Genome Editing of Hematopoietic Stem Cells to Treat Genetic Diseases
Matthew Porteus MD PhDDepartment of Pediatrics
Divisions of Stem Cell Transplantation and Regenerative Medicine, Hematology/Oncology and Human Gene Therapy
Institute of Stem Cell Biology and Regenerative MedicineChild Health Research Institute
Stanford [email protected]
14 March 2019
Potential Conflicts of Interest
CRISPR Therapeutics: Equity and SABAllogene Therapeutics: Equity and SAB
Managed through Stanford in accordance with their conflict of interests policy.
Honored to be included in a list of speakers who have transformed their fields
Kathy High: Curative gene therapy for hemophilia--from academic discovery to commercial product
Ching-Hon Pui: Leader in transforming pediatric ALL into a disease that is now routinely cured (>90%)
Neal Young: Transformed our understanding and treatment of aplastic anemia (>90% cured)
Honored to be in Seoul, South Korea where one of the leaders in genome editing has done his pioneering work
Professor Jin-Soo Kim PhDDirector, Center for Genome Engineering
Institute for Basic ScienceSeoul National University
Outline of Talk
1. Development of RNP/AAV6: a highly active and robust system for homologous recombination mediated genome editing (HR-GE)
2. Engineering Hematopoietic Stem and Progenitor Cells (HSPCs) to revert a single disease causing variant
3. Improving Specificity 4. Engineering HSPCs to secrete proteins to cross-correct for a
missing enzyme (synthetic biology)
Monogenic Diseases Permeate Medicine(6,000-10,000 such diseases)
(Patients: ~30 million in USA, ~350 million worldwide)
Hematology: Sickle Cell Disease/ThalassemiaHematology: Hemophilia
Pulmonary: Cystic FibrosisImmunology: Primary Immunodeficiencies (e.g. Severe
Combined Immunodeficiency (SCID))Cardiology: Familial Hypercholesterolemia
Dermatology: Epidermolysis bullosaGenetics: Muscular Dystrophy, MPS I
Neurology: Huntington’s Disease, Myotonic Dystrophy, NGLY1 deficiency
.
.Each patient affects a larger community of people(echoes of the disease) + life years saved
Genome Editing Provides a Precise Method of Genetically Engineering Cells
Precise Spatial Modification (DSB stimulates process by >1010)
Method to Break Things
Precise Spatial AND Nucleotide Modification of Genome
(DSB stimulates process by >105)
Method to Fix Things
Donor DNA
*
HomologousRecombination
(copy and paste)
Non-homologousend-joining(stitching)
Engineered Nuclease
Hgb A Hgb S Sickle (E6V)
Sickle Cell Disease is Caused by a Single Nucleotide Variant in the HBB Gene
Hertz Nazaire
Median Lifespan
United States: mid-40s(though taking medicine for pain >3 times/week)(neurocognitive damage starts occurring in first
years of life)
Africa: 5-8 years old
RBC Formation from Hematopoietic Stem Cells
In order to fix this cell…
… we need to fix this cell.
RBC Formation from Hematopoietic Stem Cells
Matched Sibling Donor Outcomes: 2016 Update
Mixed chimerism shows 20% corrected cells can
cure the disease (Tisdale and colleagues)
(though as low as 2-5% might provide significant
benefit (Walters and colleagues))
Replace Allogeneic Cells with Corrected Autologous Cells
Donor
Allogeneic Cells
CorrectedAutologous Cells
Genome Editing Provides a Precise Method of Genetically Engineering Cells
Precise Spatial Modification (DSB stimulates process by >1010)
Method to Break Things
Precise Spatial AND Nucleotide Modification of Genome
(DSB stimulates process by >105)
Method to Fix Things
Donor DNA
*
HomologousRecombination
(copy and paste)
Non-homologousend-joining(stitching)
Engineered Nuclease
Two Principles to Get High Frequencies of HR Mediated Editing: Good Nuclease + Lots of Donor
