Key words: sea urchin; Drosha; DGCR8 (DiGeorge critical region 8 gene); Dicer; TRBP (HIV-1 transactivating responseRNA binding protein); PACT (protein activator of the interferon-induced protein kinase); Exportin-5; Argonautes; RNAinterference
Accepted 4 September 2007
INTRODUCTION
RNA-mediated interference (RNAi) isa conserved gene regulatory mecha-nism that involves double-stranded(ds) RNA as a signal to trigger thesequence-specific degradation of tar-get mRNA, resulting in posttranscrip-tional silencing and/or translationalrepression. RNA-directed transcrip-tional silencing was first identified inplants (Wassenegger et al., 1994;Mette et al., 2000), and subsequentstudies revealed that a wide range ofeukaryotes from fungi to human use
small RNAs and the canonical compo-nents of the RNA silencing machineryto carry out conserved gene silencingmechanisms (reviewed in Zamore andHaley, 2005). The RNAi silencingpathway is directed by small RNAs,21 to 30 nucleotides in length, whichcan be endogenously synthesized orexogenously introduced. Small regula-tory RNAs are categorized by their or-igin, not by their functions. The bio-genesis of both miRNA (micro RNA)and siRNA (small interfering RNA)require dsRNA—specific endonucle-
ase Dicer and small RNA-binding pro-teins of the Argonaute family.
The ribonuclease III family enzymeDrosha and the dsRNA binding pro-tein DGCR8/Pasha are required forthe initial processing of an RNA poly-merase II transcribed primarymiRNA (pri-miRNA) into approxi-mately 65 nucleotide stem-loop RNAprecursors (Basyuk et al., 2003; Lee etal., 2003, 2006). DGCR8/Pasha bindsdirectly to pri-miRNAs by recognizingthe flanking single-stranded RNA ofthe pri-miRNA hairpin structure and
The Supplementary Material referred to in this article can be found at http://www.interscience.wiley.com/jpages/1058-8388/suppmatDepartment of Molecular Biology, Cell Biology and Biochemistry, Brown University, Providence, Rhode IslandGrant sponsor: NIH; Grant sponsor: NIH/NRSA; Grant number: F32HD046247.*Correspondence to: Jia L. Song, Box G-L173, 185 Meeting Street, Brown University, Providence, RI 02912.E-mail: [email protected]
DOI 10.1002/dvdy.21353Published online 17 October 2007 in Wiley InterScience (www.interscience.wiley.com).
acts as a molecular anchor for Drosha-mediated catalysis (Han et al., 2004,2006; Yeom et al., 2006). The stem-loop precursor structure is essentialfor Exportin-5 interaction and exportin a Ran-GTP–dependent manner (Yiet al., 2003; Lund et al., 2004).
In contrast to the polymerase II tran-scribed pre-miRNAs, siRNAs are de-rived from long dsRNA hundreds tothousands of base pairs. The pre-miRNAs or long dsRNAs are furtherrecognized and processed by Dicer andits cofactor TRBP (HIV-1 transactivat-ing response RNA binding protein) intomiRNAs and siRNAs in the cytoplasm,respectively (Bernstein et al., 2001;Grishok et al., 2001; Hutvagner et al.,2001; Ketting et al., 2001; Chendri-mada et al., 2005). Dicer-cleaved smalldsRNAs are then used by the RISC(RNA-induced silencing complex) fortarget processing. Small RNAs andtheir associated proteins together regu-late transcriptional silencing, transla-tional repression, heterochromatin for-mation, genome integrity, and mRNAstability (Mochizuki et al., 2002; Bartel,2004; Verdel et al., 2004; Mochizuki andGorovsky, 2005; Murchison et al.,2007).
Small RNA-directed mRNA cleav-age or translational repression iscatalyzed by Argonaute proteins inthe RISC. The Argonaute family isdivided into AGO-like and PIWI-likesubfamilies based on their aminoacid similarities (Yigit et al., 2006;reviewed in Tolia and Joshua-Tor,2007). All Argonaute proteins con-tain two RNA-binding domains: thePIWI domain, which binds the smallRNA guide at the 5�end, and the PAZdomain, which binds the single-stranded 3�end of small RNA (Yan etal., 2003; Haley and Zamore, 2004;Song et al., 2004). The crystal struc-ture of Argonaute from P. furiosusrevealed that the PIWI domain hasan RNAse H fold with conserved as-partate and histidine residues im-portant for its catalytic activity ofcleaving the target mRNA (Song etal., 2004).
The sea urchin is a basal deutero-stome that shares a common ancestorwith the chordates. The embryos ofthe purple sea urchin, Strongylocen-trotus purpuratus, consists of only10–15 cell types with a single celllayer epithelium surrounding several
different types of mesenchymal cells(Ettensohn and Ingersoll, 1992; Et-tensohn et al., 2004). A diagrammaticrepresentation and fate map of the seaurchin embryo are depicted in Figure1A. A vast majority of the specific cellfates acquired in this embryo arebased on cell interactions (Ransickand Davidson, 1993), and the blas-tomeres express distinct sets of signal-ing molecules and transcription fac-tors that regulate these cellularspecification and differentiationevents (Duboc et al., 2005; Croce et al.,2006; Howard-Ashby et al., 2006a–c;Lapraz et al., 2006; Materna et al.,2006; Walton et al., 2006). However, aregulatory role of small, noncodingRNAs has not been investigated inthis organism.
