Pesticide Biochemistry and Physiology 87 (2007) 54–61www.elsevier.com/locate/ypest
Frequency detection of pyrethroid resistance allele in Anopheles sinensis populations by real-time PCR ampliWcation of speciWc allele (rtPASA)
Hyunwoo Kim a, Ji Hyung Baek a, Won-Ja Lee b, Si Hyeock Lee a,¤
a School of Agricultural Biotechnology, Seoul National University, Seoul 151-921, Republic of Koreab Department of Medical Zoology, Korea National Institute of Health, Seoul 122-701, Republic of Korea
Received 30 March 2006; accepted 5 June 2006Available online 4 July 2006
Keywords: Anopheles sinensis; Knockdown resistance (kdr); Real-time PASA (rtPASA); Pyrethroids
1. Introduction
The mosquito Anopheles sinensis is a major vector ofmalaria in Korea. In the1990s the national malaria eradica-tion program, based mostly on chemical control of vectormosquitoes, resulted in the apparent disappearance ofmalaria in South Korea; however malaria has sinceresurged with more than 21,400 cases detected to date(Korea Center for Disease Control and Prevention, http://dis.cdc.go.kr/eng_statistics/statistics.asp). Since their intro-duction during the 1970s, insecticides including pyrethroidsand organophosphates have been widely used for the con-trol of medically important arthropod pests, including mos-quitoes. Permethrin and DDVP (Dichlorvos) have beenused in Korea as the principal active ingredients of both
indoor and outdoor mosquito control products and havealso been widely used for the control of mosquitoes andXies in animal farming. Intensive use of insecticides wasquickly followed by development of insecticide resistance ina variety of mosquito species including An. sinensis.
It is extremely important to understand the mechanismof insecticide resistance in order to suppress and delay thedevelopment of resistance and establish a reliable resistancemonitoring system. Consequently, many studies have beenconducted on the molecular basis of insecticide resistance.One important mechanism of resistance to pyrethroids ischaracterized by a marked reduction in the intrinsic sensi-tivity of the insect nervous system to these compounds.This phenomenon was originally reported as knockdownresistance (kdr) in Musca domestica, and it was subse-quently determined that a single mutation (leucine to phen-ylalanine, Leu1014Phe) in the S6 transmembrane segmentof domain II in the sodium channel is associated with kdr topyrethroids and DDT in both M. domestica [1] and the
H. Kim et al. / Pesticide Biochemistry and Physiology 87 (2007) 54–61 55
German cockroach, Blattella germanica [2]. Kdr-relatedmutations, identical or similar to the Leu-to-Phe mutation,have been also reported in Anopheles gambiae [3] and in avariety of pyrethroid-resistant arthropod species [4].
To establish a successful resistance management system,it is essential to develop more sensitive tools for the rapidestimation of resistance allele frequencies from Weld popu-lations [5,6]. Detection of the conserved mutations associ-ated with insecticide resistance, such as the Leu-to-Phemutation, has been achieved by various DNA-based geno-typing techniques, including PCR ampliWcation of speciWcallele (PASA) [7], bi-directional PCR ampliWcation of spe-ciWc allele (bi-PASA) [8], single stranded conformationalpolymorphism (SSCP) [9], minisequencing, and serial inva-sive signal ampliWcation reaction (SISAR) [10]. Althoughthese individual genotyping techniques are very useful inprecise estimation of both frequency and genotype of resis-tance alleles, they usually require a great number of analy-sis and sample preparation, limiting their potential as ahigh throughput resistance monitoring tool. For the rapidmonitoring of resistance in a large number of Weld popula-tions of mosquito, necessary would be a genotyping tech-nique based on pooled DNA samples that can be employedat the preliminary step of resistance monitoring prior tomore elaborate individual genotyping.
In the present study, we demonstrate that the Leu-Phesodium channel mutation is commonly found in mostKorean populations of An. sinensis and describe a simpleand accurate real-time PASA (rtPASA) protocol for theestimation of the kdr allele (Leu-Phe mutation) frequencyon a population basis of An. sinensis. We also discuss theapplicability of this protocol in large scale resistance moni-toring and management.
2. Materials and methods
2.1. Mosquitoes
Anopheles sinensis mosquitoes were collected using anaspirator or black-light trap. Blood-fed female mosquitoeswere individually placed in a paper cup containing waterand allowed to lay eggs under the conditions of 27§ 2 °Ctemperature, 65§ 5% relative humidity, and 12:12 photope-
riod (light:dark). Hatched larvae were reared under thesame conditions and used for RNA or DNA extraction.For individual genotyping, F1 larvae were obtained from100 blood-fed females, combined and stored at ¡20 °C untiluse.