More Nuclease Leads to More
Editing (both HR and NHEJ Mediated)
More Donor Shifts to HR Mediated
Editing From NHEJ Mediated
Editing
Dever & Bak et al., under review Hendel, Kildebeck et al Cell Reports (2014)
The intracellular pathogen sensing
innate immune response is a barrier to
successful genome editing when
components are delivered as naked
DNA molecules
Gene Description Fold-Induction
IFNB1 interferon, beta 1, fibroblast 89.07
IFIT2 interferon-induced protein with tetratricopeptide repeats 2 83.49
IFIT1 interferon-induced protein with tetratricopeptide repeats 1 58.41
RSAD2 radical S-adenosyl methionine domain containing 2 55.08
OASL 2'-5'-oligoadenylate synthetase-like 52.97
--- class=mRNAlike lncRNA name=NULL transcriptId=HIT000062856 44.52
NR4A2 nuclear receptor subfamily 4, group A, member 2 42.77
--- accn=AF352781 class=mRNAlike lncRNA name=NULL ref=H-invitational v7.5 42.47
---havana:sense_intronic chromosome:GRCh37:8:39771748:39773240:1 gene:ENSG00000253838 gene_biotype:sense_intronictranscript_biotype:sense_intronic |
40.73
HERC5 HECT and RLD domain containing E3 ubiquitin protein ligase 5 32.09
CXCL11 chemokine (C-X-C motif) ligand 11 31.53
IFIT3 interferon-induced protein with tetratricopeptide repeats 3 24.65
CXCL10 chemokine (C-X-C motif) ligand 10 22.31
--- class=lncRNA name= ref=RefGeneNoncode transcriptId=NR_028308 21.42
CCL5 chemokine (C-C motif) ligand 5 21.08
IFI44 interferon-induced protein 44 18.9
EMP1 epithelial membrane protein 1 18.84
IDO1 indoleamine 2,3-dioxygenase 1 17.37
CSAG2 CSAG family, member 2, CSAG family, member 3 16.37
Collaboration with Agilent Research Laboratories
Nature Biotechnology 2015
Ribonucleoprotein (RNP): Purified Cas9 protein complexed to synthetic stabilized single guide molecule (s3gRNA)
0102030405060708090
Unm
odifi
ed MS
Unm
odifi
ed MS
5 µgCas9
protein
15 µgCas9
protein
Modified sgRNAs Enhance Editing when Delivered as a Ribonucleoprotein (RNP) Complex
Gene Correction using CRISPR/Cas9/gRNA and a non-integrating virus (AAV6)
Recombinant Adeno-Associated Virus (AAV6)
(non-integrating) Bak, Dever et al Nature Protocols (2018)
Combining Cas9/gRNA and rAAV6 Mediates High Targeting Efficiencies in peripheral blood
CD34+ HSPCs
RNP and AAV6 change gene expression much less significantly than Cas9 mRNA in CD34+
HSPCs
24h
6h
Cromer et al (2018) Molecular Therapywith Ayal Hendel and Agilent
106 57 221 208
Editing Sickle Variant in CD34+ HSPCs from Six Sickle Cell Disease Patients
Nature 2016
Do the gene corrected stem cells do what they are supposed to do?1. Make non-sickling red blood cells2. Retain their stem cell properties
Gene Corrected Patient Derived CD34+ HSPCs Differentiated in vitro into RBCs Generate High
Levels of HgbA and Low Levels of HgbS
Sample Hgb A Hgb S
Mock 0.73 +/- 1.0 99.27 +/- 1.0
Gene Corrected(RNP+AAV6) 92.5 +/- 4.3 7.5 +/- 4.3
Percent of Beta-Globin Derived Hemoglobin in Total RBC Population
(no selection)
N=6
Keeping the %S <30% stops disease progression
Allele Frequency in Human Cells at 16 Weeks Post-
Transplant into NSG Mice
High Frequencies of Gene Correction at HBB in Patient Derived CD34+ HSPCs is maintained after
transplantation into NSG mice
What about potential off-target INDELs?
Peter Marks (head of CBER, FDA): “We don’t want off-target events leading to serious adverse events.”
Implication: Off-target changes per se are not serious adverse events—only if they lead to functional adverse events.
Example: We do not let the fact that extra somatic mutations are generated by flying in a plane inhibit us from personally engaging with the worldwide biomedical research community.
