at SciVerse ScienceDirect

Plant Physiology and Biochemistry 70 (2013) 311e317

Contents lists available

Plant Physiology and Biochemistry

journal homepage: www.elsevier .com/locate/plaphy

Short communication

Gene expression and biochemical changes of carbohydratemetabolism in in vitro micro-propagated apple plantlets infectedby ‘Candidatus Phytoplasma mali’

Filomena Giorno a,*, Gea Guerriero a,1, Matteo Biagetti a, Anna Maria Ciccotti b, Sanja Baric a

a Laimburg Research Centre for Agriculture and Forestry, Laimburg 6 e Pfatten (Vadena), 39040 Auer (Ora), BZ, Italyb IASMA Research and Innovation Centre, Fondazione Edmund Mach, Via E. Mach 1, I-38010 San Michele all’Adige, TN, Italy

a r t i c l e i n f o

Article history:Received 5 May 2013Accepted 29 May 2013Available online 13 June 2013

Kewords:Malus x domesticaApple proliferationGene expressionCarbohydrate metabolismStress response

Abbreviations: APP, apple proliferation phytoplasmpathogenesis related; Hsp70, heat shock protein 70; qtranscriptase real-time PCR.* Corresponding author. Present address: Departm

ology, Radboud University Nijmegen, HeyendaalseweNetherlands.

E-mail addresses: mgiorno@science.ru.nl,(F. Giorno), guerrier@lippmann.lu (G. Guerriero),(M. Biagetti), annamaria.ciccotti@alice.it (A.M. Cicco(S. Baric).

1 Present address: Centre de Recherche Public, GabrL-4422 Belvaux, Luxembourg.

0981-9428/$ e see front matter � 2013 Elsevier Mashttp://dx.doi.org/10.1016/j.plaphy.2013.05.040

a b s t r a c t

‘Candidatus Phytoplasma mali’ (Ca. P. mali) is the disease agent causing apple proliferation (AP), which hasdetrimental effects on production in many apple growing areas of Central and Southern Europe. Thepresent study investigated transcriptional and biochemical changes related to the sugar metabolism aswell as expression of pathogenesis-related (PR) protein genes in in vitromicro-propagated AP-infected andhealthy control plantlets with the aim of shedding light on host plant response to ‘Ca. P. mali’ infection.Expression changes between infected and control plantlets were detected by quantitative real-time PCRanalysis. The most significant transcriptional changes were observed for genes coding for pathogenesis-related proteins and for heat shock protein 70, as well as for some genes related to the sugar meta-bolism, such as a sorbitol transporter (SOT5), hexokinase, sucrose-phosphate synthase or granule boundstarch synthase. Furthermore, biochemical analyses revealed that infected plantlets were characterized bya significant accumulation of starch and sucrose, while hexoses, such as glucose and fructose, and sorbitolwere present at lower concentrations. In summary, the present analysis provides an overview of a gene setthat is involved in response to phytoplasma infection and, therefore, it may help for a better understandingof the molecular mechanisms involved in phytoplasmaehost plant interaction in apple.

� 2013 Elsevier Masson SAS. All rights reserved.

1. Introduction

Phytoplasmas are plant pathogenic bacteria of the class Molli-cutes, characterized by obligate parasitism, reduced genomes,limited number ofmetabolic pathways and the absence of a cell wall[1]. Due to the impossibility to growphytoplasmas in axenic cultures,the molecular mechanisms of their pathogenicity and symptomstriggered in host plants are still poorly understood [1]. In plants,phytoplasmas are restricted to the nutrient-rich phloem tissue andtransmitted from plant to plant by sap-sucking insect vectors or

a; PS II, photosystem II; PR,RT-PCR, quantitative reverse

ent of Molecular Plant Physi-g 135, 6525 AJ Nijmegen, The

filomena.giorno@gmail.commatteobiagetti@hotmail.comtti), Sanja.Baric@provinz.bz.it

iel Lippmann 41, Rue du Brill

son SAS. All rights reserved.

through grafts [1]. Most typical symptoms of phytoplasma-induced disease are small and/or bronze reddish leaves, enlargedstipules, leaf-rosette formations, virescent flowers with abnormalnumber of petals, and decreased fruit quality [1]. At the tissue level,host plants show anatomical aberrations such as callose accumula-tion on the plates of sieve tubes and in some cases phloem tissueproliferation and necrosis [2]. Reduced stomatal conductance hasalso been reported togetherwith the inhibition of photosystem II (PSII) activity [3,4].

