1
Genome analysis and colonization properties of probiotic Symbioflor®2 E. coli Trudy M. Wassenaar, Claudia Beimfohr, Kurt Zimmermann, Florian Gunzer The probiotic product Symbioflor®2 consists of 6 different E. coli cultures. The complete genome sequence of these E. coli components revealed the presence of a number of viru- lence-associated genes. Their presence seems to be in conflict with a recorded history of safe use, and the observed low frequency of adverse effects over a period of over 6 years. The genome sequences were used to identify unique sequences for each component, for which strain-specific hybridization probes were designed. A colonization study was conducted whereby 5 volunteers were exposed to an exceptio- nally high, single dose of Symbioflor®2, to assess tolerance of the product, after which pre- sence of E. coli in their faeces was tested for a follow-up period of 30 weeks. Intake of the product did not result in severe side effect in any of the individuals, though mild side ef- fects were observed. Stool analysis showed that Symbioflor®2 E. coli had colonized all five persons for a period of 10 to 30 weeks. In 2 individuals there was evidence of competition between host E. coli and Symbioflor®2 E. coli, while in 2 others total E. coli levels increased persistently with at least a factor of 10 as a result of the received dose. In one individual, who had lacked detec- table levels of faecal E. coli at the time of exposure, long-term colonization was established, first by Symbioflor®2 E. coli exclusively which were later replaced by host E. coli strains. Mol. Microbiol. Genomics Consultants, Zotzenheim Vermicon AG, München SymbioPharm GmbH, Herborn Inst. Med. Microbiol. Hygiene, TU Dresden What we did What it means What we found Genome analysis Plasmid analysis Volunteer study Virulence-related loci Found in: hemolysin A (hlyABCD) G1-2, G6-7, G8 type 1 fimbriae (fimABCDEFGHI) G5, G4-9, G3-10 type 3 fimbriae (mrkABCDF, E-) G3-10 (plasmid) aerobactin (iucABCD, iutA) G1-2, G6-7, G8 enterobactin (entABCDEFS) in all iron dicitrate system (fecABCDEIR) G1-2, G6-7, G5, G4-9 serine protease autotransporter sigA G1-2, G6-7, G8 autotransporter, adhesine upaG G5, G4-9, G3-10 adhesin and siderophore receptor iha G1-2, G6-7, G8 colicin IB cib G1-2, G6-7, G8 colicin IK cka G1-2, G6-7, G8 (plasmid) colicin S4 G1-2, G6-7, G8 (plasmid) glutamate decarboxylase in all mmune globulin binding, increased serum survival (eibCDEFG) G1-2, G6-7, G4-9 Probe Sequence Color code prG1-2 ACAGGCAAACCAAAGGATTG prG3-10 GGCTGAACTCACTGGAAAGC prG4-9 CCCCTTTTGCATTTACCAAC prG5 AAAAATGCCCGGTTCTTCTTC pr23S CGACAAGGAATTTCGCTAC Plasmid in: Size, kb Nr. of CDS, relevant findings pSYM1 G3-10 50,572 60, conjugation protein, type 3 fimbrial prot, pSYM2 G3-10 4,197 3 pSYM3 G3-10, G5 1,934 1 pSYM4 G3-10, G4-9 