Differential Expression of the At1g17950 gene in Diploid and Tetraploid Arabidopsis
thaliana
Biology 404
Professor Andreas Madlung
Daniel Akamine and CB Wolf
Abstract
The At1g17950 gene in Arabidopsis thaliana is a transcriptional factor that mediates the production of abscisic acid, a hormone responsible for salt stress mitigation. Previous studies have shown mutant A. thaliana with overexpressed At1g17950 have exceptionally low resistance to salt stress relative to diploid specimen. In our study, we chose to observe the expression of this gene in both diploid and tetraploid A. thaliana. What we found is that At1g17950 is expressed more in diploid specimen than in their tetraploid counterparts, who are also more salt resistant. From this data, we can hypothesize that expression of the At1g17950 gene is homologous with weakness to excess environmental salt.
Introduction
The study of genetics and molecular biology are based in understanding the expression of
genes and how they are regulated. In this sense, the actual functions of study genes and the
relative significance of study organisms can be secondary to what they teach us about processes
that guide their metabolic pathways. In this light, a plant called Arabidopsis thaliana has come to
the forefront of genetics. Although A. thaliana is a small, agriculturally insignificant weed, its
small genomic size of about 135mbp (www.arabidopsis.org) allowed it to be the first plant to
have its genome completely sequenced (Arabidopsis Genome Initiative, 2000). This makes A.
thaliana a prime study organism for differential expression across ploidy levels, which is what
we set out to observe for this project.
Exposure to varying levels of salinity confers differential expression in metabolic
processes in A. thaliana (Park 2011). We used microarray analysis of two specimen, one diploid
individual and one tetraploid individual, in order to determine which genes are the most
differentially expressed when both organisms were stressed by excess environmental salt. From a
list of multiple genes (See table 1), we chose At1g17950, a transcription factor from the MYB
family. MYB family proteins are transcriptional factors expressed in the nucleus (Voinnet 2003)
1
that aid in Abscisic Acid production (Abe 2003). Abscisic Acid is partially responsible for
metabolic response to salt stress (Shi 2002). Genes related to At1g17950 have been studied in the
context of downstream regulation of cell wall synthesis (Zhong 2008).
Previous studies in A. thaliana have shown that diploid plants are less resistant to salt
stress than their polyploidy counterparts, and that At1g17950 is also more expressed in diploids
than tetraploids (Chao 2013). This same study showed that mutant individuals who had multiple
copies At1g17950 gene artificially inserted and overexpressed were even less resistant than the
diploid test group. In this sense, we can hypothesize that the At1g17950 activity is a proxy for
salt sensitivity. Our hypothesis states that, because tetraploids are better at managing salt stress,
they should have reduced At1g17950 expression relative to diploid individuals.
Materials and Methods
First, RNA was extracted from both diploid and tetraploid A. thaliana using a Qiagen
RNeasy kit. We used an original mass of 100mg of both diploid and tetraploid tissues. The RNA
was then assessed in terms of quality and quantity through gel electrophoresis and
spectrophotometry. Next, we used a Genishphere Array 900 kit in order to transcribe cDNA
from our the RNA. cDNA from tetraploid and diploid specimens were labeled with Cy5 (red)
and Cy3 (green) dyes respectively and hybridized to a 70-mer spotted oligonucleotide glass
microarray chip. After hybridization, we washed our slides in order to remove excess dye that
had not bound to our the chip. We conducted a total of two washes: one that was stringent in
terms of temperature (42°C), and another that was stringent in terms of salt concentration
(0.2xSSC). We analyzed our results of the microarray using thein computer programs Genepix
pro and Acuity. Table 1 shows a list of the most differentially expressed genes, as well as their
functions. We chose the At1g17950 gene to focus on for the remainder of our study.
Next, we conducted a quantitative PCR analysis on our the gene of interest in order to
evaluate validate differential gene expression found via array analysis. This involved designing
forward and reverse primers on the webpage http://bioinfo.ut.ee/primer3, and synthesizing
cDNA from the RNA we extracted earlier. Primer constitution can be seen below (Table 2).