2.2. PCR ampliWcation of the para-homologous sodium channel gene fragment
Total RNA was extracted with Tri Reagent® (MRC,Cincinnati, OH) from 120 4th instar larvae (Paju strain)and mRNA was isolated with the PolyATract mRNA iso-lation SystemIII® (Promega, Madison, WI). First-strandcDNA was synthesized from the mRNA using Superscrip-tIII reverse transcriptase as recommended by the manufac-turer (Invitrogen, Carlsbad, CA). PCR was performed withdegenerate primer sets (5�IIS4 vs. 3�IIS56; 5�ASIIS56 vs.3�IIIS3) designed from highly conserved regions (Table 1and Fig. 1) to amplify the IIS4-IIIS3 cDNA fragment of thepara-homologous sodium channel gene in two overlappingconsecutive fragments. A 20 �l reaction mixture contained20�M each of degenerate primer (Table 1), 0.5 U of Advan-tage® 2 polymerase mix (TITANIUM™ Taq DNA Poly-merase, 0.3 mM Tris–HCl (pH 8.0), 1.5 mM KCl, and 10�MEDTA) (Clontech, Palo Alto, CA), 0.2 mM of dNTP(Invitrogene), and 1�l of cDNA template. Reaction mix-tures were incubated at 95 °C for 1 min prior to 30 cycles ofampliWcation (95 °C for 30 s, 50 °C for 30 s, and 68 °C for1 min).
To amplify the IIS5-IIS6 genomic DNA fragment of thesodium channel gene, PCR was performed using sequence-speciWc primers (Table 1) and genomic DNA as thete7mplate. Genomic DNA was extracted from 10 adultmosquitoes with 200�l DNAzol® as recommended by themanufacturer (MRC). PCR mixtures (20�l) were asdescribed above except for 0.1�M sequence-speciWc prim-ers (5ASIIS56 and 3ASII6intron) (Table 1 and Fig. 1) and20 ng of genomic DNA. The thermal program was: onecycle of 95 °C for 3 min followed by 35 cycles of 95 °C for20 s, 65 °C for 20 s, and 68 °C for 1 min. Following Wltrationthrough Microcon-100 Wlter (Millipore, Bedford, MA)twice, the 361-bp ampliWed DNA fragments were directlysequenced and the genotypes were analyzed.
Table 1Primers used for the isolation of An. sinensis sodium channel gene fragment encompassing the Leu-to-Phe mutation site and for rtPASA
Name Sequence Remarks
5�IIS4 5�GCIAARWSITGGCCIACNYT Primers for the ampliWcation of sodium channel3�IIS56 5�YTITGYGGIGARTGGATHG3�IIIS3 5�CCARCACCAIGCRTTIGTRAA5�ASIIS5 5�GACGTTCGTGCTCTGCATTAT3�ASIIS5 5�CACATCCCCGACTAGCATACA
5�ASIIS56 5�CGGACTTCATGCACTCCTTCA Primers for the ampliWcation of the rtPASA template3�ASIIS56intron 5�TTAGCGCATTTGCTACGTTC
As-PASA-5 5�GGAGTGGATCGAATCAATG Allele-speciWc primers for the rtPASAAs-PASA-3R 5�CTGCAGTTACTCACCACAAs-PASA-3S 5�CTGCAGTTACTCACCACC
56 H. Kim et al. / Pesticide Biochemistry and Physiology 87 (2007) 54–61
2.3. rtPASA with standard DNA mixtures
A 361-bp genomic DNA fragment corresponding to theIIS5-IIS6 segment of the sodium channel gene was PCR-ampliWed from individual mosquitoes and directlysequenced to identify individuals with homozygous resis-tant (with Leu-Phe mutation) or homozygous susceptible(without Leu-Phe mutation) genotypes. Once the kdr geno-type was determined, DNA samples were stored at ¡20 °Cfor use as standard template DNA. The standard templateDNA mixtures for rtPASA were prepared by combiningPCR-ampliWed fragments with and without the Leu-Phemutation in various ratios (% susceptible allele: % resis-tance alleleD 100:0, 50:50, 10:90, 1:99, 0:100). The opti-mized rtPASA reaction mixture (20�l) contained 1 ngstandard template DNA mixture, 0.5 U of Taq polymerase(Promega), 0.035�M TaqStart antibody (Clontech), SYBRGreen I (1:40,000 Wnal concentration; Molecular Probe,Eugene, OR), 0.3 �M susceptible or resistance allele-speciWcprimer (As-PASA-3S or As-PASA-3R), 0.3�M generalprimer (As-PASA-5), 100�M dNTPs, and 1.2 mM MgCl2.rtPASA was performed using a Chromo 4™ real-timedetector (Bio-Rad, Hercules, CA) with a thermal cyclerprogram of 1 cycle of 95 °C for 3 min, 35 cycles of 95 °C for20 s, 62 °C for 20 s, 72 °C for 30 s, and a Wnal cycle of 72 °Cfor 3 min.