Molecular approaches mainly based on transcriptome analyseshave shown that gene expression changes are associated with awide array of symptoms observed in the diseased tissues [5e9].Considerable and tissue specific modulations were found for genesrelated to the cell wall metabolism, which aremost likely correlatedto the anatomical aberrations found on the plates of sieve tubes ininfected plants [2,6,10]. Jagoueix-Eveillard et al. [5] reported adown-regulation of a putative sterol-C-methyltransferase in peri-winkle after infection with stolbur phytoplasma and associated thisgene repression with leaf yellowing and stunting. Expressionchanges in genes related to developmental processes were alsofound in phytoplasma-infected plants and, correspondingly, ab-normalities in flower organs were shown [1]. An overall decrease in

F. Giorno et al. / Plant Physiology and Biochemistry 70 (2013) 311e317312

transcript abundance of genes coding for proteins involved in thephotosynthesis machinery was described in several investigations,suggesting a possible link to interferences with PS II activity [3,4,8].This inhibition may also have an impact on the carbohydratemetabolism, particularly on the accumulation of soluble carbohy-drates and starch, as observed in source leaves of plants infected byphytoplasmas [11e14]. Albertazzi et al. [6] and Hren et al. [8] haverecently found that specific genes such as vacuolar invertase andsucrose synthase were up-regulated in phytoplasma-infectedgrapevine leaves, which may be linked to the negative in-terferences with sucrose metabolism [11,12]. Beside the transcrip-tional changes strictly related to the primary and secondarymetabolism, other major alterations were found in the host tissuesand included the activation of defence genes such as the heat shockprotein 70 (Hsp70) and genes coding for pathogenesis-related (PR)proteins, which are downstream components of systemic acquiredresistance in plants [6,8].

Thus, the main objective of the present study was to investigatetranscriptional changes occurring in apple tissue after phytoplasmainfection, and to ascertain the hypothesis that biochemical changesrelated to carbohydrate metabolism may be associated to tran-scriptional modulations of specific gene classes in the diseasedtissue. To this end, the expression profiles were monitored inin vitromicro-propagated apple plantlets infected with ‘CandidatusPhytoplasma mali’ (‘Ca. P. mali’), the disease agent of apple prolif-eration (AP) that can have serious impact on the yield of manyapple cultivars [15,16]. Unravelling the transcriptional changesassociated with carbohydrate metabolism will undoubtedly be animportant step towards a better understanding of the molecular

Fig. 1. Expression analyses of PR and Hsp70 genes in vitro micro-propagated apple plantlets.and infected (APP-Infected) apple plantlets. The qRT-PCR analysis results were normalizedaverage relative expression levels of three biological replicates. Statistical differences were

mechanisms involved in phytoplasmaehost plant interaction and,in turn, may help to develop future strategies for the control ofdisease progression in apple.

2. Results

2.1. Analyses of gene expression changes of PR and Hsp70 genes

It was shown in previous studies that genes encoding for PRproteins and for Hsp70 were differentially expressed in responseto biotic stresses [6,8,9]. Therefore, members of the PR familyand the Hsp70 gene were identified in the apple genome andused as marker genes. PR-1a gene was slightly down-regulatedin infected plantlets with respect to the healthy controls, whileno transcriptional changes were observed for the TLP gene en-coding a thaumatin-like protein (Fig. 1). On the other hand, in-creased messenger RNA levels of PR-6, PR-8, MALD1 and Hsp70genes in infected plants compared to healthy samples werefound (Fig. 1).

2.2. Transcriptional changes in genes involved in carbohydratemetabolism and transport

Transcriptional changes of genes coding for sugar transportersand enzymes involved in carbohydrate metabolism were assessedby qRT-PCR. Increased messenger RNA levels in APP-infectedplantlets compared to controls were observed for sucrose-phos-phate synthase 1 (SPS1), hexokinase 2 (HXK2), granule bound starchsynthase Ia precursor (GBSSIa) and sorbitol transporter 5 (SOT5)

Transcript levels of PR and Hsp70 genes were analyzed by qRT-PCR in control (Healthy)using EF1 alpha, Tip-41 and IMPA9 as housekeeping genes. Each bar represents the

determined using Student’s t-test (*, P < 0.05).