Bioinformatic
Oligo capture
In vitro Cas9/gDNA cleavage
Multiple Methods to Identify Potential Off-Target Sites
COSMID GUIDE-Seq
CIRCLE-Seq Site Sequence Closest Gene Distance
(kb) Feature hg19 Location NHEJ Mock
R02 CTTGCCCCACAGGGCAGTAANGG HBB n/a Exon Chr11:5248198-5248220 54.7 0.767
COS1 GS1 CS2 OT1 TCAGCCCCACAGGGCAGTAAGGG GRIN3A 95.004 Intergenic Chr9:104595866-104595888 16.2 0.076
COS2 OT2 CCTCTCCCACAGGGCAGTAAAGG LINC01482 0.034 Intergenic Chr17:66624239-66624261 0.048 0.041
COS3 OT3 TTTTCCCCAAAGGGCAGTAATAGMYO16 n/a Intron Chr13:109818336-
109818358 0.012 0.007
COS8 GS2 CS7 OT4 GTGGCCCCACAGGGCAGGAANGG MAGEE2 1.209 Intergenic ChrX:75006240-75006262 0.003 0.005
COS7 GS3 CS4 OT5 GCTGCCCCACAGGGCAGCAANGG FAM101A 3.258 Intergenic Chr12:124803828-124803850 0.15 0.015
GS4 OT6 GATGCCATTCATAGCAGTCANCG C22orf34 225.248 Intergenic Chr22:49582904-49582926 0 0.001
COS23 OT7 CTCGCCCCTCAGGGCAGTAGTGG GREB1 n/a Intron Chr2:11777795-11777817 0.006 0.042
COS9 CS1 OT8 TGTGCCCCACAGAGCACTAANGG LOC101929350 1.3kb Intergenic Chr22:17230606-17230628 0.028 0.064
COS19 CS3 OT9 ATTGCCCCACGGGGCAGTGANGG LOC643339 n/a Intron Chr12:93549185-93549207 0.054 0.016
COS26 CS5 OT10 GTTGCCCCTCAGGACAGTACNGG LOC105370802 374kb Intergenic Chr15:46598112-46598134 n.d. n.d.
CS6 OT11 GAAGCCCTACAGGGCAGCAANGG NRSN1 416kb Intergenic chr6:23709573-23709595 0.024 0.006
COS15 CS8 OT12 ATGGCCCCACAAGGCAGAAANGG IFI27 2.3kb Intergenic Chr14:94585321-94585343 0.013 0.018
CS9 OT13 AGTGCCACACACAGCAGTAANGG DOCK5(H3K27Ac) 110kb Intergenic chr8:24931375-24931397 0.015 0.006
CS10 OT14 TGTGCACCACAGAGCAATAANGG ZNF716 183kb Intergenic chr7:57716460-57716482 0.019 0.04
CS11 OT15 GTTATCCCACAGGACAGTGANGG SFTA3 53kb Intergenic chr14:36889532-36889554 0.055 0.043
All bonafide Off-Target Sites (two) in CD34+ HSPCs using RNP were Identified by all three methods
with Ciaran Lee and Gang Bao (Rice University)
Qualitative Biochemical Understanding of Nuclease Specificity
p(Editing) ≈ c1[conc] * c2(Time) * c3(Kd) (on/off) * c4(Kcat) * c5(p(repair fidelity))
Kd ≈ (guideRNA binding energy)(Cas9-DNA binding energy)
Using SCD-CD34s
IDT HiFi SpCas9 (R691A) Mediates High Level Sickle Gene Correction while Reducing Off-Target INDELs
by > 1-log in Sickle Cell Patient Derived CD34+ HSPCs
Vakulskas, Dever, Camarena, Lee, Bao, Behlke(Nature Medicine (2018))
Scaling up the Gene Correction Process
Assay Specs Run 1 Run 2 Run 3 Run 4 Run 5 Run 6
Viability (%) >70% 90 79 65 75 75 80
Total Viable Cell Count Report 100
million24
million29
million73
million111
million145
million
Phenotypic Analysis
>80% CD34 85.0 99.8 99.7 93.0 92.0 92.0
Percent Allele Correction Report 56 41 39 37 44.5 52
Percent Cells Corrected >20% 65 47 53 54 ND 61
Hematopoietic Stem Cells
Harvested from Patient
Transplant Autologous Gene Corrected Cells Back into Patient
Myeloablative Busulfan(Non genotoxic conditioning)
Genome Editing: Gene correction
with nuclease mediated
homologous recombination
Moving Towards a Phase I/II Clinical Trial for Gene Correction for Sickle Cell Disease in 2019
Minimum: 2 x 106 CD34/kgIdeal: >5 x 106 CD34/kg
AtMinimum: 10% Gene Correction
Ideal: >20% Gene Correctionwhile
Passing Quality Control (QC) and Quality Assurance (QA) assays
GMP Grade HiFi Cas9 Protein (Aldevron)GMP Grade sgRNA (Agilent)
GMP Grade AAV6 (CMO)GMP Grade Electroporation (Lonza)
Minimum: 5 x 106 CD34/kgIdeal: >10 x 106 CD34/kg
Engineered hematopoietic stem cells to deliver protein therapeutics
Natalia Gomez-Ospina M.D., Ph.D.Assistant Professor - Division of Medical
GeneticsStanford Medicine - Stanford University