To minimize prediction errors of rtPASA due to varia-tions in template DNA concentration, the concentration ofthe PCR-ampliWed template DNA was estimated both bygel band intensity analysis (Kodak 1D image analysis soft-ware Version 3.5, Rochester, NY) with the Low DNA MassLadder (Invitrogen) following agarose gel electrophoresis,and by Xuorometric determination using PicoGreen
(Molecular Probe) according to the manufacturer’s direc-tions, with a SPECTRAmax GEMINI XS MicroplateSpectroXuorometer (Molecular Device, Palo Alto, CA).
Threshold cycles (Ct) were determined from eachampliWcation curve, and plotted against respective sus-ceptible allele frequency. Standard linear regression lineswere generated from plotting the log scale of susceptibleallele frequency vs. Ct value using the Sigma Plotprogram (Version 6.00 for Windows). The PCR ampliW-cation eYciency was calculated from the slope ofthe standard curve using the following equation:E D 10¡1/slope [11,12].
2.4. Evaluation of rtPASA
One hundred individual frozen 4th instar larvae ofAnsan population were cut into two pieces with a razorblade at the head–thorax region. The abdominal part ofeach body was separately processed for individual genomicDNA extraction, whereas the head–thorax parts were com-bined for pooled genomic DNA extraction. Genomic DNAextraction was performed using DNAzol (MRC) as recom-mended by the manufacturer, with a minor modiWcation.The single individual abdominal parts and pooled head–thorax parts of the larvae were homogenized in 200 and40 �l of DNAzol, respectively. The 361-bp sodium channelgene fragments were ampliWed from both the pooled and 30individual genomic DNA samples. The PCR-ampliWedsodium channel gene fragments from 30 individuals weredirectly sequenced (NICEM sequencing facility, SNU,Seoul, Korea) to determine the kdr allele frequency, whilethe product from the pooled genomic DNA was used as anunknown sample for rtPASA.
Fig. 1. Sequence and intron-exon structure of the IIS4-IIS6 transmembrane segment of the para-homologous sodium channel gene from An. sinensisencompassing the Leu-Phe or Leu-Cys mutation site. The Leu-Phe mutation site is marked with a box. Two introns are indicated by shadowing. Thesequence has been submitted to the GenBank database with Accession No. DQ334052.
H. Kim et al. / Pesticide Biochemistry and Physiology 87 (2007) 54–61 57
2.5. Analysis of kdr allele frequencies of An. sinensis regional populations by rtPASA
Adult female An. sinensis mosquitoes were collected from11 regions using an aspirator or black-light trap and thenfrozen and stored at ¡20°C until use. Genomic DNA wasextracted from 100 adults of each regional population. Stan-dard DNA template was ampliWed by PCR from each geno-mic DNA as described above, and 1ng was used for rtPASA.
3. Results
3.1. Cloning of the IIS4-6 fragment of the para-homologous sodium channel gene
Two contiguous overlapping cDNA fragments (230-bpIIS4-IIS5 and 347-bp IIS5-IIIS3) of the para-homologoussodium channel gene were ampliWed by PCR using degener-ate primer sets and sequenced. The assembled 531-bpcDNA fragments showed 97.2 and 96.6% sequence identityto the corresponding region of the sodium channel genesfrom An. gambiae and Aedes aegypti, respectively. A 1500-bp PCR product was generated using the sequence-speciWcprimer set (Table 1) with genomic DNA as template. Twointrons were identiWed within the IIS4-IIS6 segment of thesodium channel gene: a 905-bp intron located close to theend of IIS5 and a 64-bp intron in the middle of the IIS6transmembrane segments (Fig. 1).
