Chapter 21

Genomes and Their Evolution

Overview: Reading the Leaves from the Tree of Life

• Complete genome sequences exist for a human, chimpanzee, E. coli,

brewer’s yeast, nematode, fruit fly, house mouse, rhesus macaque,

among others

– Comparisons of genomes among organisms provide information

about the evolutionary history of genes and taxonomic groups

• Genomics is the study of whole sets of genes and their interactions

– The enormous amount of data generated in our studies of

genomics has spawned a

new field called bioinformatics

• Bioinformatics is the

application of

computational methods to

the storage and analysis

of biological data

Fig. 21-1

Concept 21.1: New approaches have accelerated the pace of genome sequencing

• The most ambitious mapping project to date has

been the sequencing of the human genome

– Officially begun as the Human Genome

Project in 1990, the sequencing was largely

completed by 2003

• The project had three stages:

– Genetic (or linkage) mapping

– Physical mapping

– DNA sequencing

Three-Stage Approach to Genome Sequencing

• The initial stage in sequencing the human genome was to construct a type

of genetic map called a linkage map

– A linkage map maps the location of several thousand genetic markers

on each chromosome

• The order of the markers and the relative distances between them

on this map are based on recombination frequencies

• The genetic marker may be a gene or

any other identifiable DNA sequence

(RFLPs, STRs)

– By 1992, researchers had

compiled a human linkage map

with ~5,000 markers

• This map allowed scientists to locate

other markers, including genes, by

testing for genetic linkage to the

known markers

Fig. 21-2-4

Cytogenetic map

Genes locatedby FISH

Chromosomebands

Linkage mapping1

2

3

Geneticmarkers

Physical mapping

Overlappingfragments

DNA sequencing

• The next stage was the physical mapping of the human genome

– A physical map expresses the distance between genetic markers, usually as the number of base pairs along the DNA

• It is constructed by cutting a DNA molecule (using restriction enzymes) into many short fragments and arranging them in order by identifying overlaps

• These fragments are prepared by DNA cloning using one of the following cloning vectors:

– A yeast artificial chromosome (YAC) that can carry inserted fragments made up of 1 million base pairs

– A bacterial artificial chromosome (BAC) that typically carries 100,000-300,000 bp

• After these long, cloned fragments are put in order, each fragment is cut into smaller pieces

– These smaller pieces are then cloned in plasmids or phages, ordered, and finally sequenced

Fig. 21-2-4

Cytogenetic map

Genes locatedby FISH

Chromosomebands

Linkage mapping1

2

3

Geneticmarkers

Physical mapping

Overlappingfragments

DNA sequencing

• The final stage of genome sequencing is to determine the

complete nucleotide sequence

– Thus was accomplished by sequencing machines, using

the dideoxy chain termination method

– The sequencing of all 3.2 billion base pairs of the haploid

human genome still presented a

formidable challenge, even with

automation

• In the 1980s, a productive lab

could usually sequence ~1,000

bp/day

• By 2000, each research center

was sequencing

1,000 bp/second

Fig. 21-2-4

Cytogenetic map

Genes locatedby FISH

Chromosomebands

Linkage mapping1

2

3

Geneticmarkers

Physical mapping

Overlappingfragments

DNA sequencing

Whole-Genome Shotgun Approach to Genome Sequencing

• An alternative approach to whole-genome sequencing was devised

by J. Craig Venter in 1992

– This whole-genome shotgun approach essentially skips the

linkage mapping and physical mapping stages

• It instead begins directly with the sequencing of random DNA

fragments

• Powerful computer programs

then assemble the resulting

fragments of overlapping

short sequences into a

single continuous sequence

Fig. 21-3-3

Cut the DNAinto overlappingfragments short enoughfor sequencing

1

2

3

4

Clone the fragmentsin plasmid or phagevectors.

Sequence eachfragment.

Order thesequences intoone overallsequencewith computer software.