Fig. 2. Expression analyses of genes involved in carbohydrate metabolism in in vitromicro-propagated apple plantlets. Transcript levels of tested genes were analyzed by qRT-PCR incontrol (Healthy) and infected (APP-Infected) apple plantlets. The qRT-PCR analysis results were normalized using EF1 alpha, Tip-41 and IMPA9 as housekeeping genes. Each barrepresents the average relative expression levels of three biological replicates. Statistical differences were determined using Student’s t-test (*, P < 0.05).

F. Giorno et al. / Plant Physiology and Biochemistry 70 (2013) 311e317 313

genes (Figs. 2 and 3). In contrast, SPS2F encoding the sucroseephosphate synthase 2F was the only gene with decreasedexpression levels in the APP-infected plantlets compared tohealthy ones. No considerable transcriptional changes wereobserved for the other genes related to carbohydrate metabolismand transport.

Fig. 3. Expression analyses of genes involved in carbohydrate transport in in vitro micro-procontrol (Healthy) and infected (APP-Infected) apple plantlets. The qRT-PCR analysis resultsrepresents the average relative expression levels of three biological replicates. Statistical di

2.3. Carbohydrate changes occurring in infected tissues

Imbalance in the carbohydrate metabolism has been shown inseveral crop plants infected by phytoplasmas [11,12]. Therefore, totest the hypothesis that transcriptional modulations related tosugar metabolism were also associated with alterations of the

pagated apple plantlets. Transcript levels of tested genes were analyzed by qRT-PCR inwere normalized using EF1 alpha, Tip-41 and IMPA9 as housekeeping genes. Each barfferences were determined using Student’s t-test a (*, P < 0.05).

F. Giorno et al. / Plant Physiology and Biochemistry 70 (2013) 311e317314

carbohydrate concentration, we analyzed soluble sugars andstarch content in healthy and infected in vitro micro-propagatedapple plantlets. Glucose, fructose and sorbitol contents weresignificantly lower in APP-infected samples than in healthy ones,while higher levels of sucrose and starch were observed in infectedtissue (Fig. 4).

3. Discussion

The molecular mechanisms involved in the interaction betweenphytoplasmas and host plants are so far largely unknown and onlyrecently some gene expression changes have been identified[2,6,8,10,17]. Using in vitro micro-propagated apple plantlets, wehave shown effects on gene expression and biochemical alterationsrelated to phytoplasma infection. Although the in vitro system doesnot allow to selectively analyze different tissues or to evaluate theseasonality of gene expression and/or biochemical changes, ourresults and those from previous investigations show that it repre-sents a useful system for a generalized assessment of transcrip-tional changes following phytoplasma infection [10].

Our analysis demonstrated that some genes coding for PR pro-teins were differentially expressed between healthy and infectedsamples. Apple trees inoculated with the pathogen Erwinia amylo-vora exhibited an induction of PR-2, PR-5 (thaumatin-like proteins)and PR-8 genes [18], while transcriptional changes of MhPR1, MhPR5and MhPR8 genes were reported in different organs of Malus hupe-hensis tissue culture seedlings after hormone treatment [19]. Landi &Romanazzi [9] have shown that b-1,3-glucanase (PR-2 family) andclass III chitinase (PR-8 family) were up-regulated in Bois noirphytoplasma-infected leaves of grapevine. Similarly towhat reportedin Vitis vinifera, an enhanced expression of some PR genes such as PR-6, PR-8 and MALDI was observed in phytoplasma-infected appleplantlets whereas other PR members were down-regulated (PR-1a)or did not show any significant transcriptional changes compared tothe healthy controls (PR-2 and TLP). Based on these results it may behypothesized that PR-6, PR-8 and MALD1 genes can be indicators ofthe defence response to ‘Ca. P. mali’ infection in apple plants. Inaddition, an increased expression of Hsp70 gene was observed in

Fig. 4. Carbohydrate content in in vitro micro-propagated apple plantlets. Glucose, fructoseplantlets. Each bar represents the average of three biological replicates. Statistical differenc

infected plantlets, as reported in other woody plants such as Prunusarmeniaca and grapevine upon phytoplasma infection [7,8]. Hsp70proteins are chaperones belonging to a quite highly conservedmulti-gene family whose members are expressed under different stresses[20]. Although the role of Hsp70 in plant pathogen response is notclear, it could be possible that Hsp70 chaperon activity is required tocope with phytoplasma infection.