This study examines the spatial andtemporal RNA expression patterns ofgenes that are involved in the biogen-esis and function of small regulatoryRNAs in the sea urchin RNAi silenc-ing pathway. Their presence and dy-namic expressions suggest that thesea urchin may selectively use theRNAi silencing pathway in regulatingembryogenesis.
RESULTS AND DISCUSSION
Key Molecules Involved inthe RNAi Pathway ArePresent in the Sea Urchinand Have a Strong MaternalComponent
Genes involved in the RNAi pathwaywere identified bioinformatically fromthe sea urchin genome database(http://annotation.hgsc.bcm.tmc.edu/Urchin and www.genbore.org) andpartial sequences were cloned for fur-ther analysis. S. purpuratus containsone putative gene each for Drosha,DGCR8/Pasha, Dicer, TRBP, and Ex-portin-5, and at least 4 Argonautegenes. Each of these predicted pro-teins contains the known conservedresidues for function (Fig. 1B).
Quantitative, real-time polymerasechain reaction (QPCR) analysis indi-cates that each gene involved in theRNAi pathway has a high mRNA ac-cumulation in the egg that generallydecreases during the 72 hr of growthto the pluteus larval stage (Fig. 2).AGO1 and Seawi (Rodriguez et al.,2005; Juliano et al., 2006), however,
each has the highest RNA accumula-tion at the mesenchyme blastulastage. The QPCR results from thisstudy are consistent with the data-base results from the global genomeoligonucleotide microarrays (Wei etal., 2006). The only discrepancies seenbetween the two technologies are (1)the peak RNA accumulation of PiwiL1observed by QPCR is in the egg,whereas by the oligonucleotide mi-croarray, it occurs in the early blas-tula stage; and (2) AGO1 observed byQPCR peaks at mesenchyme blastulastage, whereas it is not detected afterthe blastula stage by the oligonucleo-tide microarray (Wei et al., 2006).These minor differences may reflectmore differences in the batches ofwild-type embryos used for these stud-ies than the technologies themselves.Overall, however, the QPCR resultsshown here are consistent with theresults from the whole genome arrays.
Drosha and Its Cofactor,DGCR8 (DiGeorge SyndromeCritical Region 8Gene)/Pasha, Have SimilarSpatial and TemporalExpression Patterns
The mRNA of sea urchin homologs ofDrosha and its cofactor DGCR8/Pashaare most abundant in the oocytes andeggs (Fig. 3). In early blastulae, themRNA of both genes accumulatethroughout the embryo, and later inmesenchyme blastulae, they are en-riched in the apical ectoderm, primarymesenchyme cells, and in the vegetalplate. Low levels of Drosha andDGCR8/Pasha mRNA are detected se-lectively in the endoderm of the gas-trulae. In general, this accumulationpattern reflects areas of the embryomost active in cell division, and/or cellfate determinations.
Exportin-5 Is Enriched inthe Oocytes
One Exportin-5 homolog was identi-fied in the sea urchin genome. Its RNAaccumulation is highest in the oocytesand decreased dramatically by the 32-cell stage. Exportin-5 is at low levelsand cannot be detected by whole-mount in situ hybridization throughsubsequent development but is detect-able consistently by QPCR (Figs. 2, 3).
RNAI IN THE SEA URCHIN 3181
Dicer mRNA IsAsymmetrically Enriched inthe Egg and Embryos
Only one homolog of Dicer was bioinfor-matically identified from the sea urchingenome database, suggesting that, sim-ilar to humans, the sea urchin Dicermay mediate both miRNA and siRNAsilencing pathways. Dicer mRNA accu-mulates asymmetrically in one periph-ery of the oocyte in punctate cytoplas-mic structures, similar to some of theArgonaute mRNAs (Fig. 3). This asym-metric localization of Dicer mRNA ismaintained throughout development;in mesenchyme blastula and gastrulastages, its RNA accumulation is en-riched selectively in the presumptiveoral ectoderm and endodermal epithe-lium. The transcript then decreases toundetectable levels in the larval plu-teus stage 72 hr after fertilization(Fig. 3).
Of special note here is that severalsea urchin transcription factors havesimilar spatial expression patterns asDicer, including the orphan steroid re-ceptor TF-COUP, the zinc finger z55,and the homeobox transcription factorE2f3 in that their mRNAs are enrichedin the oral ectoderm (Vlahou et al.,1996; Materna et al., 2006; Howard-Ashby et al., 2006a). TF-Coup hasasymmetric RNA localization in oocytesand eggs, similar to Dicer. However, incleavage stage embryos, TF-COUPRNA is localized lateral to the animal/ventral axis and at 45-degree angle tothe oral/aboral axis, whereas DicerRNA is ubiquitous (Vlahou et al., 1996;Fig. 3). z55 has maternal RNA tran-scripts in the egg, ubiquitous expressionat 7 hr after fertilization, and is re-stricted to the presumptive oral ecto-derm in the blastula stage (Materna etal., 2006). E2f3 mRNA is not detectablewith whole-mount in situ hybridizationbefore 24 hr postfertilization (blastulastage) and is localized to the oral ecto-derm in blastula and to the oral ecto-derm and the endodermal gut in gas-
Fig. 1. A,B: The diagrammatic representation and fate map of the embryo during sea urchin devel-opment (A; adapted from Gilbert, 2000) and protein domains predicted by the Simple Modular Archi-tecture Research Tool (B; Schultz et al., 1998). Proteins involved in the RNAi silencing pathway containconserved functional protein domains. The scale bar represents the number of amino acids.
