Genomic Inheritance (Genetics)

GCB531Fall 2012

John Isaac Murray, Ph.D.

Genomic Inheritance outline

• Importance of genetics in the genomic era

• Mendelian inheritance

• Nonmendelian inheritance

• Population genomics and genome structure

Genomic Inheritance outline

• Importance of genetics in the genomic era

• Mendelian inheritance

• Nonmendelian inheritance

• Population genomics and genome structure

What is Genetics?“The branch of biology that deals with the transmissionand variation of inherited characteristics, in particular chromosomes and DNA” (wiktionary.org)

- Characteristics: “Phenotype”- Relevant DNA sequences: “Genotype” - Separable DNA sequence of this type are “genes”

In molecular biology, “gene” refers to a individual portion of the genome that is transcribed into a functional RNA. These definitions only partially overlap!

Co-expressionProtein interaction networks

Mutant phenotypes (all genes) Hypothesized

relationships

In functional genomics, genetics tests causality

Image: Piano et al, Wormbook 2006

Genetic mechanisms drive cancer progression

• Cancers develop as clones of cells

• Most cancers require multiple driver mutations

• Tumor cells are populations subject to selection

Genomic Inheritance outline

• Importance of genetics in the genomic era

• Mendelian inheritance

• Nonmendelian inheritance

• Population genomics and genome structure

Genotype PhenotypeClassical Mendelian inheritance

A simple cross

and y are DNA sequence variants on a chromosome

(y homozygote)

( y heterozygote)

is dominant; y is recessive

Chromosomes are the carriers of genetic information

genome.ucsc.edu

GENE NAME

Single nucleotide polymorphisms

a

a

a

a

a aa

Meiosis I Meiosis II

From momFrom dad

Recombination

Meiotic recombination allows assortment of genes on the same chromosome

Syntenic: on the same chromosome

Question 1You are studying a newly identified species of Martian which has Mendelian genetics. The Martians have either red or purple eye color, which is controlled by the P gene; the P allele is dominant and corresponds to purple eyes, and the recessive p allele corresponds to red eyes. Which of the following crosses will produce 75% purple eyes?

a) Pp X PPb) PP X PPc) Pp X Ppd) Pp X ppe) pp X pp

Answer 1c) Pp X Pp will give 75% purple (25% PP, 50% Pp) and 25%

red (pp) progeny

P p

P PP P

p P

Types of sequence changes

AGTATACCTATATCGGATAC

AGTATACCTAGATCGGATAC

AGTATACCTATATCGGATAC

AGTATACCTATCGGATAC

Copy number variations (CNVs) and chromosomal rearrangements

Single nucleotide polymorphisms(SNPs)

Small insertion/deletions (indels)or larger insertions/deletions

DNA sequence differences: mutations vs. variants

• A mutation is a deviation from the “Normal” DNA sequence for a species

• All species carry sequence polymorphisms that are common in the population

• Which sequence variants are considered mutantsdepends on the definition of normal!

• Can define based on phenotype but this can cause problems:–– Is red hair a mutant trait? What about dry earwax?

Resistance to poison ivy?• Alternative definition uses allele frequency: any allele

with frequency

Gene Mutations and Protein Function Mutation Type Consequence

Changes in Coding Region

Point Mutations• Missense,• Nonsense,• Frameshift

Loss of Function• Complete loss of the protein:

‐ null, loss‐of‐function• Reduction of protein’s ability to work: 

‐ hypomorph, reduction‐of‐function

Gain of Function• Increase in the protein’s function:‐ hypermorph, gain‐of‐function

• A protein that interferes with the wild‐type protein’s function:‐ antimorph, dominant negative

• Acquisition of a new function (or ectopic expression of the function):‐ neomorph, dominant gain‐of‐

function

Changes RNA Stability, or Splicing Defects

• Regulatory mutations,• Splice‐site mutations,• RNA processing mutations

Changes in Gene Dosage, or, Regulation

• Larger gene deletions• Inversions• Fusions, and• Duplications

often but not alwaysrecessive (e.g. RB)

often but not alwaysdominant (e.g. sickle cell)

Lessons learned from Mendelian diseasesa) Most disease genes were completely unsuspected on the basis of previous

knowledge.

