GENOMIC REARRANGEMENTS IN HUMAN AND MOUSE AND THEIR
CONTRIBUTION TO THE WILLIAMS-BEUREN SYNDROME PHENOTYPE.
by
Edwin James Young
A thesis submitted in conformity with the requirements
for the degree of Doctor of Philosophy,
Institute of Medical Science
University of Toronto
© Copyright by Edwin James Young (2010)
ii
Genomic rearrangements in human and mouse and their contribution to the Williams-
Beuren Syndrome phenotype.
Doctor of Philosophy (2010)
Edwin James Young
Institute of Medical Science
University of Toronto
Abstract:
Genomic rearrangements, particularly deletions and duplications, are known to cause
many genetic disorders. The chromosome 7q11.23 region in humans is prone to recurrent
chromosomal rearrangement, due to the presence of low copy repeats that promote non-allelic
homologous recombination. The most well characterized rearrangement of 7q11.23 is a
hemizygous 1.5 million base pair (Mb) deletion spanning more than 25 genes. This deletion
causes Williams-Beuren Syndrome (WBS; OMIM 194050), a multisystem developmental
disorder with distinctive physical and behavioural features.
Other rearrangements of the region lead to phenotypes distinct from that of WBS. Here
we describe the first individual identified with duplication of the same 1.5 Mb region, resulting
in severe impairment of expressive language, in striking contrast to people with WBS who have
relatively well preserved language skills. We also describe the identification of a new gene for a
severe form of childhood epilepsy through the analysis of individuals with deletions on
iii
chromosome 7 that extend beyond the boundaries typical for WBS. This gene, MAGI2, is part of
the large protein scaffold at the post-synaptic membrane and provides a new avenue of research
into both the molecular basis of infantile spasms and the development of effective therapies.
Individuals with smaller than typical deletions of 7q11.23 have delineated a minimal
critical region for WBS and have implicated two members of the TFII-I transcription factor
family. To better understand the contribution of these genes to WBS, I have generated animal
models with these genes deleted singly and in combination. Disruption of the first gene,
Gtf2ird1, resulted in phenotypes reminiscent of WBS including alterations in social behaviour,
natural fear response and anxiety. An alteration in serotonin function was identified in the
frontal cortex and may be linked to these behavioural phenotypes. Together with a model for the
second gene, Gtf2i, and the double deletion model that was generated using Cre-loxP
technology, these resources will permit the study of the individual and additive effects of
hemizygosity for Gtf2i and Gtf2ird1 and will greatly expand our understanding of the role the
TFII-I gene family in WBS.
iv
Acknowledgements
I want to first start off by thanking my supervisor Dr. Lucy Osborne and my committee
members Dr Steve Scherer and Dr Paul Franklin for all their technical assistance and especially
their patience. A special thank you to Drs. Bernice Morrow, Sue Quaggin and Johanna
Rommens, for agreeing to be members of my doctoral defense committee. I would also like to
thank the members of the Osborne lab past and present, in particular Jen O‘Leary for the
countless hours of ‗scientific discussion‘ over the last several years.
Thank you to the many collaborators and their respective lab members that I have had the
priveledge of working with including Dr John Roder, Dr Howard Mount, Dr Paul Fletcher, Dr
Evelyn Lambe (especially Eliane Proulx), Dr Andras Nagy (especially Marina Gerstenstein), the
Marsden Lab (especially Brent Steer), The Centre for Applied Genomics, Dr Carolyn Mervis, Dr
Colleen Morris and the WBS family members.
A special thanks my parents and family for although I do not think they always
understood why I did it, they were always there with motivation and enthusiasm. I would also
like to thank my inlaws Lino and Kathy Vrigini for all encouragement and support they have
provide me and my family throughout my studies.
Of course the greatest thanks have to go to my family; my wife Lisa, my son Owen and
our dog Lily. Lisa, I knew from the beginning that the journey would not be an easy one but
your unwavering love and support made the completion my studies possible. Although my son
Owen will not remember this period in his life, his safe arrival in the last year of my studies
provided not only a impetus to finish but also a great deal of perspective of what is truly
important in my life.
v
TABLE OF CONTENTS
Abstract ii
Acknowledgements iv
Table of Contents v
List of Figures x
List of Tables xii
List of Abbreviations xiv
Internet Resources xxi
Chapter I: Introduction to Williams-Beuren syndrome. 1
1.1 Literature Review. 2
1.1.1: Williams-Beuren syndrome history 2
1.1.2: Williams-Beuren syndrome clinical phenotype 3
1.1.3: Williams-Beuren syndrome cognitive and behavioral phenotype 7
1.1.4: Williams-Beuren Syndrome Cognitive Profile (WBSCP): 7
1.1.5: Genomic structure and molecular basis of Williams-Beuren Syndrome 11
1.1.6: WBS genotype-phenotype correlations 13
1.1.7: Identification of a WBS critical region 14
1.1.8: Transcription factors in human disease 15
1.1.9: GTF2I transcription factor gene family 17
1.1.10: The transcription factor GTF2I 19
1.1.11: The transcription factor GTF2IRD1 22
1.1.12: The transcription factor GTF2IRD2 23
1.2: Research Aims and Hypothesis 24
1.3: References
26
Chapter II: Genomic rearrangements of the human 7q11-q21 region 35
2.1: Literature Review. 36
2.1.1: Chromosomal rearrangements and the human genome 36
2.1.2: Chromosomal rearrangements and association with disease 39
2.1.3: Inversion of the WBS region 40
2.1.4: Duplication of the WBS region 41
2.1.5: Large deletions of the WBS region 42
2.2: Methods: Severe Expressive-Language Delay Related to Duplication of the
Williams–Beuren Locus
43
2.2.1: Participants 43
2.2.2: Clinical evaluation of language fundamentals and physical
manifestations
44
2.2.3: Fluorescence in situ hybridization 44
vi
2.2.4: Single-copy microsatellite markers 45
2.2.5: Site Specific Nucleotide (SSN) dosage analysis 45
2.2.6: Genomic analysis using quantitative PCR 46
2.2.7: Expression analysis using quantitative PCR 46
2.3: Methods: The Common Inversion of the Williams-Beuren Syndrome Region at
7q11.23 Does Not Cause Clinical Symptoms
47
2.3.1: Participants 47
2.3.2: Developmental assessment 48
2.3.3: Inversion testing 49
2.3.4: Expression analysis using quantitative PCR 49
2.3.5: Copy Number Variation (CNV) analysis 51
2.3.6: Genomic analysis using quantitative PCR 52
2.4: Methods: Infantile Spasms Is Associated with Deletion of MAGI2 on
Chromosome 7q11.23-q21.11
52
2.4.1: Participants 52
2.4.2: Preparation of genomic DNA 53
2.4.3: Copy Number Variation (CNV) analysis 53
2.4.4: Genomic analysis using quantitative PCR 54
2.5: Results: Duplications and its Association with Speech Language Delay 56
2.5.1: Mild physical manifestation of 7q11.23 duplication 56
2.5.2: Severe expressive language delay is the most striking feature of
7q11.23 duplication
58
2.5.3: Duplication of the 1.5 Mb WBS region 60
2.5.4: Single-copy microsatellite markers 61
2.5.5: The duplication is the reciprocal of the WBS deletion 64
2.5.6: Genes within the duplication show altered expression 64
2.6: Results: Common Inversion Does Not Cause Clinical Symptoms 66
2.6.1: Clinical assessment 66
2.6.1.1: Medical and family history Participant 1 67
2.6.1.2: Medical and family history Participant 2 67
2.6.1.3: Physical examination Participant 1 68
2.6.1.4: Physical examination Participant 2 70
2.6.2: INV-1 participant 1 and 2 developmental assessment 72
2.6.3: Inversion testing using three-colour interphase FISH 76
2.6.4: INV expression analysis 76
2.6.5: Copy Number Variation (CNV) analysis 79
2.7: Results: Identification of MAGI2 Deletions and its Association with IS 81
2.8: Conclusion and Discussion: 86
2.8.1: Severe expressive language delay related to duplication of the
Williams–Beuren locus:
86
2.8.2: The common inversion of 7q11.23 does not cause clinical symptoms 94
2.8.3: Infantile spasms (IS) is associated with deletion of MAGI2 102
2.9: References: 107
Chapter III: Analysis of Gtf2ird1 Mouse Model: 121
vii
3.1: Literature Review: 122
3.1.1: Contribution of the genes telomeric to elastin to the Williams-Beuren
syndrome phenotype
122
3.1.2: The neurobiology of fear, emotion and social cognition 125
3.1.3: The unique social profile seen in Williams-Beuren syndrome 126
3.1.4: Increased levels of generalized anxiety and specific phobias in WBS 128
3.1.5: Role of serotonin in emotional behaviors 130
3.2: Material and Methods: 132
3.2.1: Generation of targeted Gtf2ird1 mouse model 132
3.2.2: Expression analysis 133
3.2.3: General morphological analysis 135
3.2.4: Resident intruder/Olfactory function test 136
3.2.5: Elevated plus maze 136
3.2.6: Cube exploration/novel object recognition test 137
3.2.7: Locomotor activity in the Open Field 138
3.2.8: Morris Water Maze Test 138
3.2.9: Context and cued fear conditioning 139
3.2.10: Neurochemical analyses 140
3.2.11: Rotorod analysis 141
3.2.12: Microarray analysis 141
3.2.13: Western blotting analysis 142
3.2.14: Immunohistochemistry 143
3.2.15 Golgi-Cox Staining 143
3.2.16: Brain slice preparation and electrophysiology 144
3.2.17: Statistical Analysis 146
3.3: Results: 146
3.3.1: Characterization of Gtf2ird1 mice: 147
3.3.2: Phenotypic analysis of Gtf2ird1 targeted mice 151
3.3.3: Analysis of body weight 151
3.3.4: Assessment in the Open Field 152
3.3.5: Gtf2ird1-/-
mice are less anxious in the elevated plus maze 154
3.3.6: Gtf2ird1-/-
mice display deficits in cued based fear conditioning 155
3.3.7: Resident Intruder: Gtf2ird1-/-
mice are less aggressive and engage in
more social interaction
157
3.3.8: Gtf2ird1-/-
mice have normal visuo-spatial learning and memory 159
3.3.9: Gtf2ird1-/-
mice display cerebellar structural abnormalities and
muscular deficits along with deficits in motor co-ordination on the
rotorod test:
160
3.3.10: Gtf2ird1-/-
mice show altered serotonin metabolite levels in various
brain regions:
165
3.3.11: Alterations in neuronal activity in Gtf2ird1-/-
mice 167
3.3.12: Serotonin elicits larger outward currents in layer V pyramidal neurons
in Gtf2ird1-/-
mice
169
3.3.13: 5-HT-elicts direct outward currents mediated by 5-HT1A receptor in
Gtf2ird1-/-
mice.
171
3.3.14: Serotonin 5-HT1A outward currents are unchanged in prefrontal layer 173
viii
II/III in Gtf2ird1-/-
mice
3.3.15: Other inhibitory currents are not enhanced in layer V in Gtf2ird1-/-
mice 173
3.3.16: Spine density in layer V pyramidal cells in Gtf2ird1-/-
mice is
unchanged
175
3.3.17: 5-HT receptor expression is unchanged in Gtf2ird1-/-
mice 177
3.3.18: Identification of stress-induced changes in gene expression in Gtf2ird1-
/- mice using microarray analysis
179
3.4: Conclusion and Discussion: 182
3.4.1: Gtf2ird1+/-
and Gtf2ird1-/-
mice show mild growth retardation 183
3.4.2: Changes in behavior including aggression and anxiety and sociability in
Gtf2ird1-/-
mice
186
3.4.3: Gtf2ird1-/-
mice display deficits in muscle function 189
3.4.4: Gtf2ird1-/-
mice have altered fear-based learning, but normal spatial
learning and memory:
191
3.4.5: Gtf2ird1-/-
mice show altered serotonin metabolite levels in the brain 192
3.4.6: Gtf2ird1-/-
mice show altered neuronal activity 194
3.4.7: Implications of elevated 5-HT1A currents in Gtf2ird1-/-
mice 195
3.4.8: Altered stress-induced gene expression in the frontal cortex of
Gtf2ird1-/-
mice
199
3.5: References:
202
Chapter IV: Mouse Models: 215
4.1: Literature Review: 216
4.1.1: Mouse genome engineering 216
4.1.2: Existing mouse models of WBS genes 220
4.2: Methods: 226
4.2.1: Generation of Gtf2iloxP
mouse model 226
4.2.2: Preparation of genomic DNA 229
4.2.3: Genomic copy number analysis using conventional and quantitative
PCR
229
4.2.4: Re-deriving of parental Gtf2iloxP
G10 line 230
4.2.5: Identification and characterization of gene trap clones 230
4.2.6: Expression analysis of gene trap ES cells 232
4.2.7: Generation of gene trap mice 235
4.2.8: Generation and characterization of Gtf2i gene family deletion mice 235
4.2.9: Determination of methylation status of loxP sites 238
4.2.10: X-gal staining of the mouse cortex 239
4.3: Results: 240
4.3.1: Generation and characterization of Gtf2iloxP
mice 240
4.3.2: Identification and characterization of gene trap mice 242
4.3.3: Gtf2ird1GT+-
null mice are viable, Gtf2iGT+
-null mice are embryonic
lethal
243
4.3.4: Reduced expression of ― trapped‖ alleles 244
ix
4.3.5: TFII-IRD1 protein expression is predominantly in layer V of the frontal
cortex
246
4.3.6: TFII-I protein is strongly expressed throughout the brain 249
4.3.7: Determination of methylation status of loxP sites 250
4.3.8: Identification of cre-induced genomic recombination 252
4.4: Conclusion and Discussion 254
4.5: References
263
Chapter V: Summary and Future Direction: 269
5.1: Introduction 270
5.1.1: Summary: 270
5.1.2: Genomic rearrangements of the human 7q11.23-21.11 region 271
5.1.3: Targeting of Gtf2ird1 results in increased sociability, reduced fear and
aggression, altered serotonin metabolism and deficits in motor
function/co-ordination
273
5.1.4: Generation of gene trap and deletion mouse models for the Gtf2i gene
trap family
274
5.1.5: Future direction 275
5.2: References: 278
x
LIST OF FIGURES
Chapter I: Introduction to Williams-Beuren syndrome.
FIGURE 1.1. WBS patient with typical facial features 4
FIGURE 1.2. Example of spatial abnormalities 9
FIGURE 1.3. Physical map of the WBS region 12
FIGURE 1.4. Reported cases of individuals with atypical deletions of the WBS
region
14
FIGURE 1.5. Structural elements of the the proteins encoded by the Gtf2i gene
family members
18
Chapter II: Genomic rearrangements of the human 7q11-q21 region.
FIGURE 2.1. NAHR mechanisms resulting in deletions and duplications 37
FIGURE 2.2. Comparison of the faces of individuals with WBS and dup7q11.23 57
FIGURE 2.3. FISH analysis of the dup7q11.23 patient 61
FIGURE 2.4. Map of telomeric breakpoint region in dup7q11.23 patient 65
FIGURE 2.5. Participant 1 at age 17 years 68
FIGURE 2.6. Detection of 7q11.23 inversion using three-color FISH 76
FIGURE 2.7. Summary of copy number variants identified in patient 1 80
FIGURE 2.8. Summary of interstitial deletions of 7q11.23-q21.1 in cases with and
without infantile spasms
82
FIGURE 2.9. Comparison of human and mouse MAGI2 gene structure 103
FIGURE 2.10. MAGI2 expression in various tissues 104
Chapter III: Analysis of Gtf2ird1 Mouse Model:
FIGURE 3.1. Targeted disruption of the murine Gtf2ird1 gene 148
FIGURE 3.2. Disruption of Gtf2ird1 results in truncated transcript. 149
FIGURE 3.3. Decreased expression of full length Gtf2ird1 150
FIGURE 3.4. Alteration in body weight of Gtf2ird1-/-
mice 152
FIGURE 3.5. Behavioral Changes observed in the Open Field. 153
FIGURE 3.6. State and trait anxiety are reduced in Gtf2ird1-/-
mice 155
FIGURE 3.7. Altered cued-based fear conditioning in Gtf2ird1-/-
mice 156
FIGURE 3.8. Decreased aggression and increased sociability in V during the
resident-intruder test
158
FIGURE 3.9. Gtf2ird1-/-
mice perform normally in the Morris water maze 160
FIGURE 3.10. Decreased Purkinje Cell layer length in paraflocculus of Gtf2ird1-/-
mice
162
FIGURE 3.11. Altered grip strength in Gtf2ird1-/-
mice 163
FIGURE 3.12. Deficits in motor co-ordination in Gtf2ird1-/-
mice 164
FIGURE 3.13. Reduced c-Fos mRNA levels in the frontal cortex of Gtf2ird1-/-
mice 167
FIGURE 3.14. Reduced c-Fos-IR levels in layer V of the the frontal cortex of 168
xi
Gtf2ird1-/-
mice
FIGURE 3.15. Enhanced outward currents in layer V pyramidal neurons in Gtf2ird1-/-
mice
170
FIGURE 3.16. Enhanced outward currents are mediated by 5-HT1A receptors in
Gtf2ird1-/-
mice
172
FIGURE 3.17. Other inhibitory currents are not enhanced in layer V of the Gtf2ird1-/-
mice
174
FIGURE 3.18. Dendritic spine density is unaltered in Gtf2ird1-/-
mice 176
FIGURE 3.19. Decreased expression of Trpc4 in Gtf2ird1-/-
mice using qPCR and
Western Analysis
181
Chapter IV: Mouse Models:
FIGURE 4.1. Gene trapping mechanism 220
FIGURE 4.2. Syntenic WBS regions in human and mouse 222
FIGURE 4.3. Gap repair targeting of Gtf2i 228
FIGURE 4.4. Trans allelic meiotic recombination (TAMERE) 236
FIGURE 4.5. Analysis of targeted GTF2IloxP
ES cell lines 242
FIGURE 4.6. Genotyping of Gtf2i and Gtf2ird1 gene trap mice 244
FIGURE 4.7. Expression of Gtf2i and Gtf2ird1 in Gene Trap cell lines 245
FIGURE 4.8. Western blot analysis of Gtf2i gene family member expression in gene
trap and recombinant mouse lines.
246
FIGURE 4.9. Expression of TFII-IRD1/LacZ in various region of the mouse brain 248
FIGURE 4.10. Expression of TFII-I/LacZ in various region of the mouse brain 249
FIGURE 4.11. Methylation status of lox71 and loxP sites in Gtf2i and Gtf2ird1 gene
trap mice
251
FIGURE 4.12. Identification of Gtf2i gene family deletion 253
xii
LIST OF TABLES
Chapter I: Introduction to Williams-Beuren syndrome
Table 1.1 Clinical symptoms of Williams-Beuren syndrome 5
Table 1.2. Transcription factors that cause disease by haploinsufficiency 16
Chapter II: Genomic rearrangements of the human 7q11-q21 region.
Table 2.1. Contiguous Gene Disorders associated with chromosomal rearrangements 40
Table 2.2. Primers used for Expression analysis 50
Table 2.3. qPCR Primers Used to Characterize MAGI2 Breakpoints 55
Table 2.4. Standard Scores on Intellectual and Vocabulary Assessments 59
Table 2.5. Single-Copy Microsatellite Analysis Using Markers from Within the
WBS Region
63
Table 2.6. Genes Within the Duplication Show Altered Expression. 66
Table 2.7. Clinical and neurobehavioral features of individuals with Williams-
Beuren syndrome and of Participants 1 and 2
71
Table 2.8. Standard scores on intellectual and adaptive behaviour assessments for
Participants 1 and 2 and for adolescents and young adults with Williams-
Beuren syndrome
75
Table 2.9. Expression analysis of genes from the WBS region in individuals who
have WBS or individuals in the general population who have WBSinv-1
78
Table 2.10. Copy number variant analysis of Participants 1 and 2 80
Table 2.11. Summary of clinical features in participants with deletions of
chromosome 7q11.23-q21.1
84
Chapter III: Analysis of Gtf2ird1 Mouse Model:
Table 3.1. Primers for quantitative PCR amplification from cDNA 134
Table 3.2. Serotonin metabolite 5HIAA levels are increased in the amygdala,
parietal cortex and occipital cortex
166
Table 3.3. Expression of serotonin receptors in the frontal cortex of Gtf2ird1-
targeted mice.
178
Table 3.4. Microarray results for genes whose expression was increased or decreased
two-fold or greater.
179
Chapter IV: Mouse Models:
Table 4.1. Primers used in qPCR screening of Gtf2iloxP
targeted clones 230
Table 4.2. Primers used in genotyping of Gtf2iloxP
and gene trap mice 232
Table 4.3. Primers used in expression analysis of gene trap clones 234
xiii
Table 4.4. Primers used to genotype gene trap mice 235
Table 4.5. Primers used to genotype Gtf2i gene family deletion mice 237
Table 4.6. qPCR primers used to identify genomic rearrangements in Gtf2i gene
family deletion and duplication mice
238
Table 4.7. Primers used in bisulfite sequencing 239
Table 4.8 Trans-loxer males, litter sizes and efficiency of cre-induced
recombination
253
xiv
LIST OF ABBREVIATIONS, DISEASES AND GENE NAMES
5-HIAA 5-hydroxyindoleacetic acid
5-HT Serotonin
5-HT1A Serotonin 1A receptor
5-HT1B Serotonin 1B receptor
5-HT2A Serotonin 2A receptor
5-HT2C Serotonin 2C receptor
5-HTP 5-hydoxytryptophan
ACC Anterior cingulate cortex
ACE Agonist-induced Ca2+
entry
ACSF Artificial cerebrospinal fluid
ACTB Beta-actin
ACTH Adrenocorticotropic hormones
ADHD Attention deficit hyperactivity disorder
AMPA α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid
ANOVA Analysis of variance
APDC 2R,4R-4-Aminopyrrolidine-2,4-dicarboxylate
ASD Autism Spectrum Disorder
ASR Acoustic Startle Response
BAC bacterial artificial chromosome
BAZ1B Bromodomain Adjacent To Zinc Finger Domain, 1B
BDNF Brain-Derived Neurotrophic Factor
BSA Bovine Serum Albumin Or Basal Synaptic Activity
BTK Bruton Tyrosine Kinase
CA Chronological Age
xv
CaMKII Calmodulin Kinase II
CALN1 Calneuron 1
CELF-Preschool 2 Clinical Evaluation Of Language Fundamentals—Preschool Version 2nd
Ed.
CMT1A Charcot-Marie-Tooth Disease, Type 1A
CNS Central Nervous System
CNV Copy Number Variation
CR Conditioned Response
Cre Cyclization Recombination
CREB cAMP Response Element Binding
CREBP cAMP Response Element Binding Protein
CSF Cerebrospinal Fluid
CLIP2 Cytoplasmic Linker Protein 2
DA Dopamine
DAS Differential Abilities Scale
DD Distal Deletion
DGS DiGeorge Syndrome
DOPAC Dihydroxyphenylacetic Acid
EBV Epstien-Barr Virus
EDTA Ethylenediaminetetraacetic Acid
EEG Electroencephalograms
EGR1 Early Growth Response 1
EIF4H Eukaryotic Initiation Factor 4A
ELN Elastin
EPM Elevated Plus Maze
ERK Extracellular Signal-Regulated Kinase-1
ES Cell Embryonic Stem Cell
EVT Expressive Vocabulary Test
xvi
FISH Fluorescent In Situ Hybridization
FKBP6 FK506 Binding Protein 6
fMRI Functional MRI
FOXP2 Forkhead Box Protein P2
FZD9 Frizzled-9
GABA Gamma-Aminobutyric Acid
GABAA GABA Receptors (A-Type)
GABAB GABA Receptors (B-Type)
GAD Generalized Anxiety Disorder
GCA General Conceptual Ability
GIRK Gi/O-Protein Linked Inwardly Rectifying Potassium
GTF2I General Transcription Factor 2I
GTF2IRD1 General Transcription Factor 2I Repeat Domain Containing Protein 1
GTF2IRD2 General Transcription Factor 2I Repeat Domain Containing Protein 2
HEK Human Embryonic Kidney
HIP1 Huntingtin Interacting Protein 1
HLH Helix-Loop-Helix Domain
HMBS Hydroxymethylbilane Synthase
HNPP Hereditary Neuropathy With Liability To Pressure Palsies
HPLC High Performance Liquid Chromatography
HPRT1 Hypoxanthine Phosphoribosyltransferase 1
HVA 4-Hydroxy-3- Methoxyphenylacetic Acid
IC Insular Cortex
IGTC International Gene Trap Consortium
IIH Idiopathic Infantile Hypercalcemia
IR Immunoreactivity
IS Infantile Spasms
xvii
K-BIT Kaufman Brief Intelligence Test
KO Knockout
LacZ Beta-Galactosidase
LAT2 Linker for Activation of T Cells 2 (formerly WBSCR5)
LCR(S) Low-Copy Repeat(S)
LI Language Impairment
LIMK1 LIM Domain Kinase 1
loxP Locus of X-Over P1
LTD Long Term Depression
LTP Long Term Potentiation
LZ Leucine Zipper
MAGI2 Membrane-Associated Guanylate Kinase Inverted-2 (also known as S-
SCAM, Synaptic Scaffolding Molecule)
MAPK Mitogen Activated Protein Kinase
Mb Megabase (Million Base Pair)
MCR Minimal Critical Region
MEF2C Myocyte Enhancer-Binding Factor 2C
mGlur2/3 Metabotropic Glutamate Receptors Type 2 And 3
MLPA Multiplex Ligation-Dependent Probe Amplification
MaoA Monoamine Oxidase A
MRI Magnetic Resonance Imaging
NAHR Non Allelic Homologous Recombination
NCF1 Neutrophil Cytosolic Factor 1
NCoR Nuclear Receptor Co-Repressor
NE Norepinephrine
NEL Normalized Expression Level
NEO Neomycin
NMDA N-Methyl-D-Aspartic Acid
xviii
NPE Non-Pre-Exposed
NS Not Significant
OFC Orbitofrontal Cortex
OFT Open Field Test
OMIM Online Mendelian Inheritance In Man,
ORF Open Reading Frame
PB Phosphate Buffer
PBS Phosphate Buffered Saline
PCR Polymerase Chain Reaction
P/D Deletion of the WBS Syntenic Region (Chromosome 5G2) in the Mouse
PD Proximal Deletion
PE Pre-Exposed
PFA Paraformaldehyde
PFC Prefrontal Cortex
PGK1 Phosphoglycerate Kinase 1
PKA Protein Kinase A
PKC Protein Kinase C
PLC Phospholipase C
POM121 Pore Membrane Protein Of 121 kDa
PPI Prepulse Inhibition
PPS Peripheral Pulmonary Stenosis
PPVT-III Peabody Picture Vocabulary Test—3rd
Edition.
qPCR Quantitative Polymerase Chain Reaction
Rb Retinoblastoma Protein
RFC2 Replication Factor C (Activator 1) 2
RT-PCR Reverse Transcription Polymerase Chain Reaction
SA Splice Acceptor
xix
SDHA Succinate Dehydrogenase
SDS-PAGE Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis
SEM Standard Error of the Mean
SERPIND1 Serpin Peptidase Inhibitor, Clade D (Heparin Cofactor), Member 1.
SERT Serotonin Transporter
SIB-R Scales of Independent Behavior-Revised
SHFM Split Hand/Foot Malformation
SLI Specific Language Impairment
SMC Smooth Muscle Cell
SMS Smith-Magenis Syndrome
SN Substantia Nigra
SNP(s) Single Nucleotide Polymorphism(s)
SRE Serum Response Element
SRF Serum Response Factor
SSN Site Specific Nucleotide
SSRI(S ) Serotonin Reuptake Inhibitor(S)
STX1A Syntaxin 1A
SVAS Supravalvular Aortic Stenosis
Sycp1 Synaptonemal Complex Protein 1
TAMERE Targeted Meiotic Recombination
TBP TATA-Box Binding Protein
TBS Tris-Buffered Saline
TBST TBS + 0.05% Tween
TCP Toronto Centre For Phenogenomics
TFII-I Transcription Factor 2 I
TFII-IRD1 Transcription Factor 2 I Repeat Domain Containing Protein 1
TFII-IRD2 Transcription Factor 2 I Repeat Domain Containing Protein 2
xx
TK Thymidine Kinase
TPH1 Tryptophan Hydroxylase 1
TPH2 Tryptophan Hydroxylase 2
TRIM50 Tripartite Motif-Containing 50
TRIM74 Tripartite Motif-Containing 74
TRPC4 Transient Receptor Potential Cation Channel, Subfamily C, Member 4
TST Tail Suspension Test
TTX Tetrodotoxin
UTR Untranslated Region
VCFS Velocardiofacial Syndrome
VMAT2 Vesicular Monoamine Transporter 2
VTA Ventral Tegmental Area
WASI Wechsler Abbreviated Scale Of Intelligence
WBS Williams-Beuren Syndrome
WBSCP Williams-Beuren Syndrome Cognitive Profile
WBSCR Williams-Beuren Syndrome Chromosome Region
WBSinv-1 Williams-Beuren Syndrome Inversion 1
WT Wild Type
xg relative centrifugal force
X-Gal 5- Bromo-Chloro-Indolyl-Galactopyranoside
YPEL1 Yippee-Like 1
xxi
INTERNET RESOURCES
Database of Genomic Variants, The Centre for Applied Genomics, Toronto. World Wide Web
URL: http://projects.tcag.ca/variation/
The Chromosome 7 Browser, The Centre for Applied Genomics, Toronto. World Wide Web
URL: http://www.chr7.org/
Online Mendelian Inheritance in Man (OMIM):
URL: http://www.ncbi.nlm.nih.gov/Omim
PAST (PAlaeontological STatistics),
URL: http://folk.uio.no/ohammer/past/
NCBI BLAST Server:
URL: http://www.ncbi.nlm.nih.gov/BLAST
University of California Santa Cruz (UCSC) Genome Browser:
URL: http://genome.ucsc.edu/
Primer3. Web-based PCR primer selection tool.
URL: http://frodo.wi.mit.edu/primer3/
Allen Brain Atlas. An interactive, genome-wide image database of gene expression.
URL: http://mouse.brain-map.org/
Repeatmaker. Screens DNA sequences in FASTA format against a library of repetitive elements
and returns a masked query sequence ready for database searches.
URL: http://www.repeatmasker.org/
The International Gene Trap Consortium (IGTC). Publicly available gene trap cell lines, which
are available on a non-collaborative basis for nominal handling fees.
URL: http://www.genetrap.org/
Webcutter. Online restriction digest tool.
URL: http://rna.lundberg.gu.se/cutter2/
1
CHAPTER I: INTRODUCTION TO WILLIAMS-BEUREN SYNDROME:
2
1.1: Literature Review:
1.1.1: Williams-Beuren syndrome history:
The history of Williams-Beuren Syndrome (WBS- also known as Williams syndrome:
OMIM #194050) began to unfold almost 60 years ago. In the early 1950s reports began to
emerge in Great Britain and Switzerland of an epidemic of idiopathic infantile hypercalcemia
(IIH) (Lightwood, 1952). It was soon determined that this rise in IIH was the result of infant
food being over fortified with vitamin D. With the subsequent reduction in the amount of vitamin
D supplementation, a substantial decrease in the incidence of IIH was seen by the end of the
1950‘s (Jones, 1990). It was noted however, that two forms of the disorder existed; a mild form
that could be treated by dietary restrictions and a more severe form that dated from birth and
involved additional features including an elfin facial appearance, mental retardation and cardiac
abnormalities (Fanconi et al., 1952; Lowe et al., 1954). Although severe cases of IIH were
reported throughout the 1950s, (with the first picture of a Williams syndrome individual believed
to have been published in 1956 by Scheslinger et al.) it was not until the early 1960s when a
cardiologist at Greenlane Hospital in Auckland, New Zealand, reported supravalvular aortic
stenosis or SVAS (a narrowing of the ascending aorta) present in four patients each associated
with distinctive facial features as well as physical and mental retardation in the absence of IIH
and recognized it as a distinct disorder (Williams et al., 1961). The following year Beuren et al.,
further identified three individuals with similar features and were the first to report a consistent
style of social behavior, stating “All have the same kind of friendly nature – they love everyone,
are loved by everyone, and are very charming” (Beuren et al 1962). Eventually this combination
of SVAS, distinctive faces, mental retardation and an overly friendly behavior evolved into the
clinical diagnosis of WBS.
3
However it was more than 30 years later that the etiology of WBS began to emerge. In
the mid 1990s, an SVAS patient was identified having a disruption of the elastin gene at 7q11.23
by a translocation, definitively linking the elastin gene to SVAS (Currran et al., 1993). It was
subsequently determined that WBS was caused by a submicroscopic deletion resulting in
hemizygosity at the elastin locus (Ewart et al., 1993). Generation of detailed physical and
transcription maps of the 7q11 chromosomal interval over the next ten years delineated the WBS
critical region to be 1.5 million base pairs encompassing at least 25 genes (Meng et al., 1998;
Osborne, 1999; Desilva et al, 2002; Merla et al., 2002). Although the deletion of ELN could
account for the cardiovascular disease in WBS, it was evident that the loss of neighbouring genes
was likely responsible for the remaining clinical features seen in WBS.
1.1.2: Williams-Beuren syndrome clinical phenotype:
It has been determined that WBS occurs at a frequency of between 1 in 7,500 and 20,000
(Greenberg 1990; Stromme et al, 2002) and results from non-allelic homologous recombination
between large low-copy repeat elements (LCRs) that flank the WBS deletion region (Bayés et
al., 2003). The vast majority of deletions are believed to occur in a sporadically and be de novo
in origninr; however there have been reported cases of autosomal dominant transmission from
mother to child (Morris et al., 1993). Although presentation shows variability both between
individuals and over time, the Williams-Beuren syndrome clinical profile (Table 1.1) is
distinguishable from other neurodevelopmental disorders by a recognizable pattern of symptoms;
dysmorphic facial features, mental retardation, a distinctive uneven cognitive and behavioral
profile, connective tissue abnormalities and cardiovascular disease (Morris and Mervis, 2000).
4
The distinctive physical appearance of WBS includes a wide forehead, bitemporal
narrowing, flat nasal bridge, pre-orbital fullness, stellate patterning of the iris, strabismus,
bulbous nasal tip, long philtrum, wide mouth, prominent cheeks, malocclusion, small jaw and
prominent earlobes (Morris and Mervis, 2000) (Figure 1.1). Growth delay is a common feature
in individuals with WBS with 30-40% falling below the third percentile on standard growth
curves (Franke, 1999). An abnormal pattern of growth is evident from birth with feeding
problems including colic, gastric reflux, constipation and failure to thrive (Pankau et al., 1992).
In addition, hypothyroidism (Stagi et al., 2005; Cambiaso et al., 2007; Stagi et al., 2008) and
growth hormone deficiency (Spadoni et al., 1983) have also been documented in a subset of
adult WBS cases.
Commonly observed neuroanatomical abnormalities in WBS include a decrease in brain
size (Meyer-Lindenberg et al., 2006) thought to be the result of a decrease in sub-cortical white
5
matter and significantly reduced neuronal density (Galaburda et al., 2002). The cerebrum is
enlarged in adults with WBS relative to age-matched normally developing controls. (Tassabehji,
2003). Other neurological abnormalities such as hypotonia and hyperflexia are thought to
contribute to the awkward gait seen in WBS (Morris and Mervis, 2000).
Table 1.1 Clinical Symptoms of Williams-Beuren Syndrome.
SYSTEM PROBLEM INCIDENCE (%)
Birth defects
Congenital heart disease
Umbilical hernia
Inguinal hernia
79
14
38
Nervous
Developmental delay, specific
learning disability,
attention deficit disorder during
childhood
Mental retardation - IQ<70 -
during adulthood
97
Cardiovascular
Supravalvular aortic stenosis
Supravalvular pulmonary stenosis
Hypertension in adulthood
64
24
47
Ocular
Stellate patterning of iris
Esotropia
Hyperopia
72
50
24
Auditory Hypersensitivity to sound
Chronic otitis media
85
43
Dental
Malocclusion
Enamel hypoplasia
Microdontia
85
48
55
Genitourinary Renal anomalies 52
6
SYSTEM PROBLEM INCIDENCE (%)
Gastrointestinal
Constipation
Vomiting, constipation and colic
in infancy
Hypercalcemia in infancy
43
45
67
Musculoskeletal
Joint limitation/
Curvature of spine
Awkward gait
Extra sacral crease
Fifth-finger clinodactyly
50
45
60
52
Integumentary
Dysmorphic facial features
Hoarse, low voice
Prematurely aging skin and
graying hair in adulthood
Hypoplastic nails
96
95
60
67
Adpated from Morris et al. 1988, J. Pediatrics. Total of 42 indviduals with Williams Syndrome.
One of the most well characterized aspects of the WBS phenotype is the cardiovascular
disease presenting as elastin arteriopathy that varies in WBS individuals from aortic hypoplasia
to severe stenosis (Pober et al., 2008). Cardiovascular problems including SVAS, peripheral
pulmonary stenosis (PPS), hypertension and mitral valve prolapsed collectively are thought to
occur in approximately 80% of WBS cases and with about half of these individuals requiring
surgery (Ensing et al., 1989). It has been reported that abnormal deposition of elastin in arterial
walls of patients with SVAS and SVAS in conjunction with WBS, leads to increased
proliferation of arterial smooth muscle cells (SMC), resulting in the formation of hyperplastic
lesions (Dridi et al., 2005). This structural abnormality results in arteriopathy throughout the
7
cardiovascular system with stenosis particularly affecting the brachiocephalic, carotid and renal
arteries (Morris et al., 2003).
Other connective tissue abnormalities include hernias and a deep/hoarse voice, soft skin,
joint limitations in older individuals or hyperextensibility in younger children, bladder/bowel
diverticulae as well as premature ageing of the skin (Morris and Mervis, 2000). Musculoskeletal
and orthopedic problems may also be present and include; kyphosis, lordosis, and scoliosis.
(Morris et al., 1998).
1.1.3: Williams-Beuren syndrome cognitive and behavioral phenotype:
The unique Williams-Beuren syndrome cognitive and behavioral phenotype is
characterized by relative strengths in language acquisition, verbal abstract reasoning, visual
attention to detail and facial processing alongside severe deficits in mathematics and numerical
reasoning, visuo-spatial construction, working memory and delayed language milestones (Mervis
et al. 2000). Individuals with WBS are said to have a gregarious personality and display a lack
of social inhibition that extends to unfamiliar people. However this high sociability is often
accompanied by deficits in interpretation of emotional expressions and despite their highly social
nature, individuals with WBS often have difficulties sustaining friendships and are often isolated
in class. (Frigerio et al., 2006). It has been said that individuals with WBS know no strangers
but have no friends.
1.1.4: Williams-Beuren syndrome cognitive profile (WBSCP):
8
One of the most intriguing aspects of WBS is the unique cognitive profile characterized
by distinctive strengths and weaknesses. Individuals with WBS show a unique cognitive profile
with strengths in auditory rote memory and language abilities alongside severe deficits in spatial
cognition (Morris and Mervis, 2000). Overall level of intellectual ability, as measured by full IQ
tests; typically indicate that IQs are generally in the mild to moderate mental retardation range
(50-60). Individuals with WBS have severe deficits in conceptual reasoning including difficulties
with problem solving, and mathematics (Bellugi et al., 2000). The unique WBS personality
profile is characterized as outgoing and gregarious and affected individuals are empathetic
towards others, have a positive social outlook but may also experience anxiety and simple
phobias (Bellugi et al., 1990). Individuals with WBS are easily distracted and approximately
two thirds of children with WBS meet the diagnostic criteria for attention-deficit hyperactivity
disorder (Pober and Dykens, 1996).
Language acquisition is delayed in individuals with WBS with many not speaking until
the age of 3. Expressive language however, is relatively preserved in individuals with WBS,
with WBS individuals often having larger vocabularies relative to unaffected individuals of
similar mental ages (Lashkari et al., 1999). It also appears that the trajectory of learning is
altered in WBS with a delay in language acquisition but verbal skills improve over time with
WBS adults displaying an advanced vocabulary compared to IQ-matched individuals with
mental retardation (Grant et al., 2002). More importantly it appears that individuals with WBS
acquire language in the absence of important cognitive abilities that were once considered
essential to language acquisition (Tassabehji, 2003).
Although language appears to remain relatively intact in Williams syndrome, visuo-
spatial cognition is severely impaired compared to chronological age (CA) and IQ-matched
9
individuals with Down syndrome (Wang et al., 1995). Their specific deficit in visuo-spatial
construction is often described as focusing on the detail at the expense of the whole picture.
When ask to redraw a picture from memory they are often able to reproduce the individual
objects within the picture but the association between the objects is lost (Morris and Mervis,
2000) (Figure 1.2).
Given the unique pattern of relative strengths in language abilities and weaknesses in
visuo-spatial cognition observed in WBS, an IQ test known as the Kaufman Brief Intelligence
Test (K-BIT) is used to determine the general intelligence level since it measures verbal ability
and nonverbal reasoning ability but is not dependent on the visuo-spatial abilities of the
individual that is being tested (Kaufman and Kaufman, 1990). Mean IQs as measured by K-BIT
10
are generally in the mild to moderate mental retardation range (mean of 69.32) with a variability
(± 15.36) similar for individuals with WBS as for the general population (Mervis and Beccerra,
2006). When a full-scale assessment of intellectual ability including visuo-spatial construction
tasks such as the Differential Abilities Scale (DAS) general conceptual ability (GCA) score is
used, mean IQ levels are considerably lower. Given the high level of variability that exists
between individuals with WBS, a standardized method of assessment referred to as the Williams-
Beuren Syndrome Cognitive Profile (WBSCP) was developed and consists of four distinct
subtests from the DAS and is designed to measure strengths and weakness across a range of
abilities. A diagnosis of WBS if appropriate if the following criteria are met:
1. T-score for either Digit Recall, Naming/Definitions, or Similarities > 1st percentile
(corresponds to the prediction that WBS have strength in verbal abilities relative to
IQ scores, even for individuals who are very low functioning)
2. Pattern Construction T score < 20th percentile (absolute deficit in visuo-spatial
regardless of overall level of functioning)
3. Pattern Construction T score < mean T score (core subtests – weakness in visuo-
spatial ability relative to overall level of functioning)
4. Pattern construction T score < Digit Recall T score (auditory memory will be a
strength compared to visuo-spatial ability)
When tested on a large cohort of individuals with WBS, Mervis et al., (2000) found that
88% fit all four of the above criteria indicating a high degree of sensitivity and that when
individuals from a known mixed etiology group were evaluated 93% of them did not fit the
WBSCP indicating a high degree of specificity. The use of the WBSCP allows for an accurate
11
clinical diagnosis beyond the present conventional cytogenic testing that relies solely on the
presence or absence of the ELN gene as determined by FISH.
1.1.5: Genomic structure and molecular basis of Williams-Beuren syndrome:
Once disruption of the ELN gene locus was identified as the cause of SVAS and ELN
was shown to be deleted in WBS patients, an effort was undertaken to identify the nature of the
chromosome abnormality in WBS. Analysis in 1996 by Perez-Jurado et al., identified three
large repetitive DNA segments, called duplicons, labeled centromeric (c) medial (m) and
telomeric (t) that flank what is now known as the commoly deleted region in WBS. Each
duplicons is composed of three differentiated blocks (A/B/C blocks) containing genes and
pseudogenes that are aligned in direct as well as inverted orientation making it possible to
generate inversions, deletions and duplications through aberrant meiotic homologous
recombination (Figure 1.3). Haplotype analysis determined that 2/3 of deletions arise from inter-
chromosomal and 1/3 from intra-chromosomal recombination (Baumer et al., 1998). Although
atypical deletions have been identified, 95% of WBS individuals carry a 1.55 Mb deletion
between the centromeric (Bc) and medial (Bm) B blocks, since these segments have the greatest
homology (> 99.6 % identity), whilst the remaining 5% occur between the centromeric (Ac) and
medial (Am) A blocks to generate a 1.84Mb deletion (Bayes et al., 2003).
The underlying molecular basis of WBS is haploinsufficiency, or the inability of genes
within the deletion to compensate for the lack of one copy. From the physical and gene map of
the deleted region at 7q11.23 (Figure 1.3), there are 26-28 genes that are commonly deleted. Two
12
genes, GTF2IRD2 and NCF1, are variably deleted depending upon the exact point of
recombination within the B block.
Traditionally, fluorescent in situ hybridization (FISH) using bacterial artificial
chromosomes (BAC), P1 phage and cosmid probes to identify hemizygosity at the elastin (ELN)
locus were used to detect the presence of the 7q11.23 deletion. However, this technique was
time consuming and required fresh blood samples from the individual being studied as well as
control individuals. More recently, the arsenal of molecular diagnostic tools includes genome-
wide copy number variation (CNV) analysis using microarray chip technology that in addition to
detecting copy number changes in the WBS region may also detect variation at other genomic
13
locations. Simpler and more cost effective methods include the identification of deletions (as
well as duplications) using quantitative PCR (qPCR) as well as multiplex ligation-dependent
probe amplification (MLPA) using primers and probe oligonucleotides respectively generated
against specific genomic loci within the WBS region.