Fig. 2.
Fig. 2. Quantitative, real-time polymerase chainreaction (QPCR) measurement of genes in-volved in the RNA-mediated interference (RNAi)pathway. QPCR results are normalized to ubiq-uitin and presented relative to the levels in theegg. Standard deviations of triplicates areshown.
3182 SONG AND WESSEL
trula similar to Dicer (Howard-Ashby etal., 2006a). Whether these transcriptionfactors functionally interact with Diceris unclear, but very few genes identifiedin the sea urchin have this particularpattern of expression.
Phylogenetic analysis indicated
that the S. purpuratus Dicer clusterswith the deuterostome Dicers (Fig.4). In addition to having the con-served dicer protein domains, the S.purpuratus Dicer has an HDAC (hi-stone deacetylase) interaction do-main between the PIWI and ribonu-
clease III domains (Fig. 1). Analysisof Dicer homologs with SMART(Simple Modular Architecture Re-search Tool; Schultz et al., 1998) in-dicated that the HDAC interactiondomain is unique to S. purpuratus andnot found in Dicer homologs from
Fig. 3. RNA transcripts detected by whole-mount in situ RNA hybridizations. Genes involved in the RNA-mediated interference silencing pathwayhave dynamic expression patterns during sea urchin development. Embryos are presented in lateral views with the animal pole at the top, except forthose marked (v) with ventral side or (a) with animal side of the embryo facing the page. The arrows indicate coelomic pouches. The differentdevelopmental stages of the sea urchin are correlated with the time scale indicated by hours postfertilization (hpf). Scale bar � 20 �M.
The RNAi machinery can represstranscription by recruiting histonemodifying enzymes to the chromatin.For example, the RNAi-inducedinitiation of transcriptional gene si-lencing (RITS) is required for hetero-chromatic gene silencing at centro-meres in the fission yeast (Hansen etal., 2005; Buhler et al., 2006; Moazedet al., 2006; Buker et al., 2007). Di-cer-deficient mouse embryonic stemcells are defective in DNA methyl-ation and histone modifications, sug-
gesting a close link between theRNAi pathway and chromatin re-modeling (Kanellopoulou et al.,2005). Therefore, the S. purpuratusDicer may function in posttranscrip-tional regulation through RISC andtranscriptional gene silencing by us-ing its HDAC interaction domain todirectly recruit chromatin remodel-ing complexes.
BLASTing the human TRBP and PACT(protein activator of the interferon-in-duced protein kinase) identified a singlehomolog in the sea urchin genome da-
tabase. The TRBP mRNA localizationoverlaps with Dicer mRNA localizationat the apical ectoderm in mesenchymeblastula through late gastrula (Fig. 3).Because TRBP/PACT has an additionalrole in immunity within mammals, thismay explain why its localization doesnot solely correspond to that of its cofac-tor Dicer (Chendrimada et al., 2005;Gatignol et al., 2005). The sea urchinhas a large repertoire of potential im-mune receptors, regulators, and effec-tors, and a complex innate immune sys-tem (Hibino et al., 2006; Rast et al.,2006). Perhaps TRBP mRNA localiza-tion in the secondary mesenchyme cellsand their descendents reflect a secondfunction.
The sea urchin TRBP mRNA alsoaccumulates in the coelomic pouchesof the larva (72 hr), where conservedmarkers of early primordial germcell development such as vasa andnanos transcripts are localized (Fig.3; Table 1; Juliano et al., 2006). Inmammalian cells, TRBP is expressedin spermatids where it’s involved intranslational repression of prota-mine mRNA translation and regula-tion of male germ cell differentiation(Lee et al., 1996; Siffroi et al., 2001).The expression patterns of the TRBPhomolog in the sea urchin suggestthat it may have multiple roles, in-cluding germ cell regulation and em-bryogenesis.
Sea Urchins Have at LeastFour Argonaute ProteinsWith Dynamic ExpressionPatterns
BLAST searches of PAZ and PIWI do-main-containing proteins from the seaurchin genome database and molecularcloning identified at least four Argo-naute proteins (Fig. 5C). Sea urchinAGO1 and AGO2 are most closely re-lated to the AGO-like subfamily of Ar-gonautes, whereas the sea urchin Pi-wiL1 and Seawi are most closely relatedto the PIWI subfamily of Argonautes(Fig. 5A). All four of the sea urchin Ar-gonautes examined contain conservedaspartic acid and histidine residues im-portant for RNAse H activity within thePIWI domain, suggesting that they allhave potential slicer activity (Fig. 5B).Seawi was previously found to be a com-ponent of microtubule-ribonucleopro-tein complexes from two species of sea
Fig. 4. Phylogenetic tree of Dicer. Amino acid sequences of the sea urchin Dicer gene was alignedusing ClustalX (http://www.ebi.ac.uk/clustalw/ and http://www.ch.embnet.org/software/Clustal-W.html). Amino acid sequences of the sea urchin Dicer (with asterisk) were aligned with other Dicerproteins from GenBank using the Clustal algorithms within MacVector (Accelrys, Burlington, MA).Neighbor joining trees were computed using PAUP with 1,000 bootstrap replicates (Swofford,2002). The scale bar represents 0.1 amino acid substitutions per site. The GenBank accessionnumbers for these genes are available in Supplementary Table S1, which can be viewed athttp://www.interscience.wiley.com/jpages/1058-8388/suppmat.
