+ All Categories
Home > Documents > Forensic Science 2. The DNA Molecule DNA is what makes genes DNA stands for deoxyribonucleic acid ...

Forensic Science 2. The DNA Molecule DNA is what makes genes DNA stands for deoxyribonucleic acid ...

Date post: 12-Jan-2016
Category:
Upload: collin-banks
View: 215 times
Download: 1 times
Share this document with a friend
20
Forensic Science 2
Transcript
Page 1: Forensic Science 2. The DNA Molecule  DNA is what makes genes  DNA stands for deoxyribonucleic acid  It is a molecule that makes up genes and determines.

Forensic Science 2

Page 2: Forensic Science 2. The DNA Molecule  DNA is what makes genes  DNA stands for deoxyribonucleic acid  It is a molecule that makes up genes and determines.

The DNA Molecule DNA is what makes genes DNA stands for

deoxyribonucleic acid It is a molecule that makes

up genes and determines the traits of all living things

All living things contain DNA in their cells

The structure is similar to that of a ladder

Ladder Upright

Ladder Rung

Page 3: Forensic Science 2. The DNA Molecule  DNA is what makes genes  DNA stands for deoxyribonucleic acid  It is a molecule that makes up genes and determines.

The DNA Molecule Six features of the DNA

model Two main sides (similar to

the ladder) Sides are made of

alternating sugar and acid molecules

Parts connect the sides together (similar to the rungs of a ladder) called nitrogen bases

There are 4 types of nitrogen bases: adenine (A), cytosine (C), thymine (T), guanine (G)

The four bases join together in certain ways

The “ladder” is twisted in a spiral called a double helix

Page 4: Forensic Science 2. The DNA Molecule  DNA is what makes genes  DNA stands for deoxyribonucleic acid  It is a molecule that makes up genes and determines.

The DNA Molecule Nitrogen bases:

Adenine always pairs with thymine

Guanine always pairs with cytosine

They fit together similar to that of a puzzle

All your DNA comes together to form chromosomes

Remember: chromosomes are found in the nucleus of cells and your body is made entirely of cells

Page 5: Forensic Science 2. The DNA Molecule  DNA is what makes genes  DNA stands for deoxyribonucleic acid  It is a molecule that makes up genes and determines.

Hoe DNA Works DNA is a code for life So, the code

determines if the organism is a plant or animal, is tall or short, have dark or light hair and every other unique thing we see in life

Example:GAGTGAGGCTTCCTCACTCCGAAG This is a code

Page 6: Forensic Science 2. The DNA Molecule  DNA is what makes genes  DNA stands for deoxyribonucleic acid  It is a molecule that makes up genes and determines.

How DNA Works The code is read

similar to how you read a sentence

The code starts on the right and continues reading until a stop code is reached

For example: you read and understand each word and when you reach a period (.) you know the sentence is complete.

The code gives the cell information it needs to function

Page 7: Forensic Science 2. The DNA Molecule  DNA is what makes genes  DNA stands for deoxyribonucleic acid  It is a molecule that makes up genes and determines.

Making Proteins Remember: your cells

have ribosomes, which make proteins & ribosomes are located in the cytoplasm (not the nucleus where the DNA is found)

DNA codes for the proteins that the ribosomes make

There has to be a messenger to relay information from the DNA (in the nucleus) to the ribosomes (in the cytoplasm)

Page 8: Forensic Science 2. The DNA Molecule  DNA is what makes genes  DNA stands for deoxyribonucleic acid  It is a molecule that makes up genes and determines.

Making Proteins The messenger is

called ribonucleic acid or RNA

Types of RNAMessenger RNA

(mRNA)Transfer RNA (tRNA)

The DNA copies it’s information onto the mRNA and the mRNA travels out of the nucleus into the cytoplasm where the ribosome is and give the information to the tRNA

Page 9: Forensic Science 2. The DNA Molecule  DNA is what makes genes  DNA stands for deoxyribonucleic acid  It is a molecule that makes up genes and determines.

How DNA Copies Itself to RNA

Think about the ladder model of DNA again

The ladder breaks apart into 2 sides

A strand of RNA attaches itself to the DNA and makes a copy of the code – the only difference is RNA does not have the nitrogen base thymine (T), but has uracil (U) which pairs with adenine (A)

Example:AACGTTT DNAUUGCAAA RNA

Page 10: Forensic Science 2. The DNA Molecule  DNA is what makes genes  DNA stands for deoxyribonucleic acid  It is a molecule that makes up genes and determines.

How DNA Copies Itself to RNA The copied mRNA

detaches from the DNA

The DNA closes back up

The mRNA moves out of the nucleus into the cytoplasm

The mRNA attaches to the ribosome and gives the information tRNA to make the proteins

Page 11: Forensic Science 2. The DNA Molecule  DNA is what makes genes  DNA stands for deoxyribonucleic acid  It is a molecule that makes up genes and determines.