Forward Primer
5’ CGTCGAACAATTTGGTCCTCA 3’
2
Reverse Primer
5’ TCCCATGGATCCGATGAGAC 3’
We then ran three different PCR reactions. The first was to optimize the annealing
temperature. Our experimental temperature ranged from 57-64°C, and we found that the most
efficient annealing temperature was 61°C, which then became the temperature that we used
for all consecutive iterations. The second PCR reaction was to calculate the efficiency of the
primer pair with a standard curve, and the third to run the experimental cDNA using diploid and
tetraploid samples. Third analysis was used to determine whether diploid or tetraploid had a
greater expression of At1g17950 the target gene and was normalized to PP2 reference gene
(Table 2). We conducted our analysis using a Bio-Rad CFX 96 quantitative PCR machine and its
associated software.
Results
RNA Extraction and Microarray Analysis:
Our electrophoresis and spectrophotometry results showed that the extracted diploid
RNA had a concentration of 0.575 µg/µl and a 260/280 ratio of 2.10, and the extracted tetraploid
RNA had a concentration of 0.568 and and 260/280 ratio of 2.08. RNA analysis by agarose gel
electrophoresis showed crisp 28S and 18S rRNA bands signifying high quality of extracted
tetraploid and diploid RNA (Fig. 1). Microarray analysis of diploid and tetraploid RNA provided
us with 10 most differentially expressed genes that were upregulated and 10 most differentially
expressed genes that were downregulated. The gene At1g17950 was selected as the gene of
interest was selected as and it was significantly expressed in the diploid by -7.48 fold (p ≤ 0.005;
Table 1).
qPCR Analysis and At1g17950 gene expression:
Optimal aAnnealing temperature was determined to be at 61°C, as reactions at this
temperature resulted in the lowest Cq showing single melt peak curves for all three duplicates
(Fig. 2 & Fig. 4). The qPCR standard curve analysis calculated the primer efficiency to be
93.6%, indicating that the amplicon copy number increased 1.93 folds at the end of each cycle.
The correlation coefficient of qPCR standard curve was 0.949, demonstrating that each primer
3
had similar efficiency (Fig. 3). The relative quantification of the At1g17950 gene verified a
3.796 folds higher expression in diploids (4.79±3.37(SE)) in contrast to tetraploids
(1.0±0.67(SE); Fig. 5).
Discussion
The expression of the At1g17950 gene produced the MYB52 transcription factor.
MYB52 is a downstream regulator for CesA8 a gene involved in secondary cell wall biogenesis
and the RD29B gene involved in abscisic acid response (Abe et al., 2003). Past studies have
shown that the over expression of the At1g17950 gene in mutants increased mutants tolerance to
drought and salt stress versus wild type A. thaliana, through inhibiting cell wall expansion,
which emphasized the role of MYB52 in regulating the stress response of A. thaliana (Park et al.,
2011). In this study, we showed that diploid A. thaliana had a higher expression of the
At1g17950 gene than the tetraploid A. thaliana, which indicated that tetraploids showed a lower
stress response to salt sensitivity than diploids (Fig. 5). This evidence demonstrated that
tetraploid and diploid A. thaliana plants have different transcriptional activity and gene
expressions (Fig. 5).
Other studies have shown that polyploids have a higher tolerance and resistance to salt.
One study cultivated diploid and tetraploids A. thaliana in nutrient media treated with
supplementary NaCl. The study revealed that tetraploids had a higher salt tolerance due to
increased levels of potassium and decreased levels of sodium that accumulated in leaves. In
addition, the study showed that the reproductive success and fitness was higher in tetraploids
than diploids because tetraploids produced more seeds under an elevated salinity treatment than
diploids (Chao et al., 2013). While this study did not show the molecular basis of their findings,
this evidence supports our findings because it signified how tetraploids have a higher resistance
and altered physiological response to salt stress in contrast to diploids.
Another study conducted a genome-wide transcriptomic analysis of diploid and tetraploid
A. thaliana plants exposed to salt and drought stress. The study found a variety of expressed
genes that were significantly upregulated and downregulated in diploids in contrast to
tetraploids. The study verified that diploids significantly expressed MYB family member genes,
such as MYB77 involved in the auxin signal transduction, in response to drought and salinity
4
stress. The study used an enriched gene ontology analysis (GO) and the analysis revealed that
genes involved in cell wall loosening and modification were downregulated in tetraploids
exposed to salt stress. Unfortunately, the study did not recognize the significant expression of our
At1g17950 target gene in tetraploids and diploids (Del pozo and Ramirez-Parra, 2014).