In plants, soluble sugars constitute metabolic resources, struc-tural cell components and signalling molecules, regulating variousprocesses under normal and stress conditions, including defenceresponse to pathogen attacks [21]. An imbalance in carbohydratecontent was shown between source and sink tissues inphytoplasma-infected tobacco and coconut palm plants [11,12]. Itwas hypothesized that phytoplasmas can act as additional sink forphotosynthesized carbohydrates and, therefore, induce a block insugar transport from leaf source to sink tissues. Possible mecha-nisms involved in these metabolic changes are largely unknown.We herein explored at the gene expression level the assumptionthat ‘Ca. P. mali’ may also alter the expression of genes coding forenzymes involved in carbohydrate metabolism to meet their re-quirements for energy, growth and spread using the host plant’sphloem system. Sucrose is one of the main carbohydrates loadedinto the phloem tissue of apple plants [22,23]. It has been proposedthat this sugar can also act as a signalling molecule in plant im-munity, by functioning as an agent that induces “priming”, i.e. theprocess preparing the plant to a fast and strong defence response,without however triggering any response before the actual mani-festation of the stress condition [24]. In rice, sucrose supply to roottissues induces an up-regulation of PR genes, namely OsPR1a, 1band PR5 [25]. Therefore, the increase of sucrose content in theapple-plantlets may determine the activation of protective mech-anisms as the up-regulation of some of the PR genes found in thisstudy. The high demand of sucrose in the diseased tissue may bedependent on the different expression patterns found for the twosucrose-phosphate synthase isoforms, i.e. SPS1 and SPS2F. Bothisoforms belong to the SPS family which strictly regulates sucroseaccumulation in apple plants, particularly under stress conditions[26]. A situation in which genes involved in sucrose metabolism

, sucrose, sorbitol and starch levels were measured in healthy and APP-infected applees were determined using Student’s t-test (*, P < 0.05).

F. Giorno et al. / Plant Physiology and Biochemistry 70 (2013) 311e317 315

were differentially expressed under phytoplasma infectionwas alsofound in other plants [8,14].

In contrast to sucrose content, decreased levels of sorbitol wereobserved in infected apple plantlets as compared to healthy ones.Sorbitol comprises over 80% of the carbohydrate translocated in thephloem of apple, and thus is the main carbon source imported bysink tissues [23]. Specific sorbitol transporters (SOTs) are involvedin the sorbitol loading from the phloem [23]. Since SOT5 was theonly SOT gene highly induced in the infected tissues a role for thistransporter during the response to phytoplasma infection can beassumed.

Apart from their metabolic role, soluble sugars can act as sig-nalling molecules and, like hormones, control the expression ofdifferent genes [21]. It was observed that members of the hexoki-nase family are important components of this network [27].Therefore, the up-regulation ofHXK2 found in the infected plantletsmay suggest that a HXK-dependent sugar-signalling pathway couldbe active during phytoplasma infection in apple tissues.

A considerable increase of starch in micropropagated APP-infected apple plantlets was observed in this study, which iscongruent with the situation found in other plant species [11,12].Usually, starch consists of a mixture of two different components,amylose and amylopectin and environmental factors can affectstarch quality and quantity. For example, water deficit provoked areduction in starch synthesis in potato tubers, while amylose con-tent decreased in rice grains upon heat stress, but increased at lowtemperatures [28e30]. Amylose synthesis is mainly catalyzed byproteins belonging to the GBSS family [31]. In rice leaves, GBSSIexpression responds to exogenous stressors and its modulation af-fects grain quality [32]. Our results show an increase of GBSSIa

Table 1List of genes and primers.

Code Gene name Accession number

Pathogenesis-related protein genesPR-1a Pathogenesis-related protein 1a DQ318212PR-2 Pathogenesis-related protein 2 AM600693TLP Thaumatin-like protein EG631181PR-6 Pathogenesis-related protein 6 TC82874PR-8 Pathogenesis-related protein 8 DQ318214MALD1 Major allergen Mal d 1 AF124835Hsp70 Heat shock protein 70 CN890470Genes involved in carbohydrate metabolismBFRUCT3 Beta-fructosidase EB122193CWINV1 Cell wall invertase EB152734NINV1 Neutral invertase CV628130ADG1 ADP-glucose pyrophosphorylase GU983663NINV2 Neutral invertase EB122192SUS3 Sucrose synthase 3 EB122984SUS4 Sucrose synthase 4 CN918916GBSSIa Granule bound starch synthase Ia precursor EU586115SPP Sucrose-phosphate phosphatase AY509992SPS1 Sucrose-phosphate synthase 1 CV085786SPS2F Sucrose-phosphate synthase 2F EB123469GBSSIb Granule bound starch synthase Ib precursor EU586116HXK2 Hexokinase 2 CO904487APL2 ADP-glucose synthase CV630524SDH Sorbitol dehydrogenase AY053504Genes involved in carbohydrate transportSOT1 Sorbitol transporter AY237400SOT2 Sorbitol transporter AY237401SOT3 Sorbitol transporter AB125646SOT4 Sorbitol transporter AB125647SOT5 Sorbitol transporter AB125648SUT1 Sucrose transporter AY445915Reference genes for normalizationIMPA-9 Importin alpha isoform 9 CN909679Tip-41 Tip-41 like protein CN941833EF-1 alpha Elongation factor 1 alpha subunit AJ223969.1