1.1.6: WBS genotype-phenotype correlations:
The classic features of Williams syndrome (facial features/ behavior/cognition) are all
highly penetrant and since the vast majority of deletions identified in WBS share common
breakpoints, deciphering the precise relationship between genetic and phenotypic components in
WBS has been a difficult task. To date, only the elastin gene has been unequivocally associated
with the WBS phenotype, namely the cardiovascular symptoms including SVAS (Currran et al.,
1993; Ewart et al., 1993). Point mutations and intragenic deletions in the elastin gene have been
shown to cause isolated SVAS (Tassabehji et al., 1997; Li et al. 1997). In the initial and
subsequent reports associating the elastin gene with SVAS, families were also identified who
were shown to carry deletions encompassing both ELN and the neighboring gene, LIMK1. In
addition to SVAS, it was reported that these individuals had aspects of the WBS cognitive
profile, implicating LIMK1 with the impaired visuo-spatial cognition that is characteristic of
WBS (Frangiskakis et al., 1996). However, subsequent studies identified other individuals with
similar or even larger deletions that did not fit the WBSCP (Tassabehji et al., 1999; Morris et al.,
2003). It therefore appears likely that the visuo-spatial deficits of WBS individuals are the result
of haploinsufficiency of multiple genes in the deleted region and that LIMK1 may be necessary
but insufficient to cause visual spatial impairment.
14
1.1.7: Identification of a WBS critical region:
Although the vast majority of patients with WBS have the same 1.5 Mb interval deleted,
a limited number of WBS patients have been identified who harbor atypical deletions.
Individuals with smaller deletions but who still exhibit the typical features of WBS have defined
a minimal critical region (MCR) (Botta et al., 1999; Heller et al., 2003) (Figure 1.4). This MCR
spans nine genes, extending from ELN at the centromeric end to GTF2I at the telomeric end.
15
From these studies it is predicted that haploinsufficiency of two or more of the genes found
within this minimal critical region is responsible for the majority of features of WBS and that the
loss of genes from ELN to GTF2I appear to be sufficient and necessary for ful WBS.
1.1.8: Transcription factors in human disease:
Regulation of gene expression (both spatially and temporally) is essential to proper
development and survival of all living things. Although this regulation can occur by multiple
mechanisms it is most efficiently achieved at the level of DNA transcription by the interaction of
trans-acting factors (Transcription Factors) with cis-acting regulatory DNA sequences. There are
believed to be more than 2500 proteins in the human genome that contain DNA-binding domains
and most of these are presumed to function as transcription factors; accounting for approximately
10% of genes in the genome code, making it the single largest family of human proteins (Babu et
al., 2004). Transcriptional regulators can be divided into two classes based on the location at
which they exert their influence on their respective genes. Those that regulate through core
DNA sequences in promoters and form part of the initiator complex are called General (or basal)
Transcription Factors (GTF) while those that bind to DNA sequences outside the core sequence
of the promoter are termed Transcriptional Regulatory Proteins. The regulation of expression
may involve a variety of mechanisms; 1) the recruitment of specific co-activators or co-
repressors to the initiator-DNA complex (Xu et al., 1999), 2) the stabilizing or blocking of the
transcriptional initiation complex to DNA, and 3) modification or remodeling of histones
through acylation or de-acylation of histones whereby acylation weakens the association between
16
histones and DNA resulting in an increase in transcription and de-acylation strengthen the
association resulting in decreased transcription (Narlikar et al., 2002), or
Disease phenotypes have been associated with recently identified mutations in several
transcription factors and many of the reported cases involve clear loss-of-function mutations
suggesting haploinsufficiency as the genetic mechanism involved in disease (Table 1.2).
Table 1.2. Transcription Factors that Cause Disease by Haploinsufficiency
Syndrome Gene Clinical Features
Rubinstein-Taybi CREB
Mental retardation; typical facial features; eye, skin, skeletal and
cardiovascular abnormalities; agenesis of corpus callosum;
broad thumbs and great toes.
Waardenburg PAX3 Pigmentary disturbance and hearing loss
Aniridia PAX6 Complete loss of the iris
Hypodontia PAX9 permanent molar teeth segregation
ATR-16 SOX8 mental retardation
Greig
Cephalopolysyn-
dactyly
GLI3 Affecting the fingers and toes (digits) and the head and facial
(craniofacial) area
Additional diseases known to be associated with haploinsufficiency of a transcription factor
include; Axenfeld-Rieger syndrome (FOXCI); Velocardial facial syndrome (TBX1); Holt-Oram
syndrome (TBX5); Rett Syndrome (MECP2); Rubinstein-Taybi syndrome (CREBBP), and WS
17
Waardenburg syndrome types I and II (PAX3 and MITF respectively) (Seidman and Seidman,
2002).
1.1.9: GTF2I transcription factor gene family:
General Transcription Factor 2I (GTF2I), GTF2I Repeat Domain containing 1
(GTF2IRD1) and GTF2I Domain Repeat containing 2 GTF2IRD2 (which is variably deleted in
WBS) comprise a novel three-member group of transcription factors characterized by the
presence of multiple helix-loop-helix (HLH) I-repeat domains that are significantly longer (90
amino acids) than in other HLH transcription factors, and an N-terminal leucine zipper (LZ)
motif (Figure 1.5). Both features are thought to be necessary for dimerization, which imparts
functionality (Roy, 2001). All three members of the family are highly conserved in vertebrates
and are thought regulate transcription through chromatin remodelling. Although the sequence
identity of the I-repeats is less than 50% between the different paralogs, the secondary structure
18
has been conserved through evolution (Hinsley et al., 2004). The gene products of GTF2I (TFII-
I) and GTF2IRD1 (TFII-IRD1) are widely expressed in both early embryonic stages of
development, including pre and post-implantation embryos, as well as in unfertilized oocytes.
Although the expression pattern of these genes in mice are similar throughout early development,
the localization of their protein products is significantly different at the stage of implantation
(E4.5) with TFII-I detectable in both the nucleus and the cytoplasm while TFII-IRD1 is a
predominantly nuclear protein (Bayarasaihan et al., 2003; Enkhmandakh et al., 2004). This is
19
suggestive of non-redundant differentially regulated roles of TFII-I and TFII-IRD1, despite their
similar protein structure.
1.1.10: The transcription factor GTF2I:
GTF2I was the first of the GTF2I gene family members to be identified and
characterized. GTF2I‘s gene product TFII-I was independently identified as TFII-I (Roy et al.,
1997), SPIN (Grueneberg et al., 1997) and BAP135 (Yang and Desiderio, 1997) by its
association with the adenovirus major late promoter, its interaction with Phox-1 and the serum
response factor (SRF), as well as being a downstream target of the Tec-family Bruton tyrosine
kinase (BTK). Analysis of the genomic structure indicates that GTF2I likely originated from
GTF2IRD1 as a result of gene duplication and its further structural evolution was associated with
its novel functional specialization (Makeyev et al., 2004). While it is not known exactly when
this duplication occurred, it is interesting to note that paralogs of GTF2IRD1 can be found in the
genomes of human and primates, mice, rat Xenopus, zebra fish and fungi whereas GTF2I is only
found in human and rodent species (Morris et al., 2006). TFII-I is unique from other
transcription factors in that it has been shown to act both as a basal factor, stimulating
transcription from transcription start site initiator elements (Inr) in promoters, as well as a signal-
inducible factor through binding Inr or E-Box sequences found in upstream enhancer elements
(Roy et al., 1997). Alternate splicing of two exons between the first and second I-repeat gives
rise to four different isoforms in humans and mice (Cheriyath et al., 2000). TFII-I promotes the
formation of higher order ―enhancesome‖ complexes and may function to bridge basal and
upstream regulatory sites and integrate multiple pathways.
20
In resting B-cells TFII-I has been shown to interact with Bruton‘s tyrosine kinase (BTK),
a hematopoietic non-receptor protein tyrosine kinase that is critical for B lymphocyte
development and upon activation of the surface B receptor TFII-I is phosphorylated, is released
and translocates from the cytoplasm to the nucleus (Sacristan et al., 2004). It has also been
demonstrated that TFII-I function is dependent on an active mitogen activated protein (MAP)
kinase pathway (Kim and Cochran, 2000). TFII-I contains putative MAPK tyrosine
phosphorylation sites at Y357 and Y462 in the loop of HLH domain (Egloff and Desiderio,
2001) and it has been demonstrated that tyrosine phosphorylation is necessary for activation and
translocation into the nucleus and that this process is regulated by both ras and rho pathways
(Kim et al., 1998).
TFII-I has also been shown to play an important role in the regulation of c-fos induced
expression in response to growth factor signaling. There are three known TFII-I binding sites in
the FOS promoter and it is believed that TFII-I may regulate transcription by forming protein-
protein complexes with the serum response factor (SRF) and members of the STAT family of
transcription factors that bind to the c-sis/platelet derived growth factor inducible element (SIE)
and the serum response element (SRE) respectively (Kim et al., 1998). In a mechanism similar
to its activation in B-cells, in response to growth factor signaling, TFII-I undergoes a tyrosine
phosphorylation on tyrosine residues 248 and 611 that has been demonstrated to be mediated by
c-Src tyrosine kinase (Cheriyath et al., 2002).
TFII-I is known to interact with multiple transcription factors including the TATA
Binding protein (TBP), USF-1, Phox-1, SRF, c-myc, Stat1/3, p50, NF-B and ATF-6 (Roy et al,
1993; Casteel et al., 2002) as well as HDAC3 and PIASx suggesting a role in histone
modification and SUMOylation (Enkhmandakh et al., 2004).
21
In adult mouse brain, TFII-I is present exclusively in neurons with the greatest expression
levels observed in cerebellar Purkinje cells – including the dendritic trees, hippocampal
interneurons in the CA1-3 region as well as the dentate gyrus and pyramidal neurons in the
cerebral cortex; areas that have shown to be functionally affected in WBS patients, suggesting
that it plays an important role in the functioning of the central nervous system (CNS) (Danoff et
al., 2004).
There is building evidence that TFII-I may also function outside the nucleus. It was
known that in resting B cells, a significant fraction of TFII-I is found in the cytoplasm
constitutively associated with (BTK) where upon cross linking of the Ig receptor, it is
phosphorylated, released translocates to the nucleus and suggesting that regulation of TFII-I`s
transcriptional activity is controlled through alteration in its sub-cellular localization. However,
Caraveo et al., (2006) have demonstrated TFII-I may also play a role in Ca2+
entry through the
plasma membrane. It was determined that the phosphorylated TFII-I also interacts with the src-
homology (SH)-2 domain of gamma isoform of phospholipase C (PLC-γ) which normally
activate surface transient receptor potential channels (TRPC) such as TRPC3 that modulate
calcium ion entry at the plasma membrane. TFII-I may competitively bind to PLC-γ resulting in
inhibition of TRPC3-mediated agonist-induced Ca2+
entry (ACE). Interaction with PLC- γ is
thought to occur through a split PH domain found in TFII-I that mimics that of TRPC3 and is
involved in the PLC-γ interaction. It was further demonstrated that loss of TFII-I in PC12
neuronal or human embryonic kidney (HEK) cells through gene silencing leads to increase
surface expression of TRPC3 and enhanced Ca2+
influx (Caraveo et al., 2006). It is intriguing to
postulate that the decrease in the expression of TFII-I in WBS may result in an alteration in the
conformational coupling of TRPC receptors that regulate many neuro-cognitive processes.
22
1.1.11: The transcription factor GTF2IRD1:
The gene product of GTF2IRD1 (TFII-IRD1 -also named WBSCR11, GTF3, BEN,
MusTRD1, Cream1) was originally identified as the protein MusTRD1 that binds the slow fibre-
specific upstream enhancer (USE) B1 element of the muscle gene troponin I slow gene
regulating troponin I expression in slow-twitch muscle needed for maintenance of posture and
tasks involving stamina (O‘Mahoney et al., 1998). It has recently been demonstrated that this
regulation may involve the interaction of TFII-IRD1 with both the myocyte enhancer-binding
factor 2C (MEF2C) as well as the nuclear receptor co-repressor (NCoR) (Polly et al., 2003). It
has also been shown to bind through its C-terminus to the retinoblastoma protein (Rb), known to
be an activator in cell-cycle regulation and necessary for terminal differentiation of skeletal
muscle (Yan et al., 2000). A known mouse TFII-IRD1 variant (referred to as BEN for binding
factor for early enhancer) containing 6 I-repeats, has also been to shown to be involved in the
regulation of the Hoxc8 homeobox gene involved in the control of spatial patterning during
embryogenesis (Bayarsaihan and Ruddle, 2000).
TFII-IRD1contains five I-repeats in human and 5 or 6 I-repeats in mice that share 70%
homology to TFII-I. Like TFII-I, it is thought to contain two DNA binding domains, between
amino acids 351-458 and amino acids 544-944, respectively, with serial deletion analysis
demonstrating that the repression of gene expression by TFII-IRD1 can occur in the absence of
DNA binding (Polly et al., 2003). Also similar to TFII-I, alternate splicing of exons gives rise to
multiple isoforms with 2 transcripts identified in humans. However, splicing in mice is far more
complex than Gtf2i in that it is not just exons that are alternately spliced. Two alternately spliced
23
individual exons in addition to two alternately spliced cassettes containing complete or partial
exon sequences giving rise to least 11 isoforms identified to date (Tay et al., 2003).
In developing embryos, the highest levels of TFII-IRD1 expression are found in areas of
epithelial-mesenchymal interaction such as limb buds, branchial arches and craniofacial areas
(Bayarsaihan and Ruddle, 2004), regions affected in WBS patients. From day 10 postnatal
mouse brains onward, the highest expression of TFII-IRD1 is found in the pons and cerebellum
(Danoff et al., 2004).
Although it has been demonstrated that TFII-IRD1 has a distinctive function from that of
its paralog TFII-I, there is also evidence that the two proteins may interact directly and indirectly
in the regulation of some genes. In 2001, Tussié-Luna et al., proposed the mechanism that TFII-
IRD1 may compete with TFII-I for nucleo-cytoplasmic shuttling components and that TFII-
IRD1 may sequester TFII-I in the cytoplasm. Originally identified as XWBSCR11, TFII-IRD1
was also shown to regulate the activin-nodal-inducible distal element of the Xenopus (Ring et al.,
1999) and more recently the mouse goosecoid promoter in response to TGF-β through a process
that is thought to be mediated by competition between TFII-I and TFII-IRD1 (Ku et al., 2005).
This counter regulation of transcription by competition between TFII-I and TFII-IRD1 has also
recently been suggested in the regulation of vascular endothelial growth factor receptor 2
(VEGFR-2) (Jackson et al., 2005).
1.1.12: The transcription factor GTF2IRD2:
GTF2IRD2 (gene product TFII-IRD2) is the most recently discovered gene in the TFII-I
gene family (Tipney et al., 2004). It is variably deleted in WBS, depending on the exact location
24
of chromosome recombination within the B block. It is also invariably deleted in the
approximately 5% of WBS patients who harbor a larger 1.8 Mb deletion. GTF2IRD2 is more
closely related to GTF2I than to GTF2IRD1 and is apparently derived from the GTF2I sequence
by gene duplication. The comparison of GTF2I and GTF2IRD2 gene sequence revealed two
distinct regions of homology, indicating that the structure of the GTF2IRD2 gene has been
generated by two independent genomic rearrangements (Makeyev et al., 2004). Genomic
structure analysis of both intron-exon boundaries and sequence similarity indicates that TFII-I
and TFII-IRD2 share the same N-terminal leucine zipper and the first I repeat. However repeats
I-2 to I-5 are absent, most likely due to deletion spanning introns 12 to 27. Exons 12-15 of Gtf2i
correspond to exons 28-31 of TFII-IRD2 and it appears that a random in-frame insertion of a
transposon-like Charlie8 domain has replaced the 3‘ end of the TFII-I, generating a functional
fusion gene (Makeyev et al., 2004). The Charlie8 domain is a mammalian-specific member of
the MER1 transposase family and contains a Cys-2/His-2 Zinc finger DNA binding domain and
a second LZ (Tipney et al., 2004). Most often, integration of transposable elements are not
advantages to the host. If, however, a transposable element integrates into a gene rather than a
non-coding sequence, expression of the gene will often be adversely affected. Such fusion
proteins will either be lost from the genome during evolution or in rare cases; the transposase can
insert in-frame and produce a viable protein with a novel biological functionality, and therefore
will be retained. Given that GTF2IRD2 is highly conserved among mammals, this appears likely
with GTF2IRD2, where the CHARLIE8 transposon has inserted itself in-frame likely producing
a novel functional protein.
1.2: Research Aims and Hypothesis:
25
The vast majority of Williams syndrome cases are caused by a deletion of a 1.5 to 1.8 Mb
interval on the long arm of chromosome 7. In addition to this common deletion other genomic
rearrangements of the region are known or predicted to occur and may lead to phenotypes
distinct from that of WBS. Identification and analysis of less common rearrangements of the
chromosome 7 region will allow for the deciphering of the roles that genes within the interval
contribute to the phenotype. Previous analysis of known atypical deletions of the WBS region
associated the distal end of the commonly deleted region, and in particular the GTF2I gene
family with the cognitive and behavioral aspects of the disorder. The GTF2I gene family
including the transcription factors GTF2I and GTF2IRD1 likely play a role in the WBS cognitive
and behavioral phenotype consistent with their expression in early stages of embryonic
development notably in the developing brain.
To determine their involvement in the WBS phenotype, an animal model of Gtf2ird1
deficiency was generated and analyzed to look for changes consistent with the WBS phenotype.
This analysis included identifying physical, behavioral and cognitive changes as well as, given
its role as a transcription factor, additional investigation at the molecular level to identify genes
whose expression was altered. In addition, mice carrying targeted alleles were generated for
Gtf2i as well as a double deletion of Gtf2i and Gtf2ird1 and a duplication of Gtf2i that will
provide valuable tools for elucidating the contribution these genes make to the WBS phenotype.
26
1.3: References:
Babu MM, Luscombe NM, Aravind L, Gerstein M, and Teichmann SA. (2004). Structure and
evolution of transcriptional regulatory networks. Current Opinions in Structural Biology.
14: 283–291.
Baumer A, Dutly F, Balmer D, Riegel M, Tükel T, Krajewska-Walasek M, and Schinzel AA.
(1998) High level of unequal meiotic crossovers at the origin of the 22q11. 2 and 7q11.23
deletions. Human Molecular Genetics. 7:887-894.
Bayarsaihan D, Bitchevaia N, Enkhmandakh B, Tussie-Luna MI, Leckman JF, Roy A, and
Ruddle FH. (2003) Expression of BEN, a member of TFII-I family of transcription factors,
during mouse pre- and postimplantation development. Gene Expression Patterns. 3:579-
589.
Bayarsaihan D, and Ruddle FH. (2000) Isolation and characterization of BEN, a member of the
TFII-I family of DNA-binding proteins containing distinct helix-loop-helix domains.
Proceedings of the National Academy of Sciences (USA) 97:7342-7347.
Bayés M, Magano LF, Rivera N, Flores R, and Pérez Jurado LA. (2003) Mutational mechanisms
of Williams-Beuren syndrome deletions. American Journal of Human Genetics. 73:131-
151.
Bellugi U, Bihrle A, Jernigan T, Trauner D, and Doherty S. (1990). Neuropsychological,
neurological, and neuroanatomical profile of Williams syndrome. American Journal of
Medical Genetics. 6:115-125.
Bellugi U, Lichtenberger L, Jones W, Lai Z, and St George M. (2000) The neuro-cognitive
profile of Williams Syndrome: a complex pattern of strengths and weaknesses. Journal of
Cognitive Neuroscience. 12(S1):7-29.
Bergman JD. (1996) Social, affective and behavioral impairments in Williams syndrome.
(Abstract) Professional Meeting of the Williams syndrome Association. Valley Forge, PA.
Beuren AJ, Apitz J, and Harmjanz D. (1962) Supravalvular aortic stenosis in association with
mental retardation and a certain facial appearance. Circulation. 26:1235-1240.
Bini R, and Pela I. (2004) New case of thyroid dysgenesis and clinical signs of hypothyroidism
in Williams syndrome. American Journal of Medical Genetics (A). 127A:183-185.
Botta A, Novelli G, Mari A, Novelli A, Sabani M, Korenberg J, Osborne LR, Digilio MC,
Giannotti A, and Dallapiccola B. (1999) Detection of an atypical 7q11.23 deletion in
Williams syndrome patients which does not include the STX1A and FZD3 genes. Journal
of Medical Genetics. 36:478-480.
27
Cambiaso P, Orazi C, Digilio MC, Loche S, Capolino R, Tozzi A, Faedda A, and Cappa M.
(2007) Thyroid morphology and subclinical hypothyroidism in children and adolescents
with Williams syndrome. Journal of Pediatrics. 150:62-65.
Casteel DE, Zhuang S, Gudi T, Tang J, Vuica M, Desiderio S, and Pilz RB. (2002) cGMP-
dependent protein kinase I beta physically and functionally interacts with the
transcriptional regulator TFII-I. Journal of Biological Chemistry. 277: 32003-32014.
Caraveo G, van Rossum DB, Patterson RL, Snyder SH, and Desiderio S. (2006) Action of TFII-I
outside the nucleus as an inhibitor of agonist-induced calcium entry. Science. 314:122-125.
Cheriyath V, Desgranges ZP, and Roy AL. (2002) c-Src-dependent transcriptional activation of
TFII-I. Journal of Biological Chemistry. 277:22798-22805.
Cherniske EM, Carpenter TO, Klaiman C, Young E, Bregman J, Insogna K, Schultz RT, and
Pober BR. (2004) Multisystem study of 20 older adults with Williams syndrome.
American Journal of Medical Genetics (A). 131:255-264.
Curran ME, Atkinson DL, Ewart AK, Morris CA, Leppert MF, and Keating MT. (1993) The
elastin gene is disrupted by a translocation associated with supravalvular aortic stenosis.
Cell. 73:159-168.
Danoff SK, Taylor HE, Blackshaw S, and Desiderio S. (2004) TFII-I, a candidate gene for
Williams syndrome cognitive profile: parallels between regional expression in mouse brain
and human phenotype. Neuroscience. 123:931-938.
DeSilva U, Elnitski L, Idol JR, Doyle JL, Gan W, Thomas JW, Schwartz S, Dietrich NL,
Beckstrom-Sternberg SM, McDowell JC, Blakesley RW, Bouffard GG, Thomas PJ,
Touchman JW, Miller W, and Green ED. (2002) Generation and comparative analysis of
approximately 3.3 Mb of mouse genomic sequence orthologous to the region of human
chromosome 7q11.23 implicated in Williams syndrome. Genome Research. 12:3-15.
Doyle TF, Bellugi U, Korenberg JR, and Graham J. (2004) "Everybody in the world is my
friend" hypersociability in young children with Williams syndrome. American Journal of
Medical Genetics, Part A. 124A:263-273.
Dridi SM, Foucault Bertaud A, Igondjo Tchen S, Senni K, Ejeil AL, Pellat B, Lyonnet S, Bonnet
D, Charpiot P, and Godeau G. (2005) Vascular wall remodeling in patients with
supravalvular aortic stenosis and Williams Beuren syndrome. Journal of Vascular
Research. 42:190-201.
Egloff AM, and Desiderio S. (2001) Identification of phosphorylation sites for Bruton's tyrosine
kinase within the transcriptional regulator BAP/TFII-I. Journal of Biological Chemistry.
276:27806-27815.
Enkhmandakh B, Bitchevaia N, Ruddle F, and Bayarsaihan D. (2004) The early embryonic
expression of TFII-I during mouse preimplantation development. Gene Expression
Patterns. 4:25-28.
28
Ensing GJ, Schmidt MA, Hagler DJ, Michels VV, Carter GA, and Feldt RH. (1989) Spectrum of
findings in a family with nonsyndromic autosomal dominant supravalvular aortic stenosis:
a Doppler echocardiographic study. Journal of the American College of Cardiology.
13:413-419.
Ewart AK, Morris CA, Atkinson D, Jin W, Sternes K, Spallone P, Stock AD, Leppert M, and
Keating MT. (1993a) Hemizygosity at the elastin locus in a developmental disorder,
Williams syndrome. Nature Genetics. 5:11-16.
Ewart AK, Morris CA, Ensing GJ, Loker J, Moore C, Leppert M, Keating M. (1993b) A human
vascular disorder, supravalvular aortic stenosis, maps to chromosome 7. Proceedings of the
National Acadmey of Sciences (USA). 90:3226-3230.
Fanconi G, Girardet P, Schlesinger B, Butler N, and Black J. (1952) Chronic hyperglycemia,
combined with osteosclerosis, hyperazotemia, nanism and congenital malformations.
Helvectica Paediatrica Acta. 7:314-349.
Frangiskakis JM, Ewart AK, Morris CA, Mervis CB, Bertrand J, Robinson BF, Klein BP, Ensing
GJ, Everett LA, Green ED, Pröschel C, Gutowski NJ, Noble M, Atkinson DL, Odelberg
SJ, and Keating MT. (1996) LIM-kinase1 hemizygosity implicated in impaired
visuospatial constructive cognition. Cell. 86:59-69.
Frigerio E, Burt DM, Gagliardi C, Cioffi G, Martelli S, Perrett DI, and Borgatti R. (2006) Is
everybody always my friend? Perception of approachability in Williams syndrome.
Neuropsychologia. 44:254-259.
Gagliardi C, Bonaglia MC, Selicorni A, Borgatti R, and Giorda R. (2003) Unusual cognitive and
behavioral profile in a Williams syndrome patient with atypical 7q11.23 deletion. Journal
of Medical Genetics. 40:526-530.
Galaburda AM, Holinger DP, Bellugi U, and Sherman GF. (2002) Williams syndrome: neuronal
size and neuronal-packing density in primary visual cortex. Archives of Neurology.
56:1461-1467.
Grant J, Valian V, and Karmiloff-Smith A. (2002) A study of relative clauses in Williams
syndrome. Journal of Child Language. 29:403-416.
Greenberg F. (1990) Williams syndrome professional symposium. American Journal of Medical
Genetics. 6(S):85-88.
Grueneberg DA, Henry RW, Brauer A, Novina CD, Cheriyath V, Roy AL, and Gilman M.
(1997) A multifunctional DNA-binding protein that promotes the formation of serum
response factor/homeodomain complexes: identity to TFII-I. Genes and Development.
11:2482-2493.
Heller R, Rauch A, Lüttgen S, Schröder B and Winterpacht A. (2003) Partial deletion of the
critical 1.5 Mb interval in Williams-Beuren syndrome. Journal of Medical Genetics.
40:e99.
29
Hinsley TA, Cunliffe P, Tipney HJ, Brass A, and Tassabehji M. (2004) Comparison of TFII-I
gene family members deleted in Williams-Beuren syndrome. Protein Science. 13:2588-
2599.
Hirota H, Matsuoka R, Chen XN, Salandanan LS, Lincoln A, Rose FE, Sunahara M, Osawa M,
Bellugi U, and Korenberg JR. (2003) Williams syndrome deficits in visual spatial
processing linked to GTF2IRD1 and GTF2I on chromosome 7q11.23. Genetics in
Medicine. 5:311–321.
Hoogenraad CC, Eussen BH, Langeveld A, van Haperen R, Winterberg S, Wouters CH,
Grosveld F, De Zeeuw CI, and Galjart N. (1998) The murine CYLN2 gene: genomic
organization, chromosome localization, and comparison to the human gene that is located
within the 7q11.23 Williams syndrome critical region. Genomics. 53:348-358.
Hoogenraad CC, Koekkoek B, Akhmanova A, Krugers H, Dortland B, Miedema M, van Alphen
A, Kistler WM, Jaegle M, Koutsourakis M, Van Camp N, Verhoye M, van der Linden A,
Kaverina I, Grosveld F, De Zeeuw CI, and Galjart N. (2002) Targeted mutation of Cyln2 in
the Williams syndrome critical region links CLIP-115 haploinsufficiency to
neurodevelopmental abnormalities in mice. Nature Genetics. 32:116-127.
Hoogenraad CC, Akhmanova A, Galjart N, and De Zeeuw CI (2004) LIMK1 and CLIP-115:
linking cytoskeletal defects to Williams syndrome. Bioessays. 26:141-150.
Howald C, Merla G, Digilio MC, Amenta S, Lyle R, Deutsch S, Choudhury U, Bottani A,
Antonarakis SE, Fryssira H, Dallapiccola B, and Reymond A. (2006) Two high throughput
technologies to detect segmental aneuploidies identify new Williams-Beuren syndrome
patients with atypical deletions. Journal of Medical Genetics. 43:266-273.
Hultqvist M, Olofsson P, Holmberg J, Bäckström BT, Tordsson J, and Holmdahl R. (2004)
Enhanced autoimmunity, arthritis, and encephalomyelitis in mice with a reduced oxidative
burst due to a mutation in the Ncf1 gene. Proceedings of the National Acadmey of Sciences
(USA). 101:12646-12651.
Jackson TA, Taylor HE, Sharma D, Desiderio S, and Danoff SK. (2005) Vascular endothelial
growth factor receptor-2: counter-regulation by the transcription factors, TFII-I and TFII-
IRD1. Journal of Biological Chemistry. 280:29856-29863.
Jones KL. (1990) Williams syndrome: an historical perspective of its evolution, natural history,
and etiology. American Journal of Medical Genetics. S6:89-96.
Kaufman AS and Kaufman NL. (1990) Kaufman Brief Intelligence Test. Circle Pines, MN:
American Guidance Service.
Kim DW and Cochran BH. (2000) Extracellular signal-regulated kinase binds to TFII-I and
regulates its activation of the c-fos promoter. Molecular and Cellular Biology. 20: 1140-
1148.
30
Kim DW, Cheriyath V, Roy AL, and Cochran BH. (1998) TFII-I enhances activation of the c-fos
promoter through interactions with upstream elements. Molecular and Cellular Biology.
18:3310-3320.
Ku M, Sokol SY, Wu J, Tussie-Luna MI, Roy AL, and Hata A. (2005) Positive and negative
regulation of the transforming growth factor beta/activin target gene goosecoid by the
TFII-I family of transcription factors. Molecular and Cellular Biology. 25:7144-7157.
Lashkari A, Smith AK, and Graham JM Jr. (1999) Williams-Beuren syndrome: an update and
review for the primary physician. Clinical Pediatrics. 38:189-208.
Li DY, Toland AE, Boak BB, Atkinson DL, Ensing GJ, Morris CA, and Keating MT. (1997)
Elastin point mutations cause an obstructive vascular disease, supravalvular aortic stenosis.
Human Molecular Genetics. 6:1021-1028.
Li DY, Brooke B, Davis EC, Mecham RP, Sorensen LK, Boak BB, Eichwald E, and Keating
MT. (1998a) Elastin is an essential determinant of arterial morphogenesis. Nature.
393:276-280.
Li DY, Faury G, Taylor DG, Davis EC, Boyle WA, Mecham RP, Stenzel P, Boak B, and
Keating MT. (1998b) Novel arterial pathology in mice and humans hemizygous for elastin.
Journal of Clinical Investigation. 102:1783-1787.
Lightwood R. (1952). Idiopathic hypercalcemia with failure to thrive. Nephrocalcinosis
Proceedings of the Royal Society of Medicince. 45:401.
Lowe KG, Henderson JL, Park WW, and McGreal DA. (1954) The idiopathic hypercalcaemic
syndromes of infancy. Lancet. 267:101-110.
Makeyev AV, Erdenechimeg L, Mungunsukh O, Roth JJ, Enkhmandakh B, Ruddle FH, and
Bayarsaihan D. (2004) GTF2IRD2 is located in the Williams-Beuren syndrome critical
region 7q11.23 and encodes a protein with two TFII-I-like helix-loop-helix repeats.
Proceedings of the National Academy of Science (U S A). 101:11052-11057.
Meng X, Lu X, Li Z, Green ED, Massa H, Trask BJ, Morris CA, and Keating MT. (1998)
Complete physical map of the common deletion region in Williams syndrome and
identification and characterization of three novel genes. Human Genetics. 103:590-599.
Meng, Y. Zhang Y., Tregoubov V., Janus C., Cruz L., Jackson M., Lu W., MacDonald J., Wang
J., Falls D, and Jia Z. (2002) Abnormal Spine Morphology and Enhanced LTP in LIMK-1
Knockout Mice. Neuron. 35: 121-133.
Merla G, Ucla C, Guipponi M,and Reymond A. (2002) Identification of additional transcripts in
the Williams-Beuren syndrome critical region. Human Genetics. 110:429-438.
Mervis CB, Robinson BF, Bertrand J, Morris CA, Klein-Tasman BP, and Armstrong SC. (2000)
The Williams syndrome cognitive profile. Brain and Cognition. 44:604–628.
31
Mervis CB, and Becerra AM. (2007) Language and communicative development in Williams
syndrome. Mental Retardation and Developmental Disability Research Reviews. 13:3-15.
Meyer-Lindenberg A, Mervis CB, and Berman KF. (2006) Neural mechanisms in Williams
syndrome: a unique window to genetic influences on cognition and behaviour Nature
Reviews Neuroscience. 7:380-393.
Morris CA. (1988) Genetic aspects of supravalvular aortic stenosis. Current Opinion in
Cardiology. 13:214-219.
Morris CA, Thomas IT, and Greenberg F. (1993) Williams syndrome: autosomal dominant
inheritance. American Journal of Medical Genetics. 47:478-481.
Morris CA, and Mervis CB. (2000) Williams syndrome and related disorders. Annual Review of
Genomics and Human Genetics. 1:461-484.
Morris CA, Mervis CB, Hobart HH, Gregg RG, Bertrand J, Ensing GJ, Sommer A, Moore CA,
Hopkin RJ, Spallone PA, Keating MT, Osborne L, Kimberley KW, and Stock AD. (2003)
GTF2I hemizygosity implicated in mental retardation in Williams syndrome: genotype-
phenotype analysis of five families with deletions in the Williams syndrome region.
American Journal of Medical Genetics 123A:45-59.
Morris CA, Lenhoff HM, and Wang PP. (2006) in Williams-Beuren Syndrome – Research,
Evaluation and Treatment, John Hopkins Press, Baltimore MD.
Narlikar GJ, Fan HY, and Kingston RE. (2002) Cooperation between complexes that regulate
chromatin structure and transcription. Cell. 108:475–87.
Osborne LR. (1999) Williams-Beuren syndrome: unraveling the mysteries of a microdeletion
disorder. Molecular Genetics and Metabolism. 67:1-10.
O'Mahoney JV, Guven KL, Lin J, Joya JE, Robinson CS, Wade RP, and Hardeman EC. (1998)
Identification of a novel slow-muscle-fiber enhancer binding protein, MusTRD1.
Molecular Cell Biology. 18:6641-6652.
Pankau R, Partsch CJ, Gosch A, Oppermann HC, and Wessel A. (1992) Statural growth in
Williams-Beuren syndrome. European Journal of Pediatrics. 151:751-755.
Payne WW. (1952) The blood chemistry in idiopathic hypercalcemia. Archives of Disease in
Childhood. 27:302.
Pérez Jurado LA, Peoples R, Kaplan P, Hamel BC, and Francke U. (1996) Molecular definition
of the chromosome 7 deletion in Williams syndrome and parent-of-origin effects on
growth. American Journal of Human Genetics. 59:781-792.
Pober BR, and Dykens EM. (1996) Williams syndrome: An overview of medical, cognitive and
behavioral features. Child and Adolescent Psychiatric Clinics of North America. 5:929-
943.
32
Pober BR, Johnson M, and Urban Z. (2008) Mechanisms and treatment of cardiovascular disease
in Williams-Beuren syndrome. Journal of Clinical Invesigation. 118:1606-1615.
Polly P, Haddadi LM, Issa LL, Subramaniam N, Palmer SJ, Tay ES, and Hardeman EC. (2003)
hMusTRD1a1 represses MEF2 activation of the Troponin I slow enhancer. Journal of
Biological Chemistry. 278:36603–36610.
Ranheim EA, Kwan HC, Reya T, Wang YK, Weissman IL, and Francke U. (2005) Frizzled 9
knock-out mice have abnormal B-cell development. Blood. 105:2487-2494.
Reiss AL, Eliez S, Schmitt JE, Straus E, Lai Z, Jones W, and Bellugi U. (2000) IV.
Neuroanatomy of Williams syndrome: a high-resolution MRI study. Journal of Cognitive
Neuroscience. 12(S):65-73.
Ring C, Ogata S, Meek L, Song J, Ohta T, Miyazono K, and Cho KW. (1999) The role of a
Williams-Beuren syndrome-associated helix-loop-helix domain-containing transcription
factor in activin/nodal signaling. Genes and Development. 16:820-835.
Roy AL, Du H, Gregor PD, Novina CD, Martinez E, and Roeder RG. (1997) Cloning of an Inr
and E-box binding protein, TFII-I that interacts physically and functionally with USF1.
EMBO Journal. 16:7091–7104.
Roy AL. (2001) Biochemistry and biology of the inducible multifunctional transcription factor
TFII-I. Gene. 274:1–13.
Sacristán C, Tussié-Luna MI, Logan SM, and Roy AL. (2004) Mechanism of Bruton's tyrosine
kinase-mediated recruitment and regulation of TFII-I. Journal of Biological Chemistry.
279:7147-7158.
Seidman JG, and Seidman C. (2002) Transcription factor haploinsufficiency: when half a loaf is
not enough. Journal of Clinical Investigation. 109:451–455.
Schlesinger BE, Butler NR, and Black JA. (1956) Severe type of infantile hypercalcemia. British
Medical Journal. 1:127–134.
Spadoni GL, Colloridi V, Finocchi G, Manca Bitti ML, Chini L, and Boscherini B. (1983)
Williams syndrome and growth hormone deficiency. Journal of Pediatrics. 102:640.
Stagi S, Bindi G, Neri AS, Lapi E, Losi S, Jenuso R, Salti R, and Chiarelli F. (2005) Thyroid
function and morphology in patients affected by Williams syndrome. Clinical
Endocrinology (Oxf). 63:456-460.
Stagi S, Manoni C, Salti R, Cecchi C, and Chiarelli F. (2008) Thyroid hypoplasia as a cause of
congenital hypothyroidism in Williams syndrome. Hormone Research. 70:316-318.
Stromme P, Bjornstad PG, and Ramstad K. (2002) Prevalence estimation of Williams syndrome.
Journal of Child Neurology. 17:269–271.
33
Tassabehji M, Metcalfe K, Donnai D, Hurst J, Reardon W, Burch M, and Read AP. (1997)
Elastin: genomic structure and point mutations in patients with supravalvular aortic
stenosis. Human Molecular Genetics. 12:R229-R237.
Tassabehji M, Metcalfe K, Hurst J, Ashcroft GS, Kielty C, Wilmot C, Donnai D, Read AP, and
Jones CJ. (1998) An elastin gene mutation producing abnormal tropoelastin and abnormal
elastic fibres in a patient with autosomal dominant cutis laxa. Human Molecular Genetics.
7:1021-1028.
Tassabehji M, Metcalfe K, Karmiloff-Smith A, Carette MJ, Grant J, Dennis N, Reardon W,
Splitt M, Read AP, and Donnai D. (1999) Williams syndrome: use of chromosomal
microdeletions as a tool to dissect cognitive and physical phenotypes. American Journal of
Human Genetics. 64:118-125.
Tassabehji M. (2003) Williams-Beuren syndrome: a challenge for genotype-phenotype
correlations. Human Molecular Genetics. 15:R229-R237.
Tay ES, Guven KL, Subramaniam N, Polly P, Issa LL, Gunning PW, and Hardeman EC. (2003)
Regulation of alternative splicing of Gtf2ird1 and its impact on slow muscle promoter
activity. Biochemical Journal. 374:359-367.
Tipney HJ, Hinsley TA, Brass A, Metcalfe K, Donnai D, and Tassabehji M. (2004) Isolation and
characterisation of GTF2IRD2, a novel fusion gene and member of the TFII-I family of
transcription factors, deleted in Williams-Beuren syndrome. European Journal of Human
Genetics. 12:551-560.
Tussié-Luna MI, Bayarsaihan D, Ruddle FH, and Roy AL. (2001) Repression of TFII-I-
dependent transcription by nuclear exclusion. Proceedings of the National Academy of
Science (USA). 98:7789-7794.
Wang PP, Doherty S, Rourke SB, and Bellugi U. (1995) Unique profile of visuo-perceptual skills
in a genetic syndrome. Brain and Cognition. 29:54-65.
Williams JC, Barratt-Boyes BG, and Lowe JB. (1961) Supravalvular aortic stenosis. Circulation.
24:1311-1318.
Xu L, Glass CK, and Rosenfeld MG. (1999). Coactivator and corepressor complexes in nuclear
receptor function. Current Opinion in Genetic Development. 9:140–147.
Yan X, Zhao X, Qian M, Guo N, Gong X, and Zhu X. (2000) Characterization and gene
structure of a novel retinoblastoma-protein-associated protein similar to the transcription
regulator TFII-I. Biochemical Journal. 345:749-757.
Yang, W. and Desiderio S. (1997) BAP-135, a target for Bruton's tyrosine kinase in response to
B cell receptor engagement. Proceedings of the National Academy of Science (USA).
94:604-609.
34
Zhao C, Avilés C, Abel RA, Almli CR, McQuillen P, and Pleasure SJ. (2005) Hippocampal and
visuospatial learning defects in mice with a deletion of frizzled 9, a gene in the Williams
syndrome deletion interval. Development. 132:2917-2927.
Zhang MC, He L, Giro M, Yong SL, Tiller GE, and Davidson JM. (1999) Cutis laxa arising from
frameshift mutations in exon 30 of the elastin gene (ELN). Journal of Biological
Chemistry. 274:981-986.
35
CHAPTER II: GENOMIC REARRANGEMENTS OF THE HUMAN 7q11-q21 REGION.
36
2.1: Literature Review:
2.1.1: Chromosomal rearrangements and the human genome:
Genomic rearrangement has played an important role in the development of human
genome. It is believed that as much as 5% of genome might be duplicated within large segments
of highly homologous DNA sequence known as segmental duplications or low-copy repeats
(LCRs) (Stankiewicz and Lupski, 2002). LCRs usually consist of segments of DNA from 10-
400kb in length with sequence identity of greater than 97% that are believed to have been
generated by the duplication of genomic sequence, resulting in paralogous regions (Shaw and
Lupski, 2004). It is believed that repeated genomic duplication events are responsible for the
creation of the β-globin and Hox gene clusters. Multiple domains within a single protein are also
likely due to the duplication of exons, and together contribute significantly to the karyotypic
evolution that has resulted in primate speciation (Stankiewicz and Lupski, 2002). However, the
presence of segmental duplications increases the likelihood of replication errors through non-
allelic homologous recombination (NAHR) between these region-specific LCRs. Recently it has
been determined that inversions may be present in a significant subset of the population and may
instigate illegitimate recombination events leading to chromosome deletion in offspring (Feuk et
al., 2005).
37
38
In the predicted model of NAHR, rearrangements mediated by duplicated sequences can
take place in one of three ways; between paralogs on the same chromatid (intra-chromatidal), on
sister chromatids (inter-chromatidal) or on the homologous chromosome (inter-chromosomal).
The first mechanism produces only interstitial deletion whereas in the latter two cases, a deletion
and a reciprocal duplication are generated (Figure 2.1) (Turner et al., 2008). It has been
demonstrated that germ-line rates of de novo meiotic deletion and duplication resulting from
inter-chromatidal recombination were negligible (Turner et al., 2008), consistent with previous
findings that the deletions of 7q11.23 in WBS are generated by inter-chromasomal (del+dup) or
intra-chromatidal rearrangements (Bayes et al., 2003). Since the latter mechanism produces only
a deletion the predicted frequency of occurrence for the WBS reciprocal duplication would be
expected to be less than the deletion frequency.
When the LCRs are in the same, or direct, orientation, deletions and duplications are
possible and occur by intra-chromosomal or inter-chromosomal misalignment. Deletions can
also be generated through intra-chromatid misalignment with an acentric supernumerary
chromosome also being produced. In rare cases, supernumerary chromosomes are stably
retained through subsequent cell division and if euchromatic sequence is present gene expression
can occur. If the genes contained with the supernumerary chromosome are dosage sensitive,
disease can occur; as is the case with some individuals with cat-eye syndrome, a rare
malformation involving human chromosome 22 (McDermid et al., 1986).
The presence of inverted repeats, where the homologous sequences are in the opposite
orientation to each other, results in an inversion of the region between the LCRs (Stankiewicz
and Lupski, 2002).
39
2.1.2: Chromosomal rearrangements and association with disease:
It is believed that cytogenetically visible chromosomal deletions occur in approximately
1 in every 7,000 live births (Jacobs et al., 1992) and although not all are pathogenic, deletions
and duplications can lead to the alteration of dosage-sensitive genes within the deleted and
duplicated genomic sequence. Depending on the size of the genomic segment between the LCRs
this genomic rearrangement may result in the disruption of a single gene leading to a Mendelian
disease or a contiguous gene disorder if more than one gene is dosage sensitive (Stankiewicz and
Lupski, 2002). In the case of inversions, the gene copy number is not altered but the
rearrangement can disrupt gene function at the junction of the inverted genomic segment or alter
gene expression by displacement of enhancer sequences if they occur outside the inverted
segment (Lupski, 1998). Deletions can also adversely affect the expression of genes outside the
deleted regions through a similar mechanism. The majority of the diseases caused by genomic
rearrangements are the result of a deletion. Duplications are likely less pathogenic than deletions
since over expression of a gene may not be as deleterious as a decrease in gene expression.