Sequence analysis of the genomic DNA of the IIS4-IIS6segment of the sodium channel gene from four regionalpopulations of An. sinensis revealed that the Leu-Phe (TTGto TTT) mutation known to confer the kdr trait was presentin all populations tested, but the Met-Thr mutation knownto be associated with the super kdr trait was not present inany of the populations (Fig. 2). Interestingly, an allele con-taining a Leu-Cys (TTG-TGT) mutation at the same posi-tion was found in all the regional populations at a relatively
Fig. 2. Nucleotide sequence chromatograms at the Leu-Phe or Leu-Cysmutation site when sequencing the IIS5-IIS6 genomic DNA fragment ofthe sodium channel gene ampliWed from 10 adults of An. sinensis. TheLeu/Phe/Cys-encoding codon position was indicated by dotted verticallines. The typical Leu-Phe (TTG to TTT) mutation is mixed with a minorallele (TGT) encoding Cys in all the regional populations (Paju, Ansan,Jeonju, and Gurye) examined. Peak colors represent: T (red), C (blue), A(green), G (black). (For interpretation of the references to color in thisWgure legend, the reader is referred to the web version of this paper.)
low frequency as judged by the presence of weak but dis-tinct G sequence signal in the TGT triplet code (Fig. 2).
3.2. Development of rtPASA protocol
Since two potential resistance alleles [the major Leu-Phe(TTT) mutated allele and the minor Leu-Cys (TGT)mutated allele were found in regional populations of An.sinensis, the rtPASA assay was designed to use the suscepti-ble allele-speciWc primer (As-PASA-3S, Table 1) to detectthe susceptible allele (TTG) instead of using primers spe-ciWc for the resistance allele. Optimal conditions for thertPASA were determined by sequential testing of variousannealing temperatures and concentrations of primer,DNA template, and MgCl2. To Wnd the optimum annealingtemperature that can simultaneously give minimum allele-nonspeciWc ampliWcation and maximum ampliWcationeYciency for target DNA template, we tested a range oftemperatures (55–67 °C) based on the estimated meltingtemperature (50 °C) of the susceptible allele-speciWc primerunder the conditions of 1.2 mM MgCl2, 0.3 �M of eachprimer, and 1 ng of 100% susceptible or 100% resistancestandard DNA template. NonspeciWc ampliWcation wassuppressed signiWcantly as the annealing temperatureincreased, as determined by the logE�Ct(0–100) value, whereE is the ampliWcation eYciency and �Ct(0–100) is the Ctvalue diVerence between 0 and 100% susceptible standardDNA templates (Fig. 3A). The ideal level of allele-speciWcampliWcation was obtained at 63 °C. The ampliWcationeYciency, however, decreased noticeably at higher tempera-tures (67 °C) (Fig. 3A). Taken together, the optimum tem-perature was determined to be around 62–63 °C, at whichallele-nonspeciWc ampliWcation was maximally suppressedwhereas the eYciency of allele-speciWc ampliWcationremained close to 2.0. When titrating primer concentration,it was apparent that decreasing the concentration of theallele-speciWc primer (As-PASA-3S) to a certain level(0.1�M) resulted in both the reduction of ampliWcationeYciency and a signiWcant impairment of ampliWcation(Fig. 3B). In contrast, as the primer concentration increasedto 0.4�M, ampliWcation eYciency increased above the ideallevel of 2.0 (Fig. 3B), most likely due to nonspeciWc ampliW-cation as indicated by heterogeneous melting curves (datanot shown). Therefore, the optimum allele-speciWc primerconcentration was determined to be 0.2–0.3 �M (Fig. 3B).AmpliWcation eYciency was not altered signiWcantly withinthe range of template DNA concentrations tested (0.5, 1.0,and 2.0 ng/reaction) and no signiWcant diVerences wereobserved between diVerent MgCl2 concentrations in therange of 1.2–1.5 mM (data not shown). Taken together, theoptimum conditions for the rtPASA were determined to be:62 °C annealing temperature, 0.3 �M each primer, 1 ngDNA template, and 1.2 mM MgCl2.
Typical results obtained from the rtPASA using standardDNA mixtures under the optimum conditions are shown inFig. 4A. Based on the relationship between susceptible allelefrequencies (100–0%) and corresponding Ct values, a linear
58 H. Kim et al. / Pesticide Biochemistry and Physiology 87 (2007) 54–61
regression line was generated by converting the frequency tolog values. The high regression coeYcient (r2D0.9995) dem-onstrated a very strong correlation between susceptible allelefrequency and Ct value (Fig. 4B). The calculated PCR ampli-Wcation eYciency was 2.1, indicating that the rtPASA wasconducted under the optimum conditions.
