Date post: | 18-Jan-2018 |
Category: |
Documents |
Upload: | sylvia-charles |
View: | 213 times |
Download: | 0 times |
Genetics…in the news.
Mutations
…are heritable changes in base sequences that modify the information
content of DNA.
Wild-type Allelestwo definitions
• General: any allele existing at a frequency greater than 1% in a natural population,
• Experimental Geneticist: the one allele that dictates the most commonly found phenotype in a population.
• Forward mutation: any change that changes a wild-type allele to a
different allele…
A+ --> arecessive mutation
b+ --> Bdominant mutation
a --> A+ , B --> b+ reversions
• Reverse mutations: novel mutant alleles can revert back to wild-type…
Mutant Classifications…by their effect on DNA
Substitutions
Mutagenic Agents
Base Analogs
Alkylating AgentsIntercalating Agents
Deaminating Agents
To Know
Mutant Classifications…by their effect on DNA
deletions and insertions
i d1 base?2 base?3 base?etc.
Frameshifts
Mutant Classifications…by their effect on DNA
inversions translocations
Trinucleotide Repeat Expansions
FMR1
Fragile X Mental Retardation 1
cgg cgg cgg cgg cgg cgg cgg cggcgg
...GCGCGGCGGTGACGGAGGCGCCGCTGCCAGGGGGCGTGCGGCAGCG...
…CTGGGCCTCGAAGCGCCCGCAGCCA
cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cggcgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg
cgg cgg cgg cgg cgg cgg cgg cgg cggcgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cggcgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg cgg ... > 230
Ames Testtesting for mutagenicity
More mutagenic?
Barbecue beefIceberg LettuceCold Beer
5’ 3’
3’ 5’
5’
5’
3’5’
N- -C
enhancer, silencer, core promoter?
? ? ? ??
AAUAAA
Transposable Elements
…a segment of DNA that can move to, or move a copy of itself to another locus on the same or a different chromosome (hopping DNA),
…may be a single insertion sequence, or a more complex structure (transposon) consisting of two insertion sequences and one or more intervening genes.
Inverted repeats.
Transcribed genes.
Transposable Elements
Transpositionnormal gene, normal RNA, normal protein,
transposon inserted in gene, abnormal RNA, abnormal protein, loss of function.
Transposons
Two transposable elements flanking other DNA, the whole complex ‘hops’.
Other genes.
5’ 3’
3’ 5’
5’
5’
3’5’
N- -C
?? ? ? ?
?AAUAAA
Assignments
• Chapter 7: Problems 7.1 - 7.12,
• Monday: Prokaryotic Genetics, 8.1 - 8.3s