Mechanistically duplications are also less likely since intra-chromatidal misalignments that
generate deletions do not produce a reciprocal duplicated chromosome.
Examples of contiguous gene disorders caused by deletions and duplications are listed in
Table 2.1. Although both Smith-Magenis and Di George/VCFS are classified as contiguous
gene disorders due to the size of the genomic interval involved and number of genes deleted,
there is growing evidence that RAI1 and TBX1 respectively, are responsible for most of the
characteristic features of these diseases.
40
Table 2.1. Contiguous Gene Disorders Associated with Chromosomal Rearrangements
DISORDER CHROMOSOMAL
LOCATION
GENES
INVOLVED
REARRANGEMENT
TYPEB SIZE (kb)
Williams-Beuren Syndrome 7q11.23 ELN + DEL 1500
Smith-Magenis Syndrome 17p11.2 RAI1 DEL 4000
Dup(17)(p11.2p11.2) 17p11.2 ? DUP 4000
Prader-Willi Syndrome 15q11.2q13 SNRPN DEL 3500
DiGeorge Syndrome/VCFS 22q11.2 TBX1 DEL 3000/1500
Microduplication 22q11.2 22q11.2 TBX1 DUP 3000-6000
2.1.3: Inversion of the WBS region:
In 2001, an inversion of the WBS region was identified in WBS families using 3-colour
interphase FISH. It was determined that 33% (4/12) of parents from whose germ cells the
deletion was transmitted were carriers of the inversion (WBSinv-1) (Osborne et al., 2001; Bayés
et al, 2003). It was subsequently determined that the inversion exists as a polymorphism present
in approximately 7% of the general population suggesting that this newly identified genomic
variant within the population may be associated with a predisposition to subsequent NAHR
(Hobart et al., 2010). Indeed similar pre-disposing inversions have since been identified in the
parents of individuals with Angelman syndrome, Sotos syndrome and two recently identified
genomic disorders on chromosome 15 and 17 (Gimelli et al., 2003; Visser et al., 2005; Koolen et
al., 2006; Sharp et al., 2008).
41
The 7q11.23 inversion was also identified in 3 individuals that presented with a ―WBS-
LIKE‖ diagnosis based on their medical records but did not have a deletion of the WBS region
and it was theorized that the inversion in these atypical patients may be different from those seen
in parents and may be pathogenic due to disruption of gene function at one of the inversion
breakpoints (Osborne et al., 2001).
The generation of high-resolution physical maps of human chromosome 7q11.23 and its
syntenic region of mouse chromosome 5G have provided a valuable comparative sequence
resource (DeSilva et al., 2002). The syntenic WBS region in mouse has the full complement of
genes but without the LCRs that flank the human WBS region. Interestingly, the genes
commonly deleted in WBS occur in an inverted orientation in the mouse relative to neighbouring
genes with respect to the human sequence suggesting that human 7q11.23 underwent inversion
from the ancestral chromosome.
2.1.4: Duplication of the WBS region:
Although prior to 2005, duplications of the WBS region had not been identified, they had
been predicted because of the mechanism of NAHR. Supernumerary chromosomes containing
the 7q11.23 genomic region were known to exist resulting in deficits in language, in particular,
with a delay in expressive language and difficulty in articulation (Tan-Sindhunata et al., 2000).
The genetic basis underlying speech and language disorders are believed to be complex with
interaction of several loci as well as the environment to affect the susceptibility to disease (Fisher
et al., 2003). To date, only the rare Mendelian form of developmental verbal dyspraxia (OMIM
602081) can be directly associated with a specific gene, FOXP2 on chromosome 7 (Lai et al.,
2001). In 2001, mutations in FOXP2 were found to be associated with severe speech problems
42
in a large multigenerational family (Lai et al, 2001). Symptoms included orofacial dyspraxia
and the inability to select and produce the fine movements of the tongue and lips necessary for
the development of speech. Language disorders on the other hand, involve deficits in the
processing of linguistic information and may involve receptive (impaired language
comprehension), expressive (language production), or a combination of both (Fisher et al.,
2003). Examples of language disorders include specific language impairment, dyslexia and
aphasia.
The WBS phenotype also contains aspects of speech and language. Although the onset
of language is often delayed in WBS individuals, upon acquisition of speech, language abilities
develop at a faster rate than in a normal child. Since WBS is a contiguous gene disorder known
to be caused by a hemizygous deletion of the 7q11.23 region it can be inferred that the gene(s)
responsible for the language aspects of WBS are likely dosage sensitive. This is supported by
speech language difficulties seen in individuals with supernumerary chromosomes containing all
or portions of the WBS commonly deleted region.
2.1.5: Large deletions of the WBS region:
While atypical deletions smaller than the commonly deleted region have aided in the
identification of a minimal critical region, larger WBS-deletions have also been reported. These
larger deletions often share one breakpoint with the common deletion and can extend either
centromerically or telomerically. Deletions that extend telomerically are associated with a more
severe phenotype including serious cognitive impairments (Stock et al., 2003; Ferland et al.,
2006) often accompanied by infantile spasms (Mizugishi et al., 1998; Wu et al., 1999; Morimoto
43
et al., 2003). Infantile spasms (IS), also known as West syndrome, is a rare form of epilepsy seen
in the first year of life (4-8 months) (Hrachovy et al., 2002). In about one half of cases of IS, the
spasms are a symptom of a generalized brain disorder, CNS infection (Hongou et al., 1998) or of
developmental brain disturbances such as lissencephaly, focal cortical dysplasia (Palmini et al.,
1991), tuberous sclerosis (Curatolo, 1996), and neurofibromatosis (Korf et al., 1993). The other
50% of cases are idiopathic, occurring in the absence of brain malformation or neurological
insult (Palmini et al., 1991; Curatolo, 1996; Cowan, 2002).
In IS, the seizures are characterized by clusters of flexion jerks of the head neck trunk or
extremities that persist for 1-2 seconds and may occur repeatedly throughout the day. Distinctive
high voltage spike patterns on electroencephalograms (EEG) called hypsarrythmia may be
present in two thirds of cases (Gibbs and Gibbs, 1952). There is a significant risk of mortality
and morbidity associated with IS and treatments and may include adrenocorticotropic hormones
(ACTH) or inhibitors of the catabolism of GABA, such as Vigabatrin, although this is only
variably effective and carries the risk of serious side effects such as vision problems, weight
gain, hypertension and in rare cases, congestive heart failure (Riikonen et al., 2004). Without
treatment, the neurodevelopment of the immature brain may be impaired due to increased
neuronal excitability with over one half of individuals developing secondary forms of seizures
(Berg et al., 2001; Sillanpaa et al., 1998).
2.2: Methods: Severe Expressive-Language Delay Related to Duplication of the Williams–
Beuren Locus:
2.2.1: Participants:
44
All protocols complied with the ethics guidelines of the institutions involved and
appropriate informed consent was obtained from all human subjects. To determine the effect of
the reciprocal duplication of the WBS region, comparative evaluations were performed on both
the proband (KP) and an unaffected sibling (LP). Although KP‘s mother died when he was 4
years 3 months old, informed consent was obtained from the father and assent from the children
before performing genetic and psychological studies. Complete family medical records were
reviewed and KP, his sibling, and his father completed psychological assessments and were
examined for neurologic signs and dysmorphic features. At the time of assessment, KP was 8
years 10 months old and LP was 11 years 1 month old.
2.2.2: Clinical evaluation of language fundamentals and physical manifestations:
Language assessment was performed by Carolyn Mervis, dysmorphology assessment was
performed by Colleen Morris. Differential Abilities Scales (DAS), Peabody Picture Vocabulary
Test (PPVT-III), Expressive Vocabulary Test (EVT) and the Clinical Evaluation of Language
Fundamentals—Preschool Version 2nd
ed. (CELF-Preschool 2) were carried out as previously
described. (Elliott, 1990; Dunn and Dunn, 1997; Williams, 1997; Wiig et al., 2004).
2.2.3: Fluorescence in situ hybridization (FISH):
FISH analysis was performed on chromosome spreads from peripheral blood
lymphocytes using standard methodology. Briefly, for interphase analysis, lymphocytes were
cultured up to 72 hours, then synchronized with BrdU (0.18 μg/ml, Sigma) and washed and re-
45
cultured for 6 h in α-MEM (Invitrogen) with thymidine (2.5 μg/ml; Sigma). Slides from cell
lines or peripheral blood were dried at room temperature for 3 days. Prior to hybridization, slides
were denatured in 70% formamide/2 × SSC for 30 s at 70 °C and dehydrated with ethanol.
Probes were generated from genomic DNA isolated from BAC/PAC clones and labelled with
either biotin (green) or digoxigenin (red). Probes were denatured for 5 min at 75 °C and
hybridized to slides overnight (37 °C in 50% formamide with C0t-1 DNA). The slides were
washed, detection solution added, stained with DAPI and examined under a fluorescence
microscope.
2.2.4: Single-copy microsatellite markers:
PCR was performed using standard protocols at The Center for Applied Genomics
(TCAG). Single-copy microsatellite markers were amplified using fluorescently labeled primers
and the sizes of the resulting products determined using an Applied Biosystems 3730xl DNA
analyzer. Estimation of the number of alleles at multilocus microsatellites was performed by
comparing the relative ratios of the areas under the peaks from alleles of the same size in
different samples, using GeneMapper 3.5 software (PE Applied Biosystems).
2.2.5: Site specific nucleotide (SSN) dosage analysis:
Site Specific Nucleotide (SSN) dosage analysis was used when further delineation of the
duplication breakpoints could not be accomplished using FISH or microsatellite analysis due to
the high degree of sequence homology in the flanking LCRs. This method utilizes dosage
46
analysis of SSNs between the centromeric, medial and telomeric repeat blocks allowing for the
identification of the relative number of block B-type copies at each position analyzed to
determine whether the recombinant block B was Bm type (breakpoint proximal or centromeric to
the position) or Bc type (breakpoint distal or telomeric). The assay was performed as previously
described (Bayés et al., 2003). Briefly, PCR products for each SSN locus were generated using
standard PCR methods, purified and digested using restriction endonucleases according to
manufacturer‘s instructions, followed by size fractionation on 1%-3% agarose or 10%
polyacrylamide gels.
2.2.6: Genomic analysis using quantitative PCR:
To determine genomic copy number, real-time PCR was performed using an ABI
Prism7900HT sequence detection system with 10 l reactions containing 5ng of template and
Power®SYBR master mix (Applied Biosystems, Foster City, CA) for 40 cycles of amplification.
Each plate contained a No Template Control (water) and serially diluted concentrations (range
10-0.62 ng) of control genomic DNA (BD Bioscience) were used to generate a standard curve
for genomic quantification. Real-time PCR experiments were normalized using SDHA and
HMBS as reference genes assuming that the copy number of these reference genes would be
constant in both test and control samples. Primer sequences are listed in Table 2.2.
2.2.7: Expression analysis using quantitative PCR:
Expression analysis to identify changes in gene expression was carried out, using total
RNA extracted from EBV transformed lymphoblast cell lines using standard Trizol/chloroform
47
extraction procedures. 5 ug of total RNA was DNase treated (Fermentas) and reverse transcribed
in a 20 ul reaction with random hexamers using SuperScript™ First-Strand Synthesis System
(Invitrogen). Real-time PCR was carried out using an ABI Prism7900HT sequence detection
system with 11 ul reactions containing 5 ng of template and Power®SYBR master mix (Applied
Biosystems, Foster City, CA) for 40 cycles of amplification. All samples were run in triplicate
and the experiment was repeated twice with consistent results. Real-time PCR experiments were
normalized using ACTB, and HPRT as references. Each plate contained a No Template Control
(NTC – water) and serially diluted concentrations of control genomic DNA (range 10-0.62 ng) to
generate a standard curve for transcript quantification. Primer sequences are listed in Table 2.2.
All samples were run in triplicate and the experiment was repeated twice with consistent results.
Comparative expression ratios were calculated by dividing the averaged normalized values for
each of the test genes by the normalized test gene values for the control group.
2.3: Methods: The Common Inversion of the Williams-Beuren Syndrome Region at
7q11.23 Does Not Cause Clinical Symptoms:
2.3.1: Participants:
Participants 1 and 2 were described previously as showing some features of WBS and
having an inversion but not a deletion of the 7q11.23 region (15441 and 12503 in Osborne et al.,
2001). The third patient originally reported in the paper is now deceased. To determine if the
inversion contributed to the observed syndromic features, a detailed family and medical history
was taken and a thorough clinical and developmental assessment and for each patient was
performed by Dr. Colleen A. Morris, an experienced dysmorphologist at the University of
48
Nevada School of Medicine. Immediate family members were also examined for features of
WBS. All other study participants were from families with WBS. All subjects presented in this
research were enrolled in a research study approved by the Research Ethics Board of the
University of Toronto. Informed consent was obtained before any clinical or genetic studies
were performed.
2.3.2: Developmental assessment:
The Williams Syndrome Cognitive Profile (WSCP) originally developed by Dr. Carolyn A.
Mervis and Dr Bonita P Klein-Tasman (2000) includes evaluation based on an individual‘s
performance on the DAS. To assess the cognitive and behavioral aspect of the reported
individuals, the following developmental assessments were performed by Dr. Carolyn Mervis: 1)
Differential Ability Scales (DAS) (Elliott, 1990) used to measure cognitive ability. 2) Wechsler
Abbreviated Scale of Intelligence (WASI) (Wechsler, 1999). The WASI is a standardized
measure of intelligence for the full age range of individuals in the patients‘ families (6 – 60
years) and includes 4 subtests (verbal: vocabulary, similarities; performance: block design,
matrices) and yields a verbal IQ, performance IQ, and full-scale IQ, and 3) Scales of
Independent Behavior-Revised (SIB-R) (Bruinsinks et al., 1996). The SIB-R is a standardized
measure of adaptive and maladaptive behavior. Four subscales of adaptive behavior (motor
skills, social interaction and communication skills, personal living skills, community living
skills) and three subscales of maladaptive behavior (internalized, asocial, externalized) were
measured.
49
2.3.3: Inversion testing:
Three-color fluorescence in situ hybridization (FISH) analysis was performed on both
blood and transformed lymphoblastoid cell lines from each participant, at The Center for Applied
Genomics, (Toronto, Canada) according to previously described protocols (page 50).
Chromosome spreads for interphase FISH analysis were prepared from peripheral blood
lymphocytes using standard methodologies. Three-color FISH was performed using two probes
located within the commonly deleted region, RP5-1186P10 at the GTF2IRD1 locus and CTA-
208H19 at the FZD9 locus, and one probe located telomeric to the WBS deleted region CTB-
139P11 at the HIP1 locus.
2.3.4: Expression analysis using quantitative PCR:
Expression analysis was carried out using total RNA extracted from transformed
lymphoblast cell lines as described previously (Section 2.2.7). Primer sequences are indicated in
Table 2.2. Each test gene was normalized to control genes hydroxymethylbilane synthase
(HMBS), hypoxanthine-guanine phosphoribosyltransferase (HPRT) and TATA binding protein
(TBP). A mean normal expression ratio was calculated for each of the control genes by averaging
the values for each gene obtained for the control group. Mean normal expression ratios were
then used to standardize the expression ratio across all three control genes, and averaged to
generate a normalized expression level (NEL). Comparative expression ratios for the WBSinv-1
and WBS deletion groups are expressed as a ratio of NEL of the test group relative to the control
group.
50
Table 2.2. Primers Used for Expression Analysis
Primer Name Sequence
ACTB-F AAAGCCACCCCACTTCTCTCTAA
ACTB-R ACCTCCCCTGTGTGGACTTG
ASLRTe10-F GCTGTGCATGACCCATCTC
ASLRTe10-R CATCTGAGAGCTGCACGAAG
BAZ1B-RTe4-F TCATCCTTTGGAGAAAGTGGA
BAZ1B-RTe4-R CTTCTGATGGTCCTGAGCAA
CYLN2-RTe2-F CACTCACCCTTGTCCACCTG
CYLN2-RTe2-R AAGCTGACCCAGTAGATGTCC
GTF2I-RTe2-F GAAATCTACAACCCAGGCAAA
GTF2I-RTe2-R GCAAAAGCAGAAATAGTCCTCAA
GTF2IRD1-RTe3-F CTCAGCGCTGTCCAAACTG
GTF2IRD1-RTe3-R CGGGCATTCAGGAACATTCT
HPRT1-RT-F GCCTATAGACTATCAGTTCCCTTTGG
HPRT1-RT-R TGCTGTGGTTTAAGAGAATTTTTTCA
KCTD7RTe4-F GAGTGTCCGCTCCTCAACTC
KCTD7RTe4-R TCCACTTCACAGTGGTGCTC
LIMK1-RTe3-F GAAGGATGGGCAGCTCTTCT
LIMK1-RTe3-R CAGTCCCTTGGTGATTTGCT
PORRTe14-F GGGGAGACGCTGCTGTACTA
PORRTe14-R ACGTTGAGCTGGGTGAGC
RFC2-RTe7-F AGTCCTCCGGTACACAAAGC
RFC2-RTe7-R GCTTCTAGGCCGTCATCAGT
51
Primer Name Sequence
WBSCR1-RT3‘-F GGCCACATCTTGGGGACA
WBSCR1-RT3‘-R CCCTAGCACTCCCACATAACT
WBSCR5-RTe2-F AGCTCGGGGACTGAACTG
WBSCR5-RTe2-R AGCAGCGCACACACAGAC
SERPIND1-RTe2-F CGGATCCAGCGTCTTAACAT
SERPIND1-RTe2-R CCAACGGGTGCTATGAAGA
YPEL1-RTe2-F GTCCCAGCTGTGTGGACAGT
YPEL1-RTe2-R GCTGGCCTCTCTGACAAAAG
The control group contained RNA samples from 8 individuals known not to carry a
rearrangement of the 7q11.23 region. The WBSinv-1 carrier group consisted of 8 individuals
determined to be carrying one WBSinv-1 inverted chromosome and the WBS group consisted of
5 individuals possessing the common 1.5 Mb deletion of 7q11.23.
Pair wise statistical comparison between was performed using a two-tailed student t-test to
look for differences in expression of each gene in the test groups relative to the control group.
Probabilities of P<0.05 were considered significant.
2.3.5: Copy number variation analysis:
Copy number variation (CNV) analysis was performed on Participant 1 and Participant 2 at The
Center for Applied Genomics by Dr. Christian Marshall using SNP array analysis. DNA samples
were genotyped with the Affymetrix GeneChip® Human Mapping NspI Array (Affymetrix Inc.,
52
Santa Clara, CA) according to the manufacturer‘s instructions. The NspI Array scans were
analyzed using dChip 2006 software (DNA Chip Analyzer) and copy number analysis was
performed as described previously (Zhao et al., 2004). The CNVs identified in each DNA
sample were compared with previously documented CNVs using the Database of Genomic
Variants, a curated catalogue of structural variations in the human genome (Iafrate et al., 2004).
2.3.6: Genomic analysis using quantitative PCR:
The detected CNVs were confirmed using quantitative real-time PCR with primers located
within the SERPIND1 and YPEL1 genes listed in Table 2.2. Real-time PCR was carried out
using a 7900HT genetic analyzer (Applied Biosystems, Foster City, CA) with 11 ul reactions,
performed in triplicate, containing 5 ng of template and Power®SYBR master mix (Applied
Biosystems, Foster City, CA) for 40 cycles of amplification. The DNA copy number of each
gene was obtained from a calibration curve that assumes the reference genome is diploid.
Genomic ratios were determined by comparing absolute copy number of the two test genes to the
reference gene, HMBS.
2.4: Methods: Infantile Spasms is Associated with Deletion of MAGI2 on Chromosome
7q11.23-q21.11.
2.4.1: Participants:
In order to determine whether a novel locus for IS could be defined, 12 cases were
identified with interstitial deletions of 7q11.23-q21 from our Chromosome 7 Annotation Project
53
clinical database. Additional subjects described in this study included four with a diagnosis of
WBS, six with a diagnosis of WBS plus IS, and three with a diagnosis of IS or other seizure
disorder, but not WBS. Clinical data for all subjects, plus the 13 additional subjects from the
literature with deletions of 7q11.23-q21.1 are presented in Table 2.11. Seizure history was
obtained for all cases and genotype-phenotype correlation was performed on the basis of the
presence or absence of IS or other forms of seizure activity.
2.4.2: Preparation of genomic DNA:
Genomic DNA was obtained directly from the Hospital for Sick Children (Toronto,
Canada) or prepared from peripheral blood lymphocytes using standard methodologies. Briefly,
cell pellets were digested in lysis buffer (10 mM Tris, 100 mM NaCl, 10 mM EDTA, 0.5% SDS,
0.4 ug/ml Proteinase K) overnight at 60oC. Potassium acetate was added to final concentration
of 1.2M and equal volume of chloroform. Samples were incubate 20 minutes at -20°C and
pelleted for 5 minutes at 12000 xg at room temperature. The aqueous phase was transferred to
fresh tube and DNA precipitated with 2 volumes of 100% ethanol. Pellet at 12000 xg at RT and
wash with 70% ethanol. Re-suspended in nuclease free water and store at -20°C. DNA was also
purified from buccal samples using the Oragene DNA Self-Collection Kit following
manufacturer‘s instructions.
2.4.3: CNV analysis:
Comparative intensity analysis was performed by Dr. Christian Marshall at the Center for
Applied Genomics (Toronto, Canada) on DNA samples from 17 of the 26 subjects in order to
54
establish the copy number variation (CNV) content and to define the breakpoints of the
interstitial 7q11.23-q21.1 deletions. For each DNA sample, an average of 250,000 SNPs were
genotyped using the GeneChip® Human Mapping NspI and StyI Array (Affymetrix, Inc., Santa
Clara, CA) according to the manufacturer‘s instructions and as described previously (Marshall et
al., 2008). Briefly, 250ng of genomic DNA was digested with NspI or StyI restriction enzyme
(New England Biolabs, Boston, MA), ligated to an adaptor and amplified by PCR. The PCR
products were then fragmented with DNase I to a size range of 250 to 2,000 bp, labeled, and
hybridized to the array. After hybridization, arrays were washed on the Affymetrix fluidics
stations, stained, and scanned using the Gene Chip Scanner 3000 7G and Gene Chip Operating
System. The NspI and StyI Arrays scans were analyzed independently using dChip 2006 software
(DNA Chip Analyzer) (Li and Wong, 2003). Array scans were normalized at the probe intensity
level with an invariant set normalization method (Li and Wong, 2001a). After normalization, a
signal value was calculated for each SNP using a model-based method (Li and Wong, 2001b). In
this approach, image artifacts were identified and eliminated by an outlier detection algorithm.
Using this approach, comparative intensity analysis enabled the mapping to within
approximately 10 Kb of the 7q11.23-q21.1 deletion boundaries in each subject sample. When the
deletion breakpoint was located within the low copy repeats flanking the WBS region, it was not
possible to identify the precise location of the breakpoint due to the presence of multiple copies
of SNPs within the low copy repeats.
2.4.4: Genomic analysis using quantitative PCR:
Confirmation of the array data and refinement of the breakpoints within and around
MAGI2 was performed by quantitative real-time PCR analysis using the 7900HT genetic
55
analyzer (Applied Biosystems, Foster City, CA). The total volume was 11 ul and reactions were
performed in triplicate, using 5 ng of template and Power®SYBR master mix (Applied
Biosystems, Foster City, CA) for 40 cycles of amplification. The DNA copy number of each test
sequence was obtained from a calibration curve that assumes the reference genome is present in
two copies at that site. Genomic ratios were determined by comparing absolute copy number of
the test sequences to the reference gene, HMBS. Quantitative real-time PCR analysis of MAGI2
exon 1 and exon 21 was carried out on all 20 available DNA samples (Figure 2.8; Cases 1; 6-12;
13-21; 22-24) and breakpoints for critical cases were further refined using primer pairs listed in
Table 2.3.
Table 2.3. qPCR Primers Used to Characterize MAGI2 Breakpoints
Primer Name Sequence
hsMAGI2RTe1-F AGCTGGGCTTTGAACTGAAG
hsMAGI2RTe1-R ATTTGCTGCCGCTCTCATAG
hsMAGI2RTe2a-F GCGAATGGGTTGGATCAGTA
hsMAGI2RTe2a-R GAGCTCTGTTCAAAGGAAGCA
hsMAGI2RTe3-F ACCACAAGGCCACATAAGGA
hsMAGI2RTe3-R CCACTTTCTAGGAGAGCACCA
hsMAGI2RTe4-F CAGCAGAACCAGCACCATTA
hsMAGI2RTe4-R CTTCCGTTTTCCTTCAGCAC
hsMAGI2RTe19-F TGAAAGCAAGGCAAGATGTG
hsMAGI2RTe19-R CTGCTGGTAGTCCCCTCCT
hsMAGI2RTe22-F ACCCTTCCCACCAGATAAGC
hsMAGI2RTe22-R TGAAAGCTCCTTTGGTTTCC
56
Primer Name Sequence
hsMAGI2RT-3'-F CACTGCATGAAGGACTTGGA
hsMAGI2RT-3'-R GCTCCGTGCAGTTTGATTTT
2.5: Results: Duplications and its Association with Speech Language Delay:
Data from this section has been included in the following publication:
Somerville MJ*, Mervis CB*, Young EJ, Seo E-J, del Campo M, Bamforth JS, Peregrine E, Loo
W, Lilley M, Perez-Jurado LA, Morris CA, Scherer SW, and Osborne LR. (2005) Severe
expressive-language delay related to duplication of the Williams–Beuren locus. New England
Journal of Medicine 353:1694-1701.
*authors contributed equally to this work
The patient was identified by Dr. Stephen Bamforth and Margaret Lilley. The
duplication of 7q11.23 was initially found by Dr. Martin Somerville. Physical evaluation was
performed by Dr. Colleen Morris and assessment of speech, language and cognitive abilities was
performed by Dr. Carolyn Mervis and Ella Peregrine. FISH was performed by Drs. Eul-Ju So
(Dr. Stephen Scherer‘s lab). Site specific nucleotide (SSN) dosage analysis was performed by
Drs. Miguel del Campo and Luis Perez-Jurado. I determined the extent of the duplication and
evaluated changes in expression of deleted genes.
2.5.1: Mild physical manifestation of 7q11.23 duplication:
Although this is the first case of the reciprocal duplication of the WBS deletion, KP
displayed few physical symptoms, namely growth retardation and mild dysmorphism, unlike the
distinctive facial gestalt seen in WBS (Morris, 2005). In the physical assessment, KP‘s height,
weight and head circumference were found to be in the 2nd
, 5th and 30
th centile respectively.
Other dysmorphic features included dolichocephaly, a high narrow forehead, long eyelashes, a
57
high and broad nose, short philtrum, high arched palate, dental malocclusion (anterior open bite),
retrognathia, and asymmetric face (Figure 2.2).
It should be noted that KP did not exhibit any of the facial features commonly seen in
WBS (Morris, 2005). He had bilateral simian creases, and the left hand was smaller than the
right. On neurological exam, KP was noted to have mild dysmetria and some difficulty walking
and standing on one foot.
58
2.5.2: Severe expressive language delay is the most striking feature of 7q11.23 duplication:
The expressive language difficulties exhibited by KP were immediately apparent,
pronouncing only a very small number of words. The majority of words were approximations,
often composed of the first consonant (or a related consonant) and the first vowel (or a related or
neutral vowel) of the word being spoken. The results of the intellectual and vocabulary
assessments are summarized in Table 2.4. KP‘s performance on the nonverbal reasoning, spatial
ability, general conceptual ability and special nonverbal composite subtest of the Differential
Ability Scales (DAS) (Elliott, 1990) did not differ significantly from his sister who did not carry
the duplication of 7q11.23. On the Verbal subtest, where verbal responses, manual signs,
gestures, pantomime, and drawing were all considered acceptable responses, KP‘s score was
significantly lower than his sister and if only verbal responses had been accepted, his standard
score on the Verbal subtest would have been considerably lower.
The Peabody Picture Vocabulary Test (PPVT-III) (Dunn and Dunn, 1997), measuring
receptive vocabulary, and the Expressive Vocabulary Test (EVT) (Williams, 1997) were
administered to provide a direct comparison of KP‘s receptive and expressive language abilities
(Table 2.4). Even though words and word approximations as well as manual signs were
considered acceptable responses, KP‘s standard score for receptive vocabulary was in the low
average range (age equivalent of 6 years 10 months) in contrast to his expressive vocabulary
standard score which was in the severe impairment range (age equivalent of 2 years 3 months),
59
Table 2.4. Standard Scores on Intellectual and Vocabulary Assessments
Assessment KP LP
Differential Ability Scales (DAS)
Verbala 65 93
Nonverbal Reasoning 65 70
Spatial 70 68
General Conceptual Ability 62 73
Special Nonverbal Composite 65 67
Vocabulary
PPVT-III 82 106
EVTb 40 104
aKP responded with a combination of words, manual signs, gestures, and pantomime; all these
modes were acceptable for the DAS Verbal Cluster, provided his meaning was clear. bFor KP, responses composed of words or manual signs (but not gesture or pantomime) were
acceptable for the EVT.
Due to the impairment of KP‘s language abilities he was unable to complete the age-
appropriate version of the Clinical Evaluation of Language Fundamentals. Therefore, the
Clinical Evaluation of Language Fundamentals - Preschool Version 2nd
ed. (CELF-Preschool 2)
(Wiig et al., 2004) was administered. On the subtests evaluating receptive language, KP
demonstrated that he understood a variety of grammatical constructions, was able to categorize
pictures of objects, and understood simple relational language. Overall, his performance was
consistent with moderate language impairment.
In contrast to his receptive language abilities, KP was unable to answer a single question
correctly on the three primary expressive subtests: recall of sentences, expressive vocabulary,
60
and word structure, indicative of severe expressive language impairment. These subtests
measured production of grammatical markers such as plural or past tense, ability to repeat
verbatim sentences spoken by the examiner, and ability to label pictures (using either words or
signs). Although KP's standard scores were in the mild mental deficiency range on the DAS
Nonverbal Reasoning and Spatial Clusters, his abilities were similar to those of his sister and are
also consistent with the type of difficulties his mother was also reported to have had. Both
children‘s scores on the DSM-IV Inattentive, Hyperactive-Impulsive and the Conners‘ Rating
Scale (Conners, 1997) were consistent with their previous diagnosis of ADHD. Therefore the
primary basis for these difficulties is likely not the duplication of the 7q11.23 region.
2.5.3: Duplication of the 1.5 Mb WBS region:
KP was initially referred to a diagnostic centre for velocardiofacial syndrome (VCFS)
testing. Using real-time PCR-based methods, the assay identified abnormal genomic ratios of
several genes located within the WBS critical region (7q11.23) (Christiansen et al., 2004). FISH
analysis with probes from the 7q11.23 region (Morris, 2005) showed that the duplication was
limited to the region commonly deleted in WBS. Three signals on interphase FISH spreads were
observed using BAC probes from within the WBS common deletion region (CTA-208H19, RP5-
1186P10), while BAC probes flanking the common deletion region (RP11-815K3, CTB-139P11)
gave only two signals (Figure 2.3). Two signals were also seen using the cosmid LL07NCO1-
207g3, which lies between the medial and telomeric LCRs, indicating that the duplication was
restricted to the region spanning the centromeric and medial LCRs, corresponding to the region
61
commonly deleted in WBS. No duplication was detected in KP‘s father or sister or in over 250
other WBS or non-WBS controls examined.
2.5.4: Single-copy microsatellite markers:
Single-copy microsatellite analysis using markers from within the WBS region of KP
identified distinctive alleles at the following loci D7S2476, D7S3194 and D7S1870 (Table 2.5).
At all three markers, only one of the alleles was found to be present in the father indicating that
KP mostly likely inherited two different copies of the WBS region from his mother. Subsequent
analysis of single-copy microsatellite markers from both maternal grandparents determined that
62
the duplicated chromosome was derived from segments of chromosome 7 inherited
independently from each maternal grandparent (Table 2.5). Therefore, the inter-chromosomal
recombination that led to the duplication took place during meiosis in the mother‘s germ cells,
and that the recombination was a de novo rearrangement.
Two multi-copy microsatellite markers were also used: BASTR1 (D7S489) which is
present in the centromeric (D7S489Cc), medial (D7S489A) and telomeric (D7S489Ct) A-blocks
as well as within the commonly deleted region (D7S489B), and BBSTR1, which is present in
each of the three B-blocks (Bayés et al., 2003). An additional copy of each locus was identified
in KP‘s DNA when compared to his father, indicating a gain of a B block.
63
Table 2.5. Single-Copy Microsatellite Analysis Using Markers from Within the WBS
Region
FAMILY MEMBER MARKER
ALLELE 1 ALLELE 2 ALLELE 3
Size in base pairs
Proband 216 222
Sibling 222 222 Father D7S653 216 222
Mat GF 222 222
Mat GM 222 222
Proband 140 150
Sibling 144 144
Father D7S672 144 150
Maternal Grandfather 140 140 Maternal Grandmother 142 144
Wil
liam
s-B
eure
n s
yn
dro
me
regio
n
Proband 156 162 168
Sibling 156 168
Father D7S2476 156 156
Mother (reconstructed) 162 168
Maternal Grandfather 154 162
Maternal Grandmother 154 168
Proband 202 204 208
Sibling 204 204
Father D7S3194 202 204
Mother (reconstructed) 204 208
Maternal Grandfather 208 208
Maternal Grandmother 196 204
Proband 134 132 136
Sibling 134 136
Father D7S1870 134 134
Mother (reconstructed) 132 136
Maternal Grandfather 128 132
Maternal Grandmother 134 136
Proband 210 210
Sibling 206 210
Father D7S2455 206 210
Maternal Grandfather 202 202
Maternal Grandmother 208 210
Proband 207 207
Sibling 207 211 Father D7S675 207 211
Maternal Grandfather 209 211
Maternal Grandmother 207 209
64
2.5.5: The 7q11.23 duplication is the reciprocal of the WBS deletion:
Due to the high sequence identity of the LCRs, further narrowing of the duplication
breakpoints could not be accomplished with FISH or microsatellite analysis. Previously, it has
been demonstrated that site-specific nucleotide (SSN) dosage analysis can be used to refine the
breakpoints of the WBS deletion within the repetitive B-blocks of sequence (Bayés et al., 2003).
This method utilizes dosage analysis of SSNs between the centromeric, medial and telomeric
repeat blocks enabling the determination of the relative number of block B-type copies at each
position analyzed and whether the recombinant block B was Bm type (breakpoint proximal or
centromeric to the position) or Bc type (breakpoint distal or telomeric). Analysis of seven SSNs
spanning 7q11.23 showed that in KP the transition between block Bm and Bc occurred within
the NCF1 gene between SSN 4 and SSN 6 (Figure 2.4) similar to 95% WBS deletion breakpoints
(Valero et al., 2000; Bayés et al., 2003), indicating that the duplication is the exact reciprocal of
the common WBS deletion.
2.5.6: Genes within the duplication show altered expression:
Quantitative PCR gene expression analysis using RNA derived from lymphoblastoid cell
lines demonstrated that 5 of 6 genes within the duplicated region (GTF2I, LIMK1, EIF4H, RFC2,
BAZ1B) showed increased expression in KP and reduced expression in individuals with WBS
(Table 2.6). Only LAT2 (formerly WBSCR5), which showed a 60% reduction in expression in
individuals with WBS, displayed levels consistent with control individuals in KP. WBSCR16,
located just outside the telomeric WBS deletion/duplication breakpoint, also did not show altered
expression in either KP or WBS patients, indicating that this rearrangement breakpoint did not
65
af
fect the expression of WBSCR16. Calneuron 1 (CALN1), the nearest gene outside the
centromeric WBS boundary, was not expressed in lymphoblast cell lines. However, since it is at
least 300 kb from the proximal B block (Bayés et al., 2003) and the breakpoint is separated from
CALN1 by the complex and actively transcribed LCRs, it is unlikely the duplication or deletion
breakpoint would affect its expression although it cannot be ruled out.
66
Table 2.6. Genes Within the Duplication Show Altered Expression
Gene
Comparative Expression Ratio (vs. control group n=9)
WBS Patients (n=9)
Mean ± SEM
KP Duplication
Mean ± SD
BAZ1B 0.42 (± 0.07) 1.47 (± 0.15)
WBSCR18 0.39 (±0.04) 1.44 (± 0.12)
LIMK1 0.50 (± 0.22) 1.57 (± 0.17)
EIF4H 0.45 (±0.05) 1.35 (± 0.10)
LAT2 0.38 (± 0.17) 1.05 (± 0.28)
RFC2 0.50 (± 0.06) 1.30 (± 0.02)
GTF2I 0.56 (± 0.08) 1.58 (± 0.13)
WBSCR16 0.99 (±0.12) 0.94 (± 0.37)
2.6: Results: Common Inversion Does Not Cause Clinical Symptoms:
Data from this section has been included in the following publication:
Tam E, Young EJ, Morris CA, Marshall CR, Loo W, Scherer SW, Mervis CB, Osborne LR.
(2008) The common inversion of the Williams-Beuren syndrome region at 7q11.23 does not
cause clinical symptoms‖ American Journal of Medical Genetics: Part A. 146A:1797-1806.
Figures reprinted with permission.
Physical evaluation was performed by Dr. Colleen Morris and assessment of speech,
language and cognitive abilities was performed by Dr. Carolyn Mervis. CNV analysis was
performed by Dr. Christian Marshall (Dr. Stephen Scherer‘s lab). Wayne Loo, Elaine Tam and I
performed expression analysis.
2.6.1: Clinical assessment:
67
2.6.1.1: Medical and family history Participant 1:
Participant 1 was a female, delivered at term and was noted to have ectrodactyly of the feet
at birth. She did not walk until between 16 and 18 months. She pronounced her first words at
age 1 year, and was able to speak in sentences by the age of 3 years. With the exception of the
occurrence of inguinal hernias in a maternal uncle, a five-generation family history did not reveal
any symptoms common to individuals with WBS. Subsequent physical examination of her half
sister, mother, and both maternal grandparents revealed no dysmorphic features.
2.6.1.2: Medical and family history Participant 2:
Participant 2 is a female that was delivered at term with initial respiratory distress. She had
delayed motor development and was diagnosed with static encephalopathy (cerebral palsy).
When she was evaluated at the age of 2 years, due to developmental delay, her head
circumference was 43 cm, which was below the 2nd percentile. Six months later, she was noted
to have increased tone in her lower extremities as well as a wide based gait. As a young child,
she had a past history of a seizure disorder, which resolved by the age of 12 years, as well as a
history of chronic ear infections (otitis media). Initial karotyping studies revealed no
abnormalities and a DNA test for Fragile X was also negative. She was diagnosed with a growth
hormone deficiency at the age of 12 years and responded well to growth hormone therapy. A
four-generation family history failed to identify any symptoms common to people with WBS
although Participant 2‘s older sister had been diagnosed with Grave‘s disease. Further physical
examination of Participant 2‘s parents and sister revealed no dysmorphic features.
68
2.6.1.3: Physical examination Participant 1:
A summary of clinical presentation can be found in Table 2.7. At the time of examination,
Participant 1 was 17 years old. Participant 1‘s head circumference was at the 40th percentile, and
her cranial shape was dolichocephalic although her facial measurements were with the normal
range with the exception of a wide mouth (Figure 2.5). She had bilateral epicanthal folds and the
69
palpebral fissures were down slanting. Participant 1 possessed a mildly webbed neck and there
was a low posterior hairline, although in general, her hair pattern was normal. Participant 1 had
sloping shoulders, there was a tight heel cord on the right and her right leg was smaller than the
left. Participant 1 also exhibited bilateral ectrodactyly of the feet with the right foot showing a
70
severe ectrodactyly with pes cavus, and the left foot showing a mild ectrodactly (four toes were
present), resulting from a previously identified 24 Mb inversion disrupting the 7q21.3 region that
has been associated with split hand/foot malformation (SHFM) (Scherer et al., 1994).
Participant 1 did not meet the clinical criteria for WBS. Participant 1 did have 2 of 17
facial features consistent with WBS (WBS have >9) including strabismus and a wide mouth with
bowed upper lip (Mervis and Morris, 2007). Other common physical features consistent with
WBS include: radio-ulnar synostosis, sloping shoulders, lordosis, and joint contractures although
the latter may be due to her ectrodactyly and leg length discrepancy.
2.6.1.4: Physical examination of Participant 2:
A summary of her clinical presentation can be found in Table 2.7. Participant 2 was
examined at age 22 years of age. Her height and weight scored at the 5th percentile, and her head
circumference was 51.5 cm, which is below the 3rd percentile. Participant 2 had a low anterior
hairline, left esotropia (strabismus) and mildly up-slanting palpebral fissures. She had
hypotelorism with inner canthal distance; inter pupilary distance and outer canthal distance all
below the 3rd percentile. Participant 2 had a broad nose and her mouth width was at the 25th
percentile. Participant 2‘s fingers were thin and tapered and a bilateral shortening of the fifth
fingers. Participant 2 had tight heel cords and hamstrings with the right worse than left, as well
as a mild two-three toe syndactyly on her left foot.
Participant 2 possessed none of the common physical features typically associated with
WBS. Strabismus was the only WBS associated facial feature identified (Mervis and Morris,
71
2007). The joint contractures in Participant 2 were related to her static encephalopathy and
microcephaly.
Table 2.7. Clinical and Neurobehavioral Features of Individuals with Williams-Beuren
Syndrome and of Participants 1 and 2
Williams-Beuren Syndrome Participant 1 Participant 2
Faces
Broad forehead Normal forehead Microcephaly
Bitemporal narrowing Normal bitemporal area Microcephaly
Low nasal root & bulbous nasal tip Normal nose Broad nose
Prominent earlobes Low set and posteriorly
rotated ears
Ears normally placed and
formed
Periorbital fullness Normal periorbital area Normal periorbital area
Stellate iris Normal iris Normal iris
Malar flattening but full cheeks Mild malar hypoplasia Normal mala
Long philtrum Normal philtrum Normal philtrum
Full lips and wide mouth Wide mouth (2 SD >mean) Small mouth
Small jaw Prominent jaw Normal jaw
Small, widely spaced teeth Normal sized teeth Normal sized teeth
Normal palate Normal palate High, arched palate
Other Physical
Low birth weight Normal birth weight Normal birth weight
Growth retardation Normal growth Growth retardation
Kidney & bladder abnormalities Renal ultrasound normal Incontinence
Kyphosis, lordosis, joint
contractures, radio-ulnar synostosis
Lordosis, joint contractures.
Radio-ulnar synostosis of the
left elbow
Joint contractures, bilateral
hallux valgus
72
Williams-Beuren Syndrome Participant 1 Participant 2
Ectrodactyly of both feet
Hypercalcemia Not tested Not tested
Ocular problems: strabismus,
hyperopia
Strabismus, myopia Strabismus
Cardiovascular problems: SVAS Normal echocardiogram None reported
Cognitive Abilities
Mild mental retardation Mild mental retardation Mild mental retardation
Weakness in spatial skills and math Relative strength in spatial
skills and math
Relative strength in spatial
skills
Relative strength in expressive
language
Relative weakness in verbal
skills
Relative weakness in
verbal skills
Behaviour
Excessively social Normal social interaction Normal social interaction
Attention deficit hyperactivity
disorder
No hyperactivity
Mild attention problems
No hyperactivity
Mild attention problems
Hypersensitivity to sound and
specific phobia of loud noises
Normal response to loud
noises
Normal response to loud
noises
2.6.2: INV-1 Participants 1 and 2 developmental assessment:
Standard scores on intellectual and adaptive behavior assessments for Participants 1 and 2
are presented in Table 2.8. Patient 1‘s full-scale IQ was determined to be 0.43 SD below the
mean for a group of 28 adolescents and young adults with WBS and 0.29 SD below the mean for
a group of 27 adolescents and young adults with Down syndrome (DS). Patient 2‘s full-scale IQ
was determined to be 1.07 SD below the mean for WBS and 0.77 SD below the mean for DS
(Mervis and Morris, 2007). On the four subtests, both participants score highest on the Block
73
Design subtest, on which individuals with WBS typically have the most difficulty. Information
provided by Participant 1‘s mother, and the results of the DAS indicate that her math skills are
more advanced than her reading skills in contrast to most people with WBS who perform
considerably better on reading than on math. Also, in contrast to people with WBS, Participant 2
displayed an aptitude for remembering dates, such as birthdays and ages; while most people with
WBS do not know the ages of their siblings (never mind their uncles, aunts, or cousins), and
almost never know in what year these people were born.