• Both the three-stage process and the whole-genome

shotgun approach were used for the Human Genome

Project and for genome sequencing of other organisms

– At first many scientists were skeptical about the whole-

genome shotgun approach, but it is now widely used

as the sequencing method of choice

• This approach can miss some duplicated

sequences, however, underestimating the size of

the genome and missing genes in those regions

– A hybrid of the two approaches may thus be the most

useful in the long run

Concept 21.2 Scientists use bioinformatics to analyze genomes and their functions

• The Human Genome Project established databases and

refined analytical software programs to make data available on

the Internet

– This has accelerated progress in DNA sequence analysis

by making bioinformatics resources available to

researchers worldwide

• Bioinformatics resources are provided by a number of sources:

– National Library of Medicine and the National Institutes of

Health (NIH) created the National Center for Biotechnology

Information (NCBI)

– European Molecular Biology Laboratory

– DNA Data Bank of Japan

• The NCBI database of sequences in called Genbank

– Genbank includes the sequences of 76 million fragments of genomic DNA (~80 million base pairs)

– This database is constantly updated, doubling the amount of data it contains approximately every 18 months

– Any sequence in the database can be retrieved and analyzed using software from the NCBI website

• Available software allows online visitors to search Genbank for matches to:

– A specific DNA sequence

– A predicted protein sequence

– Common stretches of amino acids in a protein

• It also provides 3-D views of all protein structures that have been determined

Fig. 21-4

Identifying Protein-Coding Genes Within DNA Sequences

• One challenge in bioinformatics is recognizing unknown protein-coding genes and determining their function

– The usual approach uses software to scan stored sequences for transcriptional and translational start and stop signals, RNA-splicing sites, and other tell-tale signs of a protein-coding gene

– The software also looks for sequences called expressed sequence tags (ESTs) that correspond to sequences present in known mRNAs

• Comparison of sequences of “new” genes with those of known genes in other species may help identify new genes

– If a newly-identified sequence partially matches the sequence of a gene or protein whose function is well-known, this may suggest a similar function in both

– If the sequence is unlike anything ever seen before, protein function can be deduced through a combination of biochemical and functional studies

• The biochemical approach aims to determine the 3-D structure of the protein, including potential binding sites for other molecules

• Functional studies usually involve blocking or disabling the gene the determine its effects on phenotype

Understanding Genes and Their Products at the Systems Level

• The success in sequencing genomes and studying

entire sets of genes has encouraged scientists to

attempt similar systematic studies of all the

proteins encoded by the genome

– Proteomics is the systematic study of all

proteins encoded by a genome

• These studies are necessary to understand

how cells and organisms function since

proteins, not genes, carry out most of the

activities of the cell

How Systems Are Studied: An Example

• One basic application of the systems biology approach is to define gene

circuits and protein interaction networks

– This process begins with 1000s of predicted RNA transcripts

– Molecular techniques are then used to test interactions between the

whole or partial protein products of these transcripts

– Finally, statistical tests are used to select

interactions for which the data is strongest

– The vast number of protein-protein

interactions generated during these

experiments can be integrated into graphic

models using powerful computers,

mathematical tools, and newly developed

software

• Thus, the systems biology approach is possible

because of advances in bioinformatics

Fig. 21-5

Proteins

Application of Systems Biology to Medicine • A systems biology approach has several medical applications:

– The Cancer Genome Atlas project aims to understand how changes in biological systems lead to cancer

• 3 types of cancer are being analyzed by comparing gene sequences and patterns of gene expression in cancer cells with those of normal cells

• A set of ~2,000 genes in cancer cells are being sequenced at several different times during the progression of the disease to monitor changes due to mutations and rearrangements

– Silicon and glass “chips” have also been developed to hold a microarray of most of the known human genes

• Such chips are being used to analyze gene expression patterns in patients suffering from various cancers and other diseases

• The eventual aim of these chips is to tailor treatments to the unique genetic makeup of the patients, as well as their specific disease