3184 SONG AND WESSEL
urchins, S. purpuratus and Paracentro-tus lividus, and its associated mRNA inthe ribonucleoprotein complex weretranslationally repressed (Rodriguez etal., 2005).
All sea urchin Argonautes have highlevels of RNA accumulation in oocytes(Fig. 3). Sea urchin AGO2, PiwiL1,and Seawi mRNA have cytoplasmic,punctate localizations in the oocytes;the punctate staining seemed moreprevalent in younger oocytes, whereasin larger oocytes, the cytoplasmic ac-cumulation is more perinuclear (Fig.3). In the 32 cell stage, PiwiL1 andSeawi RNA accumulate in all cells,but seem to accumulate less in themicromeres. The micromeres give riseto the skeletal mesenchyme and smallmicromeres that end up in the coelom(body wall; Gilbert, 2000). In the mes-enchyme blastula stage, PiwiL1 is lo-calized to the vegetal plate, whereasSeawi, AGO1, and AGO2 have abroader mRNA accumulation in thevegetal plate, primary mesenchymecells, and the apical ectoderm. In thelate gastrula stage, mRNAs of all Ar-gonautes have decreased significantly,and by the pluteus stage, only theSeawi mRNA remains detectable, andis enriched in one of the coelomicpouches, where the future adult rudi-ment arises (Fig. 3).
The expression profile of PiwiL1mirrors that of several germline deter-mination genes, such as vasa andnanos, in the sea urchin (Juliano etal., 2006). The miRNA pathway hasbeen implicated in the regulation ofself-renewal of Drosophila germlinestem cells and primordial germ cell(PGC) maintenance (Jin and Xie,2006; Megosh et al., 2006; Park et al.,2007). Depletion of individual mem-bers of the RISC complex includingPIWI, dFMRP (Fragile X Mental Re-tardation Protein), or DCR-1, the Di-cer protein involved in the miRNA bio-genesis, leads to a failure in pole-plasm maintenance and primordialgerm cell formation in Drosophila(Megosh et al., 2006). Similar to Dro-sophila, mammalian Piwi proteinsMIWI and MILI are also involved intransposon suppression during sper-matogenesis (Aravin et al., 2007).Miwi2 and Mili mutations affect themethylation of L1 repetitive elements(Aravin et al., 2007; Carmell et al.,2007). This finding suggests a con-
served pathway of a developmentallyregulated transposon repression bypiRNA mediated by PIWI subfamily ofthe Argonaute proteins. The expres-sion patterns of the sea urchin PiwiL1and TRBP suggest that, similar toDrosophila, both piRNA-mediatedtransposon suppression and miRNA-mediated germline specification maybe involved in the maintenance of thegermline.
The results of this study indicatethat all the important molecules in-volved in the RNA-mediated interfer-ence silencing pathway are presentand differentially expressed duringsea urchin embryogenesis. These dif-ferences in RNA accumulation sug-gest an important developmental reg-ulatory role of the RNA-mediatedsilencing pathway in this organism.
EXPERIMENTALPROCEDURES
Gene Identification andCloning
All genes discussed in this manuscriptwere identified and analyzed using theSea Urchin Genome site (http://hgsc.bcm.tmc.edu/projects/seaurchin/), theSea Urchin Annotation site (http://annotation.hgsc.bcm.tmc.edu/Urchin/),and the Genebore site (www.genboree.org). Subsequently, part of these geneswas cloned by PCR using the S. purpu-ratus ovary cDNA library or by reversetranscription-PCR (RT-PCR) using em-bryos collected throughout early devel-opment. Total RNA was extracted aspreviously described (Bruskin et al.,1981), and RT-PCR was performed ac-cording to manufacturer’s directions us-ing the Access RT-PCR kit (PromegaCorporation, Madison, WI). The reversetranscription reaction was conductedfor 45 min at 48°C, followed by denatur-ation for 2 min at 94°C. PCR amplifica-tion was performed for 40 cycles (dena-turation for 30 sec at 94°C, annealingfor 1 min at 60°C, and extension for 2min at 68°C). RT-PCR products wererun on 1% agarose electrophoretic gelsand PCR fragments were gel purifiedusing QiaQuick spin columns (QiagenInc., Valencia, CA) and cloned intopGEM-T EASY vector (Promega Corpo-ration) for nucleotide sequencing.
Animals
Strongylocentrotus purpuratus werecollected by Charles Hollahan (SantaBarbara, CA) and housed in aquariacooled to 16°C in artificial sea water(ASW; Coral Life Scientific Grade Ma-rine Salt; Energy Savers Unlimited,Inc, Carson, CA). Sea urchins wereshed by intracoelomic 0.5 M KCl injec-tion. Embryos were cultured at 16°Cand collected at various developmen-tal stages.
QPCR
cDNA was prepared from 2 �g of totalRNA from embryos and adult ovary byRT-PCR (TaqMan Reverse Transcrip-tion Reagents Kit, Foster City, CA).QPCR was performed on the 7300Real-Time PCR system (Applied Bio-systems, Foster City, CA) using SYBRGreen chemistry (Applied Biosys-tems). Primer sets were designed toamplify 100–150 bp (Table 2) usingPrimer3 (Rozen and Skaletsky, 2000).Reactions were run in triplicate, nor-malized against ubiquitin mRNA, andare presented relative to the egg lev-els.
