR. 2009. Phenotypic diversity of Flo protein family-mediated 571
adhesion in Saccharomyces cerevisiae. FEMS Yeast Res. 9:178-190. doi:10.1111/j.1567-572
1364.2008.00462.x. 573
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
46. Smit G, Straver MH, Lugtenberg BJJ, Kijne JW. 1992. Flocculence of Saccharomyces 574
cerevisiae cells is induced by nutrient limitation, with cell surface hydrophobicity as a 575
major determinant. Appl. Environ. Microbiol. 58:3709-3714. 576
47. Sárvári Horváth I, Franzen CJ, Taherzadeh MJ, Niklasson C, Liden G. 2003. Effects 577
of furfural on the respiratory metabolism of Saccharomyces cerevisiae in glucose-limited 578
chemostats. Appl. Environ. Microbiol. 69:4076-4086. doi:10.1128/aem.69.7.4076-579
4086.2003. 580
48. Zakrzewska A, van Eikenhorst G, Burggraaff JEC, Vis DJ, Hoefsloot H, Delneri D, 581
Oliver SG, Brul S, Smits GJ. 2011. Genome-wide analysis of yeast stress survival and 582
tolerance acquisition to analyze the central trade-off between growth rate and cellular 583
robustness. Mol. Biol. Cell 22:4435-4446. doi:10.1091/mbc.E10-08-0721. 584
49. Ge XM, Bai FW. 2006. Intrinsic kinetics of continuous growth and ethanol production of 585
a flocculating fusant yeast strain SPSC01. J. Biotechnol. 124:363-372. 586
doi:10.1016/j.jbiotec.2005.12.029. 587
50. Pourbafrani M, Talebnia F, Niklasson C, Taherzadeh MJ. 2007. Protective effect of 588
encapsulation in fermentation of limonene-contained media and orange peel hydrolyzate. 589
Int. J. Mol. Sci. 8:777-787. doi:10.3390/i8080777. 590
51. Reifenberger E, Freidel K, Ciriacy M. 1995. Identification of novel HXT genes in 591
Saccharomyces cerevisiae reveals the impact of individual hexose transporters on 592
glycolytic flux. Mol. Microbiol. 16:157-167. doi:10.1111/j.1365-2958.1995.tb02400.x. 593
594
595
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Figures 596
Figure 1 Different flocculation characteristics depending on the size of the FLO-gene. A) 597
The three chosen flocculating transformants showed distinct differences in their flocculation 598
strength, with the weakly flocculating mutant (A2) not forming flocs as dense as the ones of the 599
intermediate (A3) and strongly (A4) flocculating mutants. A1 shows the non-flocculating non-600
transformed CEN.PK 113-7D. B) The PCR product when amplified using the EcoRV_TDH3p-601
FW and HO-RV primers from the genomic DNA of the different strains showed that the inserts 602
had different length, with longer insert corresponding to stronger flocculation. C) Restriction with 603
AccI and ScaI, respectively, showed that the difference in the inserts localised to the middle 604
region of the FLO1 gene. None of the inserts contained the entire FLO1 gene and the difference 605
in length of the FLO1 variants was in a 2809 bp region in the middle of the wild type FLO1. D) 606
Schematic representation of the TDH3p-FLO1-HO recombinant construct. ScaI and AccI 607
restriction sites are indicated. The full length FLO1 is shown with the approximate regions 608
present in the variants (A2-A4), as identified through sequencing, represented by black lines 609
below. An alignment of the full sequences is available in Figure S1. 610
Figure 2 Equal expression of flocculation genes. 611
The expression of the FLO1 gene variants was analysed by quantitative PCR and showed to be 612
equal for the different strains when compared to the reference gene, TAF10. Averages of 613
duplicate biological replicates with duplicate technical replicates are shown with ± one standard 614
deviation, n=2. 615
Figure 3 Sugar inhibition of flocculation. 616
The amount of free cells in the presence of various sugars in different concentrations was 617
measured by turbidimetry. A) Weakly flocculating mutant. B) Intermediately flocculating mutant. 618
C) Strongly flocculating mutant. The flocculation of all strains was inhibited by mannose and for 619
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
the weakly flocculating strain to some degree also by various other sugars. Average values of 620
duplicate experiments with duplicate technical replicates, shown with ± one standard deviation, 621
n=2. 622
Figure 4 The cell wall hydrophobicity is greatly affected by the length of the flocculation 623
gene. 624
The stronger the flocculation, and the larger the size of the inserted mutant variant of FLO1 and 625
corresponding protein, the higher the cell wall hydrophobicity. Average values of triplicate 626
experiments with duplicate technical replicates, shown with ± one standard deviation, n=3. 627
Figure 5 The fermentation profiles of the flocculating strains in different media reveal 628
distinct differences in inhibitor tolerance. 629