Attention problems were not identified in either patient and both were able to stay on task
throughout the 2 hours it took to complete the testing, although it was reported that both had
difficulty staying on task in group situations. In contrast to this finding, the majority of
individuals with WBS find it difficult to stay on task even in one-on-one situations. Neither
participant showed any of the characteristic behavioral features seen in individuals with WBS
Participant 1 sat quietly while examiners spoke with her family, and spoke only when asked a
direct question. Participant 2 regarded the examiners as strangers and spoke only when it was
appropriate. Participant 2 did not ask any personal questions and stayed on topic during
conversations.
On the SIB-R adaptive behavior test, Participant 1‘s Broad Independence standard was in
the range expected for WBS although this is consistent with other syndrome associated with
mild-to-moderate mental retardation. Participant 2‘s Broad Independence standard score was
determined to be considerably below individuals with WBS. Overall maladaptive behavior
scores for both participants were also within the normal range.
74
As mentioned in the introduction, persons with the WSCP are required to fit all four of
the following criteria on the DAS met by 89% of individuals with WBS (Mervis et al., 2000).
Participant 1 did not fit the WSCP because her DAS T scores did not fit criteria 3 and 4.
Participant 1‘s mother (WBSinv-1 carrier), maternal grandmother (WBSinv-1 carrier), maternal
grandfather (no inversion) and half-sister (WBSinv-1 carrier) all had full-scale IQ scores in the
average range and none fit the WSCP. Participant 2 did not fit the WSCP because her DAS T
scores did not fit criteria 1 and 3. Participant 2‘s mother, father and sister all had IQ scores in the
average range and none fit the WSCP.
75
Table 2.8. Standard Scores on Intellectual and Adaptive Behavior Assessments for
Participants 1 and 2 and for Adolescents and Young Adults with Williams-Beuren
Syndrome
Test Population
Mean ± SD
WBS
Mean ± SD
Participant
1
Participant
2
WASI
Verbal IQ 100 ± 15 71.9 ± 13.2 64 55
Performance IQ 100 ± 15 67.5 ± 12.7 61 58
Full-scale IQ 100 ± 15 67.6 ± 12.7 59 53
DAS
Pattern construction 50 ± 10 23.2 ± 5.3 26 21
Definitions 50 ± 10 29.7 ± 8.8 29 20
Similarities 50 ± 10 30.1 ± 10.8 35 20
Digit Recall 50 ± 10 34.6 ± 10.2 22 26
Mean T (six core subtests) 50 ± 10 28.3 ± 6.3 25.5 20.2
SIB-R
Adaptive Behavior:
Motor skills 100 ± 15 48.8 ± 13.1 48 27
Social interaction and
communication skills
100 ± 15 70.6 ± 11.5 64 56
Personal living skills 100 ± 15 59.2 ± 11.7 69 38
Community living skills 100 ± 15 47.4 ± 14.2 57 16
Broad independence 100 ± 15 47.3 ± 11.5 52 23
Maladaptive Behavior:
Internalized
0 ± 10
-8.9 ± 8.6
-17
-3
Asocial 0 ± 10 -9.2 ± 10.8 4 2
Externalized 0 ± 10 0.3 ± 6.4 1 3
General 0 ± 10 -9.3 ± 6.9 -6 -1
76
2.6.3: Inversion testing using three-colour interphase FISH:
The inversions present in Participants 1 and 2 had been identified previously (Osborne et
al., 2001). To further characterize the possible origins of the rearrangement, additional members
of each patient‘s family were analysed using FISH (Figure 2.6). In Participant 1‘s family, seven
other family members were tested using three-colour interphase FISH. The WBSinv-1 was found
to be present in Participant 1‘s mother, half-sister, grandmother, and one great-aunt while no
WBSInv-1 was found in Participant 1‘s aunt, grandfather and one great-aunt. In Participant 2‘s
family, three other family members were available for testing using three-color interphase FISH.
The Participant‘s mother, father and sister were all negative for the 7q11.23 inversion.
2.6.4: INV expression analysis:
It was determined in a group of individuals with the common WBS deletion (n=5) that
levels of expression of eight genes within the WBS region showed a reduction in expression of
55 to 90% (Table 2.9). In addition, the expression of 3 genes found outside the commonly
deleted WBS region were also shown to be reduced from 40 to 70% and the expression of one
gene (WBSCR16) was determined to be increased by 60% in WBS individuals.
77
78
Table 2.9. Expression Analysis of Genes from the WBS Region in Individuals who have
WBS or Individuals in the General Population who have WBSinv-1
Chromosome
position Gene
Comparative Expression Ratio
(vs. control group n=8) Mean ± SEM
Individuals
with WBS
(n=5)
Individuals
with
WBSinv-1
(n=8)
Atypical
WBS
Participant 1
Atypical
WBS
Participant 2
6.5 Mb cen ASL 0.606 ± 0.043# 1.29 ± 0.089* 1.13 ± 0.261 1.23 ± 0.365
6 Mb cen KCTD7 0.561 ± 0.073# 1.06 ± 0.064 1.05 ± 0.072 0.871 ± 0.231
WB
Sin
v-1
reg
ion
WB
S c
om
mon d
elet
ion r
egio
n
BAZ1B 0.101 ± 0.011# 0.877 ± 0.049 0.876 ± 0.363 0.855 ± 0.314
WBSCR18 0.291 ± 0.045# 1.16 ± 0.093 1.185 ± 0.108 1.12 ± 0.110
STX1A 0.244 ± 0.031# 1.18 ± 0.075* 0.792 ± 0.231 0.903 ± 0.096
LIMK1 0.320 ± 0.040# 1.08 ± 0.041 1.07 ± 0.317 0.873 ± 0.325
WBSCR1 0.450 ± 0.035# 1.05 ± 0.050 1.11 ± 0.0460 0.994 ± 0.096
RFC2 0.324 ± 0.027# 0.947 ± 0.046 1.18 ± 0.234 0.904 ± 0.060
CYLN2 0.371 ± 0.028# 0.993 ± 0.041 1.28 ± 0.193 1.03 ± 0.304
GTF2I 0.245 ± 0.030# 1.17 ± 0.088 1.28 ± 0.167 0.936 ± 0.317
WBSCR16 0.991 ± 0.121 1.21 ± 0.075* 1.12 ± 0.166 0.923 ± 0.314
Next gene tel HIP1 0.714 ± 0.108 1.18 ± 0.209 1.14 ± 0.163 0.797 ± 0.225
1 Mb tel POR 0.311 ± 0.022 # 1.19 ± 0.075 1.24 ± 0.441 0.783 ± 0.225
1.2 Mb tel MDH2 1.26 ± 0.139 1.08 ± 0.116 0.985 ±0.278 0.878±0.192
T-test, * P<0.05, #P<0.001
In contrast, expression analysis revealed no significant difference in expression between
control individuals without a WBSinv-1 chromosome (n=8), or a group of individuals carrying a
WBSinv-1 chromosome with no clinical symptoms (n=8) for all but one selected gene from
79
within the common WBS deletion region (Table 2.9). The exception was STX1A whose
expression was increased by 19%. Although statistically significant, the increase was small and
not consistent with the decrease in expression of STX1A found in individuals with WBS.
Further, an individual identified who was homozygous for the WBSinv-1 chromosome also
showed similar levels of gene expression to the control group, although it was not possible to
perform statistical analysis since it was a single sample.
2.6.5: Copy number variation analysis:
The CNV analysis for Participant 1 identified the presence of three previously
characterized CNVs on chromosomes 9p24, 9p21 and 22q11.1, as well as a novel duplication at
22q11.22 spanning the region between 19,428,100 Mb and 20,742,400 Mb (1.3 Mb) according to
the human reference sequence (NCBI Build 36) (Table 2.10). The novel 22q11.22 duplication
partially overlapped three known CNVs, but also included a unique 380 kb duplicated region
spanning three known genes (DUP1) and a 248 kb duplicated region spanning five known genes
(Dup2) (Figure 2.7). The two novel 22q11.22 duplicated regions identified in Participant 1 were
confirmed using real-time PCR with primer pairs generated for genes unique for each duplicated
region; SERPIND1 and YPEL1 respectively.
80
Table 2.10. Copy Number Variant Analysis of Participants 1 and 2
Participant Cytogenetic
band
Size of
CNV
(bp)
Type Present in
Database of
Genomic
Variants
Unique gene copy
number alteration
1
9q24.3 55,124 Gain Yes -
9p21.1 172,600 Loss Yes -
22q11.1 140,300 Gain Yes -
22q11.22
1,314,300
Gain
Partial
overlap
SERPIND1, SNAP29,
CRKL, AIFM3, LZTR1,
SDF211, PPIL2, YPEL1
2 7p14.3 182,000 Gain Yes -
17q21.3 631,100 Gain Yes -
It was determined that three copies of both genes were present in Participant 1 with
genomic ratios of 1.564 (± 0.167) and 1.461 (± 0.156) for SERPIND1 and YPEL1 respectively.
Although her father‘s DNA was not available for analysis, real-time PCR was used to determine
that the identified CNV was not present in DNA from Participant 1‘s mother. Participant 1 also
exhibits ectrodactyly resulting from a previously identified 24MB inversion disrupting the
7q21.3 region that has been associated with split hand/foot malformation (SHFM) (Scherer et al.,
1994). The results of CNV analysis for Participant 2 identified the presence of two previously
characterized CNVs on chromosomes 7p14.3 and 17q21. No other changes in copy number were
identified.
81
2.7: Results: Identification of MAGI2 Deletions and its Association with IS.
Data from this section has been included in the following publication:
Marshall CR*, Young EJ*, Pani AM, Freckmann M-L, Lacassie Y, Howald C, Fitzgerald K,
Peippo M, Morris CA, Shane K, Priolo M, Morimoto M, Kondo I, Manguoglu E, Berker-
Karauzum S, Edery P, Hobart HH, Mervis CB, Zuffardi O, Reymond A, Kaplan P, Tassabehji
M, Gregg RG, Scherer SW, Osborne LR. (2008) Infantile Spasms Is Associated with Deletion of
82
the MAGI2 Gene on Chromosome 7q11.23-q21.11. American Journal of Human Genetics.
(2008) 83:106-111. Figures reprinted with premission
*Authors contributed equally to this work
Deletions were identified and characterized by CNV and qPCR analysis by Dr. Christian
Marshall (Dr. Stephen Scherer‘s lab) and myself, respectively. All other authors contributed
clinical samples.
From the Chromosome 7 Annotation Project clinical database as well as 16 cases
previously identified in the literature (Ferland et al., 2006; Stock et al., 2003: Mizugishi et al.,
1998; Morimoto et al., 2003: Wu et al., 1999; DeBerardinis et al., 2003; Tzschach et al., 2007;
Courtens et al., 2005; Edelmann et al., 2007; Manguoglu et al., 2005; McElveen et al., 1995) we
identified deletions of 7q11.23-q21.1 ranging from 1.8 Mb to more than 20 Mb in size (Figure
2.8 and Table 2.11). For all cases a seizure history was determined and genotype-phenotype
correlation was made on the basis of the presence or absence of IS or other forms of seizure
activity. From these cases a region of overlap, approximately 700 kb in length was identified
associated with IS, spanning part of the 1.4 Mb membrane-associated guanylate kinase inverted-
2 gene (MAGI2).
It was determined that only one of 14 individuals identified with a chromosome 7
deletion and IS was not deleted for all or part of MAGI2 (Participant #10, Table 2.11/Figure 2.8).
In addition, only one of 11 individuals missing any part of MAGI2 was without a history of
seizure activity (Participant #26). To date, there are no known CNVs that span exons of MAGI2
(Iafrate et al., 2004), further supporting the hypothesis that hemizygosity of MAGI2 results in a
phenotypic effect.
83
84
Table 2.11. Summary of Clinical Features in Participants with Deletions of Chromosome
7q11.23-q21.1
Case Gender
Deletion
Size
(Mb)
Breakpoint
Mapping Clinical Description Ref.
1 1M 3.4 Array/QPCR WBS with severe hypercalcemia TS
2,3,4 2M, 1F 2.4 FISH WBS with moderate MR (ref 1 cases 15481, 18393, 18317)
1
5 F 4.2 Array WBS with severe MR (ref 1 case 23162) 1/TS
6 M 4.2 Array WBS with severe MR TS
7 F 4.3 QPCR WBS with severe MR (ref 1 case 29948) 1/TS
8 F 4.2 Array WBS with periventricular heterotopia, severe MR, non-verbal
2/TS
9 F 2.4-2.8 QPCR
WBS cognitive-behavioral profile with
moderate MR and autism spectrum disorder
3
10 M 4.4 Array/QPCR
WBS with IS (variation from
hypsarrhythmia), severe developmental
delay
4/TS
11 F 6.7 QPCR
WBS with IS (hypsarrhythmia) at 4
months and severe global developmental
delay
TS
12 M 5.5 QPCR WBS with severe delays, IS, myoclonic and tonic seizures
TS
13 M 11-12.5 QPCR
WBS with IS, hypotonia, severe PMD,
non-verbal, Wolff-Parkinson-White
syndrome
TS
14 F 10 QPCR WBS with IS, hypoglycemia,
contractures, severe PMD TS
15 M 8.3 Array/QPCR WBS with IS, focal seizures at 5 months,
severe MR TS
16 M 11 Array WBS with IS, severe MR (ref 5 case
020495) 1/TS
17 M 17 Array/QPCR WBS with IS (hypsarrhythmia) at 2
months and severely retarded PMD 5/TS
18 M 19.6 Array/QPCR WBS with EEG abnormalities, severe
PMD, marked hypotonia TS
19 F >9 MMA WBS with petit mal seizures, macrocephaly, severe MR and minimal
speech
6
20 M 17 Array/QPCR WBS with IS, minimal development and
blindness TS
21 M 26 QPCR
IS, childhood epilepsy, optic nerve
hypoplasia, cerebral palsy, severe MR,
non-verbal
TS
22 F 11.5 Array/QPCR Myoclonus epilepsy, developmental delay, non-verbal
TS
23 F 16 MMA IS, PMD and dysmorphism 7
24 F 15-20 MMA Seizure disorder age 7 years, non-verbal TS
85
Case Gender
Deletion
Size
(Mb)
Breakpoint
Mapping Clinical Description Ref.
25 F 19 Array/QPCR IS, severe MR, microcephaly, scoliosis,
dysmorphism and ectrodactyly 8/TS
26 F 3 Array/QPCR Growth retardation, MR, clinodactyly, mild spasticity, hypersensitivity to noise
9/TS
27 F 16 Array Growth retardation, severe MR,
micorcephaly, complete hearing loss 10
28 M 12-14 FISH Microcephaly, short stature, myoclonus-dystonia syndrome (e-sarcoglycan
deletion), developmental delay
11
WBS, Williams-Beuren syndrome; MR, mental retardation; PMD, psychomotor delay; IS, infantile spasm; ns, not
specified; M, male; F, female; Array, Affymetric® Human Mapping 500K of Genome-Wide Human SNP arrays;
FISH, fluorescent in situ hybridization; QPCR, quantitative real-time polymerase chain reaction, MMA,
microsatellite marker analysis. Shaded rows indicate a diagnosis of infantile spasm or other seizure disorder.
References: TS, This study; 1 - Stock et al., 2003; 2 – Ferland et al., 2006; 3 – Edelmann et al., 2007; 4 – Morimoto
et al., 2003; 5 – Mizugishi et al., 1998; 6 – Wu et al., 1999; 7 – Courtens et al., 2005; 8 – McElveen et al., 1995; 9 – Manguoglu et al., 2005; 10 – Tzschach et al., 2007; 11 – DeBeradinis et al., 2003.
Since all the reported IS individuals possessed deletions spanning multiple genes, it could
be suggested that the resulting IS phenotype may be the consequence of the deletion of two or
more genes, or may result from a position effect mediated by the loss of the large segment of
chromosomal DNA. The variable deletion sizes and the chromosomal location of the
overlapping deletions however do not support these hypotheses. There are deletions that extend
both telomerically and centromerically from the MAGI2 locus, there are several deletions where
the telomeric or centromeric breakpoints are found within MAGI2, thereby resulting in deletions
of completely different sets of genes (Figure 2.8, Cases 11 & 12 vs. Cases 22-24). This makes a
two or more-gene hypothesis extremely unlikely. Additionally, since there are individuals with
large deletions outside the critical interval, but no seizures (Figure 2.8, Cases 1-9 and 25 & 26) a
position effect on surrounding genes caused by the deletion itself also seems an unlikely
explanation for IS,
86
There was identified however, a single previously published case of WBS including well
documented IS where the individual possessed a deletion that did not span any part of MAGI2
(Figure 2.8, Case 10) (Morimoto et al., 2003). However, since it has been shown that IS can be
attributed to many underlying causes, it remains possible that the IS in this individual is
unrelated to their chromosome 7 deletion. There was also identified, a single case that possessed
a deletion that removed part of MAGI2, where no IS was documented (Figure 2.8, Case 26)
(Manguoglu et al., 2005). This individual possesses a small de novo deletion and was referred for
genetic testing because of non-specific mental retardation at the age of 10.5 years. Although
there has been no documented seizure activity in this individual since the age of 10.5 years, their
early clinical history was not available, therefore the possibility that they may have had earlier
episodes of epilepsy or IS in cannot be excluded.
2.8: Conclusion and Discussion:
2.8.1: Severe expressive language delay related to duplication of the Williams–Beuren
region:
It is believed that as much as 5-10% of the human genome has been duplicated within the
past 40 million years and that these segmental duplications may have played a vital role in the
evolution of the human genome (Eichler, 2001). Evolutionarily, these segmental duplications
arose during primate speciation and are major mechanisms contributing to non-pathogenic
structural variation in the human genome (Stankiewicz and Lupski, 2002). However, when
duplicated segments are separated by stretches of transcriptionally active genomic DNA they can
87
create instability generating inversions, deletions and duplications of the intervening sequences
that can result in the gene copy alterations of dosage sensitive genes and lead to disease.
The presence of segmental duplications flanking the WBS regions in humans increases
the likelihood that the region will undergo non-allelic homologous recombination (NAHR)
resulting in genomic rearrangements including inversions, deletions and duplications.
Reciprocal recombination products have been identified for several NAHR hotspots including:
duplication of the 17p11.2, 22q11.2, 15q11.2q13 regions commonly deleted in Smith-Magenis
syndrome, DiGeorge/velocardiofacial syndrome and Prader-Willi/Angelman syndrome
respectively (Bi et al., 2003; Ensenauer et al., 2003; Bolton et al., 2001). Interestingly, the low
number of individuals possessing genomic rearrangements often makes the ascertainment of the
underlying mechanism difficult. Although it is generally believed that duplications arise by a
similar mechanism to the corresponding deletions, an exception to this rule appeared initially to
be genomic rearrangements involving the 17p11.2-p12 region responsible for Charcot-Marie
Tooth type 1A and HNPP. It was reported by Lopes et al., (1997) that duplication of 17p11.2-
p12 resulting in CMT1A were predominantly paternal in origin and arise by inter-chromosomal
rearrangements while the deletion responsible for HNPP were predominantly maternal and arise
through intra-chromosomal rearrangements. It has since been shown that in fact almost all of the
de novo deletions and duplications are paternal in origin and that the first study was somewhat
skewed by the inclusion of familial cases (Borecole et al., 1999)
Although inversions and deletions of WBS region have been previously characterized,
only recently has the reciprocal duplication been identified (Somerville et al., 2005). There are
several hypotheses as to why the duplication would be under diagnosed. Mechanistically, the
deletions can be generated by recombination between duplicated sequences (paralogs) in one of
88
three ways: intra-chromatidal, intra-chromosomal or inter-chromosomal recombination by non-
allelic homologous recombination whereas duplications are generated as the reciprocal product
of only intra-chromosomal and inter-chromosomal recombination. It has been demonstrated that
intra-chromatidal recombination is the dominant mechanism in NAHR and therefore deletions
would occur at greater frequency (Turner et al., 2008) although they did not study men with
inversions, where one would assume the dominant mechanism would be inter-chromosomal
NAHR since the inversion is so common in WBS parents. Phenotypically, it was also proposed
that the duplication of the 7q11.23 region resulted in embryonic lethality, no phenotypic
consequence or a clinical presentation that did not overlap that of WBS and therefore was not
present within the WBS study populations. Ultimately it was a combination of the latter two
hypotheses that were correct.
The phenotype associated with duplication of 7q11.23 includes severe language deficits,
developmental delay and a subtle but identifiable facial dysmorphism. There have been
documented reports of individuals with larger duplications of the region resulting from
supernumerary ring chromosome 7 that have noted expressive language delay or impairment
accompanied by articulation problems, but none of the reports contained standardized assessment
results or specifically compared expressive and receptive language. In addition, karyotypes were
derived from G-banding and not from higher resolution molecular analysis, so the extent of the
duplication was unknown (see Lichtenbelt et al., 2005 for review of cases).
This study is the first case report of a novel syndrome caused by reciprocal duplication of
the commonly deleted WBS region, dup7q11.23. Interestingly, the intellectual strengths and
weaknesses observed in the individual possessing dup7q11.23 (KP) are in direct contrast to those
of children with WBS. In particular, for children with WBS, expressive language is a relative
89
strength (Mervis and Klein-Tasman, 2000) whereas expressive language, especially syntax and
phonology, was the area of greatest weakness for KP. Initially it was argued that WBS was
characterized by ―intact‖ language despite severe mental retardation (Bellugi et al., 1988).
However most investigators studying WBS do not believe language ability in WBS to be
independent of cognitive ability. It is thought that language acquisition and early speech
perception abilities are delayed in WBS with age of acquisition of 100 words below the 5th
percentile (Mervis and Becerra, 2007; Mervis and Robinson, 2000). At 18 months children with
WBS often express only immature babble patterns, however, individuals with WBS appear to
outgrow problems with articulation by early school years (Velleman et al., 2006). By age 4,
children with WBS usually have a more advanced vocabulary, grammar, verbal memory, and
non-verbal abilities (Mervis and Becerra, 2007) and by late childhood they speak in complete
sentences with correct grammar. It has been shown that WBS adults have advanced receptive
concrete vocabulary for such things as objects, actions and description, but receptive
conceptual/relational vocabulary involving spatial, temporal and quantitative terms is weaker
(Mervis, 2006), as is their level of visuo-spatial construction ability. (Osborne and Mervis, 2007;
Mervis and Becerra, 2007). In contrast, KP often communicated by vocalization, gesture,
pantomimes and drawing and only rarely produced word combination. KP was able to correctly
pronounce only few words correctly and his scores on tests for expressive language were in the
severe impairment range although he scored in the low to average range on receptive and non-
language tasks.
It has been well documented that visuo-spatial construction (including drawing) is
severely deficient in WBS children of the same age as KP, with most only able to draw a small
number of identifiable objects (Bertrand et al., 1997). In contrast to this, KP displayed strong
90
drawing ability and when he encountered difficulty communicating, he frequently resorted to
drawing what he was trying to express. However, unlike individuals with WBS, KP had
appropriate social interaction skills and lacked the dis-inhibition and increased sociability
associated with WBS. KP had a diagnosis of ADHD, which is also seen in WBS, but his sister
who did not carry dup7q11.23 was also receiving medication for ADHD and both their parents
were reported to have sufferance from attention problems, making it unlikely that the ADHD
was the result on alteration of expression of genes found within the duplicated region.
Following this preliminary work, several subsequent reports have been published that
provided further evidence for the role of the 7q11.23 duplication in the initially observed
phenotype (Kriek et al., 2006; Kirchhoff et al., 2007; Depeienne et al., 2007; Berg et al., 2007;
Torniero et al., 2007; Van der Aa et al., 2009). To date, although it was not always the basis for
ascertainment, all individuals possessing the dup7q11.23 have been diagnosed with speech delay
with more than half displaying severe language impairment. The vast majority also has some
form of developmental delay. Moderate to severe mental retardation is present only in about one
third of individuals with most displaying normal to mild mental retardation. Neurologically, two
thirds of those for which MRI analysis has been performed showed some form of brain
abnormalities including mild reduction in brain volume, simplified gyral pattern and increased
cortical thickness, although no specific defect in consistently found (Berg et al., 2007; Torniero
et al., 2007). In addition, a varying degree of autism has also been described in about one third
of individuals (Kirchhoff et al., 2007; Depeienne et al., 2007).
There appears to be a subtle, but recognizable facial phenotype that is shared by both
individuals with dup7q11.23 and previously reported individuals with supernumerary ring
chromosome 7, consisting of a high broad nose, posteriorly rotated ears, high arched palate and
91
short philtrum, thin upper lip, deep set eyes and prominent forehead (Tan-Sindhunata et al.,
2000; Chantot-Bastaraud et al., 2004; Lichtenbelt et al., 2005; Somerville et al., 2005; Van der
Aa et al., 2009).
Interestingly, one patient reported by Berg et al., (2007) had larger 3.55 Mb duplication
that shared the common proximal breakpoint but had a unique distal breakpoint. However, the
individual did not display a more severe phenotype. Although only preliminary, given that it is a
single case, this is in contrast to what is observed for similar deletions extending telomerically
from the commonly deleted WBS region. Deletions of genes distal the common WBS deletion
region are associated with a more severe phenotypic expression including severe cognitive
impairment (Ferland et al., 2006; Stock et al., 2003) and infantile spasms (Mizugishi et al., 1998;
Morimoto et al., 2003; Wu et al., 1999; Marshall et al., 2008) The more severe phenotype is
likely the result of the loss of additional dosage sensitive genes telomeric to the WBS region,
including MAGI2. It therefore appears likely that the loss of and therefore decrease in expression
of these distal genes are of greater consequence than the over expression of these genes due to
duplication.
Although the number of dup7q11.23 individuals identified is still low, a high degree of
parent to child transmission has been observed (Kriek et al., 2006; Berg et al., 2007). Unlike the
rarely reported parental transmission of WBS (Morris et al., 1993; Sadler et al., 1993; Ounap et
al., 1998), the dup7q11.23 in the identified individuals were inherited from seemingly unaffected
parents. In one report, the individual had inherited the reciprocal duplication of the common
WBS deletion from his father who presented only with a complete cutaneous III-IV syndactyly
of the hand, a condition absent in the proband but present in both of the paternal grandparents
(Kriek et al., 2006). Two individuals identified by Berg et al., (2007) had inherited the
92
duplication from their phenotypically unaffected parents. From this it has been postulated that
the phenotype may have variable penetrance, or that in some cases, one may outgrow childhood
disability (Berg et al., 2007). It was noted that in the case of one patient (patient 3) dramatic
improvement was seen in her language ability between the age of 4.5 and 5 years of age,
coincident with the treatment of her severe anxiety with the anxiolytic drug fluoxetine. This
patient had also received extensive intervention that may have resulted in her higher language
skill, raising the intriguing possibility that with the correct management many may outgrow their
childhood speech impairments.
Further evidence to support the hypothesis that increased expression of genes at 7q11.23
is responsible for the observed phenotype comes from the recently identified rare triplication of
the 7q11.23 region. Beunders et al., (2009) describe a 3-year-old boy with mental deficits and
behavioral problems that appear to be at the severe end of the spectrum seen in patients with
dup7q11.23. It was determined that he had not inherited the genomic rearrangement from either
of his parents. Upon examination, he was extremely anxious and displayed no expressive and
very little receptive language ability. He was also severely delayed in the acquisition of motor
milestones. He was unable to sit upright until 9 months of age and was not fully ambulatory
until 20 months. In addition he was extremely aggressive with destructive, self-mutilating
behavior. An array-CGH revealed that the triplicated region consisted on a 1.25 Mb region
sharing a similar distal breakpoint with the WBS commonly deleted region. Interesting, the
proximal breakpoint mapped between FZD9 and BAZ1B and so did not include FZD9 and
FKBP6 that are commonly deleted in WBS. Therefore, it is unlikely that these two genes
contribute the associated phenotype of the 7q11.23 duplication. Although rare, other
triplications have been identified including DLP1 (Xq22,), MECP2 (Xq28) as well as tetrasomy
93
3q (3q25.3-29) and all result in a more severe phenotype than is seen in the duplication including
a more severe mental disability (del Gaudio et al., 2006; Ounap et al., 2005; Wolf et al., 2005).
There has been a 22q11.2 triplication reported by Yobb et al., (2005). As with unaffected
members seen possessing the dup7q11.23, this paper also describes phenotypically normal
family members with 22q11 duplication.
These findings specify the expressive language phenotype associated with dup7q11.23
and define the precise region of chromosome 7 contributing to it as the 1.5 Mb interval
commonly deleted in WBS. The contrasting phenotypes of deletion and duplication of 7q11.23
with their accompanying changes in gene expression therefore suggest that genes within this
region may be dosage sensitive, and that either an increase or decrease in expression can have a
dramatic effect on both language development and visuo-spatial ability. The duplication/deletion
encompasses 26-28 genes, most of which can be excluded as major contributors to the WBS
phenotype, based on genotype-phenotype correlation in individuals with atypical deletions. The
identified minimal critical interval that must be deleted in classic WBS spans the region between
elastin and the common distal breakpoint, and encompasses just nine genes (Frangiskakis et al.,
1996; Tassabehji 2003; Hirota et al., 2003; Del Campo et al., 2001) and include members of the
general transcription factor 2 I (GTF2I) gene family; GTF2I and GTF2IRD1. These transcription
factors are predicted to possibly possess some functional redundancy (Hinsley et al., 2004).
Alteration of expression of a single gene in a simple case, or in a complex case of a
combination of GTF2I genes, might lead to a distinctive specific language impairment phenotype
overlapping with that observed in individuals with dup7q11.23. Although it must be considered
that it is possible that the genes responsible for the language impairment in individuals with the
94
duplication may not be the same genes responsible for the cognitive phenotype found in
individuals with deletion of the WBS region.
Another intriguing feature of the duplication of 7q11.23 that is not found in WBS is the
high percentage of parental transmission. Of the 27 patients identified to date it has been
determined that in 11 cases the duplication was inherited from a parent and in three of these
cases, no parental phenotype was noted. A high frequency of familial transmission has also been
observed in the 22q11.2 microduplication, the reciprocal on the deletion resulting in DGS/VCFS
and similarly to the 7q11.23 duplication, the clinical phenotypes seen in these individuals are
highly variable and relatively mild in comparison to those previously reported (Yobb 2005; Ou et
al., 2008).
Although the discovery of the WBS duplication provides the long sought-after reference
case for the existence of the reciprocal duplication of the WBS deletion, further identification of
new individuals with dup7q11.23 will allow for the further definition of the range of speech and
language impairments as well as behavioral abnormalities and associated clinical features. It
remains to be determined whether the duplication may also be present in completely unaffected
individuals or whether the phenotype of individuals with the 7q11.23 duplication can be
mitigated by speech therapy or may possibly be age dependent and therefore individuals may
outgrow their cognitive and language impairments.
2.8.2: The common inversion of 7q11.23 does not cause clinical symptoms:
More than 30 disorders have been identified that result from genomic rearrangement
within segmental duplications (Gimelli et al., 2003). In the majority of disorders, the clinical
95
diagnosis is determined using methods such as Giemsa staining or FISH analysis capable of
detecting only large genomic rearrangements. For example, diagnosis of WBS commonly
includes molecular testing using FISH to identify a hemizygous deletion at 7q11.23 using a
mixture of probes encompassing only the elastin and LIM kinase genes (Vysis Inc., Des Plains,
IL). Although accurate in more than 95% of cases, for the remaining individuals with a clinical
diagnosis of WBS there is no detectable chromosomal rearrangement (Lowery et al., 1995; Mari
et al., 1995; Nickerson et al., 1995). It is possible that these individuals constitute phenocopies of
WBS or have disruption of key genes at 7q11.23 and the underlying genetic variation has yet to
be identified. Individuals with atypical WBS have also been reported who present with some,
but not all, of the diagnostic features of WBS and have been found to carry partial deletions of
the WBS deletion region (Morris, 2006). Intriguingly, atypical WBS has also been reported in
individuals without identifiable deletions or other chromosome rearrangements (Morris, 1998).
These individuals may carry mutations in one or more genes from within or near the region.
Of the eleven atypical WBS patients initially reported by Osborne et al., (2001), it was
determined that three carried an inversion of the WBS region. Two of these individuals (15441-
Participant 1 in this study; 12503-Participant 2 in this study), both females and in their teenage
years, presented with aspects of WBS including a WBS-like facial features (including
strabismus) a WBS-like behavior profile and developmental delay, but no detectable deletion of
7q11.23. It was theorized that an inversion of the WBS region could provide a means by which
expression of genes within the WBS interval could be disrupted without actually being deleted;
either by direct interruption of gene located at the inversion breakpoints (Bondeson et al. 1995;
Lakich et al. 1993; Stankiewicz et al. 2001), or by alteration of gene expression due to re-
location of regulatory elements such as enhancers or repressors (Scherer et al. 1994; Niedermaier
96
et al. 2005). However, since the 7q11.23 inversion is present in a significant fraction (25%-
33%) of WBS parents (Bayés et al., 2003; Osborne et al., 2001; Hobart et al., 2010), as well as
in approximately 7% of the general population (Hobart et al., 2010) it suggests that i) there is a
difference in the inversion breakpoints between WBSinv-1 carriers and these atypical WBS
individuals and that disruption of gene function at these novel breakpoints are responsible for the
resulting atypical WBS phenotype, ii) the inversion is not fully penetrant or iii) that WBSinv-1
may be a polymorphic rearrangement that is not associated with any clinical manifestations
found in the identified atypical WBS individuals.
Evidence for a novel inversion breakpoint included a smaller NotI junction fragment
detected in patient 12503 (500kb) relative to a 600kb NotI junction fragment identified in
phenotypically normal inversion breakpoint carrier controls (Osborne et al., 2001). In the cases
of novel breakpoints and reduced penetrance, the phenotypic expression in the atypical
individuals would likely be a consequence of the same alterations in gene expression resulting
from the haploinsufficiency of dosage sensitive genes located within the commonly deleted
region. Although recent studies have included only fibroblast or transformed lymphoblast cell
lines, the expression of none of the genes; either within the commonly deleted region or genes
outside the commonly deleted region that have been shown to be altered in WBS, were found to
be altered in either of the reported WNSinv-1 containing atypical WBS individuals (Sommerville
et al., 2005; Merla et al., 2006; Tam et al., 2008). In the course of this evaluation, an individual
was also identified who was determined to be homozygous for the WBSinv-1 chromosome and,
although it is difficult to perform statistical evaluation of the expression data from a single
individual, expression of all except one of the genes examined (GTF2I) showed normal levels of
expression, when compared to individuals with normal chromosomes. Although a decrease in
97
GTF2I expression was observed in the homozygous WBSinv-1 individual, this altered
expression may likely be an artifact of the analysis of a single subject since GTF2I expression
was not altered in WBSinv-1 carriers and all other genes tested in the homozygous individual
showed expression levels similar to those of the control group. It is interesting to note that
although the WBSinv-1 homozygous individual was the parent of a child with WBS, the child‘s
deletion was determined to originate in the other parent, who was heterozygous for WBSinv-1.
This is not an unexpected result since based on the proposed mechanism by which WBSinv-1
carriers are at increased risk of producing a child possessing a WBS deletion (disruption of
meiotic pairing), it would be predicted that individuals homozygous for the inversion would
carry the same, low risk as those homozygous for the non-inverted chromosome 7. Although no
in-depth clinical or development assessment of this individual was performed, he did not display
any of the phenotypic characteristic commonly found in WBS. The identification of an
individual homozygous for WBSinv-1, who was of Asian Indian descent, may also raise the
possibility that the frequency of the WBSinv-1 chromosome may vary between different ethnic
populations, resulting in different population risks for having a child with a deletion or
duplication of the WBS region. A clear example of the impact of inversion frequency on a
genomic disorder is demonstrated in Sotos syndrome (OMIM #117550). In the Japanese
population, a common inversion on chromosome 5q35 predisposes to a 1.9 Mb deletion,
resulting in Sotos syndrome (Kurotaki et al. 2003; Visser et al. 2005). However, in non-
Japanese populations, where the presence of the inversion is rare, Sotos syndrome is most often
caused by smaller intragenic deletion or mutations affecting the expression of the NSD1 gene
(Tatton-Brown et al. 2005).
98
The normal expression of genes commonly deleted in WBS suggests it is likely then that
the inversion of the WBS region is a common polymorphism in the general population and is not
associated with any clinical manifestations found in the atypical WBS individuals. Consistent
with this, the common WBSinv-1 breakpoints have been determined to lie within the B-block
segments of the centromeric and telomeric LCRs that are in an inverted orientation with respect
to each other (Bayes et al., 2003). The B blocks contain only pseudogenes of GTF2I and NCF1
along with a copy of GTF2IRD2, a gene only sometimes deleted in WBS and consequently not
likely responsible for the WBS phenotype. Therefore WBSinv-1 is not predicted to directly
interrupt any genes that are commonly deleted in WBS. In addition, because the LCRs have
undergone extensive genomic rearrangement during primate evolution (Antonell et al. 2005), it
is unlikely that key regulatory elements for genes from the WBS deletion region are located
within the LCRs themselves. Even the expression of genes located several Mb away from the
common WBS deletion region who have been shown to be altered in individuals with the WBS
deletion were not altered in the WBSinv-1 group further demonstrated that the inversion of the
WBS region has a negligible position effect on the surrounding chromosome.
Although the initial diagnosis in Participant 1 and 2 were based on their medical records,
further evaluation by Drs. Colleen Morris and Carolyn Mervis, both of whom have had many
years of experience with both WBS patients and children with other developmental disabilities,
were unable to characterize any significant overlap between the clinical presentation in these two
WBSinv-1 carriers and that of individuals with WBS. This emphasizes the importance of
assessment by experienced clinicians and psychologists in cases where a specific diagnosis is
suspected, but an atypical phenotype is observed. Although these individuals are few in numbers,
the development of syndrome-specific matrices for facial features (Hammond et al. 2005),
99
growth parameters (Martin et al. 2007) cognitive or behavioral profiles (Mervis et al. 2000) or
for overall clinical presentation (Sugayama et al. 2007) should help less experienced clinicians
and psychologists make more accurate patient diagnosis.
The two participants initially reported as exhibiting symptoms of WBS, ultimately did
not fit any of the diagnostic criteria for WBS, suggesting that the presence of the WBSinv-1
chromosome and clinical presentation in these patients was coincidental. Therefore, CNV
analysis was used in an attempt to identify other possible chromosome anomalies that might
account for their clinical symptoms. Although no detectable alterations in copy number was
identified in Participant 2, leaving the etiology of her symptoms unknown, CNV analysis of
DNA from Participant 1 revealed a previously unreported duplication spanning a 1.3 Mb
segment within the region that is commonly duplicated in dup(22)(q11.2q11.2) syndrome
(Ensenauer et al. 2003; Yobb et al. 2005). In this patient, most of the identified chromosome
22q11.22 gain overlaps with CNVs previously identified in numerous control samples (Locke et
al. 2006; Simon-Sanchez et al. 2007; Wong et al. 2007), however, it also includes genes not
contained within known CNVs, so this genomic variant cannot be ruled out as contributing to the
phenotypic features seen in Participant 1. It should also be noted that Participant 1 exhibits
ectrodactyly due the presence of a 24 Mb inversion that disrupts the 7q21.3 region previously
associated with split hand/foot malformation (SHFM) (Scherer et al. 1994).
The dup(22)(q11.2q11.2) syndrome has a variable phenotype but there are features that
frequently associated with the common 3 Mb duplication including; velopharyngeal
insufficiency, cleft palate, hearing loss, cognitive deficits, motor delay, poor growth and
characteristic dysmorphism (Ensenauer et al. 2003; Yobb et al. 2005; Portnoi et al. 2005). The
pharyngeal malformations have been shown to be linked to duplication of TBX1, given that
100
mouse models containing a hemizygous deletion of Tbx1 causes similar abnormalities (Arnold et
al. 2006). Although phenotypic evaluation demonstrated that Participant 1 did not exhibit all the
typical features commonly associated with individuals possessing the dup(22)(q11.2q11.2), she
was also not duplicated for the region containing TBX1. She did, however, have some features
commonly associated with dup(22)(q11.2q11.2), including; bilateral mixed hearing loss,
cognitive deficits, mild motor delay, down-slanted palpebral fissures, strabismus and radioulnar
synostosis, although this last abnormality has also been associated with SHFM l (Debeer, et al.
2004). This finding provides evidence that the previously characterized dup(22)(q11.2q11.2)
syndrome is a contiguous gene duplication disorder and that gene(s) contributing to the common
features seen in Participant 1 and in dup(22)(q11.2q11.2) are contained within the 1.3 Mb
duplicated segment identified in Participant 1.
Although the inversion of the WBS region itself may be non-pathogenic it has been
clearly demonstrated that the presence of the inversion may predispose the region to an increased
frequency of chromosomal rearrangement including deletions and duplications (Osborne et al.,
2001; Bayés et al., 2003). In addition to this previously identified inversion polymorphism it has
been recently demonstrated using site-specific nucleotide and indel-type paralogous sequence
variants (PSVs) that submicroscopic CNVs enriched within the LCRs surrounding the WBS
region exists as low-frequency polymorphic variants in the general population, and that in some
cases the existence of the CNVs result from inversions within the LCR region. (Cusco et al.,
2008). The prevalence of these CNVs were found to be higher in WBS-transmitting progenitors
(4.44% for deletions and 2.22% for duplication versus approximately 1% in control and non-
transmitting progenitors) indicating that these CNVs, as with the 2Mb paracentric inversion
WNSinv-1 present in 25%-33% of WBS-transmitting progenitors, may also be susceptibility
101
factors for WBS and dup7q11.23 disorders. Deletion and duplications resulting from
recombination between the directly-oriented Cc and Cm blocks (WBS-CNV1) have been
identified as well as deletion and duplications of resulting from recombination within the medial
the telomeric B blocks (WBS-CNV2). Since the medial and telomeric B blocks in the inverted
orientations with respect to one another, deletion and duplication could have arisen after
inversion of intervening sequence. Interestingly, it was determined that the deletion breakpoint
resulting from the recombination within the centromeric and medial C blocks (WBS-CNV1 Del)
was mapped to between exons 11 and 16 of the POM121 gene in all identified cases and that the
resulting deletion would disrupt the coding POM121 and TRIM74 genes found in the
centromeric C Block.
With the recent emergence of comparative genomic hybridization and SNP array analysis
as tools for the global analysis of copy number across the entire genome, an astonishing number
of variants present in the normal population, many of which alter gene copy number and
expression have been identified (Feuk et al. 2006). Recently, SNP arrays have been used to
identify novel CNVs associated with syndromic disorders including developmental delay,
learning disability and autism (Koolen et al. 2006; Shaw-Smith et al. 2006; Sebat et al. 2007;
Autism Genome Project Consortium et al., 2007). It is likely than that in the future a more
―bottom-up‖ approach may be used to identify CNVs present in patient genomes that may be
contributing to their phenotypic presentation, rather than attributing symptoms to already
identified variants; an approach particularly valuable when diagnosing individuals with atypical
presentations of rare syndromes.
102
2.8.3: Infantile spasms (IS) is associated with deletion of MAGI2:
Infantile spasms (IS) was first described by W.J. West regarding his own son in a letter
to the editor of the journal Lancet in 1841, however little progress has been made since toward
understanding the etiology of the disease. The identification of a new locus for IS opens up new
avenues of research that will lead to an understanding of the pathophysiology of this catastrophic
epilepsy. Even though one half of IS cases are associated with some form of generalized brain
disturbance or injury (referred to as symptomatic) the remaining 50% have no known brain
malformation or neurological injury; these cases are referred to as idiopathic or cryptogenic
(Cowan, 2002). Although IS and West syndrome are often considered to be synonymous, many
reserve ―West syndrome‖ to identify children with age-dependent epileptic encephalopathy who
appear to be unaffected prior to the onset of spasms and for whom the etiology could not be
identified (Shields, 2002).
The identification of this new locus associated with IS has implications for the clinical
management of individuals with WBS and large deletions of 7q11.23-q21.1. Their long-term
prognosis is also complicated by the presence of IS which may further impact upon their
neurological development. In a Finnish study of individuals with IS, of the 214 patients
followed for up to 35 years, one third of the patients died before 35 years of age with 1/3 of these
dying within first three years of life (Rilkonen, 2003). Early pharmacological treatment is
important although often not always effective. Treatment with common anticonvulsant
medications such as pyridoxine and valporate are often unsuccessful at diminishing seizure
activities. Treatment with corticotropin (ACTH) has been reported as effective in 70% of
patients but there are serious adverse side-effects/safety issues associated with its use (Shields,
2002). A longitudinal study of treatment outcomes in these individuals to determine the extent
103
and severity of their developmental impairment and will help to establish some prognostic
guidelines for other families of newly diagnosed children with WBS and large deletions.