However, it reassured our findings because it indicated that our gene of interest, which is part of
MYB family genes were significantly expressed in diploids and downregulated in tetraploids
when exposed to salt stress. The findings of this study supported our results because it showed
that tetraploids were less sensitive to salt stress because of the decreased expression of MYB
family genes and diploids were more sensitive to stress because of increased expression of MYB
family genes (Del pozo and Ramirez-Parra, 2014).
It can be speculated that differences in gene expression of MYB52 in diploids and
tetraploids result in variations in the regulation and gene expression of CesA8 involved in
secondary cell wall biosynthesis. This suggests that secondary cell wall biosynthesis plays an
important role in responding to salt stress. Secondary cell wall biosynthesis is important in
building strong xylem ducts for water transport and regulating salt and mineral transport
throughout the plant. One study found that the MYB52 gene in diploid plants lead to a
significant reduction in the secondary cell wall fibers (Zhong et al., 2008). Another study linked
MYB family genes with the transcriptional regulation of activating, differentiating xylem and
phloem cells as well as the lignifications of vascular tissue (Zhao et al., 2005). This indicated
that MYB family genes alter the lignin content of secondary cell wall in xylem in order to
change its permeability and rigidity when diploid and tetraploid A. thaliana are exposed to salt
stress. Secondary cell walls have higher lignin content than primary cell wall, which provides
structure and the decreased permeability of secondary cell walls (Zhou et al., 2009).
Thus, a future study would be to knockout the MYB52 gene in diploid and tetraploids
plants and expose knockout mutants to salt stress. This would be conducted to see if knockout
mutants had varying expressions of CesA8 gene, higher salt tolerance and experienced no
physiological changes in the secondary cell wall fibers and lignin content, in contrast to wild-
type diploid and natural tetraploid A. thaliana.
5
Literature Cited
Abe, H., Urao, T., Ito, T., Seki, M., Shinozaki, K., & Yamaguchi-Shinozaki, K. (2003). Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB) function as transcriptional activators in abscisic acid signaling. The Plant Cell, 15(1): 63-78.
Arabidopsis Genome Initiative. (2000). Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature, 408 (6814): 796.
http://www.arabidopsis.org/portals/genAnnotation/gene_structural_annotation/agicomplete.jsp
Chao, D.Y, Dilkes, B., Luo, H., Douglas, A., Yakubova, E., Lahner, B., & Salt, D.E.(2013) Polyploids Exhibit Higher Potassium Uptake and Salinity Tolerance in Arabidopsis.Science, 341:658–659. doi: 10.1126/science.1240561
Park, M. Y., Kang, J. Y., & Kim, S. Y. (2011). Overexpression of AtMYB52 confers ABA hypersensitivity and drought tolerance. Molecules and cells, 31(5): 447-454.
Del pozo, J.C., & Ramirez-Para, E. (2014). Deciphering the molecular bases for drought tolerance in Arabidopsis autotetraploids. Plant, Cell & Environment, 37(12): 2722-2737.
Shi, H., Xiong, L., Stevenson, B., Lu, T., & Zhu, J. K. (2002). The Arabidopsis salt overly sensitive 4 mutants uncover a critical role for vitamin B6 in plant salt tolerance. The Cell, 14(3): 575-588.
Voinnet, O., Rivas, S., Mestre, P., & Baulcombe, D. (2003). An enhanced transient expression system in plants based on suppression of gene silencing by the p19 protein of tomato bushy stunt virus. The Plant Journal, 33(5): 949-956.
Zhao, C., Craig, J.C., Petzold, E., Dickerman, A.W., & Beers, E.P. (2005). The xylem and phloem transcriptomes from secondary tissues of the Arabidopsis root-hypocotyl. Plant Physiology, 138: 803-818.
Zhong, R., Lee, C., Zhou, J., McCarthy, R.L., and Ye, Z.H. (2008). A battery of transcriptionfactors involved in the regulation of secondary cell wall biosynthesis in Arabidopsis. Plant Cell, 20: 2763-2782.
Zhou, J., Lee, C., Zhong, R., & Ye, Z.H. (2009). MYB58 and MYB63 are transcriptional activators of the lignin biosynthetic pathway during secondary cell wall formation in Arabidopsis. Plant Cell, 21(1): 248-266.
6
Tables and Figures
Figure 1. RNA analysis for quality by agarose gel electrophoresis. A. thaliana diploid and tetraploid RNA was extracted with Qiagen RNeasy kit. Ladders loaded in lanes 1 and 2, tetraploid RNA loaded in lanes 3 and 5 and diploid RNA loaded in lanes 4 and 6. Quality was assessed based on crisp 28S and 18S rRNA bands.