– In the future, all people may carry a catalog of their DNA sequences along with their medical records with regions highlighted that predispose them to specific diseases

Fig. 21-6

Concept 21.3 Genomes vary in size, number of genes, and gene density

• By summer 2007, genomes had been sequenced for 500 bacteria, 45

archaea, and 65 eukaryotes including vertebrates, invertebrates, and plants

– Genomes of most bacteria and archaea range from 1 to 6 million base

pairs (Mb); genomes of eukaryotes are usually larger

• Most plants and animals have genomes greater than 100 Mb;

humans have 3,200 Mb

• Within each domain, however, there is no

systematic relationship between genome

size and phenotype

– Ex) The genome of F. assyriaca (a

flowering plant of the lily family)

contains 120,000 Mb, ~40X the size

of the human genome

Table 21-1

Number of Genes

• A similar difference also holds true for the number of genes among the 3 domains

– Bacteria and Archaea have fewer genes, in general, than eukaryotes

• Free-living bacteria and archaea have 1,500 to 7,500 genes

• Unicellular fungi have from about 5,000 genes and multicellular eukaryotes from 40,000 genes

– Within eukaryotes, the number of genes in a species is often lower than expected from simply considering the size of its genome

• Ex) The genome of C.elegans is 100 Mb and carries 20,000 genes, while the Drosophila genome is almost 2X as large (180 Mb) but only has ~2/3 the number (13,700) of genes

• Polypeptide diversity in eukaryotes mainly due to extensive alternative RNA splicing and post-translational modifications

Table 21-1

Gene Density and Noncoding DNA

• Gene density (number of genes per given DNA length) can

also be compared in different species

– Eukaryotes generally have larger genomes but fewer

genes in a given number of base pairs

• Humans and other mammals have the lowest gene

density

– Multicellular eukaryotes have many introns within

genes and noncoding DNA between genes

• In bacterial genomes, however, most of the DNA

codes for proteins, tRNA, or rRNA, with only a small

amount of other DNA containing regulatory

sequences, such as promoters

Concept 21.4: Multicellular eukaryotes have much noncoding DNA and many multigene families

• The bulk of most eukaryotic genomes consists of noncoding DNA sequences, often described in the past as “junk DNA”

– Much evidence indicates that noncoding DNA plays important roles in the cell

• Ex) Genomes of humans, rats, and mice show high sequence conservation for ~500 noncoding regions, a higher level of conservation than seen for protein-coding regions in these species

• This strongly suggests that these noncoding regions have important functions

• Sequencing of the human genome reveals that 98.5% does not code

for proteins, rRNAs, or tRNAs

– About 24% of the human genome codes for introns and gene-

related regulatory sequences

• The rest of the genome is located between functional genes

(intergenic DNA) and includes:

– Pseudogenes: former genes that have accumulated mutations

and are nonfunctional

– Repetitive DNA: consists of

sequences that are present in

multiple copies in the genome

• About three-fourths of repetitive

DNA is made up of transposable

elements and sequences related

to them

Fig. 21-7

Exons (regions of genes coding for protein

or giving rise to rRNA or tRNA) (1.5%)

RepetitiveDNA thatincludestransposableelementsand relatedsequences(44%)

Introns andregulatorysequences(24%)

UniquenoncodingDNA (15%)

RepetitiveDNAunrelated totransposableelements(15%)

L1sequences(17%)

Alu elements(10%)

Simple sequenceDNA (3%)

Large-segmentduplications (5–6%)

Transposable Elements and Related Sequences

• Both prokaryotes and eukaryotes have stretches of DNA that can move from one location to another within the genome

– These stretches are known as transposable (genetic) elements

– During the process of transposition, a transposable element moves from one site in a cell’s DNA to a different target site by a special type of recombination

• Transposable elements are sometimes called “jumping genes”

– This phrase is misleading because these elements never completely detach from the cell’s DNA