MAGI2 (also known as S-SCAM, synaptic scaffolding molecule) was originally
characterized as a scaffold protein interacting with N-methyl-D-aspartic acid (NMDA) receptors
at excitatory synapses (Hirao et al., 1998) but has since been shown to interact with many
different proteins pre- and post-synaptically at synapses in both excitatory and inhibitory neurons
(Deng et al., 2006). The protein contains a guanylate kinase domain, two WW domains for
protein: protein interactions (Bork and Sudol, 1994) and five PDZ domains needed to anchor
transmembrane proteins to the cytoskeleton and hold together signaling complexes (Figure 2.9)
(Ranganathan and Ross, 1997). At least two protein isoforms are known to exist in humans, with
the largest (α isoform) with an additional N-terminal PDZ domain, and a β and γ isoform (in
mice), originating from alternative translation start sites (Hirao et al., 2000). MAGI2 is known to
interact with neuroligin 2 and β-dystroglycan at inhibitory synapses in rat hippocampus (Iida et
al. 2007) but the most interesting interaction of MAGI2 is that with stargazin (Deng et al., 2006)
the protein determined to be mutated in the stargazer mouse; one of the original and best
characterized mouse models of epilepsy (Noebels et al., 1990). Mice lacking the stargazin
protein express the necessary α-amino-3-hydroxy-5-methyl-4-isoxazole propionic acid (AMPA)
subunits, but synapses in the stargazer mice lack functional AMPA receptors due to impaired
AMPA receptor transport through the endoplasmic reticulum and cis-Golgi compartments (Chen,
et al., 2000).
A recent mouse model lacking the longest, α isoform of Magi2 exhibited no obvious
phenotype in the heterozygous state, but although the homozygous mutant mice developed
normally prenatally and were born in the expected Mendelian ratio, they died within 24 hours of
104
birth with cultured neurons displaying altered spine morphology (Iida et al. 2007). It was noted
that the heterozygous mice did not show any ―remarkable abnormalities‖ even after 2 years of
study. It was however demonstrated using western blotting that protein expression of the α
isoform in heterozygous mice was greatly decreased indicating that the expression of MAGI2 is
dosage sensitive. However, the MAGI2 β and γ isoforms were not disrupted in these mice and
were expressed at normal levels and therefore may compensate for the loss of the α isoform. In
105
addition, our lab has shown that the predominant isoform in mouse brain is the beta isoform
(Figure 2.10). Unlike the Magi2 mouse model, all of the individuals presently studied have
deletions that would result in the decreased expression of all three isoforms of MAGI2 (Iida et
al. 2007). MAGI2 is known to interact with multiple proteins and participate in higher order
protein complexes (Hirao et al., 2000), therefore the decrease in expression of all isoforms of
MAGI2 is likely to disrupt multiple signaling pathways. There are more than 100 proteins that
are found within the post-synaptic density, the loss of many of which have been shown to disrupt
th
e proper function of the synapse. It is estimated that etiology of approximately 40% of human
epilepsy involve a genetic component (Annegers et al., 1996), however to date, mutations have
106
only been identified in a small fraction of the known genes, practically all of which are known to
code for ion channels and almost all in families exhibiting rare forms of epilepsy inherited in a
Mendelian fashion (Turnbull et al., 2005).
The association of IS in patients with hemizygosity for the post-synaptic scaffolding
protein MAGI2 provides insight on the genetic etiology of epilepsy and suggests that proteins
that regulate the trafficking, distribution or function of glutamate receptors are attractive
candidates for involvement in human epilepsy. Although the causes of epilepsy are known to be
heterogeneous in nature, the identification of a causative gene associated with at least some
forms of IS should allow the development further genetic mouse models and may eventually lead
to the development and testing of targeted, effective medications for this type of severe epilepsy,
both as an individual entity as well as in children with WBS.
107
2.9: References:
Alberti A, Romano C, Falco M, Calì F, Schinocca P, Galesi O, Spalletta A, Di Benedetto D, and
Fichera M. (2007) 1.5 Mb de novo 22q11.21 microduplication in a patient with cognitive
deficits and dysmorphic facial features. Clinical Genetics. 71:177-182.
Annegers JF, Rocca WA, and Hauser WA. (1996) Causes of epilepsy: contributions of the
Rochester epidemiology project. Mayo Clinic Proceedings. 71:570-575.
Antonell A, de Luis O, Domingo-Roura X, and Pérez-Jurado LA (2005) Evolutionary
mechanisms shaping the genomic structure of the Williams-Beuren syndrome
chromosomal region at human 7q11.23. Genome Research. 15:1179-1188.
Arnold JS, Werling U, Braunstein EM, Liao J, Nowotschin S, Edelmann W, Hebert JM, and
Morrow BE. (2006) Inactivation of Tbx1 in the pharyngeal endoderm results in 22q11DS
malformations. Development. 133:977-987.
Autism Genome Project Consortium, et al. (2007) Mapping autism risk loci using genetic
linkage and chromosomal rearrangements. Nature Genetics. 39:319-28.
Baumer A, Dutly F, Balmer D, Riegel M, Tükel T, Krajewska-Walasek M, and Schinzel AA.
(1998) High level of unequal meiotic crossovers at the origin of the 22q11.2 and 7q11.23
deletions. Human Molecular Genetics. 7:887-894.
Bayés M, Magano LF, Rivera N, Flores R, and Pérez Jurado LA. (2003) Mutational mechanisms
of Williams-Beuren syndrome deletions. American Journal of Human Genetics. 73:131-
151.
Bellugi U, Marks S Bihrle A. and Sabo H. (1988) Dissociation between language and cognitive
functions in Williams syndrome. In Language Development in Exceptional Circumstances
(Bishop, D. and Mogford, K., eds ), pp. 177-189, Churchill Livingstone, London).
Berg AT, Shinnar S, Levy SR, Testa FM, Smith-Rapaport S, Beckerman B, and Ebrahimi N.
(2001) Two-year remission and subsequent relapse in children with newly diagnosed
epilepsy. Epilepsia. 42:1553-1562.
Berg JS, Brunetti-Pierri N, Peters SU, Kang SH, Fong CT, Salamone J, Freedenberg D, Hannig
VL, Prock LA, Miller DT, Raffalli P, Harris DJ, Erickson RP, Cunniff C, Clark GD, Blazo
MA, Peiffer DA, Gunderson KL, Sahoo T, Patel A, Lupski JR, Beaudet AL, and Cheung
SW. (2007) Speech delay and autism spectrum behaviors are frequently associated with
duplication of the 7q11.23 Williams-Beuren syndrome region. Genetics in Medicine.
9:427-441.
Bertrand J, Mervis CB, and Eisenberg JD. (1997) Drawing by children with Williams syndrome:
A developmental perspective. Developmental Neuropsychology. 13:41-67.
108
Beunders G, van de Kamp JM, Veenhoven RM, van Hagen JM, Nieuwint AW, and Sistermans
EA. (2009) A triplication of the Williams Beuren Syndrome region in a patient with mental
retardation, a severe expressive language delay, behavioral problems and dysmorfisms.
Journal Medical Genetics. Sept. 14. [Epub ahead of print]
Bi W, Park SS, Shaw CJ, Withers MA, Patel PI, and Lupski JR. (2003) Reciprocal crossovers
and a positional preference for strand exchange in recombination events resulting in
deletion or duplication of chromosome 17p11.2. American Journal of Human Genetics.
73:1302-1315.
Bishop DV, North T, and Donlan C. (1995) Genetic basis of specific language impairment:
evidence from a twin study. Developmental Medicine and Child Neurology. 37:56-71.
Boerkoel CF, Inoue K, Reiter LT, Warner LE, and Lupski JR. (1999) Molecular mechanisms for
CMT1A duplication and HNPP deletion. Annals of the New York Academy of Science.
883:22-35.
Bolton PF, Dennis NR, Browne CE, Thomas NS, Veltman MW, Thompson RJ, and Jacobs P.
(2001) The phenotypic manifestations of interstitial duplications of proximal 15q with
special reference to the autistic spectrum disorders. American Journal of Human Genetics.
105:675-685.
Bondeson ML, Dahl N, Malmgren H, Kleijer WJ, Tönnesen T, Carlberg BM, and Pettersson U.
(1995) Inversion of the IDS gene resulting from recombination with IDS-related sequences
is a common cause of the Hunter syndrome. Human Molecular Genetics. 4:615-621.
Bork P. and Sudol M. (1994) The WW domain: a signaling site in dystrophin? Trends in
Biochemical Science. 19:531-533.
Bruininks R, Woodcock R, Weatherman R, and Hill B. (1996) Scales of Independent Behavior-
Revised. Itasca, IL: Riverside Publishing,
Castaneda AR, Jonas RA, Mayer JE, Hanley FL, (eds). 1994. Obstruction of the left ventricular
outflow tract. Cardiac surgery of the neonate and infant. Philadelphia: W. B. Saunders.
p.327.
Chantot-Bastaraud S, Muti C, Pipiras E, Routon MC, Roubergue A, Burglen L, Siffroi JP, and
Simon-Bouy B. (2004) Clinical findings and cytogenetic analysis of small supernumerary
ring chromosomes 7: Report of two new cases. Annales de Génétique. 47:241-249.
Chen L, Chetkovich DM, Petralia RS, Sweeney NT, Kawasaki Y, Wenthold RJ, Bredt DS, and
Nicoll RA. (2000) Stargazin regulates synaptic targeting of AMPA receptors by two
distinct mechanisms. Nature. 408:936-943.
Christiansen LR, Lage JM, Wolff DJ, Pai GS, and Harley RA. (2004) Mosaic duplication
1(q11q44) in an infant with nephroblastomatosis and mineralization of extraplacental
membranes. Pediatric and Developmental Pathology. 8:115-123.
109
Conners C. (1997) Conners‘ rating scales-revised. North Tonawanda, NY: Multi-Health
Systems.
Cowan, L.D. (2002) The epidemiology of the epilepsies in children. Mental Retardation and
Developmental Disabilities Research Reviews. 8:171-181.
Courtens W, Vermeulen S, Wuyts W, Messiaen L, Wauters J, Nuytinck L, Peeters N, Storm K,
Speleman F, and Nöthen MM. (2005) An interstitial deletion of chromosome 7 at band
q21: a case report and review. American Journal of Medical Genetics A. 134A:12-23.
Curatolo P. (1996) Neurological manifestations of tuberous sclerosis complex. Child’s Nervous
System. 12:515-521.
DeSilva U, Elnitski L, Idol JR, Doyle JL, Gan W, Thomas JW, Schwartz S, Dietrich NL,
Beckstrom-Sternberg SM, McDowell JC, Blakesley RW, Bouffard GG, Thomas PJ,
Touchman JW, Miller W, and Green ED. (2002) Generation and comparative analysis of
approximately 3.3 Mb of mouse genomic sequence orthologous to the region of human
chromosome 7q11.23 implicated in Williams syndrome. Genome Research. 12:3-15.
Debeer P, Vandenbossche L, de Ravel TJ, Desloovere C, De Smet L, Huysmans C, Thoelen R,
Vermeesch J, Van de Ven WJ, and Fryns JP. (2004) Bilateral complete radioulnar
synostosis associated with ectrodactyly and sensorineural hearing loss: a variant of
SHFM1. Clinical Genetics. 65:153-155.
DeBerardinis RJ, Conforto D, Russell K, Kaplan J, Kollros PR, Zackai EH, and Emanuel BS.
(2003). Myoclonus in a patient with a deletion of the epsilon-sarcoglycan locus on
chromosome 7q21. American Journal of Medical Genetics A 121:31-36.
Del Campo M, Magano LF, Martinez Iglesias J, and Pérez-Jurado LA. (2001) Partial features of
Williams-Beuren syndrome in a family with a novel 700 kb 7q11.23 deletion. European
Journal of Human Genetics. 1(S):C055.
del Gaudio D, Fang P, Scaglia F, Ward PA, Craigen WJ, Glaze DG, Neul JL, Patel A, Lee JA,
Irons M, Berry SA, Pursley AA, Grebe TA, Freedenberg D, Martin RA, Hsich GE, Khera
JR, Friedman NR, Zoghbi HY, Eng CM, Lupski JR, Beaudet AL, Cheung SW, and Roa
BB.(2006) Increased MECP2 gene copy number as the result of genomic duplication in
neurodevelopmentally delayed males. Genetics in Medicine. 8:784-792.
Deng F, Price MG, Davis CF, Mori M, and Burgess DL. (2006) Stargazin and other
transmembrane AMPA receptor regulating proteins interact with synaptic scaffolding
protein MAGI-2 in brain. Journal of Neuroscience. 26:7875-7884.
Depienne C, Heron D, Betancur C, Benyahia B, Trouillard O, Bouteiller D, Verloes A, LeGuern
E, Leboyer M, and Brice A. (2007) Autism, language delay and mental retardation in a
patient with 7q11 duplication. Journal of Medical Genetics. 44:452-458.
110
De Zeeuw CI, Hoogenraad CC, Goedknegt E, Hertzberg E, Neubauer A, Grosveld F, and Galjart
N. (1997) CLIP-115, a novel brain-specific cytoplasmic linker protein, mediates the
localization of dendritic lamellar bodies. Neuron. 19:1187-1199.
Dunn LE, and Dunn LE. Peabody Picture Vocabulary Test. 3rd ed. Circle Pines, MN: American
Guidance Service; 1997.
Edelmann L, Prosnitz A, Pardo S, Bhatt J, Cohen N, Lauriat T, Ouchanov L, González PJ,
Manghi ER, Bondy P, Esquivel M, Monge S, Delgado MF, Splendore A, Francke U,
Burton BK, and McInnes LA. (2007). An atypical deletion of the Williams-Beuren
syndrome interval implicates genes associated with defective visuospatial processing and
autism. Journal of Medical Genetics. 44:136-143.
Eichler EE. (2001) Recent duplication, domain accretion and the dynamic mutation of the human
genome. Trends in Genetics. 17:661-669.
Elliott C. (1990) Differential Ability Scales. San Antonio, TX: Psychological Corporation.
Ensenauer RE, Adeyinka A, Flynn HC, Michels VV, Lindor NM, Dawson DB, Thorland EC,
Lorentz CP, Goldstein JL, McDonald MT, Smith WE, Simon-Fayard E, Alexander AA,
Kulharya AS, Ketterling RP, Clark RD, and Jalal SM. (2003) Microduplication 22q11.2,
an emerging syndrome: clinical, cytogenetic, and molecular analysis of thirteen patients.
American Journal of Human Genetics. 73:1027-1040.
Ferland RJ, Gaitanis JN, Apse K, Tantravahi U, Walsh CA, and Sheen VL. (2006)
Periventricular nodular heterotopia and Williams syndrome. American Journal of Medical
A, 140:1305-1311.
Feuk L, MacDonald JR, Tang T, Carson AR, Li M, Rao G, Khaja R, and Scherer SW. (2005)
Discovery of Human Inversion Polymorphisms by Comparative Analysis of Human and
Chimpanzee DNA Sequence Assemblies. PLoS Genetics. 1:e56.
Feuk L, Marshall CR, Wintle RF, and Scherer SW. (2006) Structural variants: changing the
landscape of chromosomes and design of disease studies. Human Molecular Genetics.
15:R57-R66.
Fisher SE, Lai CS, and Monaco AP. (2003) Deciphering the genetic basis of speech and
language disorders. Annual Review of Neuroscience. 26:57-80
Frangiskakis JM, Ewart AK, Morris CA, Mervis CB, Bertrand J, Robinson BF, Klein BP, Ensing
GJ, Everett LA, Green ED, Pröschel C, Gutowski NJ, Noble M, Atkinson DL, Odelberg
SJ, and Keating MT. (1996) LIM-kinase1 hemizygosity implicated in impaired
visuospatial constructive cognition. Cell. 86:59-69.
Gibbs F. and Gibbs E, (1952) Atlas of electroencephalography in Epilepsy, volume 2. Gibbs and
Gibbs eds. (Reading MA: Addison-Wesley)
111
Gimelli G, Pujana MA, Patricelli MG, Russo S, Giardino D, Larizza L, Cheung J, Armengol L,
Schinzel A, Estivill X, and Zuffardi O. (2003) Genomic inversions of human chromosome
15q11-q13 in mothers of Angelman syndrome patients with class II (BP2/3) deletions.
Human Molecular Genetics. 12:849-858.
Gisselsson D, Höglund M, Mertens F, Johansson B, Dal Cin P, Van den Berghe H, Earnshaw
WC, Mitelman F, and Mandahl N. (1999) The structure and dynamics of ring
chromosomes in human neoplastic and non-neoplastic cells. Human Genetics. 104:315-
325.
Grant J, Valian V, and Karmiloff-Smith A. (2002) A study of relative clauses in Williams
syndrome. Journal of Child Language. 29:403-416.
Hammond P, Hutton TJ, Allanson JE, Buxton B, Campbell LE, Clayton-Smith J, Donnai D,
Karmiloff-Smith A, Metcalfe K, Murphy KC, Patton M, Pober B, Prescott K, Scambler P,
Shaw A, Smith AC, Stevens AF, Temple IK, Hennekam R, and Tassabehji M. (2005)
Discriminating power of localized three-dimensional facial morphology. American Journal
of Human Genetics. 77:999-1010.
Hinsley TA, Cunliffe P, Tipney HJ, Brass A, and Tassabehji M. (2004) Comparison of TFII-I
gene family members deleted in Williams-Beuren syndrome. Protein Science. 13:2588-
2599.
Hirao K, Hata Y, Ide N, Takeuchi M, Irie M, Yao I, Deguchi M, Toyoda A, Sudhof TC, and
Takai Y. (1998) A novel multiple PDZ domain-containing molecule interacting with N-
methyl-D-aspartate receptors and neuronal cell adhesion proteins. Journal of Biological
Chemistry. 273:21105-21110.
Hirao K, Hata Y, Yao I, Deguchi M, Kawabe H, Mizoguchi A, and Takai Y. (2000) Three
isoforms of synaptic scaffolding molecule and their characterization. Multimerization
between the isoforms and their interaction with N-methyl-D-aspartate receptors and
SAP90/PSD-95-associated protein. Journal of Biological Chemistry. 275:2966-2972.
Hirota H, Matsuoka R, Chen XN, Salandanan LS, Lincoln A, Rose FE, Sunahara M, Osawa M,
Bellugi U, Korenberg JR. (2003) - Williams syndrome deficits in visual spatial processing
linked to GTF2IRD1 and GTF2I on chromosome 7q11.23. Genetics in Medicine. 5:311-
321.
Hobart HH, Morris CA, Mervis CB, Pani AM, Kistler DJ, Rios CM, Kimberley KW, Gregg RG,
and Bray-Ward P. (2010) Inversion of the Williams syndrome region is a common
polymorphism found more frequently in parents of children with Williams syndrome.
American Journal of Medical Genetics, Part C. 154:220-228.
Hongou K, Konishi T, Yagi S, Araki K, and Miyawaki T. (1998) Rotavirus encephalitis
mimicking afebrile benign convulsions in infants. Pediatric Neurology. 18:354-357.
Hrachovy RA. (2002) West's syndrome (infantile spasms). Clinical description and diagnosis.
Advancements in Experimental Medicine and Biology. 497:33-50.
112
Iafrate AJ, Feuk L, Rivera MN, Listewnik ML, Donahoe PK, Qi Y, Scherer SW, and Lee C.
(2004) Detection of large-scale variation in the human genome. Nature Genetics. 36:949-
951.
Iida J, Ishizaki H, Okamoto-Tanaka M, Kawata A, Sumita K, Ohgake S, Sato Y, Yorifuji H,
Nukina N, Ohashi K, Mizuno K, Tsutsumi T, Mizoguchi A, Miyoshi J, Takai Y, and Hata
Y. (2007) Synaptic scaffolding molecule alpha is a scaffold to mediate N-methyl-D-
aspartate receptor-dependent RhoA activation in dendrites. Molecular Cell Biology.
27:4388-4405.
Jacobs PA, Browne C, Gregson N, Joyce C, and White H. (1992) Estimates of the frequency of
chromosome abnormalities detectable in unselected newborns using moderate levels of
banding. Journal of Medical Genetics. 29:103-108.
Kahler SG, Adhvaryu SG, Helali N, and Qumsiy MB. (1995) Microscopically visible deletion of
chromosome 7 in a child with features of Williams syndrome. American Journal of Human
Genetics. 57:A117.
Kirchhoff M, Bisgaard AM, Bryndorf T, Gerdes T. (2007) MLPA analysis for a panel of
syndromes with mental retardation reveals imbalances in 5.8% of patients with mental
retardation and dysmorphic features, including duplications of the Sotos syndrome and
Williams-Beuren syndrome regions. European Journal of Medical Genetics. 50:33-42.
Kitchiner D, Jackson M, Walsh K, Peart I, and Arnold R. (1996) Prognosis of supravalve aortic
stenosis in 81 patients in Liverpool. Heart. 75:396–402.
Korf BR, Carrazana E, and Holmes GL. (1993) Patterns of seizures observed in association with
neurofibromatosis 1. Epilepsia 34:616-620.
Koolen DA, Vissers LE, Pfundt R, de Leeuw N, Knight SJ, Regan R, Kooy RF, Reyniers E,
Romano C, Fichera M, Schinzel A, Baumer A, Anderlid BM, Schoumans J, Knoers NV,
van Kessel AG, Sistermans EA, Veltman JA, Brunner HG, de Vries BB. (2006) A new
chromosome 17q21.31 microdeletion syndrome associated with a common inversion
polymorphism. Nature Genetics. 38:999-1001.
Kriek M, White SJ, Szuhai K, Knijnenburg J, van Ommen GJ, den Dunnen JT, and Breuning
MH. (2006) Copy number variation in regions flanked (or unflanked) by duplicons among
patients with developmental delay and/or congenital malformations; detection of reciprocal
and partial Williams-Beuren duplications. European Journal of Human Genetics 14:180–
189.
Kurotaki N, Harada N, Shimokawa O, Miyake N, Kawame H, Uetake K, Makita Y, Kondoh T,
Ogata T, Hasegawa T, Nagai T, Ozaki T, Touyama M, Shenhav R, Ohashi H, Medne L,
Shiihara T, Ohtsu S, Kato Z, Okamoto N, Nishimoto J, Lev D, Miyoshi Y, Ishikiriyama S,
Sonoda T, Sakazume S, Fukushima Y, Kurosawa K, Cheng JF, Yoshiura K, Ohta T,
Kishino T, Niikawa N, and Matsumoto N. (2003) Fifty microdeletions among 112 cases of
Sotos syndrome: low copy repeats possibly mediate the common deletion. Human
Mutation. 22:378-387.
113
Lakich D, Kazazian HH Jr, Antonarakis SE, and Gitschier J. (1993) Inversions disrupting the
factor VIII gene are a common cause of severe haemophilia A. Nature Genetics. 5:236-
241.
Lai CS, Fisher SE, Hurst JA, Vargha-Khadem F, and Monaco AP. (2001) A forkhead-domain
gene is mutated in a severe speech and language disorder. Nature. 413:519-523.
Lewis BA, and Thompson LA. (1992) A study of developmental speech and language disorders
in twins. Journal of Speech and Hearing Research. 35:1086-1094.
Lichtenbelt KD, Hochstenbach R, van Dam WM, Eleveld MJ, Poot M, and Beemer FA. (2005)
Supernumerary ring chromosome 7 mosaicism: Case report, investigation of the gene
content, and delineation of the phenotype. American Journal of Medical Genetics A.
132A:93-100.
Li C. and Wong WH. (2001a) Model-based analysis of oligonucleotide arrays: model validation,
design issues and standard error application. Genome Biology. 2:RESEARCH0032.
Li C. and Wong WH. (2001b) Model-based analysis of oligonucleotide arrays: expression index
computation and outlier detection. Proceedings of the National Academy of Science (USA).
98: 31-6.
Locke DP, Sharp AJ, McCarroll SA, McGrath SD, Newman TL, Cheng Z, Schwartz S,
Albertson DG, Pinkel D, Altshuler DM, and Eichler EE. (2006) Linkage disequilibrium
and heritability of copy-number polymorphisms within duplicated regions of the human
genome. American Journal of Human Genetics. 79:275-290.
Lopes J, Vandenberghe A, Tardieu S, Ionasescu V, Lévy N, Wood N, Tachi N, Bouche P, Latour
P, Brice A, LeGuern E. (1997) Sex-dependent rearrangements resulting in CMT1A and
HNPP. Nature Genetics.17:136-137.
Lowery MC, Morris CA, Ewart A, Brothman LJ, Zhu XL, Leonard CO, Carey JC, Keating M,
and Brothman AR. (1995) Strong correlation of elastin deletions, detected by FISH, with
Williams syndrome: evaluation of 235 patients. American Journal of Human Genetics.
57:49-53.
Lupski JR. (1998) Genomic disorders: structural features of the genome can lead to DNA
rearrangements and human disease traits. Trends in Genetics 14:417-422.
MacDermot KD, Bonora E, Sykes N, Coupe AM, Lai CS, Vernes SC, Vargha-Khadem F,
McKenzie F, Smith RL, Monaco AP, and Fisher SE. (2005) Identification of FOXP2
truncation as a novel cause of developmental speech and language deficits. American
Journal of Human Genetics. 76:1074-1080.
Manguoğlu E, Berker-Karaüzüm S, Baumer A, Mihçi E, Taçoy S, Lüleci G, and Schinzel A.
(2005). A case with de novo interstitial deletion of chromosome 7q21.1-q22. Genetic.
Counselling. 16:155-159.
114
Mari A, Amati F, Mingarelli R, Giannotti A, Sebastio G, Colloridi V, Novelli G, and
Dallapiccola B. (1995) Analysis of the elastin gene in 60 patients with clinical diagnosis of
Williams syndrome. Human Genetics. 96:444-448.
Marshall CR, Young EJ, Pani AM, Freckmann ML, Lacassie Y, Howald C, Fitzgerald KK,
Peippo M, Morris CA, Shane K, Priolo M, Morimoto M, Kondo I, Manguoglu E, Berker-
Karauzum S, Edery P, Hobart HH, Mervis CB, Zuffardi O, Reymond A, Kaplan P,
Tassabehji M, Gregg RG, Scherer SW, and Osborne LR. (2008) Infantile spasms is
associated with deletion of the MAGI2 gene on chromosome 7q11.23-q21.11. American
Journal of Human Genetics. 83:106-111.
Martin ND, Smith WR, Cole TJ, Preece MA. (2007) New height, weight and head circumference
charts for British children with Williams Syndrome. Archives of Diseases in Childhood.
92:598-601.
McDermid HE, Duncan AM, Brasch KR, Holden JJ, Magenis E, Sheehy R, Burn J, Kardon N,
Noel B, Schinzel A, et al.(1986) Characterization of the supernumerary chromosome in cat
eye syndrome. Science 232:464-48.
McElveen C, Carvajal MV, Moscatello D, Towner J, and Lacassie Y. (1995). Ectrodactyly and
proximal/intermediate interstitial deletion 7q. American Journal of Medical Genetics. 56:1-
5.
Mervis CB, Robinson BF, Bertrand J, Morris CA, Klein-Tasman BP, and Armstrong SC. (2000)
The Williams syndrome cognitive profile. Brain and Cognition. 44:604-628.
Mervis CB, and Klein-Tasman BP. (2000) Williams syndrome: Cognition, personality, and
adaptive behavior. Mental Retardation and Development Disability Research Reviews.
6:148-158.
Mervis CB, and Robinson BF. (2000) Expressive vocabulary ability of toddlers with Williams
syndrome or Down syndrome: a comparison. Developmental Neuropsychology 17:111-
126.
Mervis CB, and Klein-Tasman BP. (2000) Williams syndrome: cognition, personality, and
adaptive behavior. Mental Retardation and Development Disability Research Reviews.
6:148-158.
Mervis CB, Robinson BF, Bertrand J, Morris CA, Klein-Tasman BP, and Armstrong SC. (2000)
The Williams syndrome cognitive profile. Brain and Cogniton. 44:604-628.
Mervis, C.B. (2006) Language abilities in Williams-Beuren syndrome. In: Williams-Beuren
syndrome: Research, Evaluation, and Treatment (Morris, C.A., Lenhoff, H. and Wang, P.,
eds) pp. 159-206, Johns Hopkins University Press, Baltimore, MD.
Mervis CB, and Becerra AM. (2007) Language and communicative development in Williams
syndrome. Mental Retardation and Development Disability Research Reviews. 13:3-15.
115
Mervis CB, and Morris CA. (2007) Williams syndrome. In: Neurogenetic Developmental
Disorders: Variation of Manifestation in Childhood. (Mazzocco MMM, and Ross JL, eds)
pp. 199-262. MIT Press. Cambridge, MA.
Mizugishi K, Yamanaka K, Kuwajima K, and Kondo I. (1998) Interstitial deletion of
chromosome 7q in a patient with Williams syndrome and infantile spasms. Journal of
Human Genetics. 43:178-181.
Morimoto M, An B, Ogami A, Shin N, Sugino Y, Sawai Y, Usuku T, Tanaka M, Hirai K,
Nishimura A, Hasegawa K, and Sugimoto T. (2003) Infantile spasms in a patient with
Williams syndrome and craniosynostosis. Epilepsia. 44:1459-1462.
Morris CA, Thomas IT, and Greenberg F. (1993) Williams syndrome: autosomal dominant
inheritance. American Journal of Medical Genetics. 47:478-481.
Morris CA. (2005) Williams Syndrome. In: Management of genetic syndromes. 2nd ed. (Cassidy
SB, Allanson JE, eds.) New York: John Wiley & Sons.
Morris CA. (2006) Genotype-phenotype correlations in Williams-Beuren syndrome. In;
Williams-Beuren syndrome. (Morris CA, Lenhoff HM, Wang PP, eds.) Baltimore: Johns
Hopkins University Press.
Nickerson E, Greenberg F, Keating MT, McCaskill C, and Shaffer LG. (1995) Deletions of the
elastin gene at 7q11.23 occur in approximately 90% of patients with Williams syndrome.
American Journal of Human Genetics. 56:1156-1161.
Niedermaier M, Schwabe GC, Fees S, Helmrich A, Brieske N, Seemann P, Hecht J, Seitz V,
Stricker S, Leschik G, Schrock E, Selby PB, and Mundlos S. (2005) An inversion
involving the mouse Shh locus results in brachydactyly through dysregulation of Shh
expression. Journal of Clinical Investigation. 115:900-999.
Noebels JL, Qiao X, Bronson RT, Spencer C, and Davisson MT. (1990) Stargazer: a new
neurological mutant on chromosome 15 in the mouse with prolonged cortical seizures.
Epilepsy Research. 7:129-135.
Osborne LR, Li M, Pober B, Chitayat D, Bodurtha J, Mandel A, Costa T, Grebe T, Cox S, Tsui
LC, and Scherer SW. (2001) A 1.5 million-base pair inversion polymorphism in families
with Williams-Beuren syndrome. Nature Genetics. 29:321-325.
Osborne LR, and Mervis CB. (2007) Rearrangements of the Williams-Beuren syndrome locus:
molecular basis and implications for speech and language development. Experimental
Review in Molecular Medicine. 9:1-16.
Ou Z, Berg JS, Yonath H, Enciso VB, Miller DT, Picker J, Lenzi T, Keegan CE, Sutton VR,
Belmont J, Chinault AC, Lupski JR, Cheung SW, Roeder E, and Patel A. (2008)
Microduplications of 22q11.2 are frequently inherited and are associated with variable
phenotypes. Genetics in Medicine 10:267-277.
116
Ounap K, Laidre P, Bartsch O, Rein R, and Lipping-Sitska M. (1998) Familial Williams-Beuren
syndrome. American Journal of Medical Genetics. 80:491-493.
Ounap K, Ilus T, and Bartsch O. (2005) A girl with inverted triplication of chromosome 3q25.3 -
-> q29 and multiple congenital anomalies consistent with 3q duplication syndrome.
American Journal of Medical Genetics A. 134A:434-438.
Palmini A, Andermann F, Olivier A, Tampieri D, Robitaille Y, Andermann E, and Wright G.
(1991) Focal neuronal migration disorders and intractable partial epilepsy: a study of 30
patients. Annals of Neurology. 30:741-749.
Pérez Jurado LA, Peoples R, Kaplan P, Hamel BC, and Francke U. (1996) Molecular definit ion
of the chromosome 7 deletion in Williams syndrome and parent-of-origin effects on
growth. American Journal of Human Genetics. 59:781-792.
Portnoï MF, Lebas F, Gruchy N, Ardalan A, Biran-Mucignat V, Malan V, Finkel L, Roger G,
Ducrocq S, Gold F, Taillemite JL, and Marlin S. (2005) 22q11.2 duplication syndrome:
two new familial cases with some overlapping features with DiGeorge/velocardiofacial
syndromes. American Journal of Medical Genetics A. 137A:47-51.
Ranganathan R, and Ross EM. (1997) - PDZ domain proteins: scaffolds for signaling complexes.
Current Biology. 7:R770–R773.
Redon R, Ishikawa S, Fitch KR, Feuk L, Perry GH, Andrews TD, Fiegler H, Shapero MH,
Carson AR, Chen W, Cho EK, Dallaire S, Freeman JL, González JR, Gratacòs M, Huang J,
Kalaitzopoulos D, Komura D, MacDonald JR, Marshall CR, Mei R, Montgomery L,
Nishimura K, Okamura K, Shen F, Somerville MJ, Tchinda J, Valsesia A, Woodwark C,
Yang F, Zhang J, Zerjal T, Zhang J, Armengol L, Conrad DF, Estivill X, Tyler-Smith C,
Carter NP, Aburatani H, Lee C, Jones KW, Scherer SW, and Hurles ME. (2006) Global
variation in copy number in the human genome. Nature. 444;444-454.
Riikonen R . (2004) Infantile spasms: therapy and outcome. Journal of Child Neurology.
19:401-404.
Sadler LS, Robinson LK, Verdaasdonk KR, and Gingell R. (1993) The Williams syndrome:
evidence for possible autosomal dominant inheritance. American Journal of Medical
Genetics. 47:468-470.
Scherer SW, Poorkaj P, Massa H, Soder S, Allen T, Nunes M, Geshuri D, Wong E, Belloni E,
Little S, et al. (1994) Physical mapping of the split hand/split foot locus on chromosome 7
and implication in syndromic ectrodactyly. Human Molecular Genetics. 3:1345-1354.
Sebat J, Lakshmi B, Malhotra D, Troge J, Lese-Martin C, Walsh T, Yamrom B, Yoon S,
Krasnitz A, Kendall J, Leotta A, Pai D, Zhang R, Lee YH, Hicks J, Spence SJ, Lee AT,
Puura K, Lehtimäki T, Ledbetter D, Gregersen PK, Bregman J, Sutcliffe JS, Jobanputra V,
Chung W, Warburton D, King MC, Skuse D, Geschwind DH, Gilliam TC, Ye K, and
Wigler M. (2007) Strong association of de novo copy number mutations with autism.
Science. 316:445-449.
117
Sharp AJ, Mefford HC, Li K, Baker C, Skinner C, Stevenson RE, Schroer RJ, Novara F, De
Gregori M, Ciccone R, Broomer A, Casuga I, Wang Y, Xiao C, Barbacioru C, Gimelli G,
Bernardina BD, Torniero C, Giorda R, Regan R, Murday V, Mansour S, Fichera M,
Castiglia L, Failla P, Ventura M, Jiang Z, Cooper GM, Knight SJ, Romano C, Zuffardi O,
Chen C, Schwartz CE, and Eichler EE. (2008) A recurrent 15q13.3 microdeletion
syndrome associated with mental retardation and seizures. Nature Genetics. 40:322-328.
Shaw CJ, and Lupski JR. (2004) Implications of human genome architecture for rearrangement-
based disorders: the genomic basis of disease. Human Molecular Genetics. 13:R57-R64
Shaw-Smith C, Pittman AM, Willatt L, Martin H, Rickman L, Gribble S, Curley R, Cumming S,
Dunn C, Kalaitzopoulos D, Porter K, Prigmore E, Krepischi-Santos AC, Varela MC,
Koiffmann CP, Lees AJ, Rosenberg C, Firth HV, de Silva R, and Carter NP. (2006)
Microdeletion encompassing MAPT at chromosome 17q21.3 is associated with
developmental delay and learning disability. Nature Genetics. 38:1032-1037.
Shields WD. (2002) West's syndrome. Journal of Child Neurology. 17:S76-S79.
Sillanpää M, Jalava M, Kaleva O, and Shinnar S. (1998) Long-term prognosis of seizures with
onset in childhood. New England Journal of Medicine. 338:1715-1722.
Simon-Sanchez J, Scholz S, Fung HC, Matarin M, Hernandez D, Gibbs JR, Britton A, de Vrieze
FW, Peckham E, Gwinn-Hardy K, Crawley A, Keen JC, Nash J, Borgaonkar D, Hardy J,
and Singleton A. (2007) Genome-wide SNP assay reveals structural genomic variation,
extended homozygosity and cell-line induced alterations in normal individuals. Human
Molecular Genetics. 16:1-14.
Somerville MJ, Mervis CB, Young EJ, Seo EJ, del Campo M, Bamforth S, Peregrine E, Loo W,
Lilley M, Pérez-Jurado LA, Morris CA, Scherer SW, and Osborne LR. (2005) Severe
expressive-language delay related to duplication of the Williams-Beuren locus. New
England Journal of Medicine. 353:1694-1701.
SLI Consortium (2002) A genome-wide scan identifies two novel loci involved in specific
language impairment. American Journal of Human Genetics. 70:384-398.
SLI Consortium (2004) Highly significant linkage to the SLI1 locus in an expanded sample of
individuals affected by specific language impairment. American Journal of Human
Genetics. 74:1225-1238.
Stankiewicz P, Rujner J, Löffler C, Krüger A, Nimmakayalu M, Piłacik B, Krajewska-Walasek
M, Gutkowska A, Hansmann I, and Giannakudis I. (2001) Alagille syndrome associated
with a paracentric inversion 20p12.2p13 disrupting the JAG1 gene. American Journal of
Medical Genetics. 103:166-171.
Stankiewicz P, and Lupski JR. (2002) Genome architecture, rearrangements and genomic
disorders. Trends in Genetics. 18:74-82.
118
Stock AD, Spallone PA, Dennis TR, Netski D, Morris CA, Mervis CB, and Hobart HH. (2003)
Heat shock protein 27 gene: chromosomal and molecular location and relationship to
Williams syndrome. American Journal of Medical Genetics A. 120: 320-325.
Sugayama SM, Leone C, Chauffaille Mde L, Okay TS, and Kim CA. (2007) Williams
Syndrome: development of a new scoring system for clinical diagnosis. Clinics. 62:159-
166.
Tam E, Young EJ, Morris CA, Marshall CR, Loo W, Scherer SW, Mervis CB, Osborne LR.
(2008) The common inversion of the Williams-Beuren syndrome region at 7q11.23 does
not cause clinical symptoms‖ American Journal of Medical Genetics: Part A. 146A:1797-
1806.
Tan-Sindhunata G, Castedo S, Leegte B, Mulder I, vd Veen AY, vd Hout AH, Wiersma TJ, van
and Essen AJ. (2000) Molecular cytogenetic characterization of a small, familial
supernumerary ring chromosome 7 associated with mental retardation and an abnormal
phenotype. American Journal of Medical Genetics. 92:147-152.
Tassabehji M. (2003) Williams-Beuren syndrome: a challenge for genotype-phenotype
correlations. Human Molecular Genetics. 12:R229-R237.
Tatton-Brown K, Douglas J, Coleman K, Baujat G, Chandler K, Clarke A, Collins A, Davies S,
Faravelli F, Firth H, Garrett C, Hughes H, Kerr B, Liebelt J, Reardon W, Schaefer GB,
Splitt M, Temple IK, Waggoner D, Weaver DD, Wilson L, Cole T, Cormier-Daire V,
Irrthum A, Rahman N; and Childhood Overgrowth Collaboration (2005) Multiple
mechanisms are implicated in the generation of 5q35 microdeletions in Sotos syndrome.
Journal of Medical Genetics. 42:307-313.
Tercero MF, Cabrera López JC, Herrero MM, and Rodríguez-Quiñones F. (2005) Williams-
Beuren syndrome and West "syndrome:" causal association or contiguous gene deletion
syndrome? American Journal of Medical Genetics A. 133:213-215.
Tomblin JB, and Buckwalter PR. (1998) Heritability of poor language achievement among
twins. Journal of Speech Language and Hearing Research. 41:188-199.
Torniero C, dalla Bernardina B, Novara F, Vetro A, Ricca I, Darra F, Pramparo T, Guerrini R,
and Zuffardi O. (2007) Cortical dysplasia of the left temporal lobe might explain severe
expressive-language delay in patients with duplication of the Williams-Beuren locus.
European Journal of Human Genetics. 15:62-67.
Torniero C, Dalla Bernardina B, Novara F, Cerini R, Bonaglia C, Pramparo T, Ciccone R,
Guerrini R, and Zuffardi O. (2008) Dysmorphic features, simplified gyral pattern and
7q11.23 duplication reciprocal to the Williams-Beuren deletion. European Journal of
Human Genetics. 16:880-887.
Turnbull J, Lohi H, Kearney JA, Rouleau GA, Delgado-Escueta AV, Meisler MH, Cossette P,
and Minassian BA. (2005) Sacred disease secrets revealed: the genetics of human epilepsy.
Human Molecular Genetics. 14(S2):2491-2500.
119
Turner DJ, Miretti M, Rajan D, Fiegler H, Carter NP, Blayney ML, Beck S, and Hurles ME.
(2008) Germline rates of de novo meiotic deletions and duplications causing several
genomic disorders. Nature Genetics. 40:90-95.
Tzschach A, Menzel C, Erdogan F, Schubert M, Hoeltzenbein M, Barbi G, Petzenhauser C,
Ropers HH, Ullmann R, and Kalscheuer V. (2007). Characterization of a 16 Mb interstitial
chromosome 7q21 deletion by tiling path array CGH. American Journal of Medical
Genetics, Part A. 143A:333-337.
Van der Aa N, Rooms L, Vandeweyer G, van den Ende J, Reyniers E, Fichera M, Romano C,
Delle Chiaie B, Mortier G, Menten B, Destrée A, Maystadt I, Männik K, Kurg A, Reimand
T, McMullan D, Oley C, Brueton L, Bongers EM, van Bon BW, Pfund R, Jacquemont S,
Ferrarini A, Martinet D, Schrander-Stumpel C, Stegmann AP, Frints SG, de Vries BB,
Ceulemans B, and Kooy RF. (2009) Fourteen new cases contribute to the characterization
of the 7q11.23 microduplication syndrome. European Journal of Human Genetics. 52:94-
100.
Velleman SL, Currier A, Lippe C, and Mervis CB. (2006) Phonological development in
Williams syndrome. In Proceedings of the International Clinical Phonetics and Linguistics
Association (31 May– 3 June 2006; Dubrovnik, Croatia) (Horga, D. and Mildner, V., eds),
147, FF Press, Zagreb, Croatia.
Visser R, Shimokawa O, Harada N, Kinoshita A, Ohta T, Niikawa N, and Matsumoto N. (2005)
Identification of a 3.0-kb major recombination hotspot in patients with Sotos syndrome
who carry a common 1.9-Mb microdeletion. American Journal of Human Genetics. 76:52-
67.
Wechsler D, (1999). Wechsler Abbreviated Scale of Intelligence. San Antonio, TX:
Psychological Corporation.
Wessel A, Pankau R, Kececioglu D, Ruschewski W, and Bursch JH. (1994) Three decades of
follow up of aortic and pulmonary vascular lesions in the Williams-Beuren syndrome.
American Journal of Medical Genetics. 52:297–301.
Williams K. Expressive Vocabulary Test. Circle Pines, MN: American Guidance Service; 1997.
Wiig EH, Secord WA, and Semel E. Clinical Evaluation of Language Fundamentals Preschool
2nd ed. Austin, TX: Psychological Corporation; 2004.
Wolf NI, Sistermans EA, Cundall M, Hobson GM, Davis-Williams AP, Palmer R, Stubbs P,
Davies S, Endziniene M, Wu Y, Chong WK, Malcolm S, Surtees R, Garbern JY, and
Woodward KJ. (2005) Three or more copies of the proteolipid protein gene PLP1 cause
severe Pelizaeus-Merzbacher disease. Brain. 128:743-751.
Wong KK, deLeeuw RJ, Dosanjh NS, Kimm LR, Cheng Z, Horsman DE, MacAulay C, Ng RT,
Brown CJ, Eichler EE, and Lam WL. (2007) A comprehensive analysis of common copy-
number variations in the human genome. American Journal of Human Genetics. 80:91-
104.
120
Wu YQ, Nickerson E, Shaffer LG, Keppler-Noreuil K, and Muilenburg A. (1999) A case of
Williams syndrome with a large, visible cytogenetic deletion. Journal of Medical Genetics.
36:928-932.
Yobb TM, Somerville MJ, Willatt L, Firth HV, Harrison K, MacKenzie J, Gallo N, Morrow BE,
Shaffer LG, Babcock M, Chernos J, Bernier F, Sprysak K, Christiansen J, Haase S, Elyas
B, Lilley M, Bamforth S, and McDermid HE. (2005) Microduplication and triplication of
22q11.2: a highly variable syndrome. American Journal of Human Genetics. 76:865-876.