3.3. Evaluation of the performance of rtPASA
Individual genotyping for 30 individual larvae (abdominal2/3 body part) from a single Weld population (Ansan) wasconducted by sequencing. As shown in Fig. 4A, two homozy-gous and three diVerent heterozygous genotypes were foundat the Leu-Phe mutation site. Among the 30 sequenced indi-vidual genotypes, 5 homozygous susceptible (TTG/TTG, Leu/Leu), 11 homozygous resistance (TTT/TTT, Phe/Phe), and 11heterozygous (TTG/TTT, Leu/Phe) genotypes were clearlydetermined on the basis of the sequence chromatogram(Fig. 4A). In addition to the major TTG/TTT heterozygote,two other minor heterozygous individuals were identiWed
Fig. 3. Determination of optimum annealing temperature (A) and primerconcentration (B) for rtPASA. (A) The PCR ampliWcation eYciency (E)(-�-) and the log E�Ct(0–100) index for maximum suppression of nonspeciWcallele (-�-) were plotted against annealing temperatures (55, 58, 62, and65 °C), where E is the ampliWcation eYciency at each annealing tempera-ture, and �Ct(0–100) is the Ct (critical ampliWcation time) value diVerencebetween 0 and 100% susceptible standard DNA templates. (B) PCRampliWcation eYciency (E) (-�-) was plotted against diVerent susceptibleallele-speciWc primer (As-PASA-3S) concentrations (0.1–0.4 �M).
A
Annealing Temperature ( OC)
54 56 58 60 62 64 66 68
Am
plif
icat
ion
Eff
icie
nc
y
1.0
1.5
2.0
2.5
Lo
g E
ΔCt(
0-10
0)
2.0
2.5
3.0
EfficiencyLog EΔCt(0-100)
Ideal Efficiency Level
B
Primer Concentration (uM)0.10 0.20 0.30 0.40
Am
plif
icat
ion
Eff
icie
ncy
1.6
1.8
2.0
2.2
2.4
2.6
Ideal Efficiency Level
from the mixed sequence signals of T(G/T)T and T(G/T)(G/T) (Fig. 4A). When the corresponding PCR-ampliWedDNA fragments were cloned and sequenced, these heterozyg-otes were resolved to be of TGT/TTT (Cys/Phe) and TTG/TGT (Leu/Cys), respectively. One TGT/TTT (Cys/Phe) andtwo TTG/TGT (Leu/Cys) heterozygous individuals were
Fig. 4. Evaluation of rtPASA performance by comparing the resistanceallele frequency of Ansan population of An. sinensis estimated from indi-vidual genotyping by sequencing (A) and that from rtPASA (B and C).(A) Typical nucleotide sequence chromatograms of a variety of genotypes[homozygous Leu (TTG), homozygous Phe (TTT), and heterozygousalleles of Leu/Phe, Phe/Cys, and Leu/Cys] identiWed from individualsequencing. (B) Typical ampliWcation curves obtained from rtPASA usingsusceptible allele-speciWc primer (As-PASA-3S) and standard templateDNA mixtures of diVerent ratios (% susceptible allele: % resistanceallele D 100:0, 50:50, 10:90, 1:99, and 0:100). Ct (critical ampliWcationtime) values were determined at Xuorescence level of 0.04. (C) Standardlinear regression line generated by plotting Ct value vs. log susceptibleallele frequency in the standard template DNA mixture.
C
B
A
Real-time PCR Graph
Cycle0 10 20 30
Flu
ore
scen
ce
0.0
0.1
0.2
0.3
0.4
0.5
Sus 100%Sus 50%Sus 10%Sus 1%Sus 0%
H. Kim et al. / Pesticide Biochemistry and Physiology 87 (2007) 54–61 59
found among the 30 samples, at low frequencies of 3.3 and6.7%, respectively. Although the function of the Cys-substitu-tion at the Leu amino acid location remains to be elucidated,the total frequency of the susceptible allele (TTG) was calcu-lated to be 38.3% (16.7% homozygous allele+43.3% heterozy-gous allele). If both the Phe (TTT) and Cys (TGT) mutationsare regarded as resistance alleles, their frequency in the Ansanpopulation was estimated to be 61.7% (100–38.3%; Fig. 4A).This allele frequency was used as a reference value for evalu-ating the performance of the rtPASA using the DNA tem-plate generated from the pooled DNA sample that had beenextracted from a combination of 100 head–thorax parts ofAn. sinensis.