b) Most monogenic disease mutations cause major changes in encoded proteins.

c) Disease-causing alleles are typically rare in the population.

e.g. CFTR(F508)

e.g. Thallasemia

Recessive traitsCystic FibrosisPhenylketonuriaSickle-cell anemiaAlbinismTay-Sachs disease

Dominant traitsHuntington diseaseAchondroplasiaMarfan syndromeNeurofibromatosis

X-linked traitsRed-green colorblindnessHemophilia A

Some Mendelian traitsAa Aa

aa aa aa

Aa aa

Aa Aa Aa aa Aa

aa aa Aa Aa aa

Aa

Mutations can be beneficial or both beneficial and harmful

• Many populations carry mutations causing persistent lactase expression (Dairy)

• Ccr5 mutations: resistance to HIV and smallpox infection

• Mutations in APP cause reduced risk of Alzheimerdisease

• Some recessive disease alleles are maintained in the population by heterozygote advantage:– Sickle cell heterozygotes are malaria-resistant– CF heterozygotes are cholera-resistant

A/C

Disease Gene

Linkage to a marker localizes genes to chromosomes

Statistical genetics: LOD score analysis (log likelihood ratio)

(RECESSIVE INHERITANCE)

Marker can be any trait whose location is known:Single nucleotide polymorphism (SNP)

Other DNA markers (RFLPs, SSLPs, STRs, etc)Visible phenotype (esp. in model organisms e.g. white eyes)

AC

AA

AC

AC

AC

AC

AA

AA

AA

AA

LOD score analysis measures significance of linkage

LOD

“Distance” units: percent recombination (“Centimorgans”)

LOD =

R = # RecombinantsN = # Nonrecombinants = Distance

Helps to know PHASE

LOD>3 indicates genome-wide significance

Log10( )Probability of observed pattern if linkedWith distance Probability of observed pattern if unlinked

A Cnormal disease

ACnormal disease

vs.

Question 2

• You sequence the genome of an individual with a dominant inherited disease and identify a heterozygous missense mutation in a protein kinase gene. You test for this mutation in other members of the (large) family and find that all 23 of the affected family members and none of the 19 unaffected at-risk family members carry this mutation. Which of these is true?a) The disease is caused by the protein kinase mutation.b) The mutation is significantly linked to the disease.c) The disease is caused by a different gene near the

protein kinase with the mutationd) Half of the normal kinase protein dose is not sufficient

for normal physiology

Answer 2

b) The mutation is significantly linked to the disease.

The family contains 42 nonrecombinants and 0 recombinants leading to a LOD score of >12 (LOD>3 is significant). Based on this information, either the mutation you identified, or another mutation nearby in the genome could be the cause of the disease. The whole-genome sequence data may be useful in determining the possibility of other nearby genes being important. Other experiments would be needed to determine conclusively whether you have identified the correct gene and why the mutation is dominant (for example, you could add the normal gene back to mutant cells, or delete the gene in a model organism).

Genomic Inheritance outline

• Importance of genetics in the genomic era

• Mendelian inheritance

• Nonmendelian inheritance

• Population genomics and genome structure

Most inherited human traits deviate from simple Mendelian inheritance

Most inherited human traits deviate from simple Mendelian inheritance

• Epigenetics (inherited, not DNA sequence)

• X-linked

• Mitochondrial inheritance

• Polygenic traits

Simple polygenic case: two independent recessive loci

Locus heterogeneity: an identical trait can result from alleles at more than one gene.

e.g. Mature Onset Diabetes in the Young 

(MODY):13 genes

RW Rw rw

RW

Rw

rw

rW

rW

♀

♂

:  RRww

:  rrWWSame PhenotypeDifferent Genotype

7/16 (vs 1/4 for single gene)

Genetic interactions

• If single mutants (e.g. dd or hh) have little or no phenotype, but the ddhh double mutant is lethal (d and h are synthetic lethal; d is an enhancer of h)

• If (ff) mutant phenotype is a result of too much H activity, the ffhh double mutant may be healthier(h is a suppressor of f)Note: the phenotype (not the gene) is being enhanced or suppressed