In Situ RNA Hybridization
Whole-mount in situ RNA hybridiza-tions were performed as previouslydescribed (Minokawa et al., 2004).Partial gene sequences were cloned byRT-PCR using templates from the S.purpuratus ovary cDNA library andtotal RNA extracted from embryos atthe 4-cell, 32-cell, blastula, mesen-chyme blastula, gastrula, and pluteusstages (Table 3). cDNA products gen-erated from the RT-PCR reactionswere cloned into pGEM-T EASY vec-tors (Promega Corporation). Plasmidscontaining Argonaute genes were lin-earized with various restriction en-zymes to exclude the PAZ and PIWIregions. Linearized plasmids were invitro transcribed, and the antisenseprobes were labeled with digoxigenin(DIG) using the DIG RNA Labeling kit(Roche Applied Science, Indianapolis,IN). Negative controls were tran-scribed off plasmid pSPT18-Neo orpSPT19-Neo provided in the DIGRNA Labeling kit.
RNAI IN THE SEA URCHIN 3185
Sequence and PhylogeneticAnalysis
Protein sequences were aligned usingClustalX (http://www.ebi.ac.uk/clustalw/
and http://www.ch.embnet.org/software/ClustalW.html). Protein domains wereanalyzed with the Simple Modular Ar-chitecture Research Tool (SMART)site (smart.embl-heidelberg.de/). Amino
acid sequences of the Dicer and Argo-naute genes were aligned using theClustal algorithms within MacVector(Accelrys, Burlington, MA). These se-quence alignments were analyzed in
Fig. 5. Phylogenetic tree of Argonautes and sequence analysis. Amino acid sequences of the sea urchin Argonaute genes (with asterisks) were aligned usingClustalX (Thompson et al., 1997) with other Argonautes in GenBank. Neighbor joining trees were constructed using PAUP with 100 bootstrap replicates (Swofford,2002). Group 3 Argonautes that are specific to Caenorhabditis elegans were excluded from this analysis. GenBank accession numbers for the Argonautes are listedin Supplementary Table S2. A: Sea urchin Argonaute protein sequences were aligned with three of the C. elegans Argonautes that contain slicer activity.B: Conserved residues of aspartic acid and histidine residues shaded in grey are found in the PIWI domains of the sea urchin Argonautes. Four sea urchin Argonautesare aligned using Clustal X (Thompson et al., 1997). C: Conserved PAZ and PIWI domains are shaded in gray.
3186 SONG AND WESSEL
PAUP (Swofford, 2002) using neigh-bor joining method to establish theirrelationships. Bootstrap scores weredetermined from 1,000 or 100 reitera-tions.
ACKNOWLEDGMENTS
We thank Annette Coleman andJulian Wong (Brown University) forthe help with PAUP and Judith
Nathanson (Brown University) forher help on the embryo drawing.This work is supported by the NIHawarded to G.M.W. and NRSAawarded to J.L.S.
TABLE 1. Summary of Spatial Expression Patterns of Genes Involved in the RNAi Pathwaya
Gene Oocyte Egg 16/32 cells BlastulaMesenchymeblastula Gastrula Late gastrula Pluteus
Drosha Pe; Pa Pa Ub V PMC; V; AEC E; AEC E; AEC EPasha/DGCR8 Pe; Pa Pa Ub Ub PMC; V; AEC AEC; E; SMC E; AEC; CB NDExportin 5 Pe; Pa Ub ND Ub ND ND ND NDDicer asymmetric asymmetric Ub OEC OEC E; AEC; OEC AEC; E; OEC; CB NDTRBP Pe; Pa Pa Ub; less in
themicromeres
V PMC; AEC AEC; SMC E; AEC; CP ND
AGO1 Pe Ub Ub Ub AEC; PMC; V ND ND NDAGO2 Pu Ub Ub Ub AEC; PMC V E; AEC;
Bartel DP. 2004. MicroRNAs: genomics,biogenesis, mechanism, and function.Cell 116:281–297.
Basyuk E, Suavet F, Doglio A, Bordonne R,Bertrand E. 2003. Human let-7 stem-loop precursors harbor features of RNase
III cleavage products. Nucleic Acids Res31:6593–6597.
Bernstein E, Caudy AA, Hammond SM,Hannon GJ. 2001. Role for a bidentateribonuclease in the initiation step ofRNA interference. Nature 409:363–366.
Bruskin AM, Tyner AL, Wells DE, Show-man RM, Klein WH. 1981. Accumulationin embryogenesis of five mRNAs en-riched in the ectoderm of the sea urchinpluteus. Dev Biol 87:308–318.
Buhler M, Verdel A, Moazed D. 2006. Teth-ering RITS to a nascent transcript ini-tiates RNAi- and heterochromatin-de-pendent gene silencing. Cell 125:873–886.
Buker SM, Iida T, Buhler M, Villen J,Gygi SP, Nakayama J, Moazed D. 2007.Two different Argonaute complexesare required for siRNA generationand heterochromatin assembly in fis-sion yeast. Nat Struct Mol Biol 14:200 –207.