121
CHAPTER III: ANALYSIS OF GTF2IRD1 MOUSE MODEL:
122
3.1: Literature Review:
3.1.1: Contribution of the genes telomeric to elastin to the Williams-Beuren syndrome
phenotype:
The contribution of specific genes to individual aspects of a contiguous gene disorders
are often determined by identification of persons carrying atypical deletions or mutations in
individual genes within the known deleted region. In the case of WBS this has proven difficult
since the vast majority of WBS individuals carry the same deletion. However several smaller
deletions of the WBS region have been identified and these have provided some insight into the
relationship between specific phenotypic features and individual genes.
The first gene to be unequivocally linked to any aspect of the WBS phenotype was elastin
(ELN). The involvement of ELN in the cardiovascular lesions seen in over three quarters of
WBS individuals, in particular SVAS and PPS, was demonstrated in 1993 through the
identification of a family with SVAS and a chromosome translocation that disrupted the gene
(Curran et al., 1993). Studies involving patients having point mutations or intragenic deletions
in the elastin gene further supported the hypothesis that hemizygosity for ELN causes SVAS but
is otherwise not involved in any other aspects of WBS (Olson et al., 1995; Tassabehji 1997; Li et
al., 1997).
The identification of SVAS individuals with ELN deletions clearly indicated that ELN
was responsible for the vascular pathology and perhaps some connective tissue abnormalities
seen in WBS but was obviously not responsible for all of the features of WBS. In particular,
when it was shown that the WBS deletions extended beyond the ELN locus, it was concluded
that WBS was a contiguous gene deletion syndrome and that gene(s) beyond the ELN locus were
123
responsible for the remaining features of WBS. Tassabehji et al., (1999) reported a 7-year-old
girl (CS) with a 800kb deletion that shared a common proximal breakpoint found in typical WBS
patients but with a distal breakpoint within RFC2. Her standard test scores for verbal, nonverbal
and spatial scores were all in the normal range. From patient CS it was proposed that the genetic
determinants of all aspects of the WBS phenotype (except cardiovascular features) are telomeric
to RFC2.
Botta et al. (1999) identified the first individuals determined to have the full WBS
phenotype yet carry smaller deletions. Two individuals were determined to have deletions
spanning from the elastin gene to marker D7S1870, the common WBS distal breakpoint. The
two individuals included a 6 year old Italian girl and 2 year old male having common WBS
facial features including pre-orbital fullness, stellate patterning of the irises, short upturned nose,
full lips as well as cardiac abnormalities and developmental delay. In addition, the girl was
described as having a hyperactive overfriendly personality accompanied by anxiety,
characteristic of individuals with WBS. Her cognitive profile was consistent with WBS
displaying preserved language abilities alongside severe deficits in visual perception and visual
motor abilities.
Further evidence to support that genes telomeric to STX1A are responsible for the
majority of the features found in WBS came from a report by Heller et al., (2003) of a classic
case of WBS in a twin boy (healthy sister) with a deletion also spanning from ELN to GTF2I.
This individual was said to display the full WBS phenotype including cardiac abnormalities,
developmental delay, characteristic facial features and a ―very friendly nature‖. From these
findings the authors concluded that the genes from ELN to GTF2I were likely responsible for
most phenotypic aspects of WBS.
124
In 2003, the first reports were published that began to elucidate the possible contributions
of CLIP2, GTF2IRD1 and GTF2I to the WBS cognitive and behavioural phenotype. In February
2003, Karmiloff-Smith et al., reported an SVAS patient (WBS-21) with a large deletion from the
common proximal breakpoint to RFC2 yet did not have the typical facial or behavioral profile.
The breakpoints in this individual were similar to the patient CS reported by Tassabehji et al.,
(1999) and consistent with this individual, WBS-21 had a normal to above average IQ (110) and
an even cognitive profile with above average non-verbal and spatial scores, with no signs of
spatial impairment. Later in 2003, Gagliardi et al., reported a 5-year-old Italian boy with a
common proximal breakpoint but a distal breakpoint that mapped within CLIP2. Also consistent
with the previous patients reported by Karmiloff et al., and Tassabehji et al., this individual had a
higher IQ (83) than commonly observed in WBS and more importantly displayed no spatial
construction impairment.
It is evident from these identified individuals, as well as subsequent patients identified
since the commencement of this work, that deletions of the genes mapping telomerically to
RFC2, such as CLIP2, GTF2I and GTF2IRD1 likely contribute to the cognitive and behavior
aspects of WBS (Botta et al., 1999; Tassabehji et al., 1999; Gagliardi et al., 2003; Karmiloff-
Smith et al., 2003; van Hagen et al., 2007; Antonell et al., 2009; Ferrero et al., 2010). Although
it is important to identify atypical deletions of regions associated with contiguous gene deletion
syndromes to determine the phenotypic contribution made by the variably deleted genes, the
etiology is often complicated by the fact that not all genes are dosage sensitive, or that the
phenotype may result from a combinatorial effect of deleted genes and may also be dependent of
genetic background, particularly reducing the value of single individual carrying unique
deletions. In addition, in the case of WBS there is an ascertainment bias in the identification of
125
individuals with smaller deletions, with all patients to date harboring a disruption of ELN.
Controlled studies, specifically the use of animal models containing both individual and multiple
deleted genes will be a valuable tool to link specific genes with the social and emotional changes
seen in WBS.
3.1.2: The neurobiology of fear, emotion and social cognition:
A great deal of research has been done on the cognitive-linguistic aspects associated with
WBS, however the neural deficits involved in the emotional and social profile have yet to be
fully investigated. This is likely due to a tendency by clinicians and researchers to often attribute
neuropsychological features in patients with mental retardation to their deficits in cognition and
although social skills and emotional traits are often highly heritable and critical for survival, little
is known about specific genetic factors and neural mechanisms influencing human social
cognition. To a neuroscientist, WBS is an ideal disorder to study. The WBS cognitive and
behavioral phenotype is an intriguing combination of gregarious sociability, anxiety, strength in
expressive skills alongside severe deficits in learning and spatial cognition. However, even
though the genetic cause of the disorder was identified over 15 years ago as a deletion of
approximately 25 genes, the neural mechanisms underlying the WBS cognitive and behavioral
phenotype remain largely unknown.
Still in its infancy, the field of cognitive neuroscience of social and emotional behavior
continues to grow in popularity and importance. What information has been gathered has come
from fear-based learning such as classical (or Pavlovian) conditioning. Fear based learning
produces rapid, robust and enduring learning. It has been demonstrated that even a single
126
intense foot shock can produce a conditioned fear response and that the learned behavior can last
for months (Maren, 2008). Although the neural pathways are still unclear, the limbic system, an
integrated functional complex consisting of both cortical and sub-cortical regions is believed to
be involved in learning and memory as well as emotional and social behavior. Again, due to
extensive work in classical fear conditioning, the areas that appear to play a pivotal role in fear as
well as emotional and social behavior are the frontal cortex and the amygdala, which is believed
to act as a protective device that receives sensory input from various areas of the brain, including
the frontal cortex and monitors environmental events such as danger. In human studies it was
demonstrated that the activation of the amygdala occurs even when subjects are given verbal
commands that may result in danger (Phelps et al., 2001) and it has been demonstrated that
activation of the amygdala can even occur in individuals that are simply watching others
participate in fear conditioning experiments; a process referred to as observational fear
conditioning (Shin and Liberzon, 2010).
3.1.3: The unique social profile seen in WBS:
An intriguing feature of Williams syndrome is the unique social profile characterized by
hypersociability and a diminished fear of strangers. Deficits in social interaction have also been
shown to be an important early marker for autism and other related neurodevelopmental
disorders with strong genetic components. It is often difficult to study sociability in neurological
disorders since intellectual impairment often limits comparison to control groups.
Several brain regions including the frontal lobes provide inhibitory input to the amygdala
(Davidson et al., 2000) and the interaction between the orbitofrontal cortex (OFC) and the
127
amygdala is thought be crucial for making appropriate social judgments (Adolphs, 2003) with
lesions of the amygdala and the OFC associated with impairments of social functioning leading
to disinhibition (Amaral, 2002). Recent work has demonstrated that there may exist extensive
reciprocal connection between the amygdala and various regions of the brain that are thought to
regulate emotional and social behavior (Shin and Liberzon, 2010) and it is this disturbance of the
functional interaction between the OFC and amygdala in subjects with WBS that is hypothesized
to contribute to social disinhibition, reduced reactivity to social cues and an increased tendency
to approach strangers (Meyer-Lindenberg et al., 2005).
Most studies attempting to elucidate the neural basis of social behaviour have involved
non-human primates. Normally, socialization in primates is a time dependent process where
they will initially take a considerable amount of time to evaluate one another, maintain a cautious
posture and avoid coming in close proximity to one another. Once a social relationship has been
established, there is an increase in positive social interaction such as grooming. However, in
primates with bilateral lesions of the amygdala, primates engage in social actions immediately.
Interestingly this appears to be age dependent. When lesions are generated in adult non-human
primates, these animals displayed a complete loss of innate fear, increased sociability and
actively engage in immediate social interactions (Emery et al., 2001). Similarly, when bilateral
lesions of the amygdala were generated shortly after birth, these animals also displayed a
complete loss of innate fear. However when these animals were then allowed to engage in social
interactions, they displayed significant increases in fearful behaviors and engaged in significantly
fewer social interactions suggesting dissociable systems of social and non social fear (Prather et
al., 2001).
128
In mice, changes in sociability and aggression can be determined using the resident-
intruder test where individually housed male mice (residents) are exposed to novel, socially
house intruder mice. The latency and duration of a number of events including aggressive
(biting, wrestling or aggressive grooming) or social behaviours (following and sniffing of
partner) are recorded. Alterations in the resident-intruder behaviours have been previously
linked to several brain regions including the amygdala as well as disruption of the hypothalamic-
pituitary-adrenocortical (HPA) axis, the vasopressin and serotonin systems (for review see
Veenema and Neumann, 2007).
3.1.4: Increased levels of generalized anxiety and specific phobias in WBS:
Specific phobias are highly prevalent in children and adults with WBS, with reported
incidences of 53.8% and 50% respectively (Leyfer et al., 2006; Cherniske et al., 2004). These
rates are far higher than those reported for individuals with mental retardation of other etiologies
which ranges from 1.5% to 17% (Cooper et al., 1997; Myers and Pueschel, 1991; Dekker and
Koot, 2003; Emerson, 2003). In contrast to their high levels of anxiety, individuals with WBS
are highly gregarious and people-oriented, and this is reflected in the low prevalence of social
phobias. Around 12% of WBS individuals are diagnosed with generalized anxiety disorder
(GAD) (Leyfer et al., 2006; Dykens, 2003), a much lower rate of GAD is found in typically
developing children (2-4%) (Achenbach et al., 1989; Anderson et al., 1987; Bowen et al., 1990)
or in those with mental retardation of other etiologies (>2%) (Dekker and Koot, 2003; Emerson,
2003).
129
Anxiety disorders are characterized by excessive fear in response to specific object or
situation but in the absence of true danger (Shin and Liberzon, 2010) and whereas fear is a
necessary adaptive physiological and behavioral response to an actual or imminent threat,
anxiety is the response to a far more uncertain threat and can be triggered by more generalized
cues (Cannistraro and Rauch, 2003; Lang et al., 2000). In particular, that anxiety is believed to
result from a malfunction in the memory consolidation and recall mechanism. Typically, when
fearful situations are encountered, they are characterized, managed (e.g. avoidance behaviour)
and over time, forgotten through a process known as extinction or reversal learning (Shin and
Liberzon, 2010). However when these neural mechanisms are not performing properly, these
fear-inducing situations are learned but not forgotten, resulting in future anxiety and specific
phobias. Although the precise mechanism is still unclear, inhibitory neurons from the ventral
and medial subregions of the prefrontal cortex project to the lateral amygdala, which then
projects to the central amygdala and to the inhibitory neurons in the intercalated cell masses
(ICM) (Sotres-Bayon et al., 2008) negatively regulating the central amygdala and suppressing
amygdala-processed fear responses. As with fear learning, synaptic plasticity within the lateral
amygdala mediates both acquisition and extinction of future anxiety and specific phobias. This
suggests a role for the lateral amygdala as the site of plasticity underlying memory storage and
fear consolidation. Interestingly, individuals with lesions of the ventral and medial subregions of
the prefrontal cortex also show inappropriate emotional behavior even in the absence of
intellectual deficits and brain imaging studies using PET and fMRI have shown activation of the
PFC and ACC in response to photographs as well as odors and tastes (Britton et al., 2006; Zald
and Pardo, 1997; Zald et al., 1998).
130
The most common method to identify alterations in fear and anxiety in animal models is
the use of the elevated plus (or zero) maze. Originally developed by the work of Montgomery in
the late 1950s, the tests uses a rodent‘s natural aversion for open spaces and provides the test
animal with the choice of either an exposed area (open arms) or a protected area (closed arms).
The test is sensitive to both anxiolytic and anxiogenic drugs with an increase in the time spent
exploring the open arms for anxiolytic drugs and a decrease seen for anxiogenics drugs (for
review see Lister, 1987).
3.1.5: Role of serotonin in emotional behaviors:
Emotional and social behaviours are moderated by a myriad of chemical neurotransmitters.
Clinical evidence for a role for the neurotransmitters serotonin (5-HT), dopamine (DA) and
norepinephrine (NE), in the regulation of emotional behaviour was first identified in the late
1950s when marked depression was observed in individuals prescribed the antihypertensive drug
reserpine which resulted in monoamine depletion (Quetsch et al., 1959). Different
neurotransmitters are produced in cell bodies that cluster in distinctive regions of the brains.
Dopamine is produced in a number of areas including the ventral tegmental area (VTA) whose
two primary efferent fiber projections of the VTA are the mesocortical and the mesolimbic
pathways, and the substantia nigra (SN) which projects via the nigrostriatal pathway to the basal
ganglion (Smith and Kieval, 2000). The principal source of serotonin production is the raphe
nucleus that projects to all cortical regions, the amygdala, hippocampus and hypothalamus
(Gaspar et al., 2003). Norepinephrine is produced in the locus corealus and projects to all areas
of the cortex, cerebellum and spinal cord (Ramirez and Wang, 1986).
131
Serotonin is known to be a major player in the modulator of emotional behaviour and
psychotherapeutic agents targeting serotonin-induced pathways are being used in the treatment
of many psychiatric disorders including depression. Serotonin is a major player in the modulator
of emotional behaviour and in the construction of neural pathways and terminal differentiation of
neurons (Gaspar et al., 2003). During development, serotonergic neurons are among the first to
be generated being expressed on embryonic day 10 in mice and first trimester in primates. It has
also been demonstrated that many non-serotonergic neurons transiently express the genes for the
serotonin transporter (SERT) and the protein needed to package serotonin into synaptic vesicles
(VMAT2) thereby allowing these cells to store and release serotonin even though they lack the
ability to produce it (Lebrand et al., 1996). Interestingly, it has also been shown that
antidepressants promote neurogenesis in the hippocampus (Gould, 1999) and increase production
of neurotrohpins in the neocortex (Vaidya et al., 1997) and that high levels of serotonin are
produced in the brain up to about the age of five but then the levels decrease until adulthood.
However, blood levels of serotonin have been shown to remain high in a subpopulation of
autistic people (Penn, 2006). The serotonin metabolite 5-hydroxyindoleacetic acid (5-HIAA)
that is believed to reflect pre-synaptic serotonin release has been shown to be deceased in the
cerebrospinal fluid (CSF) of patients suffering from depression and that brain stem levels of
serotonin and 5-HIAA are consistently reduced in suicide victims (Arango et al., 1997). In
human studies, alterations in brain serotonin levels have been associated with aggression, and
alterations in gene expression in genes involved in the breakdown of serotonin as well as
serotonin receptors, either by mutation or promoter polymorphisms, have been linked to an
increase in the risk of suicide (Roy, 2001).
132
The generation of animal models for the elucidation of neural mechanism involved in
fear-based learning as well as sociability and emotional behaviour are necessary to create
effective treatment. Although neuropsychological conditions are rarely mediated by single
genes, deciphering the contributions made by genes whose copy number is known to be affected
in contiguous gene deletion disorder in which neural functioning is disrupted, such as in WBS,
will not only contribute to a better understanding of the associated neurological phenotype but
may also provide insight to the etiology of less understood neuropsychological disorders.
3.2: Material and Methods:
3.2.1: Generation of Gtf2ird1 mouse model:
The murine Gtf2ird1 gene was disrupted using a conventional replacement targeting
strategy. The targeting vector consisted of 2.7 kb short arm and a 5.8 kb long arm derived from
RPCI-21-510M19 PAC library (derived from 129/SvJ mice) cloned into the EcoRI and KpnI
sites respectively, of the pKSLoxPNT cloning vector (Hanks et al., 1995). The resulting vector
contained a neomycin resistant gene, (Neo) flanked by loxP sites, in the same transcriptional
orientation of Gtf2ird1 (Figure 3.1A). Integration of the linearized vector into the Gtf2ird1 gene
locus of R1 murine embryonic stem cells (Nagy et al., 1993) generated neomycin resistant clones
with the expected genomic fragments by Southern-blot and PCR analysis (Figure 3.1B). The
targeting resulted in the replacement of Gtf2ird1 exons 2, 3, 4 and part of 5 with the neomycin
resistant gene cassette transcribed by the PGK1 promoter. Mice carrying the targeted allele were
generated by aggregation of targeted cells with morula-stage embryos to obtain germ line-
transmitting chimeric mice (Nagy et al., 2002).
133
Chimeric males were mated with CD1 females to produce Gtf2ird1 heterozygously
targeted mice, and the mice were subsequently maintained on a CD1 background. Both
Gtf2ird1+/-
and Gtf2ird1-/-
mice were viable and fertile and the mutant allele was transmitted at
the expected Mendelian ratio. F1 heterozygous littermates were crossed to homozygosity in
order to generate Gtf2ird1-/-
mice. Genotyping was performed by PCR analysis of purified
genomic DNA using the forward primer mIRD1-GF (5‘-CGACCACCATAGGTTGAAGG-3‘),
in combination with the two reverse primers mIRD1-GR (5‘-TGGGGAACTGTTTGAGAAGG-
3‘) and NEO-GR (5‘-GGGGAACTTCCTGACTAGGG-3‘). A 381 bp product is generated from
the wild-type locus and a 350 bp product is generated from the targeted locus.
3.2.2: Expression analysis:
Expression analysis was carried out using total RNA extracted from dissected adult frontal
cortex with TriReagent (Sigma-Aldrich Canada, Oakville, ON). Following DNase treatment
(Turbo DNA free, Ambion), 5 g of RNA was converted to cDNA using the SuperScript™
First-Strand Synthesis System (Invitrogen Canada Inc., Burlington, ON) and random hexamer
primers Samples were diluted 1/100 with sterile water and used directly in real-time assays using
the Power SYBR Green PCR Master mix and ABI Prism 7900HT sequence detection system
(Applied Biosystems, Foster City, CA) as described previously (Somerville et al. 2005). Primers
used for expression analysis are listed in Table 3.1. All samples were run in triplicate and the
experiment was repeated twice with consistent results. Absolute quantification analysis,
normalized to control genes hydroxymethylbilane synthase (Hmbs) and succinate dehydrogenase
(Sdha). Each test gene was normalized and comparative expression ratios (%) were calculated by
134
dividing the pooled normalized values for each of the test genes in the Gtf2ird1+/-
and Gtf2ird1-/-
genotype groups by the normalized test gene values for the Gtf2ird1+/+
control group.
Table 3.1. Primers for Quantitative PCR Amplification from cDNA
Primer Name Sequence
mBDNF1RTe2-F GACAAGGCAACTTGGCCTAC
mBDNF1RTe2-R TCGTCAGACCTCTCGAACCT
mGTF2IRD1RTe2-F ACTGTGACATCCCCACCAAC
mGTF2IRD1RTe2-R GAGTCTAAGGCGGACACCAG
mGTF2IRD1RTe9-F CGAGGCTGTGGAAATTGTG
mGTF2IRD1RTe9-R TGTGTCGCTCCTCCAGAATC
mCYLN2RTe4-F CAACAGAGGAGGCCACAGAG
mCYLN2RTe4-R CAAGGCCAAGAAGACCAAAC
mGTF2IRTe30-F CAGGAAGATCACCATCAACC
mGTF2IRTe30-R AGATCCTCCTCATGGAGCTG
mGABRA1RTe7-F AGCCCGTTCAGTGGTTGTAG
mGABRA1RTe7-R TTCCAGAGTCAACTGTTTGTCC
mGABRB2RTe5-F CTGGGTGCCTGACACCTACT
mGABRB2RTe5-R GATGCAATCGAATCATACGG
mGABRG2RTe2-F CATGGGTGTTGACTCCAAAA
mGABRG2RTe2-R CCGATGTCAGGTCGAAGTTT
m5-HT1aF CTGGGGACGCTCATTTTCT
m5- HT1aR CCAAGGAGCCGATGAGATAG
m5- HT1bF GAGTCCGGGTCTCCTGTGTA
m5- HT1bR TAGCGGCCATGAGTTTCTTC
m5- HT2aF TGTGCCGTCTGGATTTACCT
135
Primer Name Sequence
m5- HT2aR TGAATGGGGTTCTGGATAGC
m5- HT2cF CATGGCAGTAAGCATGGAGA
m5- HT2cR AGTCCCACCAGCATATCAGC
mMaoaF GTGCCTGGTCTGCTCAAGAT
mMaoaR TTCAGGACTGGGGCTGTTTA
mSERT-RTe8-F GTGGTGAACTGCATGACGAG
mSERT-RTe8-R CGTCTTCGTTCCTCATCTCA
mFOSRTe4-F ATCCTTGGAGCCAGTCAAGA
mFOSRTe4-R ATGATGCCGGAAACAAGAAG
mSdhaF TGATCTTCGCTGGTGTGGATGTCA
mSdhaR CCCACCCATGTTGTAATGCACAGT
mHMBSRT-F TCCAAGAGGAGCCCAGCTA
mHMBSRT-R ATTAAGCTGCCGTGCAACA
3.2.3: General morphological analysis:
Mice were routinely examined for obvious morphological or anatomical abnormalities.
For determination of body weight all mice were weighed with the same scale with an accuracy of
+/- 0.1 grams. All adult mice were at least ten weeks of age when weighed (n=120, mean 20.7
+/- 2.6 weeks). For determination of growth curves, mice were weighed twice per week from
weaning (3 weeks) until 10 weeks at approximately the same time of day. For behavioral testing,
adult mice between 3 and 9 months of age were used. All animals were group housed with access
to food and water ad libitum and were on a 12 hr light/dark cycle throughout the experiments.
136
3.2.4: Resident intruder/olfactory function test:
Aggression was assessed using the resident-intruder test in isolated male mice, essentially
as previously described (Moy et al., 2004). Males were housed individually for at least 1 week
before assessment, which was performed over three sessions, spaced 2–3 days apart. Intruders
(C57BL/6J male mice) were individually placed in the resident home cage for a 10 min test
session and a different intruder animal was used for each resident. Animals that did not attack the
intruder were given an attack latency of 10 min. The latency, duration and number of events
were recorded as: aggressive behavior (contact between the resident and the intruder such as
biting or wrestling and aggressive grooming of partner), social interest behavior (following and
sniffing of partner) and submissive behavior (defensive freezing and active avoidance of
partner). All behavioral events were video recorded and analyzed by Observer 5.0 software
(Noldus Information Technology, Netherlands). A simple test of olfactory function in each test
animal was conducted following the resident-intruder test. This was carried out as described
previously, by measuring the time it took for each mouse to find food buried in bedding (Moy et
al., 2004). All mice were first habituated to the food (Bud‘s Best Cookies, Hoover, AL) by the
experimenter placing pieces of cookie in the home cage overnight. The next day chow was
removed from the cages and the mice were food deprived for 24 hours. The test was conducted
in a plastic cage 30 x 17 x 12 cm. The food was placed in the randomly chosen area (1 x 1 x 0.5
cm) and the entire bottom of the cage covered with litter to a depth of 2.5 cm. Mice were then
placed into the cage individually and the latency to find the food was recorded, with a maximum
time of 15 min.
3.2.5: Elevated plus maze:
137
The elevated plus-maze was used to estimate the anxious state of the mice (Rodgers and
Cole, 1994). Testing was performed as described previously (Avgustinovich et al., 2004). All
measurements were taken in a dimly lit experimental room to which the mice were acclimatized,
and the maze was thoroughly cleaned between sessions. Over a 5-min test period, the following
measures of plus-maze behavior were recorded: 1) open arm time, enclosed arm time and central
platform time as a percentage of total time; 2) open arm entries, enclosed arm entries and central
platform entries as a percentage of total entries; 3) total entries; 4) head-dips. Additionally, the
number of passages from one enclosed arm to another and the number of open arm end
explorations (scored if the mouse was in the middle-to-end of the either open arm) was
measured.
3.2.6: Cube exploration/novel object recognition test:
The cube test was used to assess trait anxiety as previously described (Avgustinovich et
al., 2000). Briefly, a small cube (3cm3) was carefully placed in the center of each home cage and
total exploration times were recorded over a 5-min test period. All measurements were taken in a
dimly lit experimental room to which the mice were acclimatized, and the novel object (cube)
was thoroughly cleaned between tests. The novel object reconition test was performed as
previously described (Chan et al., 2008). Briefly, each mouse was habituated to the box with
10 min of exploration in the absence of objects for three consecutive days (habituation session,
days 1–3). During the training session, each animal was placed in the test box, and after a 5-min
habituation period, two objects were introduced in two corners. Each animal was allowed to
explore in the box for 5 min (day 4). An animal was considered to be exploring the object when
its head was facing the object (the distance between the head and object is approximately 1 cm or
138
less) or it was touching or sniffing the object. The time spent exploring each object was recorded
by an experimenter, blinded to the identity of the treatments, using stopwatches. After training,
mice were immediately returned to their home cages. During the retention sessions, the animals
were placed back into the same box 24 h after the training session (day 5), but one of the familiar
objects used during training had been replaced with a novel object. The animals were then
allowed to explore freely for 5 min, and the time spent exploring each object was recorded as
described above. A preference index in the retention session, a ratio of the amount of time spent
exploring the novel object over the total time spent exploring both objects, was used to measure
cognitive function. In the training session, the preference index was calculated as a ratio of the
time spent exploring the object that was replaced by the novel object in the retention session over
the total exploring time.
3.2.7: Locomotor activity in the open field:
Open field activity assessments were carried out as described previously (Gerlai et al.,
1993). The activity cage consisted of a clear Perspex box with a floor made of steel bars
connected to the circuit with horizontal and vertical infrared sensors. The subject‘s behavior was
recorded using a computer event-recording program (Ethograph). Each mouse was placed
individually into the center of the activity cage and horizontal and vertical activities were
recorded over a 5-min test period.
3.2.8: Morris water maze test:
139
The Morris water maze apparatus and testing procedures were described previously
(Clapcote et al., 2005). Briefly, on the first day, each mouse was given four visible platform
trials (V). Mice were then subjected to five days of four training trials per day with the
submerged platform in the same position (hidden phase). On the sixth day, the platform was
moved to a different position, and the mice were subjected to four days of four training trials per
day (reversal phase). Behavioral variables were quantified with the aid of HVS Water 2020
(HVS Image Ltd, Twickenham, Middlesex, UK).
3.2.9: Contextual and cued fear conditioning:
Contextual and cued fear conditioning was carried out according to previously published
protocols (Clapcote et al. 2005). Briefly, a fear conditioning apparatus (MED Associates Inc,
Georgia, VT) consisted on a test chamber (25cm high X 30cm wide X 25cm deep) was cleaned
prior to testing with 70% ethanol. Freezing activity was recorded using automated fear
conditioning software (Actimetrics Software) and presented as a percentage of total time. Test
subjects (+/+ n=9 (6 males, 3 females); +/- n=20 (12 males, 8 females); -/- n=6 (3 males, 3
females)) were removed from the home cage and allowed to explore for 2 minutes. Conditioning
consisted of a single pairing of an auditory cue (3600 Hz, 80 dB) with a foot shock (1 mA
scrambled). The auditory cue was presented 2 minutes after the training session started and was
30 seconds in duration. The foot shock was delivered continuously during the last 2 seconds of
the auditory cue. The subject was removed from the chamber 30 seconds later and returned to its
home cage. Approximately 24 hours later each subject was returned to the test chamber and
monitored for 5 minutes. Two hours later, the context was altered and each subject was placed
140
into the altered chamber and allowed 3 minutes for exploration, after which the auditory tone cue
of 3 minutes was delivered.
3.2.10: Neurochemical analyses:
Adult mice were killed with a brief (0.5–0.8 s) head-focused pulse of high intensity
microwave radiation (3.5 kW, 2450 MHz), delivered by a magnetron (Stoeling Co., Chicago, IL,
USA) to rapidly and effectively fix the brain in situ. The fixed brains were regionally dissected
on ice and stored at -80ºC until analysis. Tissues were processed as described previously, divided
into aliquots of 50 uL, and stored at -80ºC or analyzed immediately (Mount et al., 2004). Tissue
pellets were retained for the determination of protein content. Six to nine individual tissue
samples were obtained for each brain region.
Levels of monoamines and metabolites, including dopamine (DA), 3,4-
dihydroxyphenylacetic acid (DOPAC), 4-hydroxy-3- methoxyphenylacetic acid (HVA),
serotonin (5-HT) and 5-hydroxyindoleacetic acid (5-HIAA), were analyzed in 20–35 uL of the
perchloric acid tissue extracts by HPLC with electrochemical detection, and isocratic reverse-
phase chromatographic conditions similar to those described previously (Cosi and Marien,
1998). Briefly, the chromatographic conditions consisted of a C18 reverse-phase column
(LiChroCART 125–4 cartridge, 12.5 cm · 4.0 mm, filled with LiChrospher 100 RP-18, 5 lm
particle size, Merck) maintained at 30oC. The mobile phase was made up of NaH2PO4 (50 mM),
disodium EDTA (0.2 mM), 1-octane sulfonic acid (15–17 mL/L; PIC -B8, Waters) and 2.0–6.0%
methanol (final pH 1/4 4.0–4.6), and was delivered at a flow rate of 1.0 mL/min using a Waters
Model 510 pump. Samples were injected automatically using a refrigerated autosampler
141
(CMA/200 Microsampler, CMA/Microdialysis AB, Stockholm; or Waters Model 717plus
Autosampler). The electrochemical detector (Waters Model 460, Antec DECADE or Antec
INTRO) was operated at a working electrode potential of + 0.65 V.
3.2.11: Rotorod analysis:
Mice were placed on a rotating bar (diameter = 3.5 cm, Economex, Columbus
Instruments, Columbus, OH) rotated at a fixed rate of 12 rpm for 5 minutes. Performance
duration was recorded when the animal, unable to stay on the rotorod, fell a short distance,
tripped a plate, and automatically stopped a timer. All mice were trained 1 day prior to testing.
Mice were tested three times a day with each trial lasting no longer a maximum of 5 minutes.
Testing was repeated daily over a five-day period. Mice that repeatedly fell off the bar within
the first 15 seconds were excluded from further testing. Latency to fall is reported as the mean of
the sum total of the three daily trials.
3.2.12: Microarray analysis:
Expression analysis was carried out using total RNA extracted from dissected adult
frontal cortex with TriReagent (Sigma-Aldrich Canada, Oakville, ON) and analyzed using
(MouseWG-6 v2.0 Expression BeadChip, Illumina, San Diego, CA) as per manufacture‘s
instructions. The data preprocessing includes three steps: background correction (done in
Beadstudio), transfer of the data to log2 scale and then normalization of the data using the
quantile normalization method (Bolstad et al. 2003). The LIMMA (linear models for microarray
data) (Smyth, 2004) method was used to identify differentially expressed genes. Briefly, it starts
142
by fitting a linear model for each spot/gene in the data, and then an empirical Bayes (EB) method
is used to moderate the standard errors for estimating the moderated t-statistics for each
spot/gene, which shrinks the standard errors towards a common value. This test is similar to an
ANOVA method for each spot/gene except that the residual standard deviations are moderated
across genes to ensure more stable inference for each gene. The moderated standard deviations
are a compromise between the individual gene-wise standard deviations and an overall pooled
standard deviation.
3.2.13: Western blotting analysis:
For Western blot analysis, 20 μg of protein per fraction were separated by SDS-PAGE on
12% gradient Bis-Tris gels. After blotting to 0.2 μm nitrocellulose membranes (Pall, Port
Washington, NY, USA), protein loading and efficacy of transfer was checked by reversible
staining with Ponceau S (not shown). Membranes were routinely blocked with 5% non-fat dry
milk powder or bovine serum albumin in TBST (TBS + 0.05% Tween). Membranes were
incubated overnight at 4°C with anti-TrpC4 rabbit polyclonal antibody (Alomone Labs,
Jerusalem, Israel) diluted1/500 in blocking solution. Membranes were washed and incubated for
one hour in horseradish peroxidase (HRP)-conjugated goat anti-rabbit secondary antibody
(1/25000, GE Healthcare, Uppsala, Sweden). Membranes were washed and ECL (enhanced
chemiluminescence) reagents (GE Healthcare) were used for chemiluminescent detection using
Hyper Film (GE Healthcare). For re-probing, membranes were stripped in stripping solution
(100 mM 2-mercaptoethanol, 2% SDS, 60 mM Tris) for 30 min at 56°C.
143
3.2.14: Immunohistochemistry:
Sections were stained free-floating in 6-well plates loaded with 0.1 M Phosphate buffer
(PB). Unless otherwise stated the sections were incubated with shaking. Sections were rinsed
twice, 10 minutes each rinse, with PB 0.1 M and incubated with fresh 0.3% H2O2 in PB 0.1 M
for 30 minutes at room temperature. Sections were rinsed 3 10 minutes with 0.1 M PB and
blocked in blocking solution (PB 0.1 M; 0.1 % BSA; 0.2% Triton X-100; 2% serum) for 60 min
at room temperature. Sections were incubated with primary antibody (Anti-Fos: Polyclonal IgG,
Oncogene Research Products - Ab-5, Cat.# PC38) diluted in blocking solution overnight at room
temperature. Sections were rinsed 4 10 minutes with PB 0.1 M and incubated with
biotinylated secondary antibody (Biotin-SP-conjugated affiniPure Goat anti-rabbit IgG (H+L)
Jackson Immunoresearch, Cat.# 111-065-144. Recommended dilution: 1:2000), diluted in
blocking solution for 2 hours at room temperature on a shaker. Sections were rinsed 4 10
minutes in PB 0.1 M on a shaker and incubated in ABC solution (Vectastain ABC Kit - Elite
standard, Vector, PK-6100) for 1-2 hours at room temperature. Sections were rinsed 4 10
minutes with PB 0.1 M on a shaker and were developed with DAB/0.003% H2O2 solution (3,3‘-
diaminobenzidine tablets, Sigma D-5905) at room temperature. Sections were rinsed 4 10
minutes with PB 0.1 M, transferred to slides, allowed to air dry and dehydrated twice in ethanol
100% for 5 min, twice in toluene or xylene for 5 min and cover slipped with Cytoseal 280.
3.2.15: Golgi-Cox staining:
Brains were processed for Golgi-Cox impregnation using the FD RapidStain Golgi Kit
(FD Neurotechnologies) as per the manufacturer‘s instructions. Briefly, adult mice were
144
sacrificed by cervical dislocation; the brains were quickly removed and rinsed in Milli-Q water.
Brains were immersed in impregnation solution, made by mixing equal volumes of Solutions A
and B, and stored at room temperature for 2 weeks in the dark. The impregnation solution was
replaced after the first 24 hours of immersion. Brains were transferred into Solution C and
stored at 4ºC for at least 48 hours (up to 1 week) in the dark. The solution was replaced after the
first 24 hours of immersion. 100 um sections were cut on a Vibratome in PBS and transferred to
gelatin-coated microscope slides. Slides were dried at room temperature overnight. Sections
were briefly rinsed twice with distilled water and developed by incubating in a mixture of 1 part
Solution D, 1 part Solution E and 2 parts Milli-Q water for 10 minutes. The reaction was stopped
by rinsing in Milli-Q water. The sections were dehydrated in in 50%, 75% and 95% ethanol, 4
minutes each and then in 100% ethanol, four times for four minutes each. Sections were cleared
in xylene, and cover-slipped with Ctyoseal. Basal and apical spine densities were measured from
pyramidal cells of 5 mice at 3 separate 40 um lengths in each genotype (total of 15
measurements per genotype). The three measurements in each mouse were averaged and then
the mean of the five measurements was determined. Propagation of error was used to determine
the error of the mean.
3.2.16: Brain slice preparation and electrophysiology:
Brain slices were prepared as previously described (Proulx et al., 2010). Briefly, coronal
slices (400 µm thick) were obtained from the medial prefrontal cortex of Gtf2ird1-/-
mice and
their WT littermates. Mice were sacrificed by decapitation and the brains were removed and
cooled as rapidly as possible with 4°C oxygenated sucrose artificial cerebrospinal fluid (ACSF)
(254 mM sucrose was substituted for NaCl). Using the appearance of white matter and the
145
corpus callosum as anterior and posterior guides, prefrontal slices were cut from anterior to
posterior using a Dosaka Linear Slicer (SciMedia), Slices were transferred to 30°C oxygenated
ACSF (containing the following, in mM: 126 NaCl, 10 D-glucose, 24 NaHCO3, 2 CaCl2, 2
MgSO4, 3 KCl, 1.25 NaH2PO4, pH 7.4) in a prechamber (Automate Scientific) and allowed to
recover for at least 1.5 h before recordings. For whole cell recordings, slices were placed in a
modified chamber (Warner Instruments) mounted on the stage of an Olympus BX50WI
microscope. Regular ACSF was bubbled with 95% oxygen and 5% carbon dioxide and flowed
over the slice at 30°C with a rate of 3– 4 ml/min. Whole-cell patch electrodes (2–3 MΩ)
contained the following (in mM): 120 K-gluconate, 5 KCl, 2 MgCl, 4 K-ATP, 0.4 Na2-GTP, 10
Na2-phosphocreatine, and 10 HEPES buffer (adjusted to pH 7.33 with KOH). Layer V pyramidal
neurons were patched under visual control using infrared differential interference contrast
microscopy in the cingulate and prelimbic regions. When in voltage clamp, patched neurons
were maintained at the calculated equilibrium potential for chloride under these conditions (75
mV), and currents were recorded using continuous single electrode voltage-clamp mode with a
Multiclamp 700b (Molecular Devices), acquired and low-pass filtered at 3 kHz with
pClamp10.2/Digidata1440 (Molecular Devices). Preliminary concentration response experiments
in voltage-clamp (5-HT; 3 µM – 100 µM, 30 s) showed that 5-HT elicited outwards currents in
layer V pyramidal neurons, consistent with previous work in rats (Béïque et al., 2004). Currents
were measured in Clampfit by subtracting the mean outward current at the peak of the response
from the mean holding current at baseline. Drugs used in the study: t-APDC and baclofen were
obtained from Tocris bioscience (Burlington, ON, Canada), serotonin creatinine sulfate and
WAY-100635 from Sigma-Aldrich (St-Louis, MO, USA) and TTX from Alomone labs Ltd.
(Jerusalem, Israel).
146
3.2.17: Statistical analysis:
Data were expressed as mean ± SEM. Where stated, pair wise comparisons of individual
targeted genotypes to wild type controls were performed using either two-tailed Student‘s t-tests
or non-parametric Mann-Whitney ranked sum tests. Differences among means (to compare data
from more than two groups) were evaluated using non-parametric (distribution-free) Kruskal-
Wallis analysis of variance (ANOVA) test where indicated. Data analysis was performed using
Microsoft Excel and PAST (PAlaeontological STatistics) (http://folk.uio.no/ohammer/past/). For
all analyses the null hypothesis was rejected at the 0.05 level.
3.3: Results:
Data from this section has been included in the following publications:
Young EJ, Lipina TV, Tam E, Mandel A, Clapcote SJ, Bechard A, Chambers J, Mount HT,
Fletcher PJ, Roder JC, Osborne LR. (2008) Reduced fear and aggression and altered serotonin
metabolism in Gtf2ird1-targeted mice. Genes, Brain and Behaviour 7:224-34. Figures reprinted
with permission.
Gtf2ird1 gene targeting was performed by Ariane Mandel. Mouse husbandry,
maintenance and day-to-day genotyping were carried out by Elaine Tam. Some behavioural
testing (fear conditioning, Morris water maze, resident intruder test, open field, elevated plus
maze, novel object test) was carried out by Tatiana Lipina, Steve Clapcote and Alison Behcard
(Dr. John Roder‘s lab). Neurochemical measurements were carried out by John Chambers, Paul
Fletcher and Howard Mount. I performed statistical analysis of behavioral and neurochemical
data, performed growth curve analysis, microarray analysis and validation, all sectioning,
immunohistochemistry and staining.
147
Proulx E, Young EJ, Osborne LR, Lambe EK. Enhanced prefrontal serotonin 5-HT1A currents
in a mouse model of Williams-Beuren syndrome with low anxiety. Journal of
Neurodevelopmental Disorders. 2:99-108. Figures reprinted with permission.
Electrophysiology was performed by Eliane Proulx (Dr. Evelyn Lambe‘s lab). I performed
expression analysis of serotonin receptors. I was responsible for all other unpublished data in
this chapter.
3.3.1: Characterization of Gtf2ird1 mice:
Prior to my arrival in the lab, experiments were performed to target the murine Gtf2ird1
gene using a replacement-targeting vector that replaces the first three exons and part of the fourth
exon with a neomycin (NEO) cassette (Figure 3.1A). Several targeted clones were identified and
one line, D7, was used to establish a mouse Gtf2ird1 line. Real time PCR assays were performed
and confirmed the decreased expression of full-length Gtf2ird1 to 50% in Gtf2ird1+/-
mice with
no expression detected in Gtf2ird1-/-
mice (Figure 3.1C). This indicates a dose-dependent
expression pattern for Gtf2ird1 consistent with other transcription factors, (TWIST, FOXC1/2,
SOX9/10, p53, CREBBP, TBX1/3/5) haploinsufficiency of which are known to cause disease
(Seidman and Seidman, 2002).
148
149
However, when primers from outside the deleted region were used, expression was
detected. This transcript was determined to consist of the 5‘UTR spliced directly into exon 5.
Two possible start sites were identified downstream of the non-coding exon 1, but neither were
situated within a sequence resembling the Kozak consensus (Figure 3.2). The resulting ORF
translated from the first available ATG start codon would produce a short, out-of–frame (with
TFII-IRD1) protein terminating 120 base pairs (40 codons) downstream.
Nonsense mediate mRNA decay might be predicted to degrade this transcript. However,
qPCR results indicate that the transcript is stably expressed at a level that is approximately 25%
150
greater than the full-length transcript (Figure 3.3). Translation from the next available in-frame
ATG codon would result in an in-frame truncated protein lacking a DNA binding domain and
151
one of the GTF2I-like domains (see Figure 1.5). Based on the predicted translation potential of
the aberrantly spliced transcript no protein product is being produced from this targeted locus.
3.3.2: Phenotypic analysis of Gtf2ird1 targeted mice:
To determine if changes in expression of Gtf2ird1, as a consequence of the disruption of
the murine Gtf2ird1 gene locus, results in any phenotypic abnormalities commonly observed in
Williams-Beuren Syndrome, Gtf2ird1+/-
and Gtf2ird1-/-
mice were subjected to tests including
body weight measurement, assessment in the open field (OF), elevated plus maze (EPM),
resident intruder (RI), cued and contextual fear conditioning, accelerating rotorod (aRR), as well
as biochemical analysis of changes to neurotransmitter and gene expression levels.
3.3.3: Analysis of body weight.
One-way analysis of variance (ANOVA) test revealed that Gtf2ird1 mice showed a
significant decrease in body weight as demonstrated by analysis of both growth curve and adult
body weights (Figure 3.4A). Both Gtf2ird1+/-
(P<0.05) and Gtf2ird1-/-
(P<0.001) male mice
showed significant decreases as compared to control littermates. Body weights of female
Gtf2ird1-/-
(P <0.01) mice were significantly lower than those of wild type female mice while
those of Gtf2ird1+/-
were not significantly different. Growth retardation is a common feature of
WBS although it is unclear whether a difference exists between male and females. It was also
noted that a significantly more severe growth retardation and microcephaly is seen in WBS
individuals whose deleted chromosome maternally inherited, suggesting that an imprinted locus,
silent on the paternal chromosome and contributing to abnormal growth, may be affected by the
152
deletion (Perez Jurado et al., 1996). Since the majority of mice tested were derived from crosses
of two Gtf2ird1+/-
mice it would be difficult to determine whether the targeted allele was
inherited maternally or paternally. Similar results were also seen in growth curve analysis in
Gtf2ird1-/-
mice from 3 to 10 weeks of age (Figure 3.4B).
3.3.4: Assessment in the open field:
153
Open-field behavioral assays are commonly used to test both locomotor activity and
emotionality in mice. The open field test consists of a square or round chamber divided in
several quadrants. Once released into the chamber the spontaneous locomotor activity is
recorded. Mice will tend to avoid illuminated and open areas, favoring dark or sheltered
environments for activity. Typically, a mouse exposed to an unfamiliar situation will move
around less in the new environment, and when it does move, it will tend to stay by the walls. In
contrast, an animal that is not apprehensive will spend more time exploring the center of the
open field and will travel more distance. Increases in distance travel may also be an indication of
hyperactivity.