A B C D

E F G HPhenotype

Typical pathways are complex:

The word epistasis is sometimes used to summarize this logic

Polygenic case: two dependent recessive loci

Synthetic phenotype: double mutant for two genes has 

phenotype not seen in single mutants.

e.g. Mature Onset Diabetes in the Young 

(MODY):13 genes

RW Rw rw

RW

Rw

rw

rW

rW

♀

♂

rrww Rare genotype with distinct phenotype

1/16 (vs 1/4 for single gene)

In natural populations, variation rules

RedTallHighElevated

WhiteShortLowReduced

Flower colorHeightCholesterolRisk of diabetes…

Quantitative traits

A slightly different (additive) model (incomplete dominance)…

1:2:1 Phenotypic ratio

♀

♂

F0

F1

F2

x

x

True True

A a

A

aaa

AA Aa

Aa

These can be modified by environment too!

Polygenic Inheritance

The collection of multiple alleles for many genes can create phenotypic variation 

across a continuum

Low Height, Cholesterol, etc

XAaBbCcAaBbCc

High

1/64 1/646/64 15/64 20/64 15/64 6/64

Binary outcomes can derive from quantitative trait

AffectedUnaffected

“Liability Threshold” Model

GlycosylatedHemoglobin (HbA1C) 

Type‐2 Diabetes

6.5%

Risk can also itself be a quantitative trait

“Typical” monogenic disorderGenotype

Phenotype

Environment+ Chance

Genotype

Phenotype

Environment+ Chance

“Typical” common disease

Question 3A novel mongoose species has individuals with blue fur, brown fur or white fur. Fur pigment color is controlled by gene A. AA or Aa animals can produce only brown pigment, while aaanimals can produce only blue pigment. Another gene, B, controls pigment production: BB or Bb animals produce pigment while bb animals fail to produce pigment and are white. Match the crosses to the expected ratios of fur colors.

A) All BlueB) 9 Blue:4 White:3 BrownC) Half White, Half BrownD) 3 Blue:3 Brown:2 WhiteE) 3 Blue:1 Brown

1) AaBb X AaBb2) AaBB X AaBb3) AABB X aabb4) AaBb X aaBb5) AAbb X aaBb

Answer 3

A) All BlueB) 9 Blue:4 White:3 BrownC) Half White, Half BlueD) 3 Blue:3 Brown:2 WhiteE) 3 Blue:1 Brown

1) AaBb X AaBb2) AaBB X AaBb3) AABB X aabb4) AaBb X aaBb5) AAbb X aaBb

This describes a genetic interaction where the phenotype produced by the A genotype depends on the B genotype (one of the simplest form of multigenic inheritance)

Genomic Inheritance outline

• Importance of genetics in the genomic era

• Mendelian inheritance

• Nonmendelian inheritance

• Population genomics and genome structure

Mutation mechanisms and rates• How do DNA changes arise?

– Errors during DNA replication or recombination (and failure to fix by proofreading)

– Damage to DNA from chemicals, UV, ionizing radiation, etc (and failure of DNA damage repair)

• Rates– Mutation rate =~10-8 per base per generation (~60

new SNPs)– In addition, occasional new CNVs/deletions, etc–

Contributors to genomic diversity1) MutationNew alleles arise at 10-8 per nucleotide

2) SelectionSome alleles change the probability of survival: alleles increasing fitness are more likely to be fixed, those decreasing fitness are less likely to be fixed.

If we define normal fitness as 1, carriers of a dominant lethal mutation have a fitness of 0.

3) DriftAlleles can become more or less common by random chanceRemember: most new mutations are neutral (because they are not in functional sequence)

Drift depends on population size• Drift (random chance) is most

effective in small populations

• The probability that a neutral allele will eventually become fixed is equal to its allele frequency

• For a new mutation, this is 1/Ne (Neis “effective population size”

• Selection outweighs drift if the allele’s change in fitness is >1/Ne Image: Professor marginalia (wikimedia commons)

Nucleotide diversity in a population

At any point in time, the heterozygosity is given by

= 4 * * NeNe for humans is >~10,000 = ~1/1000This is the fraction of nucleotides that are different (SNPs) between you and me!(However several times more nucleotides are involved in larger structural variants (deletions, CNVs, etc)

The Hardy-Weinberg Law• Assumptions:

– Population is sufficiently large– Matings are random with respect to the locus in question– No appreciable rate of mutation– No selection against any particular genotype– No significant immigration of individuals from a population with allele

frequencies very different from the endogenous population.