Engineering blood stem cells for autologous transplants for lysosomal diseases: Correction
of MPS I using human, genome-edited hematopoietic stem and progenitor cells
BioRxiv: doi: https://doi.org/10.1101/408757
The effect of a small amount of enzyme on the severity of the disease (MPS I)
Symptom Severe Attenuated
Cognitive impairment +++ ---
Coarse facial features +++ ---
Hydrocephalus +++ ---
Stiff joints +++ ++
Skeletal abnormalities +++ ++
Cardiac valvular disease +++ ++
Recurrent upper airway infection +++ +
Corneal clouding +++ +
Hepato/splenomegaly +++ +
Hearing loss +++ +
IDUA enzymatic activity 0.18% (0-06) 0.79% (0.3-1.8)
Severe
Attenuated
http://www.personalhealthnews.ca/education-and-advocacy/rare-genetic-diseases-deserve-a-
place-on-physicians-radars
Current Therapeutic Options for Severe MPS I (Hurler Syndrome)
• Enzyme Replacement Therapyo Challenges in crossing the blood-brain barrier (BBB)
• Allogeneic Stem Cell Transplant (blood derived cells deliver enzyme to tissues with cross-correction)o Toxicity of procedureo Transplants from donors who are carriers are less effective
than from homozygous wild-type donors (dose response)
IDUAEnzyme
Isolate CD34+ HSPCs
Genome editing:Cas9/sgRNA
X X
Enzyme-HSPCs
Autologous Transplant
TissueMacrophages and immune cells
Safe harbor
Using Genetically Engineered Cells to Deliver Missing Enzymes
Cas9
+
Targeted Integration of Expression Cassette into a Safe Harbor using Genome Editing
Cas9 Protein Synthetic MS modifiedRNA (single) RNP Electroporation
Electroporation-aidedTransduction of AAV6
E1 E2 E3CCR5
E3
E1 E2 E3CCR5
Promoter P2AEnzyme MarkerE3 E3
Promoter P2AEnzyme MarkerE3
DSBs
HR
1 2
3
Bak, Dever, and Porteus 2018– Nature Protocols
IDUA-HSPCs express stable, high levels of functional IDUA
Enzyme Expression in CD34+ HSPCsEnzyme Expression in Macrophages
Derived from CD34+ HSPCs
Biochemical and phenotypic correction of the MPSI phenotype by
IDUA-HSPCs
Biochemical Correction: Decreased Urinary GAGs Over Time
Phenotypic Correction of the Bone Defect
Behavioral Correction by IDUA-HSPCs
High On-Target INDELs with no measurable off-target INDELs at CCR5 using HiFi RNP in CD34+ HSPCs
with Ciaran Lee and Gang Bao (Rice University)
Porteus Lab (current)Ron BaikJoab CamarenaCarsten CharlesworthKyle Cromer PhDDaniel Dever PhDAmanda Dudek PhDNatalia Gomez-Ospina MD, PhDKazuya Ikeda PhDSruthi MantriRenata MartinNathalie MostrelMara Pavel-Dinu PhDSamantha ScharenbergCamille Sindhu PhDWai SrifaSriram Vaidyanathan PhDVolker Wiebking MD
Ginger ExleyCita NicolasLoan Nguyen
Annalisa Lattanzi PhD
Funding: NIH/NHLBI/NIAID, NIH/NDC, CIRM, Amon Carter Foundation, Laurie Kraus Lacob Faculty Scholar Fund, Binns Family Cord Blood Research Program. Chan-Zuckerberg Biohub, Sutardja Foundation, Taube Foundation
Division of Pediatric SCTRMMaria-Grazia RoncaroloSandeep SoniRajni AgarwalKen WeinbergRosa BacchettaAmi ShahRobby ParkmanKatja WeinachtAgnieszka CzechowiczAlice BertainaJulia ChuMelissa Mavers
CollaboratorsAnu NarlaJennifer AndrewsMichael JengBert GladerMohan Narla/Lionel Blanc
Rachel Lynn/Crystal Mackall
Nobuko UchidaAnn Tsukamoto (BOCo)
Ayal Hendel (Bar-Ilan Univ)
Rasmus Bak (Aarhus Univ)
Andreas ReinischRavi MajetiMichael ClearyGreg Gurtner
Laurakay Bruhn (Agilent)
Mark Behlke (IDT)Chris Vakulskas (IDT)
Suk See DeRavin (NIH)Harry Malech (NIH)
Gang Bao (Rice)Ciaran Lee (Rice)
Laboratory of Cell andGene Medicine (LCGM)Chy-Anh TranNeehar BhatiaHelen SegalAbla BakirPremanjali LahiriRashi Srivastava
Thank You(for your attention and the opportunity to present our work)