Typical ampliWcation patterns of rtPASA reactionsusing a series of standard DNA mixture templates contain-ing 100, 50, 10, 1 and 0% susceptible allele frequencies areshown in Fig. 4B. The pooled DNA samples were analyzedsimultaneously with a set of internal standard DNA mix-tures with known allele frequencies (100, 50, 10, 1, and 0%)by rtPASA under the standard conditions (Fig. 4C). Theresulting Ct values for the pooled DNA samples were con-verted to actual allele frequencies using the equation gener-ated by the set of internal standard DNA mixtures(yD¡3.057x + 9.596, r2D0.9995) (Fig. 4C). The resistanceallele frequency of the pooled DNA sample of the Ansanpopulation was estimated as 60.8%, which corroboratedwell with the reference frequency determined by individualgenotyping (61.7%) within the 95% CL (conWdence limit).
3.4. Prediction of the resistance allele frequency of 11 regional populations
The frequency of the kdr resistance allele (Leu-Phemutation) in 11 regional Weld populations of An. sinensis
Fig. 5. Pyrethroid resistance allele frequencies (Leu-Phe mutation fre-quency) in 11 regional populations of An. sinensis. The resistance allelefrequencies were predicted by rtPASA. The four regions with highestresistance allele frequency were located in a major rice Weld area in Koreamarked by a shadowed oval.
was determined using the rtPASA protocol developed inthis study. Most of the regional populations revealed kdrallele frequencies higher than 50%, except for Daejeon(46.8%) and Gijang (25.0%) populations. Notably, all thelocal populations from the Jeonla-Do region (Gwangyang,Gurye, Jeonju, and Gwangju), a major paddy Weld area,showed relatively high resistance allele frequencies of 96.6,96.3, 86.5, and 79.0%, respectively, compared with thosefrom other regions (Fig. 5).
4. Discussion
Sequence analysis of the IIS4-IIS6 segment of thesodium channel gene revealed that the Leu-Phe mutationknown to confer kdr was present in all the regional popula-tions of An. sinensis examined. However, the Met-Thrmutation known to be associated with the super-kdr traitwas not found in the populations examined. In the para-homologous sodium channels present in a variety of insectspecies [4], the Leu residue is encoded by the codon CTT, inwhich a C to T substitution at the Wrst nucleotide positionof results in the Leu-Phe mutation. Interestingly, this con-served Leu is encoded by TTG in An. sinensis and the muta-tion to Phe involves the replacement of the third position ofthe triplet. A similar codon usage is found in An. gambiae(TTA) [3] and the German cockroach (TTG) [2]. In addi-tion to the TTG (Leu) and TTT (Phe) alleles, an alleleencoding cysteine (TGT) was also found in some local pop-ulations. The TGT allele was found either with TTG orTTT, thereby forming TGT/TTG (Cys/Leu) and TGT/TTT(Cys/Phe) heterozygotes. The Leu-Cys mutation is likelyassociated with resistance since the substitution of this leu-cine by serine, an amino acid residue with similar propertiesto cysteine, confers pyrethroid resistance in An. gambiae[13]. If the Leu-Cys mutation is assumed to be responsiblefor resistance, the TGT/TTT heterozygous allele likelyfunctions as a homozygous resistance allele in conferringresistance. The exact function of the Cys-substitution andwhich allele is transcribed in the cases of Cys/Leu and Cys/Phe heterozygotes remains to be determined. The frequencyof the Cys-encoding TGT allele appeared to be somewhatlow (5%) compared to the Phe-encoding TTT allele, sug-gesting that it has been introduced into An. sinensis popula-tions relatively recently. A similar case has been reported inpyrethroid-resistant populations of the house Xy, where anadditional new allele, a Leu-His mutation, was presenttogether with the Leu-Phe allele in most of the populationsfrom the Eastern US [14].
In an attempt to detect the frequency of resistance-asso-ciated mutations in the sodium channel in An. sinensis on apopulation basis, we have developed a diagnostic protocolbased on real-time PCR. To ensure an accurate predictionof resistance allele frequency, it is necessary to determineoptimum rtPASA conditions. We have found that condi-tions which are too stringent, in particular temperaturesthat are too high, generally cause an overall reduction inthe ampliWcation eYciency, thereby resulting in the
60 H. Kim et al. / Pesticide Biochemistry and Physiology 87 (2007) 54–61
impairment of target template ampliWcation and underesti-mation of target template frequency. Therefore, it is impor-tant to Wnd conditions that can ensure the idealampliWcation of target template (ampliWcation eYciency of2.0) as well as the maximum suppression of nonspeciWcampliWcation. In practice, ampliWcation eYciencies of 1.8–2.2 were considered acceptable in this study.
