GENE MAPPING 3

GENE MAPPING - 3

By A.Arputha Selvaraj

© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458


Contents

Genetic mapping: Virtual or relational mapping

Physical mapping: systematic analysis Chromosome walking: find a gene on

chromosome Determining DNA sequences: quick revision New techniques for mapping and sequencing


Why map before sequencing?

Major problem in large-scale sequencing: Current technologies can only sequence 600–800 bases

at a time. We need to sequence 30 billion bp in order to perfectly sequence human genome

One solution: make a physical map of overlapping DNA fragments: Top-Down approach Chromosomal libraries: 46 chromosomes/23 pairs Genomic library for many fragments from each

chromosome Determine sequence of each fragment Then assemble to form contiguous sequence


Map-less sequencing: Bottoms up Celera approach

Alternative solution: fragment entire genome Sequence each fragment Assemble overlapping sequences to form

contiguous sequence Focus here on principles and techniques of

mapping and sequencing of the genomes

© 2005 Prentice Hall Inc. / A Pearson Education Company / Upper Saddle River, New Jersey 07458Figure 3.15 Genomes 3 (© Garland Science 2007)

Mitosis

Chromatids


Meiosis


From:


From:



Mapping I

Mapping is identifying relationships between genes on chromosomes Just as a road map

shows relationships between towns on highway: fine maps

Two types of mapping: genetic and physical


Mapping II

Genetic mapping Based on differences in recombination

frequency between genetic loci: meiosis Physical mapping

Based on actual distances in base pairs between specific sequences found on the chromosome

Most powerful when genetic and physical mapping are combined


Genetic mapping I

Based on recombination frequencies The further away two points are on a

chromosome, the more recombination there is between them

Because recombination frequencies vary along a chromosome, we can obtain a relative position for the loci

Distance between the markers


Genetic mapping II

Genetic mapping requires that a cross be performed between two related organisms The organism should have phenotypic

differences (contrasting characters like red and white or tall and short etc) resulting from allele differences at two or more loci

The frequency of recombination is determined by counting the F2 progeny with each phenotype


Genetic mapping example I

Genes on two different chromosomes Independent

assortment during meiosis (Mendel)

No linkage Dihybrid ratio

F1

9 : 3 : 3 : 1

F2

P


Genetic mapping example II

Genes very close together on same chromosome Will usually end up

together after meiosis Tightly linked

F1

1 : 2 : 1

F2

P


Genetic mapping example III

Genes on same chromosome, but not very close together Recombination will

occur Frequency of

recombination proportional to distance between genes

Measured in centiMorgans =cM

RecombinantsNon-parental features

One map unit = one centimorgan (cM) = 1% recombination between loci


cM or centimorgan

1% Recombination = 1 cM


Genetic markers

Genetic mapping between positions on chromosomes Positions can be genes

Responsible for phenotype Examples: eye color or disease trait: limited

Positions can be physical markers DNA sequence variation


Physical markers

Physical markers are DNA sequences that vary between two related genomes

Referred to as a DNA polymorphism Usually not in a gene

Examples RFLP SSLP SNP


RFLP

Restriction-fragment length polymorphism Cut genomic DNA from two individuals with

restriction enzyme Run Southern blot Probe with different pieces of DNA Sequence difference creates different band pattern

GGATCCCCTAGG

GTATCCGATAGG

GGATCCCCTAGG

200 400

GGATCCCCTAGG

GCATCCGGTAGG

GGATCCCCTAGG

200 400*

*

200

400

600

1 2

**

2

1


SSLP/Microsatellites

• Simple-sequence length polymorphism• Most genomes contain repeats of three or four

nucleotides• Length of repeat varies due to slippage in replication• Use PCR with primers external to the repeat region• On gel, see difference in length of amplified fragment

ATCCTACGACGACGACGATTGATGCT

12

18

1 2

2

1

ATCCTACGACGACGACGACGACGATTGATGCT


SNP

Single-nucleotide polymorphism One-nucleotide difference in sequence of two

organisms Found by sequencing Example: Between any two humans, on average one

SNP every 1,000 base pairs

ATCGATTGCCATGACATCGATGGCCATGAC2

1

SNP


Genetic map of Medicago truncatula BMC Plant Biology 2002, 2:1doi:10.1186/1471-2229-2-1


Physical mapping

Determination of physical distance between two points on chromosome Distance in base pairs