TABLE 2. PCR Primers Used in Quantitative, Real-Time Polymerase Chain Reaction
Gene Glean IDa 5� to 3�
Drosha SPU_09634 FOR GAACCGGACGTTCCAAACTAREV GTCGACATTCGCTTGGATTT
Dicer SPU_28218 FOR GATCGGTTGCTACCTGGTGTREV GGAAGATCAGCTGCAGGAAG
Exportin5 SPU_018583 FOR CCTTCCAGCAATCTTCAAGCSPU_07337SPU_13561 REV CTCCTGAATGCAGAGGGAAG
DGCR5/Pasha SPU_01835 FOR GATGACGGAGGATGGAAAGAREV GCATGTTGTCCTGTGGAATG
TRBP SPU_08206 FOR CCCTGGCCTCATAAACAGAAREV GTAGGTGGGGTCTGGGAAAT
AGO 1 SPU-19389 FOR GCTCCAGAAGATCTCCAACGREV ACGATCAGCTGCAGTCCTTT
AGO 2 SPU_19390 FOR GTGGTAACATCCCAGCAGGTSPU_20628SPU_23100 REV ACGACTGGTGCCCTGAATAC
PiwiL1 SPU_23335 FOR AGCTGGGAGAGAGGTGATGASPU_12335 REV TACCCAGGCCAGATCTCAAG
aGene assignments corresponding to the sea urchin genome database (http://annotation.hgsc.bcm.tmc.edu/Urchin/ andwww.genboree.org).
TABLE 3. PCR Primers Used to Generate RNA In Situ Antisense Probes
Gene 5� to 3� Length (bp)
Drosha FOR TGATGGCTTCCAATGATGAA 1083REV GTCGACATTCGCTTGGATTT
Dicer FOR GCCAGAGCCAGTTTGAGTTC 1707REV GGAAGATCAGCTGCAGGAAG
Exportin-5 FOR CTCCTGAATGCAGAGGGAAG 1293REV TCTGCATCACTGGCAAAAAG
DGCR5/Pasha FOR GCCTGATGTAGACATGAAGG 908REV TCAGCTCTGTCACGCTCTGT
TRBP FOR CCATCAGCCAAAGTTCACCA 643REV TGACGAAGCACTGGTAGTGG
AGO1 FOR CCTGATGGAATTCTATCGGTC 1004REV TCGAAATTAACCCTCACTAAAGGGa
AGO2 FOR ATGTATCAACCACCCTTTCCG 1962REV CCTCCCAGTTTGACGTTGAT
PiwiL1 FOR AGCTGGGAGAGAGGTGATGA 1305REV TCCCGGTTCATACTGGCTAC
Seawi FOR TTCACAGGTTTCACGGCAAAC 919REV GTACTGGTAGAGTTGCCAGTC
aT3 primer corresponding to the vector sequence of the S. purpuratus ovary cDNA library.
3188 SONG AND WESSEL
Carmell MA, Girard A, van de Kant HJ,Bourc’his D, Bestor TH, de Rooij DG,Hannon GJ. 2007. MIWI2 is essential forspermatogenesis and repression oftransposons in the mouse male germline.Dev Cell 12:503–514.
Chendrimada TP, Gregory RI, Kuma-raswamy E, Norman J, Cooch N, Ni-shikura K, Shiekhattar R. 2005. TRBPrecruits the Dicer complex to Ago2 formicroRNA processing and gene silenc-ing. Nature 436:740–744.
Croce JC, Wu SY, Byrum C, Xu R, Dulo-quin L, Wikramanayake AH, Gache C,McClay DR. 2006. A genome-wide surveyof the evolutionarily conserved Wntpathways in the sea urchin Strongylo-centrotus purpuratus. Dev Biol 300:121–131.
Duboc V, Rottinger E, Lapraz F, Bes-nardeau L, Lepage T. 2005. Left-rightasymmetry in the sea urchin embryo isregulated by nodal signaling on the rightside. Dev Cell 9:147–158.
Ettensohn CA, Ingersoll EP. 1992. Mor-phogenesis of the sea urchin. In: Rosso-mando E, Alexander S, editors. Morpho-genesis: an analysis of the developmentof the biological form. New York: MarcelDecker, Inc. p 189–262.
Ettensohn CA, Wessel GM, Wray GA.2004. Methods in cell biology. In: Etten-sohn CA, Wessel GM, Wray GA, editors.Development of sea urchins, ascidians,and other invertebrate deuterostomes:experimental approaches. San Diego:Elsevier Academic Press. p 1–13.
Gatignol A, Laine S, Clerzius G. 2005.Dual role of TRBP in HIV replicationand RNA interference: viral diversion ofa cellular pathway or evasion from anti-viral immunity? Retrovirology 2:65.
Gilbert SF. 2000. Developmental biology.Sunderland, MA: Sinauer Associates.
Grishok A, Pasquinelli AE, Conte D, Li N,Parrish S, Ha I, Baillie DL, Fire A,Ruvkun G, Mello CC. 2001. Genes andmechanisms related to RNA interferenceregulate expression of the small tempo-ral RNAs that control C. elegans devel-opmental timing. Cell 106:23–34.
Haley B, Zamore PD. 2004. Kinetic analy-sis of the RNAi enzyme complex. NatStruct Mol Biol 11:599–606.