• Instead, the original and new DNA sites are brought together by DNA bending

Transposable Elements and Related Sequences

• The first evidence for wandering DNA segments came

from geneticist Barbara McClintock’s breeding

experiments with Indian corn

– McClintock identified changes in the color of corn

kernels that could only be explained by the

movement of some genetic elements from other

genome locations into

the genes for kernel

color

– This movement would

disrupt these genes

and thus change the

kernel’s color

Fig. 21-8

Movement of Transposons and Retrotransposons

• Eukaryotic transposable elements are of two types:

– Transposons: move within a genome by means of a DNA intermediate

• Transposons can move by a “cut-and-paste” mechanism that removes the element from the original site

• They can also move by a “copy-and-paste” method that leaves a copy behind in its original location

Fig. 21-9

Transposon

New copy oftransposon

Insertion

Transposonis copied

Mobile transposon

DNA ofgenome

(a) Transposon movement (“copy-and-paste” mechanism)

Retrotransposon

New copy ofretrotransposon

Insertion

Reversetranscriptase

RNA

(b) Retrotransposon movement

Movement of Transposons and Retrotransposons

• Retrotransposons: move by means of an RNA intermediate

– Retrotransposons always leave a copy at the original site during transposition because they are initially transcribed into an RNA intermediate

• To insert at another site, the RNA intermediate is first converted back to DNA by reverse transcriptase

– This enzyme is encoded in the retrotransposon itself

• Another cellular enzyme then catalyzes the insertion of this reverse-transcribed DNA at a new site

Fig. 21-9

Transposon

New copy oftransposon

Insertion

Transposonis copied

Mobile transposon

DNA ofgenome

(a) Transposon movement (“copy-and-paste” mechanism)

Retrotransposon

New copy ofretrotransposon

Insertion

Reversetranscriptase

RNA

(b) Retrotransposon movement

Sequences Related to Transposable Elements

• Multiple copies of transposable elements and related sequences are scattered throughout the eukaryotic genome

– A single unit is usually 100s-1000s of base pairs long

– These dispersed “copies” are similar but are usually not identical to one another

• In primates, a large portion (10%) of transposable element–related DNA consists of a family of similar sequences called Alu elements

– Many Alu elements are transcribed into RNA molecules; however, their function is unknown

• An even larger percentage (17%) of the human genome is made up of a type of retrotransposon called LINE-1 (L1)

– L1 sequences have a low rate of transposition and may help regulate gene expression

Other Repetitive DNA, Including Simple Sequence DNA

• About 15% of the human genome consists of duplication of long sequences

of DNA from one location to another

– This repetitive DNA probably arises due to mistakes during DNA

replication or recombination

• In contrast, simple sequence DNA contains many copies of tandemly

repeated short sequences

– Ex) GTTACGTTACGTTACGTTAC

• Simple sequence DNA is common in centromeres and telomeres,

where it probably plays structural roles in the chromosome

• These repeated units may contain anywhere between 2-500

nucleotides

– A series of repeating units of 2 to 5 nucleotides is called a short

tandem repeat (STR)

• The repeat number for STRs can vary among sites (within a

genome) or individuals

Genes and Multigene Families • Many eukaryotic genes are present in one copy per haploid set of chromosomes

– In the human genome and the genomes of many other plants and animals, these solitary genes make up less than ½ of the total transcribed DNA

• The rest of the genome occurs in multigene families, collections of identical or very similar genes

– Some multigene families consist of identical DNA sequences, usually clustered tandemly, such as those that code for RNA products

• Ex) A family of identical DNA sequences contain the genes for the 3 largest rRNA molecules

– These rRNA molecules are are transcribed from a single transcription unit that is repeated tandemly 100s- 1000s of times in one or several clusters in the genomes of multicellular eukaryotes

– The many copies of this rRNA transcription unit help cells to quickly make the millions of ribosomes needed for active protein synthesis

