+ All Categories
Home > Documents > Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled...

Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled...

Date post: 28-Mar-2015
Category:
Upload: nathan-fisher
View: 217 times
Download: 3 times
Share this document with a friend
Popular Tags:
41
Genes of cancer • Cancer is a disease of abnormal cells • Cancer cells proliferate in an uncontrolled fashion • The causes of cancer are quite diverse but the central role is played by DNA mutations in development of cancer
Transcript
Page 1: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Genes of cancer

• Cancer is a disease of abnormal cells

• Cancer cells proliferate in an uncontrolled fashion

• The causes of cancer are quite diverse but the central role is played by DNA mutations in development of cancer

Page 2: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Chemicals

radiation

infection

spontaneous

Errors in DNA replication

Mutation Cancer

Oncogenes

Tumour suppressor genes

Page 3: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Cancer related mutations affect the same two classes of genes : Oncogenes and

tumour suppressor genes

• Oncogenes are defined as genes whose presence can lead to cancer. They arise by mutation from normal genes (proto oncogenes) that code for proteins involved in stimulating cell proliferation and survival. By producing abnormal forms or excessive quantities of these proteins, oncogenes contribute to the uncontrolled proliferation and survival of cancer cells.

• In contrast to oncogenes which are abnormal genes, tumour suppressor genes are normal genes whose deletion or loss function can likewise lead to cancer. Tumour suppressor gene produce proteins that either directly or indirectly exert a restraining influence on cell proliferation and survival. The loss of such proteins can therefore allow cell proliferation and survival to evade normal restraints and controls.

Page 4: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Genetic flow of information

• Chromosomes within our cells have roughly 30,000genes.

• Each gene codes for a RNA molecule that is either directly used or used as a guide for the formation of protein

• DNA (store) to RNA (working form ) to protein (product)

Page 5: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

THE FLOW OF GENETIC INFORMATION

DNA RNA PROTEIN

DNA

1 2 3

1. REPLICATION (DNA SYNTHESIS)2. TRANSCRIPTION (RNA SYNTHESIS)3. TRANSLATION (PROTEIN SYNTHESIS)

Page 6: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

RNA polynucleotide chain

• 2’ -OH makes 3’, 5’ phosphodiester bond unstable

DNA polynucleotide chain

Page 7: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

05_06_compl_pairs.jpg

Page 8: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

01_06.jpg

Page 9: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Transcription

• The process in which a particular section of DNA (genes) are used to produce RNA is known as transcription

• Goal of transcription is to make an RNA copy of a gene.

• Only a small percentage of genes are actually being used to make RNA at a particular time in a particular cell

Page 10: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

The transcription process is tightly regulated in normal cells.

• Genes must be transcribed at the correct time.

• The RNA produced from the gene must be made in correct amount

• Only the required gene must be transcribed.

• Turning transcription off is just as important as turning it on.

Page 11: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

The steps of transcription

• A transcription factor recognises the start site (promoter) of a gene to be transcribed

• The enzyme that makes RNA (RNA polymerase) binds to transcription factor and recognises the start region

• The enzyme proceeds down the DNA making a copy until the end is reached.

• The enzyme falls of and RNA is released. This copying process may be repeated numerous times

• If the RNA is one that codes for protein it will leave the nucleus to enter the cytosol

Page 12: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Transcription and promoter elements for RNA polymerase II

transcription unit

exon exonpromoter

PTE

transcription element

Promoter (DNA sequence upstream of a gene)• determines start site (+1) for transcription initiation• located immediately upstream of the start site• allows basal (low level) transcription

Transcription element (DNA sequence that regulates the gene)• determines frequency or efficiency of transcription• located upstream, downstream, or within genes• can be very close to or thousands of base pairs from a gene• includes

enhancers (increase transcription rate)silencers (decrease transcription rate)response elements (target sequences for signaling molecules)

• genes can have numerous transcription elements

+1

Page 13: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Proteins regulating eukaryotic mRNA synthesis

General transcription factors• TFIID (a multisubunit protein) binds to the TATA box

to begin the assembly of the transcription apparatus• the TATA binding protein (TBP) directly binds the TATA box• TBP associated factors (TAFs) bind to TBP

• TFIIA, TFIIB, TFIIE, TFIIF, TFIIH1, TFIIJ assemble with TFIID

RNA polymerase II binds the promoter region via the TFII’s

Transcription factors binding to other promoter elements and transcription elements interact with proteins at the promoter and further stabilize (or inhibit) formation of a functional preinitiation complex