7
Figure 2. Melt peak analysis verifying detecting presence of non-specific amplification products and optimal annealing temperature. Optimal annealing temperature 61°C was determined by choosing reaction temperature with lowest Cq (threshold cycle) value and single melt peak of three duplicates. The presence of a moderate single-peak and absence of a non-template control (NTC) melt peak demonstrates absence of non-specific amplification products, such as a primer dimer
8
Figure 3. qPCR standard curve representing 93.6% primer efficiency. y-axis shows quantification cycle (Cq) and x-axis show starting quantity of RNA. A 2-fold dilution series of the highest and lowest dilution concentrations of RNA template with forward and reverse primers were analyzed with qPCR to gauge performance and precision of primers. Primer efficiency reflects the amplicon copy number increased 1.93 fold with each cycle. Correlation coefficient 0.949 reflects linear precision and similar efficiency of both primers.
9
Figure 4. qPCR Amplification plot with ten-fold dilution series. Ten-fold dilution series of diploid and triploid cDNA amplified by SYBR Green supermix qPCR on Bio-Rad CFX quantitative PCR machine. Lowest threshold value (Cq) used to determine optimal annealing temperature 61 °C and determine efficiency of primers through perfect doubling of qPCR products within each cycle. Higher Cq values represent lower efficiency and lower concentrations of qPCR products.
10
Figure 5. Expression analysis of At1g17950 target gene expression in diploid and tetraploid A. thaliana. Diploid and tetraploid plants experienced salt stress and treated with NaCl (100 mM) for two weeks. Expression of At1g17950 gene was determined by qPCR and normalized to PP2 reference gene using BioRad CFX Manager software. Reactions were carried out in triplicates and values are means with standard error (s.e.m.). Confirmed At1g17950 gene expression was 3.796 folds higher in diploids (4.79±3.37(SE)) as opposed to tetraploids (1.0±0.67(SE)) indicating diploids were more sensitive to salt stress because At1g17950 gene was expressed to a greater extent in diploid A. thaliana
Table 1. ID and function of differentially expressed genes.
Gene ID Fold Changes*
Function
At3g03230 -4.543 esterase/lipase/thioesterase family protein contains Interpro entry IPR000379At2g23110 -4.553 expressed proteinAt1g49250 -4.723 ATP dependent DNA ligase family protein contains Pfam profile: PF01068 ATP dependent DNA ligase
domainAt5g43580 -4.925 protease inhibitor, putative similar to SP|P19873 Inhibitor of trypsin and hageman factor (CMTI-V)
{Cucurbita maxima}; contains Pfam profile PF00280: Potato inhibitor I familyAt1g33980 -5.227 Smg-4/UPF3 family protein contains Pfam PF03467: Smg-4/UPF3 family; similar to hUPF3B (GI:12232324)
[Homo sapiens]At1g10190 -5.72 expressed protein similar to hypothetical protein GB:CAB10284 contains Pfam profile PF03080:
Arabidopsis proteins of unknown functionAt1g21670 -6.693 expressed protein similar to TolB protein precursor (SP:P50601) {Pseudomonas aeruginosa}At1g17950 -7.486 myb family transcription factor (MYB52) similar to myb-like protein GI:6979341 from [Oryza sativa]At5g54510 -7.833 auxin-responsive GH3 protein, putative (DFL-1) identical to auxin-responsive GH3 homologue [Arabidopsis
thaliana] GI:11041726; similar to auxin-responsive GH3 product [Glycine max] GI:18591; contains Pfam
11
profile PF03321: GH3 auxin-responsive promoterAt5g47920 -7.845 expressed protein similar to unknown protein (emb|CAB67623.1)
*Note: Fold change is determined by the Cy3:Cy5 ratio detected during microarray analysis.A negative value indicates that the gene in question was more highly expressed in diploid tissues and least expressed in tetraploid tissue.
Table 2. Forward and reverse primers for At1g17950 gene of interest and reference gene.
Primer Sequence
F_At1g_17950 CGTCGAACAATTTGGTCCTCA
R_At1g_17950 TCCCATGGATCCGATGAGAC
F_AT1G13320 (reference Gene) GGA AAG CAG CGT AAT CGG
R_AT1G13320 (reference Gene) CTC GTC GAT AAG CAC AGC
12