Fig. 21-10a

(a) Part of the ribosomal RNA gene family

18S

28S

28S18S 5.8S

5.8S

rRNA

DNA

DNA

RNA transcripts

Nontranscribedspacer Transcription unit

• The classic examples of multigene families of nonidentical genes are two

related families of genes that encode globins

– α-globins and β-globins are polypeptides of hemoglobin and are coded

by genes on different human chromosomes (16 & 11)

– The different forms of each globin subunit are expressed at different

times in development

• This allows hemoglobin to function effectively in the changing

environment of a developing animal

– Ex) Embryonic and fetal forms of

human hemoglobin have a higher

affinity for oxygen than adult

forms

– Several pseudogenes (green) are also

found in the globin gene family

• Pseudogenes are nonfunctional

versions of the functional genes

Fig. 21-10b

(b) The human -globin and -globin gene families

Heme

Hemoglobin

-Globin

-Globin

-Globin gene family-Globin gene family

Chromosome 16 Chromosome 11

21

2

1

G A

Embryo Embryo Fetus

Fetus

and adult Adult

Concept 21.5: Duplication, rearrangement, and mutation of DNA contribute to genome evolution

• The basis of change at the genomic level is

mutation, which underlies much of genome

evolution

– The earliest forms of life likely had a minimal

number of genes, including only those

necessary for survival and reproduction

• The size of genomes has increased over

evolutionary time, with the extra genetic

material providing raw material for gene

diversification

Duplication of Entire Chromosome Sets

• Accidents in meiosis can lead to one or more extra sets of

chromosomes, a condition known as polyploidy

– Although polyploidy is most often lethal, it can facilitate

the evolution of genes in rare cases

• One set of genes can provide their normal functions

in the organism

• The genes of the extra sets can then eventually

diverge by accumulating mutations, creating genes

with novel functions

– The outcome of these accumulations of mutations may

be the branching off of a new species

Alterations of Chromosome Structure

• Humans have 23 pairs of chromosomes, while chimpanzees have 24 pairs

– Following the divergence of humans and chimpanzees from a common ancestor, two ancestral chromosomes fused in the human line

• By comparing the chromosomal organization of many different species, we can make inferences about the evolutionary processes that shape chromosomes and may drive speciation

– In one study, researchers compared the DNA sequence of each human chromosome with the whole genome sequence of the mouse

• Large blocks of genes are found in both human and mouse chromosomes, indicating that the genes in each block stayed together during evolution

– These same comparative analyses were performed between chromosomes of humans and 6 other mammalian species

• This allowed researchers to reconstruct the evolutionary history of chromosomal rearrangements among these species

– They found many duplications and inversions of large portions of chromosomes that likely arose from mistakes during meiotic recombination

Fig. 21-11

Human chromosome 16

Blocks of DNAsequence

Blocks of similar sequences in four mouse chromosomes:

7 8

1617

• The rate of duplications and inversions seems to have accelerated about 100 million years ago

– This coincides with the time when large dinosaurs went extinct and mammals diversified

• This coincidence is likely not accidental, since chromosomal rearrangements are thought to contribute to the generation of new species

– This is because chromosomal rearrangements can lead to 2 populations that cannot successfully mate, one of the steps towards speciation

• Analysis of chromosomal breakage points associated with rearrangements showed that these spots are not randomly distributed

– Specific sites known as “hot spots” have been used over and over again

• Some of these “hot spots” correspond to locations that are associated with congenital diseases