1TFIIH is also involved in phosphorylation of RNA polymerase II, DNA repair

(Cockayne syndrome mutations), and cell cycle regulation

Page 14: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

+1

TBP

TFIIDB

E F

H

J RNA pol II

initiation

• RNA pol II is phosphorylated by TFIIH on the carboxy terminal domain (CTD), releasing it from the preinitiation complex and allowing it to initiate RNA synthesis and move down the gene

Initiation of transcription and promoter clearance

P

PP

CTD

Page 15: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Transcription (elongation)

/antisense strand

Page 16: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Transcription (termination)

http://www.phschool.com/science/biology_place/biocoach/images/transcription/tcani.gif

terminator

RNA polymerase falls off

Animation:

Template strand 3’ATGCGACGGGTTCGT

RNA sequence

Coding strand 5’TACGCTGCCCAAGCA

Page 17: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Post-transcriptional modifications

Page 18: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Transcription factors

• The inappropriate activity of transcription factors has been identified in almost all types of known cancers, Some examples of transcription factors that malfunction in human cancers.

• P53- The protein that the p53 codes for is important because it controls the transcription of genes involved in causing cells to divide.

• Rb- The protein product of this gene works by blocking other transcription factors thus preventing transcription of key genes required for cell division to progress.

• The oestrogen receptor (ER) This protein binds oestrogen and the combination acts as transcription factor to turn on genes that enable target cells to divide.

Page 19: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

What is translation• After hnRNA production through the process of transcription, it is

processed in the nucleus to produce mRNA which is then released into cytosol.

• The mRNA is then recognised by the ribosomal subunits and the message is read by the ribosome to produce a protein. The information for the direction of protein synthesis is encoded in nucleotide sequence that makes up mRNA. Groups of three nucleotides (codons) are read by ribosomes and lead to the insertion of a particular amino acid in growing peptide.

• After the protein is formed it is folded to perform its function in the cell The proper folding, transportation, activity and eventual destruction of protein are all highly regulated processes. The genes that control these processes are often found to be damaged and malfunction in cancer cells.

Page 20: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Messenger RNA (mRNA)

m7GpppCap

5’5’ untranslated region

AUG

initiation codon

translated (coding) region

(AAAA)n

poly(A) tail

3’ untranslated region

UGAtermination codon

3’AAUAAA

Page 21: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Protein translation: summary

Initiation

Elongation

Termination

http://www.phschool.com/science/biology_place/biocoach/translation/init.html

Page 22: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Reading frame• reading frame is determined by the AUG initiation codon• every subsequent triplet is read as a codon until reaching a stop codon

...AGAGCGGA.AUG.GCA.GAG.UGG.CUA.AGC.AUG.UCG.UGA.UCGAAUAAA... MET.ALA.GLU.TRP.LEU.SER.MET.SER

• a frameshift mutation

...AGAGCGGA.AUG.GCA.GA .UGG.CUA.AGC.AUG.UCG.UGA.UCGAAUAAA...

• the new reading frame results in the wrong amino acid sequence andthe formation of a truncated protein

...AGAGCGGA.AUG.GCA.GAU.GGC.UAA.GCAUGUCGUGAUCGAAUAAA... MET.ALA.ASP.GLY

Page 23: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Cell division and mitosis

• For mitosis to take place the following must occur;• The genetic material , the DNA in chromosomes , must

be faithfully copied. This occurs via a process known as replication

• The organelle, such as mitochondria , must be distributed so that each daughter cell receives adequate amount to function

• The cytoplasm of the cell must be physically separated into two different cells.

• Many features of cancer cells are due to defects in the genes that control cell division.

Page 24: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

The mammalian cell cycle

G1

S

G2M

G0

DNA synthesis and histone synthesis

Growth and preparation forcell division

Rapid growth and preparation forDNA synthesis

Quiescent cells

phase

phase

phase

phase

Mitosis

Page 25: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Overview of the major events in mitosis

Interphase prophase metaphase anaphase telophase

In case of DNA damage or failure of critical processes

DNA damage repair or initiation of programmed cell death (apoptosis)

P53 stimulates induction of inhibitory proteins that halt DNA replication

Defects in p53 are associated with avariety of cancers

Page 26: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Chromosomes and genes

Page 27: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

DNA synthesis• Occurs in the S-phase• Every chromosome is copied with high fidelity. • In this process double stranded DNA is unwound and each

individual strand is used as a template for the production of complimentary strand.