Example: between physical marker and a gene Need overlapping fragments of DNA

Requires vectors that accommodate large inserts Examples: cosmids, YACs, and BACs


Physical Mapping SystemsPhysical Mapping Systems

(like a Filing system of clones)(like a Filing system of clones)

Yeast Artificial Chromosomes (YACs) 200-1000 kb

Bacteriophage P1 90 kb

Cosmids 40 kb

Bacteriophage 9-23 kb

Plasmids (2-6 kb)


Large insert vectors

Lambda phage Insert size: 20–30 kb

Cosmids Insert size: 35–45 kb

BACs and PACs (bacterial and P1 artificial chromosomes (Viral) respectively) Insert size: 100–300 kb

YACs (yeast artificial chromosomes) Insert size: 200–1,000 kb


Pros and cons of large-insert vectors

Lambda phage and cosmids Inserts stable But insert size too

small for large-scale sequencing projects

YACs Largest insert size But difficult to work

with due to instability


BACs and PACs

BACs and PACs Most commonly used

vectors for large-scale sequencing

Good compromise between insert size and ease of use

Growth and isolation similar to that for plasmids


Contigs

Contigs are groups of overlapping pieces of chromosomal DNA Make contiguous clones

For sequencing one wants to create “minimum tiling path” Contig of smallest number of inserts that covers a region of

the chromosome

genomic DNA

contig

minimumtiling path


Contigs from overlapping restriction fragments

Cut inserts with restriction enzyme

Look for similar pattern of restriction fragments Known as

“fingerprinting” Line up overlapping

fragments Continue until a contig

is built


Restriction mapping applied to large-insert clones

Generates a large number of fragments Requires high-resolution separation of

fragments Can be done with gel electrophoresis


Analysis of restriction fragments

Computer programs perform automatic fragment-size matching

Possibilities for errors Fragments of similar size may in fact be

different sequences Repetitive elements give same sizes, but from

different chromosomal locations


Gel image processing


FPC: fingerprint analysis window


Building contigs by probing with end fragments

Isolate DNA from both ends of insert and mix

Label and probe genomic library

Identify hybridizing clones

Repeat with ends of overlapping clones


Chromosome walking

Combines probing with insert ends and restriction mapping

First find hybridizing clones Then create a

restriction map Identify the clone with

the shortest overlap Make probe from its end Repeat process

probelibrary

probe library


Sequencing

All large-scale sequencing projects use the Sanger method

Based on action of DNA polymerase Requires template DNA and primer Polymerase and nucleotides

Polymerase adds nucleotides according to template

Small amount of nucleotide analog included Stops synthesis


Sequencing reaction

Chain-termination method Uses dideoxy

nucleotides When added in right

amount, the chain is terminated Every time that base

appears in template Need a reaction for each

base: A, T, C, and G

3’ ATCGGTGCATAGCTTGT 5’

5’ TAGCCACGTATCGAACA* 3’5’ TAGCCACGTATCGAA* 3’5’ TAGCCACGTATCGA* 3’5’ TAGCCACGTA* 3’5’ TAGCCA* 3’5’ TA* 3’

Sequence reaction products

Template


Sequence detection

To detect products of sequencing reaction

Include labeled nucleotides

Formerly, radioactive labels used

Now, fluorescent labels used

Use different fluorescent tag for each nucleotide

Can run all four bases in same lane

TAGCCACGTATCGAA*

TAGCCACGTATC*

TAGCCACG*

TAGCCACGT*


Sequence separation

Terminated chains need to be separated

Requires one-base-pair resolution See difference between

chain of X and X+1 base pairs

Gel electrophoresis Very thin gel High voltage Works with radioactive

or fluorescent labels

A T C G–

+


Capillary electrophoresis

Newer automated sequencers use very thin capillary tubes

Run all four fluorescently tagged reactions in same capillary

Can have 96 capillaries running at the same time

96–well plate

robotic arm and syringe

96 glass capillaries

load bar


Sequence reading of radioactively labeled reactions

Radioactively labeled reactions Gel dried Placed on X-ray film

Sequence read from bottom up

Each lane is a different base

–

+ C A G T C A G T


Sequence reading of fluorescently labeled reactions

Fluorescently labeled reactions scanned by laser as a particular point is passed

Color picked up by detector

Output sent directly to computer


Optical Mapping

• Single-molecule technique Individual DNA molecules attached to glass

support Restriction enzymes on glass are activated When DNA is cut, microscope records length

of resulting fragments Has potential to rapidly generate restriction

maps

Optical mapping was developed at New York University in the late 1990s by David Schwartz, now a professor of chemistry and genetics at the University of Wisconsin-Madison.