Once optimum conditions are established, it is desirableto evaluate the performance of rtPASA and calibrate thesystem by running duplicate samples with known allele fre-quency. In the present study, the allele frequency was deter-mined from 30 individual genotypes and compared withthat estimated from a pooled DNA sample by rtPASA. Asreported previously, a slight change in standard DNA tem-plate concentration can cause a signiWcant shift in theregression line, potentially generating errors in frequencyprediction [15]. Therefore, it is critical to include a standardDNA template set in all routine rtPASA analyses. In addi-tion, use of a PCR fragment containing the mutation site(s)rather than genomic DNA has a great advantage withrespect to control of both the quality and quantity of tem-plate DNA.
Using the optimum conditions this rtPASA protocolshowed a high level of reliability and accuracy as demon-strated by the performance evaluation of rtPASA, wherethe allele frequency predicted by the rtPASA was well cor-related with that determined by individual sequence analy-sis. Based on this fact, rtPASA appears to be a powerfultool in detecting insecticide resistance allele frequency on apopulation basis. When estimated by rtPASA, the fre-quency of the resistance allele (Leu-Phe mutation) rangedfrom 25.0 to 96.6% in the 11 regional populations, suggest-ing that knockdown resistance of An. sinensis against pyre-throids is widespread in Korea. Due to the absence of asusceptible laboratory strain of An. sinensis that can beused as a reference, it was not possible to calculate exactpyrethroid resistance ratios in the Weld populations. How-ever, since the Leu-Phe mutation in the insect sodium chan-nel is known to confer pyrethroid resistance [1–4,16,17],presence of this mutation alone likely increases the baselineresistance level to pyrethroids in the regional populationsof An. sinensis to that extent. In addition, considering thepresence of other resistance factors such as cytochromeP450-mediated enhanced metabolism, actual resistancelevel in the Weld populations of An. sinensis would be higherthan that estimated by kdr allele frequency. Interestingly, itappears that mosquitoes collected from areas close to riceWelds and animal farms (Gurye, Gwangyang, Gwangju, andJeonju) showed relatively high levels of permethrin resis-tance compared with other regions (Fig. 5). Traditionalpyrethroids have been intensively used in animal farms tocontrol Xies, whereas nonester pyrethroids such as etofen-prox and silaXuofen have been introduced into rice Welds, amain breeding habitat of An. sinensis, for the control of therice water weevil since the late 1980s. In addition to pyre-throids directly used for the control of mosquitoes, thewidespread use of insecticides for the control of other agri-
cultural pests, including rice water weevils, appears to con-tribute to the development of insecticide resistance in An.sinensis, likely resulting in high levels of resistance in thefarming areas.
Considering the high frequency of kdr alleles in repre-sentative Weld populations, continued use of pyrethroids tocontrol An. sinensis mosquitoes will likely aggravate theresistance problem by further reducing the susceptible allelefrequency in the population. Since it is likely that sodiumchannel insensitivity due to the kdr allele confers cross-resistance to all other pyrethroids, switching to alternativepyrethroids may not solve the current resistance problem.Based on the Wndings in this study, it appears desirable torestrict the use of pyrethroids for the control of An. sinensisin Korea for the time being, thereby preserving the remain-ing pyrethroid-susceptible alleles. Since it is not easy toobtain a suYcient number of live An. sinensis larvae forbioassay and to rear under laboratory conditions, the geno-typing of resistance alleles from either dead or live adultspecimens, easily collectable by light trap, would be analternative method of baseline resistance monitoringtogether with the traditional bioassay. In this regard, thertPASA technique will greatly facilitate and expedite moni-toring of pyrethroid resistance allele frequency and itschange over time. Population-based analysis using rtPASAas a preliminary resistance monitoring tool will enable tosurvey overall resistance levels in a large number ofregional populations of An. sinensis in a very eYcientmanner.
Acknowledgments
This work was supported by Grant 02-PJ1-PG10-20405-0001 from the Korea Health Industry Development Insti-tute. H.W. Kim and J.H. Baek were supported in part byBrain Korea 21 program.
References
[1] D.A. Andow, D.M. Olson, R.L. Hellmich, D.N. Alstad, W.D. Hutchi-son, Frequency of resistance to Bacillus thuringiensis toxin Cry1Ab inan Iowa population of European corn borer (Lepidoptera: Crambi-dae), J. Econ. Entomol. 93 (2000) 26–30.
[2] J.H. Baek, J.I. Kim, D.W. Lee, B.K. Chung, T. Miyata, S.H. Lee, Iden-tiWcation and characterization of ace1-type acetylcholinesterase likelyassociated with organophosphate resistance in Plutella xylostella,Pestic. Biochem. Physiol. 81 (2005) 164–175.