154
Gtf2ird1+/-
and Gtf2ird1-/-
mice displayed significant increases in locomotor activity
measured as both horizontal and vertical activity, which may be indicative of hyperactivity
(Figure 3.5A). Mice lacking Gtf2ird1 also showed decreases in fear response as measured in the
Open Field. Although there was no significant difference between wild type and Gtf2ird1+/-
mice, Gtf2ird1-/ mice spent a greater proportion of time in the central area of the open field arena
as compared to time spent near the wall and spent significantly less time freezing (Figure 3.5A).
Both hyperactivity and an altered fear response are common characteristics found in WBS
patients.
3.3.5: Gtf2ird1-/-
mice are less anxious in the elevated plus maze:
We evaluated state and trait anxiety, using the elevated plus maze and cube exploration
test respectively, and found that both were significantly reduced in the mutant mice. Gtf2ird1-/-
mice showed a significant increase in the amount of time spent in the open arms of the elevated
plus maze, compared to wild type mice (P<0.05), indicative of reduced anxiety involving
avoidable anxiety-provoking stimuli (Figure 3.6A). A similar, but not significant trend was seen
for the heterozygous mice. Pair-wise comparison also showed significant increases in total
entries (Figure 3.C; P <0.02) and head dips (Figure 3.C; P<0.03) for the Gtf2ird1-/-
mice. In the
cube exploration test, both the heterozygous and homozygous mice showed increased interest in
the cube compare to wild-type controls (Gtf2ird1+/-
; P<0.05; Gtf2ird1-/-
; P<0.001; Figure 3.6D).
155
3.3.6: Gtf2ird1-/-
mice display deficits in cued based fear conditioning:
Auditory fear conditioning utilizes a Pavlovian learning and memory paradigm to
identify alterations in hippocampus- and amygdala-based learning and memory (Schafe et al.,
2001). Fear conditioning is expressed by activity during the trial as a percentage of baseline
activity during training, with a low value being indicative of associative learning. In tests of
156
contextual and cued fear conditioning, deficits were seen for both Gtf2ird1-/-
and Gtf2ird1-/+
in
the cued but not contextual aspects of the test (Figure 3.7). Both Gtf2ird1-/-
and Gtf2ird1+/-
mice
displayed significantly higher values than wild-type mice during cued fear conditioning,
indicating less freezing in relation to the baseline values and reduced learning (P<0.02). In both
contextual and cued fear conditioning, baselines did not differ significantly between both
Gtf2ird1-targeted genotypes and wild type controls.
157
3.3.7: Resident Intruder: Gtf2ird1-/-
mice are less aggressive and engage in more social
interaction:
Mice were tested for changes in aggressive behaviour using the resident intruder paradigm.
Gtf2ird1+/-
and Gtf2ird1-/-
mice showed a significant decrease in the number of aggressive
interactions towards an unknown intruder mouse compared to wild type mice (P<0.05; Figure
3.8A). Gtf2ird1-/-
mice also showed a significant increase in the duration of time to initiate
aggression with the intruder (P<0.01; Figure 3.8B) and a reduction in the time spent engaging in
aggressive interactions with the intruder (P<0.05; Figure 3.8C). The Gtf2ird1 heterozygous mice
showed similar a trend towards less aggression for these two aspects of the test, but neither
reached statistical significance. Gtf2ird1+/-
and Gtf2ird1-/-
mice spent more time following after
the unknown intruder mouse (P<0.01; Figure 3.8D) and the Gtf2ird1-/-
mice also spent longer
sniffing the intruder (P<0.05; Figure 3.8E).
There was no significant change in tests for submissive behavior (defensive freezing and
active avoidance of partner). The interaction between the Gtf2ird1 test mice and the intruder was
not a result of deficits in olfaction in the mutants, since the time required finding unfamiliar
buried food was not significantly different between the genotypes (WT, 354 sec. +/- 84.7;
Gtf2ird1+/-
, 314.6 sec. +/- 22.7; Gtf2ird1-/-
, 279 sec. +/- 58.2).
158
159
3.3.8: Gtf2ird1-/-
mice have normal visuo-spatial learning and memory:
The hidden platform version of the Morris water maze test has been widely used to
examine alterations in visuo-spatial learning and memory in rats and mice (Morris, 1984; Lipp
and Wolfer, 1998). Performance in the Morris water maze depends on several mechanisms,
from attention, learning and memory, to vision and motor coordination. The cognitive processes
that underlie performance in this test are dependent on many biochemical pathways and is
thought to be dependent on the proper functioning of the hippocampus. Neither Gtf2ird1+/-
nor
Gtf2ird1-/-
mice showed significant difference in their performance compared to wild type
controls (P>0.05) during either the acquisition or the reversal phase (Figure 3.9). In probe tests,
no significant difference was observed between wild type control and Gtf2ird1 mutant mice
either for percentage of time spent in or number of crossings of the target quadrant (Figure 3.9).
160
3.3.9: Gtf2ird1-/-
mice display cerebellar structural abnormalities and muscular deficits
along with deficits in motor co-ordination on the rotorod test:
161
Structural abnormalities consisting of the loss of the parafloccular sulcus were identified
in approximately 80% of Gtf2ird1-/-
mice (Figure 3.10). It was determined that although the
overall size of the paraflocculus was not altered in Gtf2ird1-/-
mice the length of the Purkinje cell
layer, and presumably therefore the number of Purkinje cells, was significantly decreased in
Gtf2ird1-/-
mice. To determine what affect the observed variation in the structure of the
paraflocculus may have on co-ordination and motor function, testing was performed at TCP.
Grip strength analysis determined that Gtf2ird1-/-
mice showed a trend towards a strength
deficiency in the forelimbs (although not statistically significant). When a combined forelimb
and hind limb strength was measured, a significant deficit (P<0.05) was observed (Figure 3.11).
162
163
164
This deficiency was evident from the first trial day of testing and Gtf2ird1-/-
mice showed
no improvement after the second day of testing indicating that there may also be a deficit in
165
motor learning (Figure 3.12). Further test showed that Gtf2ird1-/-
mice did not have problems
with gait or balance issues. It has been previously demonstrated that Gtf2ird1 can act as a
repressor of the muscle specific Troponin I slow promoter, and therefore a loss of functional
TFII-IRD1 protein may result in the decrease of slow twitch (Type I) muscle fibers.
3.3.10: Gtf2ird1-/-
mice show altered serotonin metabolite levels in various brain regions:
Levels of the serotonin metabolite 5-hydroxyindoleacetic acid (5-HIAA) were found to
be significantly elevated in the amygdala (P<0.05), frontal cortex (P<0.05) and parietal cortex
(P<0.05) (Table 3.2) of Gtf2ird1-/-
mice. Increases in 5-HIAA were also seen in the occipital
cortex and striatum in Gtf2ird1-/-
mice although these increases did not reach statistical
significance (P=0.09 and 0.065, respectively). No significant changes were seen for serotonin,
dopamine or its metabolites (DOPAC and HVA) in any of the regions tested.
166
Table 3.2. Serotonin Metabolite 5HIAA Levels are Increased in the Amygdala, Parietal
Cortex and Occipital Cortex
Genotype DA DOPAC HVA 5HT 5HIAA 5HT/5HIAA
Amygdala WT 2110±380 232±33 294±4 966±69 415±18 2.34
KO 1940±240 220±18 264±24 1120±63 509±32* 2.24
Cerebellum WT 28.3±5.3 19.0±5.0 21.8±2.4 458±51 200±13 2.31
KO 21.6±3.9 15.2±1.9 20.3±1.3 398±35 185±18 2.22
Frontal
Cortex
WT 1380±110 182±18 269±8 832±51 234±16 3.98
KO 1480±95 207±28 279 ±9 886±58 297±17* 3.04*
Occipital
Cortex
WT 97.8±15.3 21.0±3.0 32.3±7.7 830±96 321±33 2.77
KO 78.7±11.0 21.5±1.9 25.2±6.2 800±81 370±25 2.22
Parietal Cortex
WT 706±58 77.9±5.8 136±10 736±57 366±29 2.19
KO 595±89 70.4±8.0 117±13 780±45 469±41* 1.71*
Striatum WT 14520±1110 907±54 1240±58 780±33 828±46 0.988
KO 13480±776 973±78 1220±83 783±43 933±59 0.854
Values are represented as mean+/-SEM in pg/mg of tissue. P values represent the results analyzed by two-tailed
Student‘s t test, *P<0.05). DA, dopamine; DOPAC, 3,4-dihydroxyphenylacetic acid; HVA, 3-methoxytyramine;
5HT, serotonin; 5-HIAA, 5-hydroxyindoleacetic acid.
Quantitative PCR analysis was used to identify changes in the expression of serotonin-
related mouse genes including receptors; 5ht1a, 5ht1b, 5ht2a, 5ht2c and monoamine oxidase a
(Maoa) the enzyme responsible for the degradation of serotonin. Areas identified as being
having altered levels of serotonin or metabolites including amygdala, frontal and parietal
cortexes as well as the raphe nucleus. For all genes tested there were no changes in the
amygdala and the frontal cortex. In the parietal cortex, expression of the 5ht1b receptor is
reduced by 30%. In the raphe nucleus, expression of the 5ht1b receptor was increased by 30%.
Expression of the 5ht2a receptor was increased by 20% and expression of the MAOA gene was
increased by 15%. Quantitative PCR analysis was used to measure changes in c-fos expression.
Areas tested included the amygdala, frontal and parietal cortexes as well as the raphe nucleus. In
167
males mice baseline levels of c-fos was reduced by 50% in knockout mice compared to wild
type. Upon exposure to a stress-inducing environment a 60% reduction in the expression of c-
fos was identified in the frontal cortex of knockout mice relative to wild type (Figure 3.13).
3.3.11: Alterations in neuronal activity in Gtf2ird1-/-
mice:
c-Fos immunostaining was performed to look for alterations in brain activity that has
been previously associated with anxiety-related mouse models. In Gtf2ird1-/-
mice, it was
determined that after exposure to a stress-inducing environment (30 minutes in a brightly lit open
field) there was a significant decrease in the number of Fos-IR cells in the pre-limbic and infra-
limbic areas of the frontal cortex as well as the cingulate cortex extending from the frontal to the
168
retrosplenial cortex indicating that this area is less active during stress (Figure 3.14).
169
3.3.12: Serotonin elicits larger outward currents in layer V pyramidal neurons in
Gtf2ird1-/-
mice:
A neurotransmitter that is commonly altered in anxiety related mouse models is serotonin
(5-HT). It had been previously determined that serotonin metabolite levels in the frontal cortex
of Gtf2ird1-/-
were altered, therefore to elucidate the possible mechanism responsible for the
alteration in serotonin levels, patch clamps readings were performed in collaboration with Dr.
Evelyn Lambe.
Experiments were performed blind to genotype in a cohort of Gtf2ird1-/-
(n = 5) and WT
(n = 5) animals. In both groups, bath application of 5-HT (30 µM, 30 s) induced prominent
inhibitory outward currents in voltage clamp that were repeatable on a second application after
washout. The mean outward current was significantly larger in the Gtf2ird1-/-
mice (Figure 3.15
- controls: 20 ± 2.8 pA, n = 45; Gtf2ird1-/-
mice: 34 ± 4.7 pA, n = 36; two-tailed unpaired t test, P
< 0.05). There were no significant differences in the membrane properties of the neurons
between the genotypes. The average membrane potential was -88 ± 1 mV in controls (n=66 cells)
and -86 ± 1 mV in Gtf2ird1-/-
mice (n=63), input resistance was 146 ± 10 MΩ in controls (n =
66) and 144 ± 9 MΩ in Gtf2ird1-/-
(n = 63) and spike amplitude was 77
± 1 mV in controls (n = 66) and 80 ± 1 mV in Gtf2ird1-/-
(n = 63) mice. Therefore, despite
similar baseline properties, 5-HT appears to inhibit layer V output neurons of prefrontal cortex to
a greater extent in Gtf2ird1-/-
mice than wild type controls.
170
171
3.3.13: 5-HT-elicts direct outward currents mediated by 5-HT1A receptor in Gtf2ird1-/-
mice:
To determine if the observed changes in the outward currents were mediated directly by
5-HT receptors located on the recorded cell, 5-HT was added before and after blocking the
voltage-gated sodium channels necessary for action potential dependent neurotransmitter release
with tetrodotoxin (TTX, 2 µM, 10 min). The 5-HT-elicited outward currents were resistant to
TTX, with current amplitudes 99 ± 14% (n = 5) that of currents recorded prior to TTX
application in controls and 98 ± 10% (n = 4) in Gtf2ird1-/-
(Figure 3.16). Paired t tests revealed
that responses were not significantly different before and after TTX application in wild type (P =
NS) or Gtf2ird1-/-
animals (P = NS). These results suggest that the recorded responses are
directly mediated by 5-HT receptors on the layer V neurons.
The different subtypes of serotonin receptors are variably expressed throughout the brain
(Nichols and Nichols, 2008). However, the 5-HT1A receptor subtype is prominently expressed in
the prefrontal cortex where it mediates well-documented inhibitory influences (Araneda and
Andrade, 1991; Béïque et al., 2004; Goodfellow et al., 2009) for regulating anxiety (Gross et al.,
2002; Tauscher et al., 2001; Lanzenberger et al., 2007). The selective 5-HT1A antagonist WAY-
100635 (30 nM, 10 min) was applied to determine whether the observed 5-HT responses were
indeed mediated by the 5-HT1A receptor subtype. As shown in Figure 3.16, the outward currents
elicited by 5-HT (30 µM, 30 s) after pre-incubation with WAY-100635 (30 nM, 10 min) were
almost completely eliminated with 100 ± 0% (n = 4) suppression seen in controls and 99 ± 8% (n
= 7) suppression seen in Gtf2ird1-/-
mice. In both genotypes, matched pair t-test statistics confirm
a significant current reduction in the presence of WAY-100635 (P < 0.05). In layer V pyramidal
172
cells of controls and Gtf2ird1-/-
animals, therefore, the recorded 5-HT responses appear to be
directly mediated by 5-HT1A receptors.
173
3.3.14: Serotonin 5-HT1A outward currents are unchanged in prefrontal layer II/III in
Gtf2ird1-/-
mice:
5-HT has also been shown to exert inhibitory influences on 5-HT1A receptors within layer
II/III cells of the medial prefrontal cortex (Goodfellow et al., 2009). To determine whether these
outward currents were enhanced the Gtf2ird1-/-
mice, 5-HT responses recorded in layer II/III
cells and found to be not significantly different between Gtf2ird1-/-
and WT animals. Following
application of 5-HT (30 µM, 30 seconds), the average inhibitory current recorded in cells from
WT animals was 26 ± 3.2 pA (n = 12 cells) and 29 ± 12 pA in the Gtf2ird1-/-
(n = 9 cells) (P =
NS). Therefore, the larger inhibitory responses elicited by 5-HT in Gtf2ird1-/-
mice is specific to
layer V and not present in layer II/III.
3.3.15: Other inhibitory currents are not enhanced in layer V in Gtf2ird1-/-
mice:
5-HT1A receptors exert their influence through a Gi/o-coupled mechanism. Alterations in
the coupling of 5-HT1A receptors to their downstream effectors in Gtf2ird1-/-
mice might also
result in enhanced currents elicited by other Gi/o-coupled receptors. Layer V pyramidal neurons
are known to also express two other inhibitory Gi/o-coupled receptors: mGluR2/3 (Petralia et al.,
1996; Melendez et al., 2004) and GABAB receptors (Charles et al., 2003). However, the induced
outward currents in layer V pyramidal neurons elicited by mGluR2/3 agonist t-APDC (30 µM, 15
s) and the GABAB agonist baclofen (3 µM, 15 s) were not significantly different between
genotypes suggesting that altered receptor function in the Gtf2ird1-/-
mice may be specific to 5-
HT1A receptors (Figure 3.17). The mGluR2/3 agonist t-APDC elicited inhibitory outward currents
of 21 ± 6.0 pA in WT (n = 6) and 24 ± 7.0 pA in Gtf2ird1-/-
(n = 4) (P = NS) while baclofen
174
induced currents of 55 ± 5.8 pA in controls (n = 6) and 66 ± 8.5 pA in Gtf2ird1-/-
(n = 8) (P =
NS).
175
3.3.16: Spine density in layer V pyramidal cells in Gtf2ird1-/-
mice is unchanged:
Spines density was measured in pyramidal cells in layer V of the medial prefrontal and
somatosensory cortexes. There were no differences between genotypes observed in the spine
density of either basal or apical dendritic spines (Figure 3.18). It should be noted that no
distinction was made on the type of spine (thin, mushroom or stubby) that was recorded. No
distinction was made also in the maturation state of the spine or the shape of the spine neck. All
of these characteristics have been shown to be important to the proper functioning of the
associated synapses (Nimchinsky et al., 2002). The results indicated in Figure 3.18 demonstrate
only that the density of protrusions present of the basal and apical dendrites of neurons located in
layer V of the medial prefrontal and somatosensory cortexes in Gtf2ird1-/-
mice do not differ
significantly from that of wild type mice.
176
177
3.3.17: 5-HT receptor expression is unchanged in the frontal cortex of Gtf2ird1-/-
mice:
It was previously determined that the targeting of Gtf2ird1 results in alterations in
aggression and anxiety possibly resulting from increase in the levels of serotonin (5HT) and its
metabolite 5-HIAA detected in several areas of the brain including the frontal cortex (Table 3.2).
To determine the possible cause of these changes in serotonin levels, qPCR analysis was used to
detect changes in gene expression of genes involved in the metabolism, storage and transport of
serotonin including monoamine oxidase A (MAOA) that is responsible for the conversion of 5HT
to 5-HIAA. No changes were found in the expression levels serotonin receptors 5-HT1A, 5-HT2C,
MAOA, involved in the synthesis of serotonin. Slight but statistically significant alterations in
gene expression were identified for the 5ht1b and 5ht2a receptor in the raphe nucleus with 5ht1b
showing a 30% increase and 5ht2a showing a 20% increase in expression relative to wild type
control mice. The expression of multiple candidate genes whose alteration has been shown to
result in a similar phenotype, were also tested and found not significantly altered in Gtf2ird1-/-
mice. These genes included Gdi1, hRH3 (histamine receptor), BDNF as well as three subunits of
the GABAA receptors (α2, β2 and γ2) (Data not shown).
178
Table 3.3. Expression of Serotonin Receptors in Gtf2ird1-Targeted Mice.
Tissue Receptor Expression relative to WT P-Value
Raphe
Nucleus
5-HT1A 1.09 0.34
5-HT1B 1.38 0.025
5-HT2A 1.22 0.012
5-HT2C 1.19 0.16
MAOA 1.13 0.029
Amygdala
5-HT1A 0.92 0.32
5-HT1B 0.95 0.62
5-HT2A 1.09 0.37
5-HT2C 1.05 0.66
MAOA 0.93 0.050
Parietal
Cortex
5-HT1A 0.85 0.064
5-HT1B 0.74 0.027
5-HT2A 1.03 0.36
5-HT2C 1.21 0.18
MAOA 0.97 0.29
Frontal
Cortex
5-HT1A 1.13 0.26
5-HT1B 0.96 0.76
5-HT2A 1.12 0.30
5-HT2C 1.09 0.31
MAOA 0.92 0.37
179
3.3.18: Identification of stress-induced changes in gene expression in Gtf2ird1-/-
mice using
microarray analysis:
Given Gtf2ird1’s known role as a transcription factor, wild type and Gtf2ird1 knockout
mice were again exposed to a brightly lit open field for 30 minutes, and a gene expression
microarray analysis was performed. Some of the genes identified whose expression was
determined to be at least 2-fold increased or decreased are listed it Table 3.3.
Table 3.4. Microarray Results for Genes Whose Expression was Increased or Decreased
Two-Fold or Greater.
Gene ID Description Fold Change Adjusted P-Value
Increased Expression in Gtf2ird1-targeted mice (relative to wild type)
Csrp1 cysteine and glycine-rich protein 1 4.5 0.00056
Psmc3ip proteasome (prosome, macropain) 26S
subunit, ATPase 3, interacting protein 3.7 9.8x10
-9
LOC100044862 similar to Fbxl3 protein 3.1 2.8x10-9
2610528E23RIK Unknown 2.7 5.5x10-13
Prkag2 protein kinase, AMP-activated, gamma
2 2.6 0.00011
Egr2 early growth response 2 2.4 0.0025
Arc activity-regulated cytoskeleton-
associated protein 2.2 0.0016
Decreased expression in Gtf2ird1-targeted mice (relative to wild type)
Serpin1 Serine protease inhibitor 1 0.12 4.0x10-14
Ttc27 tetratricopeptide repeat domain 27 0.34 0.011
LOC677448 similar to actin, Actl8 0.35 0.005
Trpc4 Transient receptor potential cation
channel, subfamily C, member 4 0.37 2.0x10
-12
180
Gene ID Description Fold Change Adjusted P-Value
Actl6b actin-like 6B (Baf53b) 0.38 8.4x10-10
B130052F17RIK Unknown 0.41 0.038
Zfp68 Zinc finger protein 68 0.47 0.016
The expression of multiple genes was identified as being increased or decreased although
to date, only one gene (Trpc4) has been validated using quantitative PCR. It was shown that the
expression of Trpc4 was reduced by 50% in Gtf2ird1-/-
mice (Figure 3.19).
181
182
3.4: Conclusion and Discussion:
Williams-Beuren syndrome is a complex disorder characterized by distinctive physical,
cognitive and behavioral abnormalities including gregarious personalities, mental retardation,
learning difficulties, visuo-spatial problems, hypersensitivity to certain sounds, attention deficit,
inappropriate friendliness and lack of normal risk assessment (Mervis and Klein-Tasman, 2000;
Mervis et al., 2000). Although at least 26 genes lie within the commonly deleted region, to date
only elastin has been unequivocally implicated in any aspect of the disorder, namely the
cardiovascular abnormalities (Curran et al., 1993). This is at least partly due to the small
numbers and phenotypic variability of individuals identified with atypical deletions of the region,
thereby making genotype-phenotype correlation difficult. Since even in these individuals
multiple genes are often deleted it is not possible to definitively determine the contribution of
specific genes to the WBS phenotype. For this reason, mouse models have become a powerful
tool for the elucidation of the role of specific genes in the complex WBS phenotype. Mouse
models for multiple WBS genes exist but none appear to recapitulate the disorder providing
evidence that WBS is a contiguous gene disorder and that the resulting phenotype is likely the
consequence of the loss of multiple genes from within the WBS critical region.
In this work it has been demonstrated that alterations in the expression of Gtf2ird1 in
mice results in growth deficiency, and altered behaviors related to both innate and learned fear
that have not been reported in previous mouse models (Crackower et al. 2003; Fujiwara et al.
2006; Hoogenraad et al. 2002; Li et al. 1998; Meng et al. 2002; Tassabehji et al., 2005; van
Hagen et al., 2007; Zhao et al., 2005). These include increased sociability, decreased aggression
and natural fear response, along with deficits in learning and memory, similar to changes
183
observed in WBS, suggesting that the haploinsufficiency of GTF2IRD1 may contribute to the
physical, behavioral and cognitive deficits associated with this disorder. The distinctive
behavioral profile is one of the defining characteristics of WBS and insight into the genetic basis
of this aspect of the phenotype will be critical not only for understanding the molecular basis of
WBS, but also the possible contribution to normal human behavior.
3.4.1: Gtf2ird1+/-
and Gtf2ird1-/-
mice show mild growth retardation:
Growth deficiency has long been associated with WBS, with mean adult height
corresponding to the third percentile in both sexes (Pankau et al., 1992). Significant growth
deficiencies were observed in both males and female Gtf2ird1-deficient mice with decreases seen
for body weight (figure 3.4). Similar data was recently reported in another mouse model with a
disruption of Gtf2ird1 caused by transgene insertion, where mice homozygous for the insertion
showed weights between 9.4% and 13.9% lower than those of wild-type littermates (Tassabehji
et al., 2005). We also observed significant growth retardation in adult male Gtf2ird1+/-
mice
indicating that hemizygosity for Gtf2ird1 is sufficient for a disruption of normal growth
consistent with that seen in WBS. Similar results were also seen in a mouse deficient for another
gene from the WBS deletion, Clip2 (Cyln2) (Hoogenraad et al., 2002). Mild growth retardation
was seen in null mice for both sexes and significant growth retardation was observed in female
Clip2+/-
mice. Taken together, these results raise the possibility that the growth deficiency seen
in individuals with WBS results from the additive hemizygosity for Clip2 and Gtf2ird1 although
Clip2 levels were shown to be normal in our Gtf2ird1 mutant mice.
184
Another characteristic of WBS is the distinctive dysmorphic facial features that are
highly penetrant in all individuals with the common WBS deletion. Although initial analysis
failed to identify any differences in jaw alignment in the Gtf2ird1 homozygous mice generated in
this study, a careful quantitative analysis may be required to identify possible subtle
abnormalities that may exist. Previously craniofacial abnormalities, including a proportion of
homozygous mice that were observed to have misaligned jaws, were reported in a Gtf2ird1
mutant generated by random insertion of a c-myc transgene that deleted the first untranslated
exon of Gtf2ird1 (Tassabehji et al. 2005). In this work, a patient (HR) was also identified that
contained an atypically small deletion of the WBS region that spared GTF2I. This patient was
reported to have a milder facial dysmorphism than commonly seen in WBS. While WBS
individuals exhibit differing degrees of severity in craniofacial dysmorphology, thought to be a
result of genetic background, the milder dysmorphic features seen in HR may indicate that the
facial features characteristic of WBS may result from the loss of multiple genes within the WBS
region.
In a recently published report, bitemporal narrowing was identified in a small subset of
Gtf2ird1 gene trap mice (Enkhmandakh et al., 2009). Additionally, hydrocephaly, kyphosis and
hypoplasia of the mandible was also noted, none of which was identified in the present model. It
should be noted that the targeting of Gtf2ird1 was also different between these two models.
While the removal of the first coding exon in the present model does leave the possibility of an
alternate transcript, translation of the remaining coding sequence will likely result in a out-of-
frame nonsense protein or a truncated TFII-IRD1 missing the first I-repeat and the leucine zipper
motifs known to be essential for protein-protein interactions and DNA binding respectively
(Jackson et al., 2005). In the gene trap model, the trapping vector integrates near the 3‘ end of
185
the gene and although the rationale for this is that the resulting protein would lack the nuclear
localization signal to translocate to the nucleus, it would produce an almost full length protein
with all the functional domains necessary for protein-protein interactions. Since TFII-IRD1 is
also known to counter-regulate TFII-I (Jackson et al., 2005) and given TFII-I‘s known
cytoplasmic function (Tussié-Luna et al., 2001; Hakre et al., 2006), it is possible that the TFII-
IRD1/LacZ fusion protein produced may disrupt proper TFII-I function. Consistent with this,
the report also includes a description of a Gtf2i gene-trapped mouse model and although the two
genes are differentially expressed spatially and temporally, the resulting phenotype is highly
similar between the two models.
Craniofacial abnormalities were also observed in WBS deletion mouse model containing
overlapping deletions consisting of a proximal region (Gtf2i to Limk1) and a distal region (Limk1
to Trim50) (Li et al., 2009). Interestingly, the most striking abnormalities, including a
shortening of the skull, were seen in the mice carrying the overlapping deletion of the entire
WBS region and mice carrying a deletion of the distal portion of the region had similar but less
significant changes. However, male mice carrying a deletion of the just the proximal region
(including a hemizygous deletion of Gtf2ird1) displayed an increase in the overall length of the
skull and female mice showed no significant difference in skull length. Although the mice
studied were only hemizygously deleted for Gtf2ird1, it appears likely that it is the
haploinsufficiency of genes within the distal portion of the deletion (LIMK1 to TRIM50) that
may primarily contribute to the craniofacial abnormalities seen in individuals with WBS.
This apparent phenotypic variability may also be due to the influence of additional genes
that are involved in the pathways that regulated craniofacial development. It should be noted that
the mice generated in this study are maintained on a CD1 heterogeneous outbred genetic
186
background that most closely mimics the human population, whereas the other mouse models
were on a predominantly homogeneous inbred C57BL/6 background.
3.4.2: Changes in behavior including aggression and anxiety and sociability in Gtf2ird1-/-
mice:
Although Gtf2ird1 mouse models have previously been reported (Durkin et al., 2003:
Tassabehji et al., 2005; van Hagen et al., 2007; Enkhmandakh et al., 2009), no in-depth
cognitive or behavioral testing was performed. Given the breadth of behavioral and cognitive
impairment in WBS, the mice generated in this study were subjected to different paradigms
aimed at probing both natural behaviors and cognitive abilities in order to try to address the role
of any gene in the WBS phenotype.
Gtf2ird1-/-
mice displayed a decrease in anxiety, as evidenced by their performance in the
elevated plus maze apparatus, in an apparent direct contrast to people with WBS, the majority of
whom have either generalized anxiety disorder or simple phobias (Mervis and Klein-Tasman,
2000; Dykens, 2003). The decrease in anxiety seen in the mice was somewhat unexpected,
however, it is likely that the elevated plus maze is not testing the same physiological response as
that seen in people with WBS, who tend to have simple phobias based around specific fears,
often related to social situations or to hypersensitivity to particular sounds (Blomberg et al.,
2006). Anxiety has been described as a future oriented emotion connected to worry and dwelling,
which may not be the same as the distinct alarm signal connected to a specific object or situation
that seems to be more applicable to mouse behavior (Barlow, 2002). Alternatively, it could be
that the anxiety state of both the mice and humans are altered by hemizygosity for Gtf2ird1, but
in opposite directions.
187
Perhaps the most intriguing behavior noted in mice with disruption of Gtf2ird1 was the
significantly altered social interactions as well as changes in aggressive behavior. Both
heterozygous and homozygous mutants showed less aggression towards, and more interest in,
unfamiliar ―intruder‖ mice (Figure 3.8). People with WBS almost universally exhibit over-
friendliness with inappropriate social boundaries and frequently approach and/or initiate social
interactions with strangers (Doyle et al., 2004; Klein-Tasman and Mervis, 2003). The phenotype
seen in the Gtf2ird1-targeted mice is intriguingly reminiscent of the hypersociability and
disinhibition seen in individuals with WBS. The exact neural mechanisms regulating social
behavior are unknown, but the amygdala is known to play a primary role, since lesions of this
area of the brain in non-human primates result in impaired or inappropriate social function
(Prather et al., 2001; Amaral, 2002). Recent neuroimaging studies of people with WBS using
functional Magnetic Resonance Imaging (fMRI) revealed reduced activation of the amygdala
when processing images of threatening faces, suggesting an underlying dysfunction (Meyer-
Lindenberg et al., 2005). The molecular mechanisms governing the perception of and reaction to
danger and threatening situations have also been linked to the amygdala. Given its role as a
transcription factor it will be interesting to investigate in the Gtf2ird1 mice, genes that have been
implicated in fear and social response such as oxytocin has been firmly established as central
mediator of social behavior and stathmin, a molecule highly expressed in this region, the has
recently been implicated in both innate and learned fear (Winslow and Insel, 2002; Shumyatsky
et al., 2005) Although not altered in the microarray and expression analysis, further refinement
of the experimental design will likely be necessary to elucidate the genes that contribute to the
fear and anxiety-related phenotype.
188
The alterations in aggressive and social behavior seen in the Gtf2ird1-/-
mice suggests that
this gene plays an essential role in the regulation of aggression and normal social interaction in
rodents, possibly in pathways that influence transcription of the molecules mentioned above.
Interestingly, although almost all individuals with WBS exhibit the same cognitive profile,
individuals have been identified with smaller than normal deletions of the WBS region, leaving
genes at the distal end intact, who do not exhibit hypersociability (Tassabehji et al., 2005;
Ferrero et al., 2010). In one of these individuals, the deletion spanned all of the commonly
deleted genes except GTF2I, suggesting that in humans the WBS behavioral profile may be the
product of the combinatorial effect of hemizygosity for both GTF2IRD1 and GTF2I, or perhaps
other genes from within the commonly deleted interval.
The finding that Gtf2ird1-/-
mice exhibit low anxiety and increased interest in other mice
is highly important, especially since prior to the characterization of this mouse, no other mouse
model exhibited behaviors akin to the hypersociability seen in WBS. However, Gtf2ird1-/-
mice
exhibit decreased anxiety in tests for both social (resident intruder test) and non-social (elevated
plus maze task) anxiety, in contrast to individuals with WBS, who despite their low social
anxiety tend to display a high degree of non-social anxiety with approximately half of patients
suffering from specific phobias (Dykens, 2003; Leyfer et al., 2006). Alternatively, it is possible
that the elevated plus maze is not testing the same physiological response as that seen in people
with WBS. The representation of the novel object normally elicits fear response in animals or
neophobia. However, in this situation Gtf2ird1-/-
mice expressed an enhanced interest in the
novel object in the home cage, in part confirming their less anxious state observed in the plus-
maze. It is also possible that the lack of fear exhibited by these mice is masking any potential
189
anxiety elicited by being in the plus maze. The administration of anxiogenics before testing in
the plus maze may help distinguish between lack of fear response and reduced anxiety.
3.4.3: Gtf2ird1-/-
mice display deficits in muscle function:
Gtf2ird1 was originally identified as being able to modulate the expression of the muscle
type specific troponin 1 slow gene (O‘Mahoney et al., 1998). Mice presented in this study show
significant deficits in the fix-speed version of the rotorod test indicating a possible deficit in the
motor co-ordination (Figure 3.12). Interestingly, structural abnormalities were also identified in
the length (and presumably numbers) of the Purkinje cell layer in a large number of Gtf2ird1-/-
mice. However, results from the evaluation of grip strength (Figure 3.11) indicate that the
deficits seen in rotorod result may be due to a decrease in muscle function rather than difficulty
in motor co-ordination. When fore and hind limbs are evaluated together, Gtf2ird1-/-
mice show a
highly significant (P<0.01) decrease in grip strength (force). It is therefore possible that the poor
performance was due to the inability of the mice to grip the rotating rod due to decreased muscle
strength and not due to deficits in neurosensory motor function. Although there is not a
substantial decrease in grip strength observed in the Gtf2ird1-/-
mice (<20%), the decrease in grip
strength and deficits in rotorod performance are consistent with previously reported mouse
models of motor disorders including the R6/2 mouse model of Huntington‘s disease (Benn et al.,
2009).
These findings of changes to muscle function and motor co-ordination conflict with the
evaluation of the existing single gene Gtf2ird1 mouse model. Insertional mutant mice generated
by Durkin et al., (2001) and evaluated by van Hagen et al (2007) and were found to perform
190
better than wild type mice on the accelerating rotorod test while mice homozygously deleted for
Clip2 performed very poorly, thereby implicating Clip2 in the motor co-ordination deficits seen
in WBS. Consistent with these findings, a ―proximal deletion‖ mouse model hemizygously
deleted for the genes between Limk1 and Gtf2i (including Gtf2ird1and Clip2) was shown to
display motor deficits (Li et al., 2009). However that in the same report, a mouse carrying a
hemizygous deletion of the syntenic region of the commonly deleted WBS region in humans
(P/D) resulted in a greater deficit in motor function, indicating that genes telomeric to Limk1 may
also contribute to the motor deficits seen in WBS. It should be noted, that the mouse carrying
the deletion of the entire region was also homozygously deleted for Limk1, and since no motor
function analysis was performed on the existing single gene Limk1 knockout mouse model
(Meng et al., 2002), it cannot be ruled out that the increase in motor function deficits in P/D mice
may have resulted from the homozygous loss of Limk1. Staining of muscle sections from wild
type and Gtf2ird1-/-
mice will be necessary to look for alterations in the relative distribution of
slow and fast twitch fibers that may contribute to the deficits in muscle function observed in
Gtf2ird1-/-
mice.
As with other quantitative traits, performance on motor function tests is likely
significantly influence of various genetic factors. The genetic background of the Gtf2ird1
model presented in this study is different from those presented in previous reports. The mice in
this report are predominantly on an out-bred CD-1 background while the previously reported
mice are on inbred C57/Bl5 (Durkin et al., 2001; van Hagen et al., 2007) or a mixed C57/Bl6 –
129 background. Since genetic background has been shown to contribute to variability in motor
function (Crawley, 1999) the difference in performance on motor function task may also be
influenced by strain-specific modifier genes.
191
3.4.4: Gtf2ird1-/-
mice have altered fear-based learning, but normal spatial learning and
memory:
A severe deficits in spatial memory is a defining characteristic of WBS however, it
appears that a decrease in the expression of Gtf2ird1 alone is not sufficient to produce clear
deficits in hippocampal-based learning tasks, such as contextual fear conditioning and the Morris
water maze. Gtf2ird1-/-
mice did require significantly more time to find in the hidden platform on
the first two days of testing in the water maze, however no differences were observed beyond
day 2 (Figure 3.9). There were also no differences during the reversal phase. Further evidence
that hippocampal functioning is intact in Gtf2ird1-/-
mice comes from electrophysiological
recordings from the CA1 region of the hippocampus, performed by Zhengping Jia at the Hospital
for Sick Children, which showed normal basal synaptic activity and long-term potentiation.
Gtf2ird1-/-
mice also had normal response in contextual-based learning suggesting that
hippocampal function is intact. Gtf2ird1-/-
mice did however have difficulty learning to associate
the tone with foot shock during cued-based learning tests possibly indicating that amygdala-
dependent fear learning may be impaired (Phillips and LeDoux, 1992).
To date, no single gene mouse model has been shown to result in clear spatial learning
deficits. Mice lacking Clip2 displayed impaired reversal learning but there were no differences
between genotypes during the initial hidden stages. As with the Gtf2ird1 mouse model, the
observed difference is only present in homozygous deleted mice with no significant differences
seen in the heterozygotes. It is intriguing to postulate that the visuo-spatial deficits seen in WBS
are the result of a combinatorial decrease in expression of multiple genes within the commonly
deleted region.
192
Individuals with unusual deletions of 7q11.23 supporting the role of the GTF2I gene
family in spatial learning have been recently reported. In one individual, a deletion spanning the
commonly deleted WBS region but sparing GTF2I resulted in visual spatial impairment but not
to the degree seen in people with WBS (Tassabehji et al., 2005), whereas in a second individual
a deletion that removed both GTF2IRD1 and GTF2I, but none of the other commonly deleted
genes showed weakness in visuo-spatial skills equivalent to that seen in people with WBS
(Edelmann et al., 2007). Although the cases of atypically small deletions of the WBS region are
few in numbers, there is increasing evidence that the GTF2I gene family play a critical role in the
cognitive and visual spatial deficits that are a hallmark of WBS. van Hagen et al (2007)
identified a teenage male with the common centromeric breakpoint but with a telomeric
breakpoint in RFC2, sparing CLIP2 and the GTF2I gene family. This individual displayed
superior cognitive abilities, including visual-spatial performance. Recently, two multi-
generational families have been identified with deletions spanning from VPS37D to RFC2 in one
family and CLDN3 to GTF2IRD1 in the other. In both families, GTF2I is not deleted and the
affected individuals display normal cognitve and visual spatial skills (Antonell et al., 2009). A
patient has also recently been identified by Ferrero et al., (2010) as possessing a deletion from
BAZ1B to CLIP2 and consistent with the previous families, this patient had a normal IQ and
considerably greater visual spatial abilities then that typically seen in WBS.
3.4.5: Gtf2ird1-/-
mice show altered serotonin metabolite levels in the brain:
Since it is known that neurotransmitters play a central role in fear and anxiety-related
phenotypes, an examination of neurotransmitter levels was performed. Although overall
serotonin levels were unchanged in Gtf2ird1-/-
mice relative to wild type in all areas analysed, the
193
serotonin metabolite 5HIAA was found to be increased in several brains regions including the
frontal cortex. The neurotransmitter serotonin has previously been shown to play a central role
in emotional behaviour, as evidenced by brain serotonergic abnormalities in human emotional
disorders and the therapeutic efficacy of drugs targeting this system (Ballenger, 1999).
Decreases in serotonin levels shown to cause an increase in aggressive behavior in rodents
(Vergnes et al., 1986) as well as depression in humans (Ogilvie et al., 1996). In rodents,
administration of a 5-HT1B receptor agonist was shown to reduce aggression (De Almeida et al.,
2006) while alteration of 5-HT1A and 5-HT2A receptor density and binding have also been linked
to changes in aggression (Caramaschi et al., 2007; Schiller et al., 2006). Although no changes in
the levels of serotonin receptor expression were observed in the frontal cortex of Gtf2ird1-/-
mice,
a significant increase in the levels of 5ht1b mRNA was identified in midbrain samples containing
the raphe nucleus where the protein functions as an autoreceptor (Table 3.2). It has been
demonstrated that increased 5-HT1B autoreceptor expression in the dorsal raphe nucleus results in
reduced anxiety in unstressed animals (Clark et al., 2004). Increases in the expression of 5ht2a
and MoaA mRNA‘s were also identified in midbrain samples containing the raphe nucleus.
Although these changes in gene expression have yet to be confirmed at the protein level,
alteration in the expression levels of these genes would be consistent with the phenotypic
changes seen in Gtf2ird1-/-
mice.
Interestingly, although the tissue serotonin content was not significantly increased in any
of the regions tested overall, there was a significant increase of the serotonin metabolite 5-HIAA
in the frontal and parietal cortices and the amygdala in the Gtf2ird1-/-
mice suggesting an
alteration in post-synaptic serotonin turnover rather than an overall increase in serotonin
production. It has been demonstrated through the use of pharmacological agents that the
194
elevation of mood usually involves one of three mechanisms. i) the increase of serotonin levels
through the administration of the serotonin precursor 5-hydoxytryptophan, 5-HTP, ii) the
inhibition of MAOA leading to increased amounts of stored serotonin, or iii) the blocking of the
reuptake of serotonin into the pre-synaptic nerve terminal. The increase in 5-HIAA levels
without a corresponding increase in serotonin levels indicate that the behavior phenotype seen in
Gtf2ird1-targeted mice is due to an increased release of serotonin rather than an overall increase
in serotonin production levels. Further experiments are needed to determine the mechanism by
which serotonergic pathways are altered in the Gtf2ird1-targeted mice.
3.4.6: Gtf2ird1-/-
mice show altered neuronal activity:
The changes in behavior and alterations of the serotonin levels in multiple brain regions
provide evidence that neuronal activity is affected in Gtf2ird1-/-
mice. In particular, it appears
that the frontal cortex, long known to be critical in the regulation of fear and anxiety related
behaviours, is not functioning normally. The interaction between the frontal cortex and the
amygdala is thought be crucial for making appropriate social judgments (Davidson et al., 2000)
with lesions of the OFC in humans associated with social dis-inhibition, and disturbance of the
functional interaction between the OFC and amygdala in subjects with WBS thought to be
contributing to social dis-inhibition, reduced reactivity to social cues and an increased tendency
to approach strangers (Aramal, 2002). Brain activity was assessed in the amygdala and frontal
cortex in our mouse model using the expression of the immediate-early transcription factor gene,
c-Fos, The Gtf2ird1-/-
mice showed marked differences in their level of anxiety in this test, with
a 60% reduction in the expression of c-Fos was observed in the frontal cortex of Gtf2ird1-/-
mice
relative to wild-type mice. These findings were supported by protein immunostaining, showing
195
decreases in Fos immunoreactivity (Fos-IR) in the medial prefrontal cortex, including the
prelimbic and infralimbic cortex, and the cingulate cortex (Figure 3.14). The alterations in Fos
protein expression suggest that there are significant differences in activation of the prefrontal
cortex in response to fear/stress in our mouse model relative to wild type animals, consistent with
the regionally reduced activity seen in subjects with WBS (Meyer-Lindenberg et al., 2005).
Although the decrease in neural activity correlates well with fMRI studies in human WBS
patients, the mechanism underlying this change is still unknown. Golgi-Cox staining of
pyramidal cells from the medial prefrontal and somatosensory cortexes failed to detect any
differences between genotypes in the density of basal or apical dendritic spines, indicating that
the decreases in neuronl activity detected using Fos-IR (Figure 3.18) is not the result of a
decreases in the number of synapses within these specific regions.