expression in APP-infected apple plantlets, probably to partly sup-port the enhanced demand for starch synthesis under infection and,therefore, suggest a role of this gene in the response to biotic stress.

Overall, our results indicated that ‘Ca. P. mali’ is able to manip-ulate the carbohydrate metabolism in in vitro micro-propagatedapple plantlets and to induce specific changes in gene expression.These results will be useful for further studies targeting the hostplant response to phytoplasma infection and, in turn, may help for abetter understanding of the molecular mechanisms involved inphytoplasmaehost plant interaction in apple.

4. Material and methods

4.1. Plant material

Micropropagation of apple plants (cv. ‘Golden Delicious’) wasperformed as reported by Guerriero et al. [10]. Infection with sub-type AT-2/rpX-A of the in vitro plantlets was proven by the appli-cation of the procedure described by Baric et al. [15]. Samples for 3biological replicates, each corresponding to 10 pooled plantlets,were obtained from 30 homogenous in vitro apple plantlets after 30days of growing. Collected tissues were immediately frozen inliquid nitrogen and kept for long storage at �80 �C.

4.2. Gene selection

In silico analysis in the apple genome was performed in order toidentify putative gene sequences encoding for pathogenesis-related (PR) proteins, for the heat shock protein 70 (Hsp70) andfor enzymes/transporters involved in carbohydrate metabolism.

Forward primer Reverse primer

TGACGTGGGATGACAATGTAGCAC ACACACCTTTCCAGCAGCACACCATCGCTGTTGGATACGAAA CCCACTGTTGACGAGGAAGTGTCGATGATGAAGAGCCAAGTAGC AAGCGACCAGACCATGGAGATGGGCAATCGACTAGGATGTCATCTG ACAGGGATCTGGGTGACAATTCCTGAGTTGGGTGGTACGCAGTTC TGCATACTGGCATTGGGCTAGGAGCACAAGATCGACTCGGTTGAC CTTCTCTTTGCCAGCCATGACGATGTACCAAGGTGCTGGTGGTC ACGACCAAGATCACCAAACTTCC

TCAATGGCCAGTGGAGGAGATTG ATGCCAAAGGGTCCGAATGTGCAGGGTTCAGTGGAGAGTGACTCAG GGCCATTGCACCAACTGTTTCCTGCGATAGGAAGAGTTGCTCCTG ATCATGCAGCATCCATCAGCACTTGGGCTTCGGTCTTGCATAGC TGCTGCTTCTTGCACATTGTCGAATCACTGGCAGCGACCCAAAG GCCGCGCTTGCTTTCCAATAAACAGACTTACCAGCCTCCATGGTTCC ATGACGAGGTTTGCCAGATCCCTGAAGC GAACAG GCGAA GCT G GCCATTGGC ACT TCCATCAACAAGGGCATGACAAACCCGTGAAAGG TTTGTCAGTGGCCGGATTCCACAGGGAAGTTCACCCGTCAACAC GCTTGAAGTGGCCAATGGCTTGAGTGCAGGCACCAGGAAAGTTAC TCCAGCGAGAACCACCACTTTCTGGGCTTCCCTTTGTTGTGGAC AGTCTCCGGAGTTCCTTAACAGGAGAAGCCCTCCAAGCAGAAGTC TCGCTATTCCTCGGGCTTTGTCAAAGGTTGTTGTGGCGGTCTGC TGT GCTCAGCAACTTCGTCACCAGACGCTGGGAAGAGATGGTTC ATCTGATGCCCGGCTTTCATCCTGACGTGAAGCCGCTTATCACAC CCA AACAGTGGAACGGAACTTGC