Evolution of Genes with Related Functions: The Human Globin Genes

• Duplication events can lead to the evolution of genes with related functions

– The genes encoding the various globin proteins ( and ) evolved from

one common ancestral globin gene, which duplicated and diverged

about 450–500 million years ago

• After the duplication events, differences between the genes in the

globin family arose from the accumulation of mutations Fig. 21-13

Ancestral globin gene

Duplication ofancestral gene

Mutation inboth copies

Transposition todifferent chromosomes

Further duplicationsand mutations

-Globin gene familyon chromosome 16

-Globin gene familyon chromosome 11

Evo

luti

on

ary

tim

e

2 1

2

1

G A

Evolution of Genes with Related Functions: The Human Globin Genes

• Subsequent duplications of these genes and random mutations

gave rise to the present globin genes, which code for oxygen-

binding proteins

– The similarity in the amino acid sequences of the various

globin proteins supports this model of gene duplication and

mutation

Table 21-2

Evolution of Genes with Novel Functions

• The copies of some duplicated genes have diverged so much in evolution

that the functions of their encoded proteins are now very different

– Ex) the lysozyme gene was duplicated and evolved into the α-

lactalbumin gene in mammals

• Lysozyme is an enzyme that helps protect animals against bacterial

infection

• α-lactalbumin is a nonenzymatic protein that plays a role in milk

production in mammals

– Although their functions are quite different, these 2 proteins are very

similar in their amino acid sequences and 3-D structure

• Both genes are found in mammals, while only the gene for

lysozyme is found in birds

– This finding suggests that the lysozyme gene underwent

duplication after the divergence of avian and mammalian

lineages

Rearrangements of Parts of Genes: Exon Duplication and Exon Shuffling

• Rearrangement of existing DNA sequences within genes has also contributed to genome evolution

– Ex) The duplication or repositioning of exons has contributed to genome evolution

• Errors during meiosis can result in an exon being duplicated on one chromosome and deleted from the homologous chromosome

• Alternatively, occasional mixing and matching of different exons within a gene or even between 2 nonallelic genes due to errors in recombination can also occur

– This process is called exon shuffling and can lead to new proteins with novel functions

• Ex) The TPA protein that helps control blood clotting is thought to have arisen by several instances of exon shuffling and duplication

Fig. 21-14

Epidermal growthfactor gene with multipleEGF exons (green)

Fibronectin gene with multiple“finger” exons (orange)

Exonshuffling

Exonshuffling

Exonduplication

Plasminogen gene with a“kringle” exon (blue)

Portions of ancestral genes TPA gene as it exists today

How Transposable Elements Contribute to Genome Evolution

• Transposable elements also play an important role in shaping a genome over evolutionary time

– These elements can contribute to genome evolution in several ways:

• They can promote recombination, disrupt cellular genes or control elements, and carry entire genes or individuals exons to new locations

– Multiple copies of similar transposable elements may facilitate recombination between different chromosomes by providing homologous regions for crossing over

• Though most such alterations are lethal, an occasional recombination event may be advantageous to an organism

– Movement of transposable elements can also have direct consequences

• Insertion of transposable elements within a protein-coding sequence may block protein production

• Insertion of transposable elements within a regulatory sequence may increase or decrease protein production

• Transposable elements may carry a gene or groups of genes to a new location

• Transposable elements may also create new sites for alternative splicing in an RNA transcript

– In all cases, changes are usually detrimental but may on occasion prove advantageous to an organism

Concept 21.6: Comparing genome sequences provides clues to evolution and development

• Genome sequencing has advanced rapidly in

the last 20 years

• Comparative studies of genomes:

– Advance our understanding of the evolutionary

history of life

– Help explain how the evolution of development

leads to morphological diversity

Comparing Genomes

• Genome comparisons of closely related species help us understand

recent evolutionary events

– Alternatively, genome comparisons of distantly related species

help us understand ancient evolutionary events

• In either case, learning about characteristics that are shared

or divergent between groups increases our understanding of

evolutions

• The relationships

among species can

be represented by a

tree-shaped diagram

Fig. 21-15

Most recentcommonancestorof all livingthings

Billions of years ago

4 3 2 1 0

Bacteria

Eukarya

Archaea

Chimpanzee

Human

Mouse

010203040506070

Millions of years ago

Comparing Distantly Related Species

• Highly conserved genes are genes that have changed very little

over time

– These inform us about relationships among species that

diverged from each other a long time ago

• Ex) Comparisons of complete genome sequences of

bacteria, archaea, and eukaryotes indicate that these

groups diverged from each other between 2 and 4

billion years ago

– Highly conserved genes can also be studied in one model

organism, and the results applied to other organisms

• Ex) Several genes in yeast are so similar to certain

human disease genes that researchers have deduced

their functions by studying these genes in yeast

Comparing Closely Related Species

• The genomes of closely-related species are likely to show similar

organization due to their relatively recent divergence

– Genetic differences between closely related species can therefore be

more easily correlated with phenotypic differences

• For example, genetic comparison of several mammals with

nonmammals helps identify what it takes to make a mammal

– Human and chimpanzee genomes differ by 1.2%, at single base-pairs,

and by 2.7% because of insertions and deletions

• Several genes are evolving faster in humans than chimpanzees

– These include genes involved in defense against malaria and

tuberculosis, regulation of brain size, and genes that code for

transcription factors

• One particular gene called FOXP2 that encodes a

transcription factor shows evidence of rapid change in the

human lineage

– Evidence suggests that this gene functions in

vocalization in vertebrates

• Mutations in this gene can produce severe speech

and language impairment in humans, and well as

disruption of normal vocalizations in other animals

– There are only 2 amino acid differences between

human and chimpanzee FOXP2 proteins

• These differences may explain why humans but not

chimpanzees communicate by speech

• The strongest evidence for the function of the FOXP2 gene came from a “knock-out” experiment in which researchers disrupted this gene in mice and analyzed the resulting phenotype

– Mice produce ultrasonic squeaks, referred to as whistles, to communicate stress

• Researchers applied genetic engineering techniques to produce mice in which one or both copies of the FOXP2 gene were disrupted

• These mutant newborn pups were then separated from their mothers to induce vocalizations

– Homozygous mutant mice had malformed brains and failed to emit normal ultrasonic vocalizations

– Heterozygous mice also showed significant problems with vocalization

Fig. 21-16

Wild type: two normalcopies of FOXP2

EXPERIMENT

RESULTS

Heterozygote: one copyof FOXP2 disrupted

Homozygote: both copiesof FOXP2 disrupted

Experiment 1: Researchers cut thin sections of brain and stainedthem with reagents, allowing visualization of brain anatomy in aUV fluorescence microscope.

Experiment 2: Researchers sepa-rated each newborn pup from itsmother and recorded the numberof ultrasonic whistles produced bythe pup.

Experiment 1 Experiment 2

Wild type Heterozygote Homozygote

Nu

mb

er

of

wh

istl

es

Wildtype

Hetero-zygote

Homo-zygote

(Nowhistles)

0

100

200

300

400

Comparing Genomes Within a Species

• As a species, humans have only been around about 200,000 years and have low within-species genetic variation

– Variation within humans is due to single nucleotide polymorphisms, inversions, deletions, and duplications

– These variations are useful for studying human evolution and human health

• Ex) They can serve as markers for identifying genes that cause diseases or affect our health

Comparing Developmental Processes

• Evolutionary developmental biology, or evo-devo,

is the study of the evolution of developmental

processes in multicellular organisms

– Its aim is to understand how these processes

have evolved and how changes in them can

modify existing organismal features

• Genomic information has shown that minor

differences in gene sequence or regulation

can result in major differences in form

Widespread Conservation of Developmental Genes Among Animals

• Recall: Homeotic genes specify the identity of body segments in fruit flies and other animals

– Molecular analysis of the homeotic genes in Drosophila has shown that they all include a sequence called a homeobox

• This homeobox specifies an amino acid sequence called a homeodomain in the encoded protein

• An identical or very similar nucleotide sequence has been discovered in the homeotic genes of both vertebrates and invertebrates

– These resemblances even extend to the organization of these genes, as evidenced by the fact that vertebrate genes homologous to the homeotic genes of fruit flies have kept the same chromosomal arrangement

Fig. 21-17

Adultfruit fly

Fruit fly embryo(10 hours)