• Errors may occur during replication that lead to changes in the nucleotide sequence of the chromosomes. If these changes occur within genes they can alter function of the cell. Human cells have evolved several mechanism to correct errors of this type but they are not perfect.

• These mistakes can lead to mutated genes.• Accumulation of mutations can lead to the development of cancer• There are several cancers types that are associated specifically with

breakdown of repair processes.

Page 28: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

DNA replication is semi-conservative

Parental DNA strands

Daughter DNA strands

Each of the parental strands serves as a template for a daughter strand

Parent strand 1 5’GATCCTAGGTACTGACCTTGC3’

Parent strand 2 3’CTAGGATCCATGACTGGAACG5’

Daughter strand

Daughter strand

Page 29: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Features of DNA Replication

• DNA replication is semiconservative– Each strand of template DNA is being copied.

• DNA replication is bidirectional– Bidirectional replication involves two replication forks,

which move in opposite directions

• DNA replication is semidiscontinuous– The leading strand copies continuously– The lagging strand copies in segments (Okazaki

fragments) which must be joined

Page 30: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Mechanisms of Repair

• Mutations that occur during DNA replication are repaired when possible by proofreading by the DNA polymerases

• Mutations that are not repaired by proofreading are repairedby mismatched (post-replication) repair followed byexcision repair

• Mutations that occur spontaneously and in response to mutagens at any time are repaired by excision repaired (base excision or nucleotide excision)

Page 31: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Mismatched (post-replication) repair

5’3’

CH3

CH3

CH3

CH3

• the parental DNA strands are methylated on certain adenine bases

• mutations on the newly replicated strand are identified by scanning for mismatches prior to methylation of the newly replicated DNA

• the mutations are repaired by excision repair mechanisms• after repair, the newly replicated strand is methylated

Page 32: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Some common type of DNA damage

• Depurination involves loss of the base adenine or guanine caused by hydrolysis of the bond linking it to DNA chain

• Deamination involves the removal of an amino group by hydrolysis

• Pyrmidine dimers are created by an environmental mutagen, the UV radiation in sunlight

Page 33: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Deamination of cytosine can be repaired

More than 30% of all single base changes that have been detected as a cause of genetic disease have occurred at 5’-mCG-3’ sites

Deamination of 5-methylcytosine cannot be repaired

Page 34: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Excision repair (base or nucleotide)

ATGCUGCATTGATAGTACGGCGTAACTATC

thymine dimer

AT AGTACGGCGTAACTATC

ATGCCGCATTGATAGTACGGCGTAACTATC

ATGCCGCATTGATAGTACGGCGTAACTATC

excinuclease

DNA polymerase

DNA ligase

(~30 nucleotides)

ATGCUGCATTGATACGGCGTAACT

ATGC GCATTGATACGGCGTAACT

AT GCATTGATACGGCGTAACT

deamination

ATGCCGCATTGATACGGCGTAACT

ATGCCGCATTGATACGGCGTAACT

uracil DNA glycosylase

repair nucleases

DNA polymerase

DNA ligase

Base excision repair Nucleotide excision repair

Page 35: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Defects in DNA repair or replication• Xeroderma pigmentosum• Ataxia telangiectasia• Fanconi anemia• Bloom syndrome• Cockayne syndrome

DNA repair activity

Life

sp

an

1

10

100 human

elephant

cow

hamsterratmouseshrew

Correlation between DNA repair activity in fibroblast cells fromvarious mammalian species and the life span of the organism

Page 36: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

The control of cell division.

• Is the DNA fully replicated?

• Is the DNA damaged?

• Are there enough nutrients to support cell growth

• If these checks fail normal cells will stop dividing

• Cancer cells do not obey these rules and will continue to grow and divide.

Page 37: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

18_17_arrest_checkpt.jpg

Page 38: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

The control of cell division

• Cells divide in response to external signals

• What are the signals that make cells stop dividing

• A lack of positive external signals

• Contact inhibition

• Cellular Senescence

Page 39: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

18_23_01_mitogens.jpg

Page 40: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

18_23_02_mitogens.jpg

Page 41: Genes of cancer Cancer is a disease of abnormal cells Cancer cells proliferate in an uncontrolled fashion The causes of cancer are quite diverse but the.

Cell division in cancer cells

• Cancer cells can divide without appropriate external signals

• Cancer cells do not exhibit contact inhibition

• Cancer cells divide without receiving the ‘all clear’ signal.


Recommended