TTAAGGGTGATTCCGCCCACTG AACGACAGTCCGACCAACAAACTTGACTAGCGTGGCTGGA ATGG ACTCCCATACTACACCCTTGCGACGGTGAAGGCGTATGGAAAGAAC TTGGTGAATCCAACGGCAACGGAGGCAAGTTGCTCGTGGTGATG TCCGCTGTCTGCCATACCAATGTGGCGACGGTATCACTAACAACG TCGATTGCCCTCTCCTTCTTTGGCGAATCGAGTCTTTGGGACTTGGC GGTGCAGCAGAACGTGGAATTG

TCGTGAACTCAGGCGCTTACTG AAGCAACGGTAAAGCGGGCAACACATGCCGGAGATGGTGT TTGG ACTTCCAGAGTACGGCGTTGTGACTGTTCCTGTTGGACGTGTTG TGGAGTTGGAAGCAACGTACCC

F. Giorno et al. / Plant Physiology and Biochemistry 70 (2013) 311e317316

These sequences were selected on the basis of high sequence ho-mology shared with genes previously shown to be differentiallyexpressed in response to phytoplasma infection in plants [6e8].Homologous sequences were found by performing BLAST searchesin the apple genome database (http://www.rosaceae.org/). The listof selected genes is reported in Table 1.

4.3. RNA extraction, cDNA synthesis and real-time PCR analyses

Total RNA isolation, reverse transcription, primer design, qRT-PCR data normalization and analyses were performed asdescribed by Giorno et al. [33]. Table 1 lists the primer pair setsused for qRT-PCR analyses. The genes encoding for elongationfactor 1 alpha subunit (EF-1 alpha; accession number AJ223969.1),importin alpha isoform 9 (IMPA-9; accession number CN909679)and Tip-41 like protein (Tip-41; accession number CN941833) wereused as references in the qRT-PCR analyses. The results presented inthe figures are averaged data from three independent biologicalreplicates, each with two technical replications. Statistical differ-ences were determined using Student’s t-test as implemented inSPSS version 18 (SPSS, Inc.) after performing KolmogoroveSmirnovtest, which confirmed normal distribution of the data.

4.4. Soluble carbohydrate, starch analyses and analytic methods

Soluble carbohydrates were extracted from 1 g of frozen ho-mogenized tissue of healthy and infected in vitro apple plantletsamples. Extraction was performed by using 80% EtOH (vol/vol) at78 �C and by shaking the samples at 1400 rpm for 30 min. Aftercentrifugation of the extracts, the supernatant was decanted andthe pellet re-extracted. The resulting organic phases were collectedand stored at �80 �C until analysis. To assess soluble carbohydrate,samples were diluted to 100 ml with deionised water, stabilizedwith 20 mg/L sodium azide to prevent microbial growth andfiltered by using a 0.22 mm PTFE membrane. Tissue starch contentwas determined by suspending the insoluble fraction from the 80%ethanol extraction with 0.25 ml of 10 N KOH. Samples were incu-bated at 95 �C for 5 min, then cooled and neutralised with 0.25 mlof 10 N H3PO4. The gelatinized samples were suspended with 1 ml0.05 M sodium acetate buffer (pH 5) and 0.5 ml of a digestion so-lution (7 mg of amyloglucosidase and 160 mg of a-amylase in100 ml of 0.05 M sodium acetate buffer, pH 5). The resultingmixture was incubated at 50 �C and shaken at 1000 rpm for 48 h.Enzymatic reaction was stopped by adding 1 ml of 0.1 M KOH anddiluted to 100ml with deionised water, stabilized with 0.1% sodiumazide and filtered by using 0.22 mm PTFE membrane. Analyticmeasurement of soluble carbohydrate and starch content wasperformed by using HPLC with DIONEXCarboPac PA20 3� 150 mmcolumns. Sugar contents represented in Fig. 4 were from the samebiological samples used for gene expression analyses and data areexpressed as mg per g of fresh weight (gFW). Statistical differenceswere determined using Student’s t-test as implemented in SPSSversion 18 (SPSS, Inc.) after performing KolmogoroveSmirnov test,which confirmed normal distribution of the data.

Acknowledgements

Christine Kerschbamer is acknowledged for the technicalassistance and Alberto Storti for his kind support during thisresearch. This work was partially funded by the AutonomousProvince of Bozen/Bolzano, Italy (Departments 31 and 33). TheSouth Tyrolean Fruit Growers’ Co-operatives, in particularly VOGand VIP, are acknowledged for co-financing the Strategic Project onApple Proliferation e APPL.