1,304 1 pSYM5 G3-10 6,567 4, Transposases, adhesin, haemagglutinin pSYM6 G3-10 10,433 7, Transposases pSYM7 G5 4,452 5, mob operon pSYM8 G5 2,353 2 pSYM9 G5 12,686 7 pSYM10 G1-2, G6-7, G8 1,549 1 pSYM11 G5 3,215 1 PSYM12 G1-2, G6-7, G8 7,111 10, colicin S4, mob operon 60.2% 3,548 / 5,895 66.5% 3,708 / 5,579 64.8% 3,546 / 5,474 65.3% 3,608 / 5,529 59.6% 3,494 / 5,859 59.4% 3,367 / 5,668 59.2% 3,437 / 5,804 60.3% 3,600 / 5,971 59.6% 3,593 / 6,029 60.2% 3,631 / 6,027 60.2% 3,631 / 6,027 70.1% 3,677 / 5,248 66.9% 3,498 / 5,226 66.4% 3,495 / 5,265 59.9% 3,384 / 5,653 61.7% 3,308 / 5,360 61.4% 3,383 / 5,513 59.6% 3,487 / 5,853 59.9% 3,501 / 5,846 60.2% 3,536 / 5,869 73.6% 3,573 / 4,854 74.1% 3,607 / 4,865 65.7% 3,495 / 5,317 69.0% 3,428 / 4,970 67.0% 3,467 / 5,174 64.0% 3,561 / 5,567 65.4% 3,611 / 5,519 65.4% 3,643 / 5,567 84.5% 3,700 / 4,379 69.8% 3,491 / 5,004 76.9% 3,470 / 4,513 72.5% 3,473 / 4,788 68.1% 3,539 / 5,197 69.2% 3,568 / 5,157 68.4% 3,583 / 5,241 71.7% 3,547 / 4,948 78.1% 3,532 / 4,523 76.2% 3,591 / 4,715 70.2% 3,635 / 5,180 71.2% 3,660 / 5,138 70.3% 3,677 / 5,229 70.7% 3,478 / 4,921 71.3% 3,590 / 5,037 63.6% 3,564 / 5,605 64.9% 3,604 / 5,556 64.3% 3,619 / 5,631 79.1% 3,615 / 4,572 70.9% 3,607 / 5,090 71.0% 3,603 / 5,078 70.2% 3,626 / 5,162 70.9% 3,713 / 5,236 71.3% 3,718 / 5,217 70.7% 3,744 / 5,293 82.1% 4,211 / 5,128 87.2% 4,390 / 5,036 84.8% 4,319 / 5,093 O157:H7 5,335 of 4,624 O157:H7 5,335 of 4,624 CFT073 4,903 of 4,481 SMS-3-5 4,651 of 4,348 BL21 DE3 4,273 of 3,993 K12 MG1655 4,314 of 4,055 G3-10 4,981 of 4,351 G4-9 4,191 of 3,944 G5 4,500 of 4,228 G1-2 4,981 of 4,676 G6-7 5,166 of 4,658 CFT073 4,90 of 4,481 SMS-3-5 4,651 of 4,348 BL21 DE3 4,27 of 3,993 K12 MG1655 4,314 of 4,055 G3-10 4,98 of 4,351 G4-9 4,19 of 3,944 G5 4,500 of 4,228 G1-2 4,98 of 4,676 G6-7 5,166 of 4,658 G8 5,104 of 4,743 G8 5,104 of 4,743 Homology between proteomes 87.2 % 59.2 % Symbioflor®2 E. coli Apathogenic E. coli Pathogenic E. coli Most virulence-related loci are found in G1-2, G6-7 and in G8. core Unique pan { { Unique sequences were identified for G5, G4-9 and G3-10. A combined probe was identified for G1-2 + G6-7 + G8 (called G1-2 ) The probes were used for colony lift hybridization + Total E. coli counts in stools of volunteers Relative distribution of components Dynamics during the first week + Dosis for Volunteer A and C: 1·10 CFU, Volunteer B and E: 2·10 CFU, Volunteer D: 2·10 CFU 0% 20% 40% 60% 80% 100% 0% 20% 40% 60% 80% 100% 0% 20% 40% 60% 80% 100% 28 0% 20% 40% 60% 80% 100% 0% 20% 40% 60% 80% 100% Week 1 Week 2 3 4 5 6 78 9 10 11 12 Week 1 Wk 2 3 4 5 6 8 9 10 11 12 28 Week 1 Week 2 3 4 6 7 8 10 11 12 27 Week 1 Week 2 3 4 5 6 7 8 10 1112 27 Week 1 Week 2 3 4 36 34 28 S2 S2 S2 S2 S2 Volunteer A Volunteer B Volunteer C Volunteer D Volunteer E G1-2, G6-7, G8 G3-10 G4-9 G5 2 3 4 5 6 