The method uses fluorescence microscopy to image individual DNA molecules that have been divided into orderly fragments by restriction enzymes.


Pyrosequencing I

Based on production of pyrophosphate during sequencing reaction

Each time polymerase adds nucleotide (dNTP) to the growing strand, pyrophosphate (PPi) is released Amount released equal

to number of nucleotides added

QuickTime™ and aTIFF (Uncompressed) decompressor

are needed to see this picture.

Ronaghi et al. (1998-07-17). "A sequencing method based on real-time pyrophosphate". Science 281: 363.

http://www.sciencemag.org/cgi/content/full/281/5375/363


Pyrosequencing II

To quantitate amount of PPi released: ATP sulfurylase converts PPi to ATP ATP used by enzyme luciferase (firefly) to

produce light from the substrate luciferin The amount of light produced is directly

proportional to the amount of ATP, which is proportional to the amount of PPi released


Pyrosequencing III

Sequential addition of each dNTP gives sequence

Apyrase enzyme used to degrade dNTPs after reaction completed

Sequence read from amount of light emitted as each dNTP is added

Nucleotide sequence

Nucleotide added

“pyrogram,”


Pyrosequencing is a method of DNA sequencing based on the "sequencing by synthesis" principle. The technique was developed by Mostafa Ronaghi and Pål Nyrén at the Royal Institute of Technology in Stockholm in the 1990s.

"Sequencing by synthesis" involves taking a single strand of the DNA to be sequenced and then synthesizing its complementary strand enzymatically. The Pyrosequencing method is based on detecting the activity of DNA polymerase (a DNA synthesizing enzyme) with another chemiluminescent enzyme. Essentially, the method allows sequencing of a single strand of DNA by synthesizing the complementary strand along it, one base pair at a time, and detecting which base was actually added at each step. The template DNA is immobilized, and solutions of A, C, G, and T nucleotides are added and removed after the reaction, sequentially. Light is produced only when the nucleotide solution complements the first unpaired base of the template. The sequence of solutions which produce chemiluminescent signals allows the determination of the sequence of the template.

ssDNA template is hybridized to a sequencing primer and incubated with the enzymes DNA polymerase, , luciferase and apyrase, and with the substrates (APS) and luciferin.

The addition of one of the four deoxynucleotide triphosphates (dNTPs)(in the case of dATP we add dATPαS which is not a substrate for a luciferase) initiates the second step. DNA polymerase incorporates the correct, complementary dNTPs onto the template. This incorporation releases pyrophosphate (PPi) stoichiometrically.

ATP sulfurylase quantitatively converts PPi to ATP in the presence of adenosine 5´ phosphosulfate. This ATP acts as fuel to the luciferase-mediated conversion of luciferin to oxyluciferin that generates visible light in amounts that are proportional to the amount of ATP. The light produced in the luciferase-catalyzed reaction is detected by a camera and analyzed in a program.

Unincorporated nucleotides and ATP are degraded by the apyrase, and the reaction can restart with another nucleotide.

Currently, a limitation of the method is that the lengths of individual reads of DNA sequence are in the neighborhood of 300-500 nucleotides, shorter than the 800-1000 obtainable with chain termination methods (e.g. Sanger sequencing). This can make the process of genome assembly more difficult, particularly for sequence containing a large amount of repetitive DNA. As of 2007, pyrosequencing is most commonly used for resequencing or sequencing of genomes for which the sequence of a close relative is already available.