References

[1] A. Sugio, A.M. MacLean, H.N. Kingdom, V.M. Grieve, R. Manimekalai,S.A. Hogenhout, Diverse targets of phytoplasma effectors: from plant develop-ment to defense against insects, Annu. Rev. Phytopathol 49 (2011) 175e195.

[2] R. Musetti, A. Paolacci, M. Ciaffi, O.A. Tanzarella, R. Polizzotto, F. Tubaro,M. Mizzau, P. Ermacora, M. Badiani, R. Osler, Phloem cytochemical modifica-tion and gene expression following the recovery of apple plants from appleproliferation disease, Phytopathology 4 (2010) 390e399.

[3] J.A. Matteoni, W.A. Sinclair, Stomatal closure in plants infected with myco-plasma like organisms, Phytopathology 73 (1983) 398e402.

[4] R. Leon, J.M. Santamaria, L. Alpizar, J.A. Escamilla, C. Oropeza, Physiologicaland biochemical changes in shoots of coconut palms affected by lethal yel-lowing, New Phytol. 134 (1996) 227e234.

[5] S. Jagoueix-Eveillard, F. Tarendeau, K. Guolter, J.L. Danet, J.M. Bové, M. Garnier,Catharanthus roseus genes regulated differentially by mollicute infections,Mol. Plant Microbe Interact. 14 (2001) 225e233.

[6] G. Albertazzi, A. Caffagni, J.A. Milc, E. Francia, E. Roncaglia, F. Ferrari,E. Tagliafico, E. Stefani, N. Secchioni, Gene expression in grapevine cultivars inresponse to Bois Noir phytoplasma infection, Plant Sci. 176 (2009) 792e804.

[7] V. Carginale, G. Maria, C. Capasso, E. Ionata, F. La Cara, M. Pastore, A. Bertaccini,A. Capasso, Identification of genes expressed in response to phytoplasmainfection in leaves of Prunus armeniaca by messenger RNA differential display,Gene 332 (2004) 29e34.

[8] M. Hren, P. Nikoli�c, A. Rotter, A. Blejec, N. Terrier, M. Ravnikar, M. Dermastia,K. Gruden, ’Bois noir’ phytoplasma induces significant reprogramming of theleaf transcriptome in the field grown grapevine, BMC Genomics 10 (2009) 460.

[9] L. Landi, G. Romanazzi, Seasonal variation of defense-related gene expressionin leaves from Bois noir affected and recovered grapevines, J. Agric. FoodChem. 59 (2011) 6628e6637.

[10] G. Guerriero, F. Giorno, A.M. Ciccotti, S. Schmidt, S. Baric, A gene expressionanalysis of cell wall biosynthetic genes in Malus x domestica infected by‘Candidatus Phytoplasma mali’, Tree Physiol. 32 (2012) 1365e1377.

[11] P. Lepka, M. Stitt, E. Moll, E. Seemüller, Effect of phytoplasmal infection onconcentration and translocation of carbohydrates and amino acids in peri-winkle and tobacco, Physiol. Mol. Plant Pathol. 55 (1999) 59e68.

[12] B.E. Maust, F. Espadas, C. Talavera, M. Aguilar, J.M. Santamaría, C. Oropeza,Changes in carbohydrate metabolism in coconut palms infected with the le-thal yellowing phytoplasma, Phytopathology 93 (2003) 976e981.

[13] X. Ji, Y. Gai, C. Zheng, Z. Mu, Comparative proteomic analysis provides newinsights into mulberry dwarf responses in mulberry (Morus alba L.), Prote-omics 9 (2009) 5328e5339.

[14] J. Machenaud, H. Raphaël, M. Dieuaide-Noubhani, P. Pracros, J. Renaudin,S. Eveillard, Gene expression and enzymatic activity of invertases and sucrosesynthase in Spiroplasma citri or stolbur phytoplasma infected plants,B. Insectol 60 (2007) 219e220.

[15] S. Baric, J. Berger, C. Cainelli, C. Kerschbamer, J. Dalla Via, Molecular typing of‘Candidatus Phytoplasma mali’ and epidemic history tracing by a combined T-RFLP/VNTR analysis approach, Eur. J. Plant Pathol. 131 (2011) 573e584.

[16] D. Rekab, G. Pirajno, E. Cettul, F.R. De Salvador, G. Firrao, On the apple pro-liferation symptom display and the canopy colonization pattern of ‘CandidatusPhytoplasma mali’ in apple trees, Eur. J. Plant Pathol. 127 (2010) 7e12.