[3] J.M. Clark, S.H. Lee, H.J. Kim, K.S. Yoon, A. Zhang, DNA-basedgenotyping techniques for the detection of point mutations associatedwith insecticide resistance in Colorado potato beetle Leptinotarsadecemlineata, Pest Manag. Sci. 57 (2001) 968–974.
[4] J.G. Hall, P.S. Eis, S.M. Law, L.P. Reynaldo, J.R. Prudent, D.J. Mar-shall, H.T. Allawi, A.L. Mast, J.E. Dahlberg, R.W. Kwiatkowski, M.de Arruda, B.P. Neri, V.I. Lyamichev, Sensitive detection of DNApolymorphisms by the serial invasive signal ampliWcation reaction,Proc. Natl. Acad. Sci. USA 97 (2000) 8272–8277.
[5] T. Hongyo, G.S. Buzard, R.J. Calvert, C.M. Weghorst, ‘Cold SSCP’: asimple, rapid and non-radioactive method for optimized single-strandconformation polymorphism analyses, Nucleic Acids Res. 21 (1993)3637–3642.
H. Kim et al. / Pesticide Biochemistry and Physiology 87 (2007) 54–61 61
[6] D.H. Kwon, J.M. Clark, S.H. Lee, Estimation of knockdown resis-tance in diamondback moth using real-time PASA, Pest. Biochem.Physiol. 78 (2004) 39–48.
[7] Q. Liu, E.C. Thorland, J.A. Heit, S.S. Sommer, Overlapping PCR forbidirectional PCR ampliWcation of speciWc alleles: a rapid one-tubemethod for simultaneously diVerentiating homozygotes and hetero-zygotes, Genome Res. 7 (1997) 389–398.
[8] D. Martinez-Torres, F. Chandre, M.S. Williamson, F. Darriet, J.B. Berge,A.L. Devonshire, P. Guillet, N. Pasteur, D. Pauron, Molecular character-ization of pyrethroid knockdown resistance (kdr) in the major malariavector Anopheles gambiae s.s, Insect Mol. Biol. 7 (1998) 179–184.
[9] M. Miyazaki, K. Ohyama, D.Y. Dunlap, F. Matsumura, Cloning andsequencing of the para-type sodium channel gene from susceptibleand kdr-resistant German cockroaches (Blattella germanica) andhouse Xy (Musca domestica), Mol. Gen. Genet. 252 (1996) 61–68.
[10] M.W. PfaZ, A new mathematical model for relative quantiWcation inreal-time RT-PCR, Nucleic Acids Res. 29 (2001) e45.
[11] H. Ranson, B. Jensen, J.M. Vulule, X. Wang, J. Hemingway, F.H. Col-lins, IdentiWcation of a point mutation in the voltage-gated sodiumchannel gene of Kenyan Anopheles gambiae associated with resistanceto DDT and pyrethroids, Insect Mol. Biol. 9 (2000) 491–497.
[12] F.D. Rinkevich, L. Zhang, R.L. Hamm, S.G. Brady, B.P. Lazzaro, J.G.Scott, Frequencies of the pyrethroid resistance alleles of Vssc1 andCYP6D1 in house Xies from the eastern United States, Insect Mol.Biol. 15 (2006) 157–167.
[13] T.J. Smith, S.H. Lee, P.J. Ingles, D.C. Knipple, D.M. Soderlund, TheL1014F point mutation in the house Xy Vssc1 sodium channel confersknockdown resistance to pyrethroids, Insect Biochem. Mol. Biol. 27(1997) 807–812.
[14] D.M. Soderlund, D.C. Knipple, The molecular biology of knockdownresistance to pyrethroid insecticides, Insect Biochem. Mol. Biol. 33(2003) 563–577.
[15] S.S. Sommer, J.D. Cassady, J.L. Sobell, C.D. Bottema, A novelmethod for detecting point mutations or polymorphisms and itsapplication to population screening for carriers of phenylketonuria,Mayo Clin. Proc. 64 (1989) 1361–1372.
[16] WHO, Instructions for determining the susceptibility or resistance ofmosquito larvae to insecticides. WHO/VBC 81.807 (1981).
[17] M.S. Williamson, D. Martinez-Torres, C.A. Hick, A.L. Devonshire,IdentiWcation of mutations in the houseXy para-type sodium channelgene associated with knockdown resistance (kdr) to pyrethroid insec-ticides, Mol. Gen. Genet. 252 (1996) 51–60.