The fermentation profiles of the different strains were distinctly different in the different media 630
tested: A) defined non-inhibitory medium, B) spruce hydrolysate, C) glucose and D) mannose in 631
spruce hydrolysate with 1.5 g/l extra furfural, E) defined medium with 200 mM each of formic, 632
acetic and levulinic acid, and F) defined medium with 5 g/l furfural. With strong flocculation 633
creating dense cell flocs, the tolerance towards the readily convertible inhibitor furfural as well as 634
the spruce hydrolysate was increased, leading to faster fermentations. For the not readily 635
convertible acids, as well as the non-inhibitory medium, mass transfer limitations through the 636
flocs plausibly decreased the fermentation rates, leading to longer fermentation times the 637
stronger the flocculation. Average values of 3-4 experimental replicates (duplicates for B) are 638
shown with ± one standard deviation. 639
Figure 6 Furan aldehydes concentrations during batch cultivations 640
The furan aldehydes concentrations during batch cultivations of the different strains were 641
distinctly different in the spruce hydrolysate medium, with added furfural, for A) HMF and B) 642
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
furfural, where the more tolerant strains converted the inhibitors faster. C) In the medium with 5 643
g/l furfural, the profiles were however rather similar, with only a slightly different conversion 644
profile of the non-flocculating strain. Average values of 4 experimental replicates are shown with 645
± one standard deviation. 646
647
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Table 1 – PCR primers
Primer name Nucleotide sequence 5’ 3’
Ctrl-HO-FW CAGAAAGGGTTCGCAAGTC
EcoRV_TDH3p-FW ATGATATCCAGTTCGAGTTTATCATTATC
FLO1-FW ATGACAATGCCTCATCGCTATATGTTTTTGGC
FLO1-HO-RV TTAGCAGATGCGCGCACCTGCGTTGTTACCACAACTCTTATGAGT
TAAATAATTGCCAGCAATAAG
FLO1-RV CTGCATTCGAATATGTGGAGG
HO-FW TACTTTGAATTGTACTACCGCTGGGC
HO-KAN-FW TACTTTGAATTGTACTACCGCTGGGCGTTATTAGGTGTGAAACCA
CGAGCTTCGTACGCTGCAGGTAG
HO-RV TTAGCAGATGCGCGCACCTGCGTTG
SalI_TDH3p-RV TACGTCGACGTGTGTTTATTCGAAACTAAG
SapI_KAN-RV CAGCTCTTCCGCTCCTAATAACTTCGTATAG
SpeI_TDH3p-RV TACTAGTGTGTGTTTATTCGAAA
SphI_KAN-FW ATAATGCATGCTTCGTACGCTGCAGGTAGACAAC
TDH3p-FLO1-RV CATATAGCGATGAGGCATTGTCATGTGTGTTTATTCGAAACT
TAF10-FW ATATTCCAGGATCAGGTCTTCCGTAGC
TAF10-RV GTAGTCTTCTCATTCTGTTGATGTTGTTGTTG
Bold type indicates restriction sites.
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Table 2 Differences in the flocculation genes/proteins from the characterised mutants
compared to FLO1
Mutant Deleted regions Number of deleted 45
aa repeats Point mutations
Weakly
flocculating
nt 948-2297,
nt 2418-2822 10 + 3
Intermediately
flocculating nt 1029-2243 9 H926T
Strongly
flocculating nt 1275-2219 7
I882V, I906V,
S907T, H926T,
V1361A
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Table 3 Product yields and rates in anaerobic batch cultivations
Medium Strain YSE YSAce YSGly YSX qEtOH qGlu qMan CR (%)
DGM
WT 414±5 9±2 53±1 65±3 0.89±0.03 2.2±0.1 n/a 95±2
Weakly 412±5 13±0* 58±1* 67±4 0.85±0.04 2.1±0.1 n/a 96±1
Intermediately 412±4 13±2* 59±3* 69±3 0.82±0.04 2.0±0.1 n/a 96±2
Strongly 413±8 11±1 59±2* 69±2 0.77±0.03* 2.0±0.1* n/a 96±2
Furfural
WT 415±13 22±4 61±8 -1±2 0.24±0.03 0.61±0.06 n/a 90±2
Weakly 435±16 22±2 59±5 -2±1 0.24±0.02 0.61±0.06 n/a 93±3
Intermediately 440±9* 25±2 52±3 5±3* 0.25±0.02 0.63±0.05 n/a 94±2
Strongly 445±5* 26±2 43±2* 8±0* 0.34±0.02* 0.81±0.05* n/a 94±1
Carboxylic
acids
WT 421±4 36±4 71±1 12±1 0.23±0.01 0.57±0.02 n/a 94±0
Weakly 420±1 47±4* 75±2 19±3* 0.19±0.01* 0.49±0.03* n/a 96±1
Intermediately 421±2 45±19 78±1* 25±3* 0.17±0.04 0.42±0.10 n/a 98±1
Strongly 430±3* 36±5 69±2 26±4* 0.20±0.02* 0.47±0.04* n/a 98±1
Hydrolysate
+ 1.5 g/l
furfural
WT 431±16 42±8 20±3 -3±4 0.22±0.03 0.37±0.05 0.10±0.03 90±3
Weakly 427±18 40±14 22±3 3±1* 0.20±0.03 0.35±0.01 0.10±0.02 90±2
Intermediately 439±15 35±2 20±2 9±3* 0.23±0.02 0.39±0.02 0.11±0.03 94±2
Strongly 468±15* 25±2* 23±2 7±3* 0.30±0.02* 0.44±0.04 0.20±0.06* 97±3
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
Yields (n≥3) are shown in mg product per g consumed hexose. YSE – Ethanol yield, YSAce – Acetate yield, YSGly –
Glycerol yield, YSX – Biomass yield, qETOH, qGlu and qMan – average specific rate of ethanol production and glucose and
mannose consumption, g g-1 h-1 during the first 15 hours (6 hours for DGM), CR – carbon recovery, n/a – not
applicable, * significantly different from the WT, p < 0.05, in a two-tailed t-test assuming unequal variance.
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
on April 11, 2018 by guest
http://aem.asm
.org/D
ownloaded from