[17] S. Santi, S. Grisan, A. Pierasco, F. De Marco, R. Musetti, Laser microdissection ofgrapevine leaf phloem infected by stolbur reveals site-specific gene responsesassociated to sucrose transport and metabolism, Plant Cell Environ. 36 (2013)343e355.

[18] J.M. Bonasera, J.F. Kim, S.V. Beer, PR genes of apple: identification andexpression in response to elicitors and inoculation with Erwinia amylovora,BMC Plant Biol. 6 (2006) 23.

[19] J. Zhang, X. Du, Q. Wang, X. Chen, D. Lv, K. Xu, S. Qu, Z. Zhang, Expression ofpathogenesis related genes in response to salicylic acid, methyl jasmonateand 1-aminocyclopropane-1-carboxylic acid in Malus hupehensis (Pamp.)Rehd, BMC Res. Notes 3 (2010) 208.

[20] W. Wang, B. Vinocur, O. Shoseyov, A. Altman, Role of plant heat-shock pro-teins and molecular chaperones in the abiotic stress response, Trends PlantSci. 9 (2004) 244e252.

[21] M. Rosa, C. Prado, G. Podazza, R. Interdonato, J.A. González, M. Hilal, F.E. Prado,Soluble sugarsdmetabolism, sensing and abiotic stress: a complex network inthe life of plants, Plant Signaling Behav. 4 (2009) 388e393.

[22] F. Rolland, E. Baena-Gonzalez, J. Sheen, Sugar sensing and signaling in plants:conserved and novel mechanisms, Annu. Rev. Plant Biol. 57 (2006) 675e709.

[23] M. Li, F. Feng, L. Cheng, Expression patterns of genes involved in sugarmetabolism and accumulation during apple fruit development, PLoS One 7(2012) e33055.

[24] M.R. Bolouri Moghaddam, W. Van den Ende, Sugars and plant innate immu-nity, J. Exp. Bot. 63 (2012) 3989e3998.

[25] J. Gómez-Ariza, S. Campo, M. Rufat, M. Estopà, J. Messeguer, B. San Segundo,M. Coca, Sucrose-mediated priming of plant defense responses and broad-spectrum disease resistance by overexpression of the maize pathogenesis-related PRms protein in rice plants, Mol. Plant Microbe Interact 20 (2007)832e842.

[26] T.H. Li, S.H. Li, Leaf responses of micropropagated apple plants to water stress:nonstructural carbohydrate composition and regulatory role of metabolicenzymes, Tree Physiol. 25 (2005) 495e504.

F. Giorno et al. / Plant Physiology and Biochemistry 70 (2013) 311e317 317

[27] J.C. Jang, P. Leon, L. Zhou, J. Sheen, Hexokinase as a sugar sensor in higherplants, Plant Cell 9 (1997) 5e19.

[28] J. Cheng, M.A. Khan, W.M. Qiu, J. Li, H. Zhou, Q. Zhang, W. Guo, T. Zhu, J. Peng,F. Sun, S. Li, S.S. Korban, Y. Han, Diversification of genes encoding granule-bound starch synthase in monocots and dicots is marked by multiplegenome-wide duplication events, PLoS One 7 (2012) e30088.

[29] P. Geigenberger, B. Muller-Rober, M. Stitt, Contribution of adenosine 5’-diphosphoglucose pyrophosphorylase to the control of starch synthesis isdecreased by water stress in growing potato tubers, Planta 209 (1999) 338e345.

[30] M. Asaoka, O. Kazutoshi, H. Fuwa, Effect of environmental temperature at themilky stage on amylose content and fine structure of amylopectin of waxy and

nonwaxy endosperm starches of rice (Oryza sativa L.), Agric. Biol. Chem. 49(1985) 373e379.

[31] H.Y. Hirano, Y. Sano, Enhancement of Wx gene expression and the accumu-lation of amylose in response to cool temperatures during seed developmentin rice, Plant Cell Physiol. 39 (1998) 807e812.

[32] S.J. Wang, L.F. Liu, C.K. Chen, L.W. Chen, Regulations of granule-bound starchsynthase I gene expression in rice leaves by temperature and drought stress,Biol. Plant. 50 (2006) 537e541.

[33] F. Giorno, G. Guerriero, S. Baric, C. Mariani, Heat shock transcriptional factorsin Malus domestica: identification, classification and expression analysis, BMCGenomics 13 (2012) 639.