Han J, Lee Y, Yeom KH, Kim YK, Jin H,Kim VN. 2004. The Drosha-DGCR8 com-plex in primary microRNA processing.Genes Dev 18:3016–3027.
Han J, Lee Y, Yeom KH, Nam JW, Heo I,Rhee JK, Sohn SY, Cho Y, Zhang BT,Kim VN. 2006. Molecular basis for therecognition of primary microRNAs bythe Drosha-DGCR8 complex. Cell 125:887–901.
Hansen KR, Burns G, Mata J, Volpe TA,Martienssen RA, Bahler J, Thon G.2005. Global effects on gene expressionin fission yeast by silencing and RNAinterference machineries. Mol Cell Biol25:590–601.
Hibino T, Loza-Coll M, Messier C, MajeskeAJ, Cohen AH, Terwilliger DP, BuckleyKM, Brockton V, Nair SV, Berney K,Fugmann SD, Anderson MK, Pancer Z,
Cameron RA, Smith LC, Rast JP. 2006.The immune gene repertoire encoded inthe purple sea urchin genome. Dev Biol300:349–365.
Howard-Ashby M, Materna SC, Brown CT,Chen L, Cameron RA, Davidson EH.2006a. Gene families encoding transcrip-tion factors expressed in early develop-ment of Strongylocentrotus purpuratus.Dev Biol 300:90–107.
Howard-Ashby M, Materna SC, Brown CT,Chen L, Cameron RA, Davidson EH.2006b. Identification and characteriza-tion of homeobox transcription factorgenes in Strongylocentrotus purpuratus,and their expression in embryonic devel-opment. Dev Biol 300:74–89.
Howard-Ashby M, Materna SC, Brown CT,Tu Q, Oliveri P, Cameron RA, DavidsonEH. 2006c. High regulatory gene use insea urchin embryogenesis: implicationsfor bilaterian development and evolu-tion. Dev Biol 300:27–34.
Hutvagner G, McLachlan J, PasquinelliAE, Balint E, Tuschl T, Zamore PD.2001. A cellular function for the RNA-interference enzyme Dicer in the matu-ration of the let-7 small temporal RNA.Science 293:834–838.
Jin Z, Xie T. 2006. Germline specification:small things have a big role. Curr Biol16:R966–R967.
Juliano CE, Voronina E, Stack C, AldrichM, Cameron AR, Wessel GM. 2006.Germ line determinants are not localizedearly in sea urchin development, but doaccumulate in the small micromere lin-eage. Dev Biol 300:406–415.
Kanellopoulou C, Muljo SA, Kung AL,Ganesan S, Drapkin R, Jenuwein T, Liv-ingston DM, Rajewsky K. 2005. Dicer-deficient mouse embryonic stem cells aredefective in differentiation and centro-meric silencing. Genes Dev 19:489–501.
Ketting RF, Fischer SE, Bernstein E, SijenT, Hannon GJ, Plasterk RH. 2001. Dicerfunctions in RNA interference and insynthesis of small RNA involved in de-velopmental timing in C. elegans. GenesDev 15:2654–2659.
Lapraz F, Rottinger E, Duboc V, Range R,Duloquin L, Walton K, Wu SY, BradhamC, Loza MA, Hibino T, Wilson K,Poustka A, McClay D, Angerer L, GacheC, Lepage T. 2006. RTK and TGF-betasignaling pathways genes in the sea ur-chin genome. Dev Biol 300:132–152.
Lee K, Fajardo MA, Braun RE. 1996. Atestis cytoplasmic RNA-binding proteinthat has the properties of a translationalrepressor. Mol Cell Biol 16:3023–3034.
Lee Y, Ahn C, Han J, Choi H, Kim J, Yim J,Lee J, Provost P, Radmark O, Kim S,Kim VN. 2003. The nuclear RNase IIIDrosha initiates microRNA processing.Nature 425:415–419.
Lee Y, Han J, Yeom KH, Jin H, Kim VN.2006. Drosha in Primary MicroRNA Pro-cessing. Cold Spring Harb Symp QuantBiol 71:51–57.
Lund E, Guttinger S, Calado A, DahlbergJE, Kutay U. 2004. Nuclear export ofmicroRNA precursors. Science 303:95–98.
Materna SC, Howard-Ashby M, Gray RF,Davidson EH. 2006. The C2H2 zinc fin-ger genes of Strongylocentrotus purpu-ratus and their expression in embryonicdevelopment. Dev Biol 300:108–120.
Megosh HB, Cox DN, Campbell C, Lin H.2006. The role of PIWI and the miRNAmachinery in Drosophila germline deter-mination. Curr Biol 16:1884–1894.
Mette MF, Aufsatz W, van der Winden J,Matzke MA, Matzke AJ. 2000. Tran-scriptional silencing and promoter meth-ylation triggered by double-strandedRNA. EMBO J 19:5194–5201.
Minokawa T, Rast JP, Arenas-Mena C,Franco CB, Davidson EH. 2004. Expres-sion patterns of four different regulatorygenes that function during sea urchindevelopment. Gene Expr Patterns 4:449–456.
Moazed D, Buhler M, Buker SM, Colmen-ares SU, Gerace EL, Gerber SA, HongEJ, Motamedi MR, Verdel A, Villen J,Gygi SP. 2006. Studies on the Mecha-nism of RNAi-dependent Heterochroma-tin Assembly. Cold Spring Harb SympQuant Biol 71:461–471.