7 8 2 3 4 5 6 7 8 2 3 4 5 6 7 8 2 3 4 5 6 7 8 0 1 2 3 4 5 6 7 8 10 log CFU/gram stool 10 log CFU/gram stool 10 log CFU/gram stool 10 log CFU/gram stool 2 3 4 5 6 7 8 0 1 2 3 4 5 6 7 8 10 log CFU/gram stool Days Days Volunteer A: male, 38 years old, BMI of 23.9, did not report any side effects Volunteer E: female, 25 years old, BMI of 22.7, did not report any side effects. Took Ab at day 37 to treat sinusitis. Dropped out for 6 weeks. Volunteer C: male, 47 years old, BMI of 19.6, reported increased peristalsis and bowel movement 2 h after dose Volunteer B: male, 45 years old, BMI of 24.0, did not report any side effects Volunteer D: female, 27 years old, BMI of 20.3, reported abdominal cramp, flatulence and weakness which all resolved spontaneously. 10 10 10 10 10 10 10 10 2 3 4 5 6 7 8 0 7 14 21 28 35 42 49 56 63 70 77 84 105 126 147 168 189 A B C D E Features G3-10 G1-2 G4-9 G5 G6-7 G8 Nr. chromosomal contigs 5 89 33 68 53 103 Chromosome (bp) 4,999,441 5,107,160 4,548,568 4,794,933 5,248,261 5,180,708 G + C content (%) 50.89 50.74 50.69 50.80 50.73 50.67 Chromosomal CDS 4,785 5,011 4,190 4,484 5,155 5,092 rRNAs 22 22 22 22 22 22 tRNAs 87 90 72 84 83 80 Plasmids pSYM1 pSYM10 pSYM4 pSYM3 pSYM10 pSYM10 pSYM2 pSYM12 pSYM7 pSYM12 pSYM12 pSYM3 pSYM8 pSYM4 pSYM9 pSYM5 pSYM11 pSYM6 E Days CFU/g E. coli 1 week interval 3 weeks interval R 3,631 CDS are found in both genomes sharing at least 50% homology with a CDS of the other genome. In total 6027 CDS were thus pairwise com- pared, giving 60.2% homology This genome has 5104 CDS belonging to 4743 protein families Symbioflor E. coli predicted proteomes are more similar to each other and to apathogenic E. coli proteomes than to pathogenic strains. 9 9 8 microcin S The results show that prolonged colonization is restricted to those Symbioflor®2 components that contain more virulence-associated genes. We hypothesize that, instead of increasing virulence, these genes contribute to colonization fitness in the genetic background of these probiotic E. coli. These and related data will be published in: Wassenaar TM, Beimfohr C, Geske T, and Zimmermann K (2014) Voluntarily exposure to a single, high dose of Symbioflor®2 results in prolonged colonization of probiotic E. coli. Beneficial Microbes, accepted for publication. Wassenaar TM, Zschüttig A, Beimfohr C, Geske T, Cook H, Auerbach C, Zimmermann K, and Gunzer F. Genome analysis of a probiotic E. coli product with a recorded long history of safe use. Submnitted to Microbial Ecology. Zschüttig A, Auerbach C, Meltke S, Eichhorn C, Brandt M, Blom J, Goesmann A, Jarek M, Scharfe M, Zimmermann K, Wassenaar TM, Gunzer F. Complete sequence of probiotic Symbioflor2 E. coli strain G3-10 and draft sequences of Symbioflor2 strains G1-2, G4-9, G5, G6-7 and G8. To be submitted to GenomeAnnouncement. Plasmid