http://en.wikipedia.org/wiki/DNA_sequencing

http://en.wikipedia.org/wiki/Mostafa_Ronaghi

http://en.wikipedia.org/wiki/P%C3%A5l_Nyr%C3%A9n

http://en.wikipedia.org/wiki/Royal_Institute_of_Technology

http://en.wikipedia.org/wiki/DNA_polymerase

http://en.wikipedia.org/wiki/Chemiluminescent

http://en.wikipedia.org/wiki/Enzyme

http://en.wikipedia.org/wiki/DNA

http://en.wikipedia.org/wiki/Nucleotides

http://en.wikipedia.org/wiki/Primer

http://en.wikipedia.org/wiki/DNA_polymerase

http://en.wikipedia.org/wiki/Luciferase

http://en.wikipedia.org/wiki/Apyrase

http://en.wikipedia.org/wiki/Luciferin

http://en.wikipedia.org/wiki/Deoxynucleotide_triphosphate

http://en.wikipedia.org/wiki/DNTP

http://en.wikipedia.org/wiki/Pyrophosphate

http://en.wikipedia.org/wiki/Adenosine_triphosphate

http://en.wikipedia.org/wiki/DNA_sequencing#Chain-termination_methods

http://en.wikipedia.org/wiki/Genome_assembly

http://en.wikipedia.org/wiki/Repetitive_DNA


Who owns it?

Pyrosequencing AB in Uppsala. Sweden, was started to commercialize the machine and reagent for sequencing of short stretches of DNA. Pyrosequencing AB was renamed to Biotage in 2003. Pyrosequencing technology was further licensed to 454 Life Sciences. 454 developed an array-based Pyrosequencing which has emerged as a rapid platform for large-scale DNA sequencing. Most notable are the applications for genome sequencing and metagenomics. GS FLX, the latest pyrosequencing platform by 454 Life Sciences (owned by Roche), can generate 100 million nucleotide data in a 7 hour run with a single machine. It is anticipated that the throughput would increase by 5-10 fold with the next release. Each run would cost about 5,000-6,000 USD, pushing de novo sequencing of mammalian genomes into the million dollar range.

http://en.wikipedia.org/wiki/454_Life_Sciences


Membrane sequencing

Single DNA molecules pass through pore in membrane

Each nucleotide has slightly different charge

Charge detected as nucleotides pass through membrane

Many problems need to be worked out before this method can be used for genomic sequencing


From http://www.foresight.org/Nanomedicine/Sequencing.html

Nov. 1996 "Characterization of individual polynucleotide molecules using a membrane channel" (John J. Kasianowicz, Eric Brandin, Daniel Branton, David W. Deamer)

Nov. 1998 "Use of a Single Nanometer-Scale Pore to Rapidly Examine Individual DNA or RNA Strands" (Mark Akeson, Daniel Branton, John J. Kasianowicz, Eric Brandin, David W. Deamer)

Dec. 1999 "Microsecond time-scale discrimination among polycytidylic acid, polyadenylic acid, and polyuridylic acid as homopolymers or as segments within single RNA molecules" (M. Akeson, D. Branton, J.J. Kasianowicz, E. Brandin, D.W. Deamer) Abstract Paper

Feb. 2000 "Rapid nanopore discrimination between single polynucleotide molecules" (Amit Meller, Lucas Nivon, Eric Brandin, Gene Golovchenko, Daniel Branton)

Apr. 2000 "Nanopores and nucleic acids: prospects for ultrarapid sequencing" (D.W. Deamer, M. Akeson)Abstract

Sep. 2000 "Nanopore Sequencing. Probing Polynucleotides with a Nanopore: High Speed, Single Molecule DNA Sequencing" (Daniel Branton, Jene Golovchenko)

http://www.foresight.org/Nanomedicine/Sequencing.html

http://www.pnas.org/cgi/content/full/93/24/13770


http://www.foresight.org/Conferences/MNT6/Abstracts/Akeson/index.html

http://www.foresight.org/Conferences/MNT6/Abstracts/Akeson/index.html

http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids

http://mcb.harvard.edu/branton/akeson.pdf


http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids

http://mcb.harvard.edu/branton/nanopore.7sept00.html

http://mcb.harvard.edu/branton/nanopore.7sept00.html


Summary I

Basics of mapping Genetic mapping

Based on recombination frequencies Physical mapping

Requires overlapping DNA fragments Can use restriction enzymes Probing with end fragments Combination: chromosome walking


Summary II

Basics of sequencing Chain-termination method Radioactive or fluorescent labels Separated by gel or capillary electrophoresis Read from X-ray film or by laser detector

New technologies Optical mapping Pyrosequencing Membrane sequencing

Thank You


Date post:	06-May-2015
Category:	Health & Medicine
Upload:	arputha-selvaraj-a
View:	1,306 times
Download:	1 times

GENE MAPPING 3

Health & Medicine