Flychromosome

Mousechromosomes

Mouse embryo(12 days)

Adult mouse

• From these similarities, we can deduce that the

homeobox DNA sequence evolved very early

in the history of life

– It must also have been sufficiently valuable

to organisms to have been conserved in

animals and plants virtually unchanged for

100s of millions of years

• Homeotic genes in animals were named Hox genes (short

for homeobox-containing genes) because homeotic genes

were the 1st genes found to have a homeobox

– Other homeobox-containing genes were later found

that do not act as homeotic genes

• These genes do not directly control the identity of

body parts

• Most of these genes, however, are associated with

development

– Ex) Homeoboxes are present in the egg-polarity

gene bicoid, as well as in several segmentation

genes and in a master regulatory gene for eye

development

• Researchers have discovered that the homeobox-encoded homeodomain is

the part of a protein that binds to DNA when the protein functions as a

transcriptional regulator

– The shape of the homeodomain allows it to bind to any DNA segment,

so by itself, it cannot select a specific sequence

– Instead, other domains in the protein determine which genes the

protein regulates

• Interactions of these other domains with transcription factors helps

the protein recognize specific enhancers in DNA

– Proteins with homeodomains probably regulate development by

coordinating the transcription of many developmental genes, switching

them on or off

• In the embryos of many animal species, different combinations of

homeobox genes are active in different parts of the embryo

– This selective expression of regulatory genes that vary in

space in time is critical to pattern formation

• Many other genes involved in development are also highly conserved from

species to species

– These include many genes encoding components of signaling

pathways

– These similarities among developmental genes in different animal

species raises questions as to how the same genes can be involved in

the development of very diverse animals

• Current studies suggest that small changes in the regulatory

sequences of particular genes cause changes in gene expression

patterns, leading to major

changes in body form

– Ex) These differing

patterns of expression of

Hox genes along the

body axis explain the

variation in number of

leg-bearing segments in

insects and crustaceans

Fig. 21-18

ThoraxGenitalsegments

Thorax Abdomen

Abdomen

• Recent research also suggests that the same Hox gene

product may have subtly different effects in different

species

– These effects include turning on new genes or turning

on the same genes at higher or lower levels

• In still other cases, similar genes direct different

developmental processes in different organisms

– These distinct developmental processes result in

diverse body forms

• Ex) Several Hox genes are expressed in the

embryonic and larval stages of the sea urchin, even

though these are nonsegmented animals

Comparison of Animal and Plant Development

• The last common ancestor of animals and plants was probably

a single-celled eukaryote

– This indicates that the processes of development must

have evolved independently in these two lineages

• Animals require morphogenetic movements of cells and

tissues

• Morphogenesis in plants relies primarily on differing

planes of cell division and on selective cell enlargement

– Despite these differences, there are still similarities in the

molecular mechanisms of development

• In both plants and animals, development relies on a

cascade of transcriptional regulators that turn genes on

or off

Comparison of Animal and Plant Development

• The genes that direct these processes, however, differ

considerably between plants and animals

– While many master regulatory switches in animals are

homeobox-containing Hox genes, those in plants belong to

a completely different family of genes called Mads-box

genes

• Although homeobox-containing genes can be found in

plants and Mads-box genes in animals, they do not

perform the same major roles in development that they

do in the other group

– This supports the idea that developmental programs

evolved separately in plants and animals

You should now be able to:

1. Explain how linkage mapping, physical mapping, and DNA sequencing each contributed to the Human Genome Project

2. Define and compare the fields of proteomics and genomics

3. Describe the surprising findings of the Human Genome Project with respect to the size of the human genome

4. Distinguish between transposons and retrotransposons

5. Explain how polyploidy may facilitate gene

evolution

6. Describe in general terms the events that may

have led to evolution of the globin superfamily

7. Explain the significance of the rapid evolution

of the FOXP2 gene in the human lineage

8. Provide evidence that suggests that the

homeobox DNA sequence evolved very early

in the history of life