Mochizuki K, Fine NA, Fujisawa T, Gor-ovsky MA. 2002. Analysis of a piwi-re-lated gene implicates small RNAs in ge-nome rearrangement in tetrahymena.Cell 110:689–699.
Mochizuki K, Gorovsky MA. 2005. A Dicer-like protein in Tetrahymena has distinctfunctions in genome rearrangement,chromosome segregation, and meioticprophase. Genes Dev 19:77–89.
Murchison EP, Stein P, Xuan Z, Pan H,Zhang MQ, Schultz RM, Hannon GJ.2007. Critical roles for Dicer in the fe-male germline. Genes Dev 21:682–693.
Park JK, Liu X, Strauss TJ, McKearin DM,Liu Q. 2007. The miRNA pathway intrin-sically controls self-renewal of Drosoph-ila germline stem cells. Curr Biol 17:533–538.
Ransick A, Davidson EH. 1993. A completesecond gut induced by transplanted mi-cromeres in the sea urchin embryo. Sci-ence 259:1134–1138.
Rast JP, Smith LC, Loza-Coll M, Hibino T,Litman GW. 2006. Genomic insights intothe immune system of the sea urchin.Science 314:952–956.
Rodriguez AJ, Seipel SA, Hamill DR, Ro-mancino DP, M DIC, Suprenant KA,Bonder EM. 2005. Seawi—a sea urchinpiwi/argonaute family member is a com-ponent of MT-RNP complexes. RNA 11:646–656.
Rozen S, Skaletsky H. 2000. Primer3 onthe WWW for general users and for biol-ogistprogrammers.MethodsMolBiol132:365–386.
Schultz J, Milpetz F, Bork P, Ponting CP.1998. SMART, a simple modular archi-tecture research tool: identification ofsignaling domains. Proc Natl Acad SciU S A 95:5857–5864.
Siffroi JP, Pawlak A, Alfonsi MF, TroalenF, Guellaen G, Dadoune JP. 2001. Ex-pression of the TAR RNA binding proteinin human testis. Mol Hum Reprod 7:219–225.
RNAI IN THE SEA URCHIN 3189
Song JJ, Smith SK, Hannon GJ, Joshua-Tor L. 2004. Crystal structure of Argo-naute and its implications for RISCslicer activity. Science 305:1434–1437.
Swofford DL. 2002. PAUP: phylogeneticanalysis using parsimony. Sunderland,MA: Sinauer Associates.
Thompson JD, Gibson TJ, Plewniak F,Jeanmougin F, Higgins DG. 1997. TheCLUSTAL_X windows interface: flexiblestrategies for multiple sequence align-ment aided by quality analysis tools. Nu-cleic Acids Res 25:4876–4882.
Verdel A, Jia S, Gerber S, Sugiyama T,Gygi S, Grewal SI, Moazed D. 2004.RNAi-mediated targeting of heterochro-matin by the RITS complex. Science 303:672–676.
Vlahou A, Gonzalez-Rimbau M, FlytzanisCN. 1996. Maternal mRNA encoding theorphan steroid receptor SpCOUP-TF islocalized in sea urchin eggs. Develop-ment 122:521–526.
Walton KD, Croce JC, Glenn TD, Wu SY,McClay DR. 2006. Genomics and expres-sion profiles of the Hedgehog and Notchsignaling pathways in sea urchin devel-opment. Dev Biol 300:153–164.
Wassenegger M, Heimes S, Riedel L,Sanger HL. 1994. RNA-directed de novomethylation of genomic sequences inplants. Cell 76:567–576.
Wei Z, Angerer RC, Angerer LM. 2006. Adatabase of mRNA expression patternsfor the sea urchin embryo. Dev Biol 300:476–484.
Yan KS, Yan S, Farooq A, Han A, Zeng L,Zhou MM. 2003. Structure and con-
served RNA binding of the PAZ domain.Nature 426:468–474.
Yeom KH, Lee Y, Han J, Suh MR, Kim VN.2006. Characterization of DGCR8/Pa-sha, the essential cofactor for Drosha inprimary miRNA processing. Nucleic Ac-ids Res 34:4622–4629.
Yi R, Qin Y, Macara IG, Cullen BR. 2003.Exportin-5 mediates the nuclear exportof pre-microRNAs and short hairpinRNAs. Genes Dev 17:3011–3016.
Yigit E, Batista PJ, Bei Y, Pang KM, ChenCC, Tolia NH, Joshua-Tor L, Mitani S,Simard MJ, Mello CC. 2006. Analysis ofthe C. elegans Argonaute family revealsthat distinct Argonautes act sequentiallyduring RNAi. Cell 127:747–757.
Zamore PD, Haley B. 2005. Ribo-gnome:the big world of small RNAs. Science 309:1519–1524.
![What is RNA Interference [RNAi]](https://static.documents.pub/doc/80x56/55354dc34a79596c038b469f/what-is-rna-interference-rnai.jpg)
![Genetically Modified Organism-Free RNA Interference · Genetically Modified Organism-Free RNA Interference: Exogenous Application of RNA Molecules in Plants1[OPEN] Athanasios Dalakouras,a,b,2,3](https://static.documents.pub/doc/80x56/605cd1054dc5810cd70565f5/genetically-modiied-organism-free-rna-genetically-modiied-organism-free-rna.jpg)