History of DNA Investigation Was introduced in

the mid-1980s Revolutionized

forensic science and the ability of law enforcement to match perpetrators with crime scenes

Known as 'DNA fingerprinting' or DNA typing (profiling)

Page 12: Forensic Science 2. The DNA Molecule  DNA is what makes genes  DNA stands for deoxyribonucleic acid  It is a molecule that makes up genes and determines.

History of DNA Investigation

Discovered by an English geneticist named Alec Jeffreys

Found that certain regions of DNA contained DNA sequences that were repeated over and over again

He also discovered that the number of repeated sections present in a sample could differ from individual to individual

Page 13: Forensic Science 2. The DNA Molecule  DNA is what makes genes  DNA stands for deoxyribonucleic acid  It is a molecule that makes up genes and determines.

History of DNA Investigation The past 15 years have

seen tremendous growth in the use of DNA evidence in crime scene investigations as well as paternity testing

Today over 150 public forensic laboratories and several dozen private paternity testing laboratories conduct hundreds of thousands of DNA test  annually in the United States

Page 14: Forensic Science 2. The DNA Molecule  DNA is what makes genes  DNA stands for deoxyribonucleic acid  It is a molecule that makes up genes and determines.

Gathering DNA Evidence All biological evidence

found at crime scenes can be subjected to DNA testing

For example, hair, skin, some bodily fluids, blood, etc

Samples such as feces and vomit can be tested, but may not be routinely accepted by laboratories for testing

Only a few cells can be sufficient to obtain useful DNA information

Page 15: Forensic Science 2. The DNA Molecule  DNA is what makes genes  DNA stands for deoxyribonucleic acid  It is a molecule that makes up genes and determines.

Gathering DNA EvidenceEvidence Possible

Location of DNA on the Evidence

Source of DNA

baseball bat or similar weapon

handle, end sweat, skin, blood, tissue

hat, bandanna, or mask

inside sweat, hair, dandruff

eyeglasses nose or ear pieces, lens

sweat, skin

facial tissue, cotton swab

surface area mucus, blood, sweat, semen, ear wax

Evidence Possible Location of DNA on the Evidence

Source of DNA

fingernail, partial fingernail

scrapings Blood, sweat, tissue

tape or ligature

inside/outside surface

skin, sweat

bottle, can, or glass

sides, mouthpiece

saliva, sweat

Page 16: Forensic Science 2. The DNA Molecule  DNA is what makes genes  DNA stands for deoxyribonucleic acid  It is a molecule that makes up genes and determines.

Gathering DNA EvidenceEvidence Possible

Location of DNA on the Evidence

Source of DNA

dirty laundry surface area blood, sweat, semen

toothpick tips saliva

used cigarette

cigarette butt Saliva

stamp or envelope

licked area Saliva

Evidence Possible Location of DNA on the Evidence

Source of DNA

used condom

inside/outside surface

semen, vaginal or rectal cells

blanket, pillow, sheet

surface area sweat, hair, semen, urine, saliva

"through and through" bullet

outside surface

blood, tissue

bite mark person's skin or clothing

saliva

Page 17: Forensic Science 2. The DNA Molecule  DNA is what makes genes  DNA stands for deoxyribonucleic acid  It is a molecule that makes up genes and determines.

Gathering DNA Evidence Contamination - Because

extremely small samples of DNA can be used as evidence, greater attention to contamination issues is necessary when identifying, collecting, and preserving DNA evidence.

DNA evidence can be contaminated when DNA from another source gets mixed with DNA relevant to the case.

Page 18: Forensic Science 2. The DNA Molecule  DNA is what makes genes  DNA stands for deoxyribonucleic acid  It is a molecule that makes up genes and determines.

Storing DNA Evidence Direct sunlight and

warmer conditions may degrade DNA

Avoid storing evidence in places that may get hot, such as the trunk of the police car

To best preserve DNA evidence, store in a cold environment

Page 19: Forensic Science 2. The DNA Molecule  DNA is what makes genes  DNA stands for deoxyribonucleic acid  It is a molecule that makes up genes and determines.

Analyzing DNA Evidence The general

procedure includes: 1) isolating DNA from

evidence sample containing DNA of unknown origin (at a later time, the isolation of DNA from a sample (e.g., blood) from a known individual or suspect)

2) processing DNA so that test results may be obtained

Page 20: Forensic Science 2. The DNA Molecule  DNA is what makes genes  DNA stands for deoxyribonucleic acid  It is a molecule that makes up genes and determines.

Analyzing DNA Evidence The general

procedure includes: 3) determination of the

DNA test results (or types), from specific regions of the DNA

4) comparison and interpretation of the test results from the unknown and known samples to determine whether the known individual is not the source of the DNA or is included as a possible source of the DNA.


Recommended