• If those conditions are met for as little as one generation, then the allele frequencies and genotype frequencies will be in Hardy-Weinberg equilibrium.

p2 + 2pq + q2 = 1p and q are the allele frequenciesp2 and q2 are the homozygote frequencies in the population2pq is the heterozygote frequency (carrier frequency for

recessive human diseases)

Signatures of selectionCan genomes tell which changes are important?1. Purifying selection reduces nucleotide diversity and

evolutionary divergence at sites experiencing selectionNew mutations are damaging and are lost by selection more than predicted by neutral theory

2. Positive selection increases nucleotide diversity and evolutionary divergence at sites experiencing selection

Changes are advantageous; mutations are retained longer and fixed by selection more often than predicted by neutral theoryRecent positive selection reduces variation and increases fixation of new alleles in the region surrounding the selected site

3. Species-specific lossMay be a case of positive selection; specific deletion of regions (such as regulatory sequences) that are conserved across other species may have contributed to evolution of human traits

Reduced diversity around site of selection

Ancestral chromosomes

**** * * * * * * * * * * * ** * ** * * *

*:New mutation gives selective advantage*:Other mutations that happen to be on the same chromosome

After one generation (recombination +

selection)

**** * * * * * * * * * * * ** * ** * * *

After many generation

**** * * * * * * * * * * * ** * ** * * *

**** * * * * * * * * * * * ** * ** * * *

**** * * * * * * * * * * * ** * ** * * *

**** * * * * * * * * * * * ** * ** * * ***** * * * * * * * * * * * ** * ** * * ***** * * * * * * * * * * * ** * ** * * ***** * * * * * * * * * * * ** * ** * * ***** * * * * * * * * * * * ** * ** * * *

**** * * * * * * * * * * * ** * ** * * *

**** * * * * * * * * * * * ** * ** * * ***** * * * * * * * * * * * ** * ** * * *

Linkage Disequilibrium

Linkage disequilibrium reflects the non-random association of alleles at tightly linked markers.

Variants on the same ancestral chromosome are likely to remain together despite recombination, provided they are sufficiently tightly linked.

A collection of SNPs in high LD with each other is called a haplotype

Haplotype lengths depend on many factors (local recombination rates, selection, age of the alleles, etc)

When LD is very high, alleles of linked markers can sometimes be used as surrogates for the state at nearby loci.

**** * * * * * * * * * * * ** * ** * * *

**** * * * * * * * * * * * ** * ** * * ***** * * * * * * * * * * * ** * ** * * *

**** * * * * * * * * * * * ** * ** * * ***** * * * * * * * * * * * ** * ** * * ***** * * * * * * * * * * * ** * ** * * *

**** * * * * * * * * * * * ** * ** * * *

**** * * * * * * * * * * * ** * ** * * *

Question 4The sea squirt Ciona savignyi has an effective population size Ne about 100 times larger than the human population, but a similar mutation rate. What fraction of the genome would you predict is heterozygous for sequence variants in a typical individual?A) 1/10,000B) 1/1000C) 1/500D) 1/10E) 1/2

Question 4A) 1/10

The heterozygosity is proportional to the effective population size: since the human heterozygosity is ~1/1000, the Cionaheterozygosity should be 100-fold higher (~1/10).

In fact the measured heterozygosity is ~5% for SNPs and ~16% for indels:Extreme genomic variation in a natural population. Kerrin S. Small, Michael Brudno, Matthew M. Hill and Arend Sidow. PNAS 2007

Note that the reverse applies for critically endangered species (e.g. Amur Leopard with Ne

Magnus Manske (via wikimedia commons)

Image Attributions

Christoph Bock (via wikimedia commons)

(via wikimedia commons)

Many others: images placed in the public domainSlides: Maja Bucan, Arupa Ganguly, Ben Voight, David Gasser

Professor marginalia(wikimedia commons)