3.4.7: Implications of elevated 5-HT1A currents in Gtf2ird1-/-
mice:
The low anxiety, decreased aggression and high sociability phenotype exhibited by the
Gtf2ird1-/-
mice is reminiscent of behaviours observed in individuals with WBS. The alterations
in serotonin levels and decreased neuronal activity in cortical regions point to an alteration in
normal brain function but do not provide a mechanism to explain the behaviours seen in the
Gtf2ird1 -/-
mice. To investigate how the function of major output neurons in the prefrontal
cortex in mice lacking the general transcription factor Gtf2ird1 may be affected, whole cell
recordings were used to identify enhanced outward currents, upon application of serotonin, in
layer V prefrontal cortex pyramidal cells of the Gtf2ird1 -/-
mice compared to their wild-type
controls. The use of pharmacological agents such as TTX to suppress network activity and the
196
antagonist WAY-100635 demonstrated that the enhanced outward current was mediated directly
by postsynaptic 5HT1A receptors on the recorded neurons in the Gtf2ird1-/-
mice. The observed
enhancement of an inhibitory current is specific to layer V as outward currents are not enhanced
in layer II/III pyramidal neurons of the Gtf2ird1-/-
mice. The increased inhibitory current is also
specific to the 5-HT1A receptor subtype as inhibitory currents mediated by other Gi/o-coupled
mGluR2/3 and GABAB receptors in layer V pyramidal neurons remain unchanged upon
application of the agonists APDC and Baclofen respectively raising important questions about
the mechanism that underlies the enhanced 5-HT1A currents in layer V and the consequences of
this current for prefrontal functional connectivity in this mouse characterized by a low anxiety
phenotype. It has been previously demonstrated that elevated 5-HT1A receptor function is
inversely correlated with anxiety with mice lacking the 5-HT1A receptor exhibiting higher levels
of anxiety (Parks et al, 1998; Heisler et al., 1998; Ramboz et al., 1998) while decreased anxiety
is observed in mice that over express the 5-HT1A receptor (Kusserow, 2004). In preliminary
expression studies, there have been no identified changes in 5-HT1A expression levels in the
frontal cortex of Gtf2ird1-/-
mice using real-time PCR, western blotting or immunohistochemistry
although the identification of better antibodies may be necessary to verify that protein expression
levels are not altered between Gtf2ird1-/-
mice and wild-type controls.
The inhibitory effects of serotonin on layer V pyramidal neurons may have profound
effects on brain function since these cells are considered the primary output neurons of the
prefrontal cortex sending projections to the amygdala, hypothalamus and striatum, and are the
only source of cortical feedback to several key neuromodulatory nuclei including the dorsal
raphe nucleus which receives its only cortical projection from layer V pyramidal cells of the
prefrontal cortex (Gonçalves et al., 2009; Gabbott et al., 2005; Peyron et al., 1998; Vertes et al.,
197
2004). Layer V pyramidal neurons provide serotonergic neurons of the raphe with negative
feedback (Hajós et al., 1998; Celada et al., 2001; Jankowski and Sesack, 2004) and therefore,
inhibition of layer V neurons would result in an increase activity of the raphe nucleus resulting in
an increase in serotonin release in the prefrontal cortex. Consistent with this, HPLC findings in
the Gtf2ird1-/-
mice suggest that levels of the serotonin metabolite 5-HIAA are significantly
increased in the prefrontal cortex and amygdala of Gtf2ird1-/-
mice while the overall serotonin
level remains unchanged.
The dense and reciprocal connections between the prefrontal cortex and the amygdala
(Ghashghaei and Barbas, 2002; Gabbott et al., 2005) are of great interest in the investigation of
neural mechanisms underlying the WBS phenotype because of their known role in anxiety and
social cognition, with neuroimaging studies implicating the prefrontal cortex in anxiety both in
healthy individuals (Tillfors, 2001; Liotti et al., 2000; Chua et al., 1999) as well as individuals
with affective disorders (Lanzenberger, 2005; Tillfors et al., 2001; Osuch et al., 2000).
Interactions of the prefrontal cortex and amygdala have been also shown to play a critical role in
social cognition (Prather et al., 2001; Amaral, 2002; Quirk et al., 2003; Morgan et al., 1993) and
a disconnect between the prefrontal cortex and the amygdala has been identified in WBS
(Meyer-Lindenberg et al., 2005). While the cellular mechanisms underlying this disconnect
remains unknown, an increased inhibition of the prefrontal layer V pyramidal neurons may
contribute to this uncoupling.
There have been only very few transcriptional targets of the TFII-IRD1 identified, and
none in the brain (O‘Mahoney et al., 1998; Jackson et al., 2005; Polly et al., 2003). Putative
DNA binding sequences have been identified for TFII-IRD1 (Thompson et al., 2007; Lazebnik
et al., 2008), however none of the genes evaluated in this study were determined to contain
198
known TFII-IRD1 binding sequences. Gtf2ird1 is expressed throughout the developing embryo
(Palmer et al., 2007); therefore it is possible that the anxiety-related behaviors may result from
the loss of TFII-IRD1 indirectly through alterations in brain structure and function. However,
since the expression of the TFII-IRD1-LacZ fusion protein is predominantly in layer V of the
adult cortex from which single cell recordings were taken (see Fig. 4.8 in Chapter 4), this
suggests that the loss of TFII-IRD1 may exert its effect at the cellular level. Differences in 5-
HT1A outward currents observed in layer V pyramidal neurons likely do not result from enhanced
expression of the receptor since no difference in prefrontal 5-HT1A receptor mRNA was
observed.
Since the inhibitory actions of 5-HT1A receptors are mainly mediated by increasing
potassium conductance via Gi/o-protein linked inwardly rectifying potassium (GIRK) channel
activation (Innis et al., 1988; Penington et al.,, 1993), the enhanced 5-HT1A-mediated responses
could result from downstream changes such as alteration in the activation of Gi/o -protein linked
potassium channel that share common pathways with other Gi/o protein coupled receptors. If
responses mediated by these receptors were also enhanced, altered function of downstream
effectors shared by all the receptors are likely at play in mediating these larger currents. There
were no alteration in the function of two other inhibitory Gi/o-coupled receptors, the group II
metabotropic glutamate (mGluR2/3) and GABAB receptors (Innis et al., 1988; Andrade et al.,
1986), suggesting that the mechanisms underlying increased 5-HT1A-mediated inhibitory
responses are specific to the 5HT1A receptor.
There is evidence that suggests that people with WBS are hyper-sensitive to selective
serotonin reuptake inhibitors (SSRIs) commonly prescribed treatment for non-social anxiety
(Cherniske et al., 2004; Prober, 2006). Adverse effects such as further dis-inhibition have been
199
associated with even standard doses of these medicines (Cherniske et al., 2004). The down
regulation 5-HT1A autoreceptor function within the dorsal raphe upon long-term administration
of SSRIs is well-known, but recently a pronounced enhancement of the function of prefrontal 5-
HT1A receptors has also been identified (Moulin-Sallanon et al., 2009) and may provide further
insight into a possible cellular mechanism in the prefrontal cortex contributing to the behaviors
of individuals with WBS.
3.4.8: Altered stress-induced gene expression in the frontal cortex of Gtf2ird1-/-
mice:
In an effort to further identify genes whose regulation may be altered by the loss of
Gtf2ird1, an expression microarray analysis was performed on frontal cortex tissue obtained
from animals that had been exposed to a stressful environment. Multiple genes were identified
whose expression was either increased or decreased by a factor of two or greater. These
included the activity-regulated cytoskeleton-associated protein (ARC) which regulates the
function of AMPA receptors (Liu et al., 2000); Serpini1, whose protein product neurosperin, a
serine protease inhibitor, is expressed in the late stages of neurogenesis during the process of
synapse formation (Kreuger et al., 1997) and Trpc4, a member of a family of receptor-activated
non-selective calcium permeate cation channel operated by a phosphatidylinositol second
messenger system activated by G-protein coupled receptors (Freichel et al., 2001). Further
analysis including western blotting and immunohistochemistry will be necessary to determine if
the alteration determined by microarray analysis translates into changes at the protein levels.
There are commercially available antibodies for all three proteins however to date only TRPC4
has been analysed. Interestingly, although Trpc4 mRNA levels were shown by real time PCR to
be reduced about 30% in the frontal cortices of Gtf2ird1-/-
mice, western blot analysis shows that
200
more significant reduction in TRPC4 protein may exist in these mice (Figure 3.19). Trpc4 is an
ideal candidate gene for involvement in the observed phenotype of the Gtf2ird1 mouse model.
TRPC4 was originally characterised due to its structural similarities to ion channels absent in
transient receptor potential (TRP) mutants identified in Drosophila where the trp gene was
involved in the light activated depolarization of photo-receptor cells through a pathway
consisting of rhodopsin, a Gq-like G protein and phospholipase C (PLC) (Hardie and Minke,
1992). To date the majority of work elucidating the function of TRPC4 concerns its role in store-
operated Ca2+
currents in endothelium-mediated vascular smooth muscle relaxation (Freichel et
al., 2001). Initially the signalling pathways for the activation of TRPC channels was thought to
involve Gq proteins activating PLC (Lee et al., 2003) but recent studies have shown that TRPC4
can also be activated by Gi/o proteins. (Jeon et al., 2008). Since 5HT1A receptors are coupled to
PLC through Gi/o proteins, this may provide the mechanism for the alterations in 5HT1A
signalling (a Gi/o -protein coupled receptor) in Gtf2ird1-/-
mice. Expression studies have also
demonstrated that TRPC4 mRNA is highly expressed in the adult rat frontal cortex, including the
infralimbic and prelimbic cortices (Fowler et al., 2007), areas identified as having altered
neuronal activity and 5HT1A receptor activity.
Mouse models with multiple gene deletions will go some way to elucidating this and will
be very helpful in studying the interplay between different genes within the WBS deletion. The
similarity in the behavioral phenotype of the Gtf2ird1-/-
mice and people with WBS presents an
opportunity to identify downstream genes and pathways that are essential for proper
development and maintenance of certain aspects of human behavior. The Gtf2ird1 mouse model
allows us to study how the loss of one of the genes in the WBS critical region can alter
neurophysiology leading to enhanced inhibitory 5-HT currents in the prefrontal cortex. These
201
mice provide the basis for manipulations not possible in humans and may help guide future
pharmacological and functional human imaging studies in WBS and provide insight into
alternative therapeutic targets to help restore normal prefrontal excitability.
202
3.5: References:
Achenbach TM, Conners CK, Quay HC, Verhulst FC, and Howell CT. (1989) Replication of
empirically derived syndromes as a basis for taxonomy of child/adolescent
psychopathology. Journal of Abnormal Child Psychology. 17:299–323.
Adolphs, R. (2003) Cognitive neuroscience of human social behaviour. Nature Review
Neuroscience. 4:165-178.
Alberti A, Romano C, Falco M, Calì F, Schinocca P, Galesi O, Spalletta A, Di Benedetto D, and
Fichera M. (2007) 1.5 Mb de novo 22q11.21 microduplication in a patient with cognitive
deficits and dysmorphic facial features. Clinical Genetics. 71:177-182.
Amaral DG. (2002) The primate amygdala and the neurobiology of social behavior: implications
for understanding social anxiety. Biological Psychiatry. 51:11-17.
Anderson JC, Williams S, McGee R, and Silva PA. (1987) DSM-III disorders in preadolescent
children: prevalence in a large sample from the general population. Archives of General
Psychiatry. 44:69–76.
Andrade R, Malenka RC, and Nicoll RA. (1986) A G protein couples serotonin and GABAB
receptors to the same channels in hippocampus. Science. 234:1261–1265.
Araneda R, and Andrade R (1991) 5-Hydroxytryptamine2 and 5-hydroxytryptamine 1A
receptors mediate opposing responses on membrane excitability in rat association cortex.
Neuroscience. 40:399– 412.
Antonell A, Del Campo M, Magano LF, Kaufmann L, Martínez de la Iglesia J, Gallastegui F,
Flores R, Schweigmann U, Fauth C, Kotzot D, and Pérez-Jurado LA. (2009) Partial
7q11.23 deletions further implicate GTF2I and GTF2IRD1 as the main genes responsible
for the Williams-Beuren syndrome neurocognitive profile. Journal of Medical Genetics.
Nov 5. [Epub ahead of print]
Araneda R, and Andrade R. (1991) 5-Hydroxytryptamine2 and 5-hydroxytryptamine 1A
receptors mediate opposing responses on membrane excitability in rat association cortex.
Neuroscience. 40:399-412.
Arango V, Underwood MD, and Mann JJ. (1997) Biologic alterations in the brainstem of
suicides. The Psychiatric Clinics of North America. 20:581-593.
Avgustinovich DF, Lipina TV, Bondar NP, Alekseyenko OV, and Kudryavtseva NN. (2000)
Features of the genetically defined anxiety in mice. Behavioral Genetics. 30:101-109.
Avgustinovich DF, Alekseenko OV, Bakshtanovskaia IV, Koriakina LA, Lipina TV, Tenditnik
MV, Bondar' NP, Kovalenko IL, and Kudriavtseva NN. (2004) [Dynamic changes of brain
serotonergic and dopaminergic activities during development of anxious depression:
experimental study]. Uspekhi Fiziologicheskikh Nauk. 35:19-40. (in Russian)
203
Ballenger JC. (1999) Current treatments of the anxiety disorders in adults. Biological Psychiatry.
46:1579-1594.
Barlow D. (2002) Anxiety and its disorder. The nature and treatment of anxiety and panic. The
Guildford Press, New York.
Béïque JC, Chapin-Penick EM, Mladenovic L, and Andrade R (2004) Serotonergic facilitation of
synaptic activity in the developing rat prefrontal cortex. Journal of Physiology. 556:739-
754.
Bellugi U, Bihrle A, Jernigan T, Trauner D, and Doherty S. (1990) Neuropsychological,
neurological, and neuroanatomical profile of Williams syndrome. American Journal of
Medical Genetics. 6(S):115-125.
Benn CL, Butler R, Mariner L, Nixon J, Moffitt H, Mielcarek M, Woodman B, and Bates GP.
(2009) Genetic knock-down of HDAC7 does not ameliorate disease pathogenesis in the
R6/2 mouse model of Huntington's disease. PLoS One. 4:e5747.
Bishop SJ. (2007) Neurocognitive mechanisms of anxiety: an integrative account. Trends in
Cognitive Science. 11:307-316.
Blomberg S, Rosander M, and Andersson G. (2006) Fears, hyperacusis and musicality in
Williams syndrome. Research in Developmental Disabilities. 27:668-680.
Bolstad BM, Irizarry RA, Astrand M, and Speed TP. (2003) A Comparison of Normalization
Methods for High Density Oligonucleotide Array Data Based on Bias and Variance.
Bioinformatics. 19:185-193.
Botta A, Novelli G, Mari A, Novelli A, Sabani M, Korenberg J, Osborne LR, Digilio MC,
Giannotti A, and Dallapiccola B. (1999) Detection of an atypical 7q11.23 deletion in
Williams syndrome patients which does not include the STX1A and FZD3 genes. Journal
of Medical Genetics. 36:478-480.
Bowen RC, Offord DR, and Boyle MH. (1990) The prevalence of overanxious disorder and
separation anxiety disorder: results from the Ontario Child Health Study. Journal of the
Academy of Child and Adolescent Psychiatry. 29:753–758.
Britton JC, Phan KL, Taylor SF, Welsh RC, Berridge KC, and Liberzon I. (2006) Neural
correlates of social and nonsocial emotions: An fMRI study. NeuroImage. 31:397-409.
Budarf ML, Collins J, Gong W, Roe B, Wang Z, Bailey LC, Sellinger B, Michaud D, Driscoll
DA, and Emanuel BS. (1995) Cloning a balanced translocation associated with DiGeorge
syndrome and identification of a disrupted candidate gene. Nature Genetics. 10:269-278.
Cannistraro PA, and Rauch SL. (2003) Neural circuitry of anxiety: evidence from structural and
functional neuroimaging studies. Psychopharmacology Bulletin. 37:8–25.
Caramaschi D, de Boer SF, and Koolhaas JM. (2007) Differential role of the 5-HT1A receptor in
aggressive and non-aggressive mice: an across-strain comparison. Physiology and
Behavior. 90:590-601.
204
Celada P, Puig MV, Casanovas JM, Guillazo G, and Artigas F. (2001) Control of dorsal raphe
serotonergic neurons by the medial prefrontal cortex: Involvement of serotonin-1A,
GABA(A), and glutamate receptors. Journal of Neuroscience. 21:9917–9929.
Charles KJ, Calver AR, Jourdain S, and Pangalos MN (2003) Distribution of a GABAB-like
receptor protein in the rat central nervous system. Brain Research. 989:135–146.
Chan MH, Chiu PH, Sou JH, and Chen HH. (2008) Attenuation of ketamine-evoked behavioral
responses by mGluR5 positive modulators in mice. Psychopharmacology (Berl). 198:141-
148.
Cherniske EM, Carpenter TO, Klaiman C, Young E, Bregman J, Insogna K, Schultz RT, and
Pober BR. (2004) Multisystem study of 20 older adults with Williams syndrome. American
Journal of Medical Genetics. 131A:255-264.
Chua P, Krams M, Toni I, Passingham R, and Dolan R. (1999) A functional anatomy of
anticipatory anxiety. Neuroimage. 9:563–571.
Clapcote SJ, Lazar NL, Bechard AR, and Roder JC. (2005) Effects of the rd1 mutation and host
strain on hippocampal learning in mice. Behavioral Genetics. 35:591-601.
Clark MS, Vincow ES, Sexton TJ, and Neumaier JF. (2004) Increased expression of 5-HT1B
receptor in dorsal raphe nucleus decreases fear-potentiated startle in a stress dependent
manner. Brain Research.1007:86-97.
Cooper SA, Melville CA, and Einfeld SL. (2003) Psychiatric diagnosis, intellectual disabilities
and diagnostic criteria for psychiatric disorders for use with adults with learning
disabilities/mental retardation (DC-LD). Journal of Intellectual Disability Research. 47:3–
15.
Cosi C, and Marien M. (1998) Decreases in mouse brain NAD+ and ATP induced by 1-methyl-
4-phenyl-1, 2,3,6-tetrahydropyridine (MPTP): prevention by the poly(ADP-ribose)
polymerase inhibitor, benzamide. Brain Research. 809:58-67.
Crackower MA, Kolas NK, Noguchi J, Sarao R, Kikuchi K, Kaneko H, Kobayashi E, Kawai Y,
Kozieradzki I, Landers R, Mo R, Hui CC, Nieves E, Cohen PE, Osborne LR, Wada T,
Kunieda T, Moens PB, and Penninger JM (2003) Essential role of Fkbp6 in male fertility
and homologous chromosome pairing in meiosis. Science. 300:1291-1295.
Crawley JN. (1999) Behavioral phenotyping of transgenic and knockout mice: experimental
design and evaluation of general health, sensory functions, motor abilities, and specific
behavioral tests. Brain Research. 835:18–26.
Curran ME, Atkinson DL, Ewart AK, Morris CA, Leppert MF, and Keating MT. (1993) The
elastin gene is disrupted by a translocation associated with supravalvular aortic stenosis.
Cell. 73:159-168.
Danoff SK, Taylor HE, Blackshaw S, and Desiderio S. (2004) TFII-I, a candidate gene for
Williams syndrome cognitive profile: parallels between regional expression in mouse brain
and human phenotype. Neuroscience. 123:931-938.
205
Davidson RJ, Putnam KM, Larson CL. (2000) Dysfunction in the neural circuitry of emotion
regulation--a possible prelude to violence. Science. 289:591-594.
De Almeida RM, Rosa MM, Santos DM, Saft DM, Benini Q, and Miczek KA. (2006) 5-HT(1B)
receptors, ventral orbitofrontal cortex, and aggressive behavior in mice.
Psychopharmacology (Berl). 185:441-450.
Dekker MC, and Koot HM. (2003) .DSM-IV disorders in children with borderline to moderate
intellectual disability. I: prevalence and impact. Journal of American Academy of Child
and Adolescent Psychiatry. 42:915–922.
Doyle TF, Bellugi U, Korenberg JR, and Graham J. (2004) "Everybody in the world is my
friend" hypersociability in young children with Williams syndrome. American Journal of
Medical Genetics, Part A. 124A:263-273.
Durkin ME, Keck-Waggoner CL, and Popescu NC (2001) Integration of a c-myc transgene
results in disruption of the mouse Gtf2ird1 gene, the homologue of the human GTF2IRD1
gene hemizygously deleted in Williams-Beuren syndrome. Genomics. 73:20-27.
Dykens EM. (2003) Anxiety, fears, and phobias in persons with Williams syndrome.
Developmental Neuropsychology. 23:291-316.
Emerson E. (2003) Prevalence of psychiatric disorders in children and adolescents with and
without intellectual disability. Journal of Intellectual Disability Research. 47:51–58.
Edelmann L, Prosnitz A, Pardo S, Bhatt J, Cohen N, Lauriat T, Ouchanov L, González PJ,
Manghi ER, Bondy P, Esquivel M, Monge S, Delgado MF, Splendore A, Francke U,
Burton BK, and McInnes LA.. (2007) An atypical deletion of the Williams-Beuren
Syndrome interval implicates genes associated with defective visuo-spatial processing and
autism. Journal of Medical Genetics. 44:136-143.
Emery NJ, Capitanio JP, Mason WA, Machado CJ, Mendoza SP, and Amaral DG. (2001) The
effects of bilateral lesions of the amygdala on dyadic social interactions in rhesus monkeys
(Macaca mulatta). Behavioral Neuroscience. 115:515-544.
Ensenauer RE, Adeyinka A, Flynn HC, Michels VV, Lindor NM, Dawson DB, Thorland EC,
Lorentz CP, Goldstein JL, McDonald MT, Smith WE, Simon-Fayard E, Alexander AA,
Kulharya AS, Ketterling RP, Clark RD, and Jalal SM. (2003) Microduplication 22q11.2,
an emerging syndrome: clinical, cytogenetic, and molecular analysis of thirteen patients.
American Journal of Human Genetics. 73:1027-1040.
Enkhmandakh B, Makeyev AV, Erdenechimeg L, Ruddle FH, Chimge NO, Tussie-Luna MI,
Roy AL, and Bayarsaihan D. (2009) Essential functions of the Williams-Beuren syndrome-
associated TFII-I genes in embryonic development. Proceedings of the National Academy
of Science (USA). 106:181-186.
Everett GM. And Tolman, JEP. (1959) Mode of action of Rauwolfia alkaloids and motor
activity. In: Masserman, J.H., Biological psychiatry, Vol. I. Grune and Stratton, New York-
London, pp. 75–81.
206
Ferrero GB, Howald C, Micale L, Biamino E, Augello B, Fusco C, Turturo MG, Forzano S,
Reymond A, and Merla G. (2010) An atypical 7q11.23 deletion in a normal IQ Williams-
Beuren syndrome patient. European Journal of Human Genetics. 18:33-38.
Fowler MA, Sidiropoulou K, Ozkan ED, Phillips CW, Cooper DC. (2007) Corticolimbic
expression of TRPC4 and TRPC5 channels in the rodent brain. PLoS ONE 2:e573.
Freichel M, Suh SH, Pfeifer A, Schweig U, Trost C, Weissgerber P, Biel M, Philipp S, Freise D,
Droogmans G, Hofmann F, Flockerzi V, and Nilius B. (2001) Lack of an endothelial store-
operated Ca2+ current impairs agonist-dependent vasorelaxation in TRP4-/-
mice. Nature
Cell Biology. 3:121-127.
Fujiwara T, Mishima T, Kofuji T, Chiba T, Tanaka K, Yamamoto A, and Akagawa K (2006)
Analysis of knock-out mice to determine the role of HPC-1/syntaxin 1A in expressing
synaptic plasticity. Journal of Neuroscience. 26:5767-5776.
Gabbott PL, Warner TA, Jays PR, Salway P, and Busby SJ. (2005) Prefrontal cortex in the rat:
projections to subcortical autonomic, motor, and limbic centers. Journal of Comparative
Neurology. 492:145–177.
Gaspar P, Cases O, and Maroteaux L. (2003) The developmental role of serotonin: news from
mouse molecular genetics. Nature Review Neuroscience. 4:1002-1012.
Ghashghaei HT, and Barbas H. (2002) Pathways for emotion: interactions of prefrontal and
anterior temporal pathways in the amygdala of the rhesus monkey. Neuroscience.
115:1261–1279.
Gerlai R, Friend W, Becker L, O'Hanlon D, Marks A, and Roder J. (1993) Female transgenic
mice carrying multiple copies of the human gene for S100 beta are hyperactive.
Behavioural Brain Research. 55:51-59.
Gonçalves L, Nogueira MI, Shammah-Lagnado SJ, and Metzger M. (2009) Prefrontal afferents
to the dorsal raphe nucleus in the rat. Brain Research Bulletin. 78:240–247.
Goodfellow NM, Benekareddy M, Vaidya VA, and Lambe EK. (2009) Layer II/III of the
prefrontal cortex: Inhibition by the serotonin 5-HT1A receptor in development and stress.
Journal of Neuroscience. 29:10094–10103.
Gould E (1999). Serotonin and hippocampal neurogenesis. Neuropsychopharmacology. 21:46S–
51S.
Gross C, Zhuang X, Stark K, Ramboz S, Oosting R, Kirby L, Santarelli L, Beck S, and Hen R.
(2002) Serotonin1A receptor acts during development to establish normal anxiety-like
behaviour in the adult. Nature. 416:396–400.
Hajós M, Richards CD, Székely AD, and Sharp T. (1998) An electrophysiological and
neuroanatomical study of the medial prefrontal cortical projection to the midbrain raphe
nuclei in the rat. Neuroscience. 87:95–108.
207
Hakre S, Tussie-Luna MI, Ashworth T, Novina CD, Settleman J, Sharp PA, Roy AL. (2006)
Opposing functions of TFII-I spliced isoforms in growth factor-induced gene expression.
Molecular Cell. 24:301-308.
Hanks M, Wurst W, Anson-Cartwright L, Auerbach AB, and Joyner AL (1995) Rescue of the
En-1 mutant phenotype by replacement of En-1 with En-2. Science. 269:679-682
Hardie RC, Minke B. (1992) The trp gene is essential for a light-activated Ca2+ channel in
Drosophila photoreceptors.Neuron. 8:643-651.
Heller R, Rauch A, Lüttgen S, Schröder B and Winterpacht A. (2003) Partial deletion of the
critical 1.5 Mb interval in Williams-Beuren syndrome. Journal of Medical Genetics.
40:e99.
Heisler LK, Chu HM, Brennan TJ, Danao JA, Bajwa P, Parsons LH, and Tecott LH. (1998)
Elevated anxiety and antidepressant-like responses in serotonin 5-HT1A receptor mutant
mice. Proceedings of the National Academy of Science (USA). 95:15049–15054.
Hodges JR. (1984) The hypothalamo-pituitary-adrenocortical system. British Journal of
Anaesthesia. 56:701-710.
Hoogenraad CC, Koekkoek B, Akhmanova A, Krugers H, Dortland B, Miedema M, van Alphen
A, Kistler WM, Jaegle M, Koutsourakis M, Van Camp N, Verhoye M, van der Linden A,
Kaverina I, Grosveld F, De Zeeuw CI, and Galjart N. (2002) Targeted mutation of Cyln2 in
the Williams syndrome critical region links CLIP-115 haploinsufficiency to
neurodevelopmental abnormalities in mice. Nature Genetics. 32:116-127.
Impey S, Mark M, Villacres EC, Poser S, Chavkin C, and Storm DR. (1996): Induction of CRE-
mediated gene expression by stimuli that generate long-lasting LTP in area CA1 of the
hippocampus. Neuron. 16:973-982.
Impey S, Obrietan K, Wong ST, Poser S, Yano S, Wayman G, Deloulme JC, Chan G, and Storm
DR. (1998) Cross talk between ERK and PKA is required for Ca2+ stimulation of CREB-
dependent transcription and ERK nuclear translocation. Neuron. 21:869-883.
Innis RB, Nestler EJ, and Aghajanian GK. (1988) Evidence for G protein mediation of serotonin-
and GABAB-induced hyperpolarization of rat dorsal raphe neurons. Brain Research.
459:27–36.
Jackson TA, Taylor HE, Sharma D, Desiderio S, and Danoff SK. (2005) Vascular endothelial
growth factor receptor-2: counter-regulation by the transcription factors, TFII-I and TFII-
IRD1. Journal of Biological Chemistry. 280:29856–29863.
Jankowski, MP, and Sesack, SR (2004) Prefrontal cortical projections to the rat dorsal raphe
nucleus: ultrastructural features and associations with serotonin and gamma-aminobutyric
acid neurons. Journal of Comparative Neurology. 468:518–529.
208
Jeon JP, Lee KP, Park EJ, Sung TS, Kim BJ, Jeon JH, So I. (2008) The specific activation of
TRPC4 by Gi protein subtype. Biochemical and Biophysical Research Communication.
377:538-543.
Klein-Tasman BP. and Mervis CB. (2003) Distinctive personality characteristics of 8-, 9-, and
10-year-olds with Williams syndrome. Developmental Neuropsychology. 23:269-290.
Karmiloff-Smith A, Grant J, Ewing S, Carette MJ, Metcalfe K, Donnai D, Read AP, and
Tassabehji M. (2003) Using case study comparisons to explore genotype-phenotype
correlations in Williams-Beuren syndrome. Journal of Medical Genetics. 40:136-140.
Krueger SR, Ghisu GP, Cinelli P, Gschwend TP, Osterwalder T, Wolfer DP, and Sonderegger P.
(1997) Expression of neuroserpin, an inhibitor of tissue plasminogen activator, in the
developing and adult nervous system of the mouse. Journal of Neuroscience. 17:8984-
8996.
Kumari V, Kaviani H, Raven PW, Gray JA, and Checkley SA. (2001) Enhanced startle reactions
to acoustic stimuli in patients with obsessive-compulsive disorder. American Journal of
Psychiatry. 158:134-136.
Kusserow H, Davies B, Hörtnagl H, Voigt I, Stroh T, Bert B, Deng DR, Fink H, Veh RW, and
Theuring F (2004) Reduced anxiety-related behavior in transgenic mice overexpressing
serotonin 1A receptors. Brain Research. Molecular Brain Research. 129:104–116.
Lang PJ, Davis M, and Ohman A. (2000) Fear and anxiety: animal models and human cognitive
psychophysiology. Journal of Affective Disorders. 61:137–159.
Lanzenberger RR, Mitterhauser M, Spindelegger C, Wadsak W, Klein N, Mien LK, Holik A,
Attarbaschi T, Mossaheb N, Sacher J, Geiss-Granadia T, Kletter K, Kasper S, and
Tauscher J. (2007) Reduced serotonin-1A receptor binding in social anxiety disorder.
Biological Psychiatry. 61:1081–1089.
Lazebnik MB, Tussie-Luna MI, and Roy AL. (2008) Determination and functional analysis of
the consensus binding site for TFII-I family member BEN, implicated in Williams-Beuren
syndrome. Journal of Biological Chemistry. 283:11078-11082.
Lebrand C, Cases O, Adelbrecht C, Doye A, Alvarez C, El Mestikawy S, Seif I, Gaspar P.
(1996) Transient uptake and storage of serotonin in developing thalamic neurons. Neuron.
17:823-835.
Lee YM, Kim BJ, Kim HJ, Yang DK, Zhu MH, Lee KP, So I, and Kim KW. (2003) TRPC5 as a
candidate for the nonselective cation channel activated by muscarinic stimulation in murine
stomach. American Journal of Physiology, Gastrointestinal and Liver Physiology.
284:G604-G616.
Leyfer OT, Woodruff-Borden J, Klein-Tasman BP, Fricke JS, and Mervis CB. (2006) Prevalence
of psychiatric disorders in 4 to 16-year-olds with Williams syndrome. American Journal of
Medical Genetics. Part B, Neuropsychiatric Genetics. 141B: 615-622.
209
Li DY, Faury G, Taylor DG, Davis EC, Boyle WA, Mecham RP, Stenzel P, Boak B, and
Keating MT (1998) Novel arterial pathology in mice and humans hemizygous for elastin.
Journal of Clinical Investigation. 102:1783-1787.
Li HH, Roy M, Kuscuoglu U, Spencer CM, Halm B, Harrison KC, Bayle JH, Splendore A, Ding
F, Meltzer LA, Wright E, Paylor R, Deisseroth K, and Francke U. (2009) Induced
chromosome deletions cause hypersociability and other features of Williams-Beuren
syndrome in mice. EMBO Molecular Medicine. 1:50-65.
Liotti M, Mayberg HS, Brannan SK, McGinnis S, Jerabek P, and Fox PT. (2000) Differential
limbic--cortical correlates of sadness and anxiety in healthy subjects: implications for
affective disorders. Biological Psychiatry. 48:30–42.
Lipp HP, and Wolfer DP. (1998) Genetically modified mice and cognition. Current Opinion
Neurobiology. 8:272-280.
Lister RG. (1987) The use of a plus-maze to measure anxiety in the mouse.
Psychopharmacology. 92:180-185.
Liu D, Bei D, Parmar H, and Matus A. (2000) Activity-regulated, cytoskeleton-associated
protein (Arc) is essential for visceral endoderm organization during early embryogenesis.
Mechanisms of Develoment. 92:207-215.
Malenka R, and Bear M. (2004). LTP and LTD: an embarrassment of riches. Neuron. 44:5–21.
Malenka RC, and Nicoll RA. (1999) Long-term potentiation--a decade of progress? Science.
285:1870-1874.
Malinow R, Schulman H, Tsien RW. (1989) Inhibition of postsynaptic PKC or CaMKII blocks
induction but not expression of LTP. Science. 245:862-866.
Maren S. (2008) Pavlovian fear conditioning as a behavioral assay for hippocampus and
amygdala function: cautions and caveats. European Journal of Neuroscience. 28:1661-
1666.
Martin KC, Michael D, Rose JC, Barad M, Casadio A, Zhu H, and Kandel ER. (1997) MAP
kinase translocates into the nucleus of the presynaptic cell and is required for long-term
facilitation in Aplysia. Neuron. 18:889-912.
Matynia A, Kushner SA, and Silva AJ. (2002) Genetic approaches to molecular and cellular
cognition: a focus on LTP and learning and memory. Annual Review of Genetics. 36:687-
720.
Melendez RI, Gregory ML, Bardo MT, and Kalivas PW. (2004) Impoverished rearing
environment alters metabotropic glutamate receptor expression and function in the
prefrontal cortex. Neuropsychopharmacology. 29:1980–1987.
Meng Y, Zhang Y, Tregoubov V, Janus C, Cruz L, Jackson M, Lu WY, MacDonald JF, Wang
JY, Falls DL, and Jia Z (2002) Abnormal spine morphology and enhanced LTP in LIMK-1
knockout mice. Neuron. 35:121-133.
210
Mervis CB, and Klein-Tasman BP. (2000) Williams syndrome: cognition, personality, and
adaptive behavior. Mental Retardation and Developmental Disabilities Researach
Reviews. 6:148-158.
Mervis CB, Robinson BF, Bertrand J, Morris CA, Klein-Tasman BP, and Armstrong SC. (2000)
The Williams syndrome cognitive profile. Brain and Cognition. 44:604-628.
Meyer-Lindenberg A, Hariri AR, Munoz KE, Mervis CB, Mattay VS, Morris CA, and Berman
KF. (2005) Neural correlates of genetically abnormal social cognition in Williams
syndrome. Nature Neuroscience. 8:991-993.
Milner B, Squire LR, and Kandel ER. (1998) Cognitive neuroscience and the study of memory.
Neuron. 20:445-468.
Mount HT, Martel JC, Fluit P, Wu Y, Gallo-Hendrikx E, Cosi C, and Marien MR. (2004)
Progressive sensorimotor impairment is not associated with reduced dopamine and high
energy phosphate donors in a model of ataxia-telangiectasia. Journal of Neurochemistry.
88:1449-1454.
Montgomery KC. (1958) The relation between fear induced by novel stimulation and exploratory
behaviour. Journal of Comparative Physiology and Psychology. 48:254-260.
Moy SS, Nadler JJ, Perez A, Barbaro RP, Johns JM, Magnuson TR, Piven J, and Crawley JN.
(2004) Sociability and preference for social novelty in five inbred strains: an approach to
assess autistic-like behavior in mice. Genes Brain and Behavior. 3:287-302.
Morgan MA, Romanski LM, and LeDoux JE. (1993) Extinction of emotional learning:
contribution of medial prefrontal cortex. Neuroscience Letters. 163:109–113.
Morris R. (1984) Developments of a water-maze procedure for studying spatial learning in the
rat. Journal of Neuroscience Methods. 11:47-60.
Moulin-Sallanon M, Charnay Y, Ginovart N, Perret P, Lanfumey L, Hamon M, Hen R, Fagret D,
Ibáñez V, and Millet P. (2009) Acute and chronic effects of citalopram on 5-HT1A
receptor-labeling by [18F]MPPF and -coupling to receptors-G proteins. Synapse. 63:106–
116.
Moy SS, Nadler JJ, Perez A, Barbaro RP, Johns JM, Magnuson TR, Piven J, and Crawley JN.
(2004) Sociability and preference for social novelty in five inbred strains: an approach to
assess autistic-like behavior in mice. Genes Brain and Behavior. 3:287-302.
Myers BA,and Pueschel SM. (1991) Psychiatric disorders in persons with Down syndrome. The
Journal of Nervous and Mental Disease. 179:609–613.
Nagy A, Rossant J, Nagy R, Abramow-Newerly W, and Roder JC. (1993) Derivation of
completely cell culture-derived mice from early-passage embryonic stem cells.
Proceedings of the National Academy of Sciences (U S A). 90:8424-8428.
Nagy A, Gertsenstein M,. Vintersten K, and Behringer R. (2003) In: Manipulating the Mouse
Embryo. Cold Spring Harbor Laboratory Press.
211
Nichols DE, and Nichols CD (2008) Serotonin receptors. Chemical Reviews. 108:1614–1641.
Nimchinsky E, Sabatini B, and Svoboda K (2002). Structure and function of dendritic spines.
Annual Review of Physiology. 64: 313–353.
Ogilvie AD, Battersby S, Bubb VJ, Fink G, Harmar AJ, Goodwim GM, and Smith CA (1996)
Polymorphism in serotonin transporter gene associated with susceptibility to major
depression. Lancet. 347:731-733.
Olson TM, Michels VV, Urban Z, Csiszar K, Christiano AM, Driscoll DJ, Feldt RH, Boyd CD,
and Thibodeau SN. (1995) A 30 kb deletion within the elastin gene results in familial
supravalvular aortic stenosis. Human Molecular Genetics. 4:1677-1669.
O'Mahoney JV, Guven KL, Lin J, Joya JE, Robinson CS, Wade RP, and Hardeman EC. (1998)
Identification of a novel slow-muscle-fiber enhancer binding protein, MusTRD1.
Molecular and Cellular Biology. 18:6641–6652.
Osuch EA, Benson B, Geraci M, Podell D, Herscovitch P, McCann UD, and Post RM. (2000)
Regional cerebral metabolism associated with anxiety symptoms in affective disorder
patients. Biological Psychiatry. 48:1020–1023.
Palmer SJ, Tay ES, Santucci N, Cuc Bach TT, Hook J, Lemckert FA, Jamieson RV, Gunnning
PW, and Hardeman EC. (2007) Expression of Gtf2ird1, the Williams syndrome-associated
gene, during mouse development. Gene Expression Patterns. 7:396–404.
Pankau R, Partsch CJ, Gosch A, Oppermann HC, and Wessel A (1992) Statural growth in
Williams-Beuren syndrome. European Journal of Pediatircs. 151:751-755.
Parks CL, Robinson PS, Sibille E, Shenk T, and Toth M. (1998) Increased anxiety of mice
lacking the serotonin1A receptor. Proceedings of the National Academy of Sciences (USA).
95:10734–10739.
Penington NJ, Kelly JS, and Fox AP (1993) Whole-cell recordings of inwardly rectifying K+
currents activated by 5-HT1A receptors on dorsal raphe neurones of the adult rat. The
Journal of Physiology. 469:387–405.
Penn HE. (2006). Neurobiological correlates of autism: a review of recent research. Child
Neuropsychology. 12:57–79.
Pérez Jurado LA, Peoples R, Kaplan P, Hamel BC, and Francke U. (1996) Molecular definition
of the chromosome 7 deletion in Williams syndrome and parent-of-origin effects on
growth. American Journal of Human Genetics. 59:781-792.
Petralia RS, Wang YX, Niedzielski AS, and Wenthold RJ (1996) The metabotropic glutamate
receptors, mGluR2 and mGluR3, show unique postsynaptic, presynaptic and glial
localizations. Neuroscience. 71:949–976.
Peyron C, Petit JM, Rampon C, Jouvet M, and Luppi PH. (1998) Forebrain afferents to the rat
dorsal raphe nucleus demonstrated by retrograde and anterograde tracing methods.
Neuroscience. 82:443–468.
212
Phelps EA, O'Connor KJ, Gatenby JC, Gore JC, Grillon C, and Davis M. (2001) Activation of
the left amygdala to a cognitive representation of fear. Nature Neuroscience. 4:437-441.
Phillips RG, and LeDoux JE. (1992) Differential contribution of amygdala and hippocampus to
cued and contextual fear conditioning. Behavioural Neuroscience. 106:274-285.
Polly P, Haddadi LM, Issa LL, Subramaniam N, Palmer SJ, Tay ES, and Hardeman EC. (2003)
hMusTRD1alpha1 represses MEF2 activation of the troponin I slow enhancer. Journal of
Biological Chemistry. 278:36603–36610.
Prather MD, Lavenex P, Mauldin-Jourdain ML, Mason WA, Capitanio JP, Mendoza SP, and
Amaral DG. (2001) Increased social fear and decreased fear of objects in monkeys with
neonatal amygdala lesions. Neuroscience. 106:653-658.
Pober BR. (2006) Evidence-based medical management of adults with Williams-Beuren
Syndrome. In: Williams-Beuren Syndrome: Research, evaluation, and treatment. (Morris
CA, Lenhoff HM, Wang P, eds) Baltimore: Johns Hopkins University Press.
Proulx E, Young EJ, Osborne LR, and Lambe EK. (2010) Enhanced prefrontal serotonin 5-HT1A
currents in a mouse model of Williams-Beuren syndrome with low innate anxiety. Journal
of Neurodevelopmental Disorders. 2:99-108.
Quetsch RM, Achor RW, Litin EM, and Fauchett RL. (1959) Depressive reactions in
hypertensive patients; a comparison of those treated with Rauwolfia and those receiving no
specific antihypertensive treatment. Circulation. 19:366–375.
Quirk GJ, Likhtik E, Pelletier JG, and Paré D. (2003) Stimulation of medial prefrontal cortex
decreases the responsiveness of central amygdala output neurons. Journal of Neuroscience.
23:8800–8807.
Quirk GJ, Garcia R, and González-Lima F.2006 Prefrontal mechanisms in extinction of
conditioned fear. Biological Phsychiatry. 60:337-343.
Ramboz S, Oosting R, Amara DA, Kung HF, Blier P, Mendelsohn M, Mann JJ, Brunner D, and
Hen R. (1998) Serotonin receptor 1A knockout: an animal model of anxiety-related
disorder. Proceedings of the National Academy of Sciences (USA). 95:14476–14481.
Ramirez OA, and Wang RY. (1986) Locus coeruleus norepinephrine-containing neurons: effects
produced by acute and subchronic treatment with antipsychotic drugs and amphetamine.
Brain Research. 362:165-170.
Rascle C, Mazas O, Vaiva G, Tournan, M, Rayboi O, Goudemand M, and Thomas P. (2001)
Clinical features of latent inhibition in schizophrenia. Schizophenia Research. 51:149-161.
Rodgers RJ, and Cole JC. (1994) Anxiolytic-like effect of (S)-WAY 100135, a 5-HT1A receptor
antagonist, in the murine elevated plus-maze test. European Journal of Pharmacology.
261:321-325.
213
Rolls ET, Hornak J, Wade D, and McGrath J. (1994) Emotion-related learning in patients with
social and emotional changes associated with frontal lobe damage. Journal of Neurology,
Neurosurgery and Psychiatry. 57:1518-24.
Roy A, (2001) Genetic influences on suicide risk. Clinical Neuroscience Research. 1:324-330.
Schafe GE, Nader K, Blair HT, and LeDoux JE. (2001) Memory consolidation of Pavlovian fear
conditioning: a cellular and molecular perspective. Trends in Neuroscience. 24:540-546.
Schiller L, Donix M, Jahkel M, and Oehler J. (2006) Serotonin 1A and 2A receptor densities,
neurochemical and behavioral characteristics in two closely related mice strains after long-
term isolation. Program in Neuropsychopharmacol Biol Psychiatry. 30:492-503.
Seidman JG, and Seidman C. (2002) Transcription factor haploinsufficiency: when half a loaf is
not enough. Journal of Clinical Investigation. 109:451-455.
Shin LM, and Liberzon I. (2010) The Neurocircuitry of Fear, Stress, and Anxiety Disorders.
Neuropsychopharmacology. 35:169-191
Shumyatsky GP, Malleret G, Shin RM, Takizawa S, Tully K, Tsvetkov E, Zakharenko SS,
Joseph J, Vronskaya S, Yin D, Schubart UK, Kandel ER, and Bolshakov VY. (2005)
Stathmin, a gene enriched in the amygdala, controls both learned and innate fear. Cell.
123:697-709.
Silva AJ, Kogan JH, Frankland PW, and Kida S (1998) CREB and memory. Annual Review of
Neuroscience. 21:127-148.
Smith Y, and Kieval JZ. (2000) Anatomy of the dopamine system in the basal ganglia. Trends in
Neuroscience. 23:S28-S33.
Smyth GK. (2004). Linear models and empirical Bayes methods for assessing differentially
expresssed in microarray experiments. Statistical Applications in Genetics and Molecular
Biology, 3, No. 1, Article 3
Sotres-Bayon F, Corcoran KA, Peters J, and Sierra-Mercado D. (2008) Neural correlates of
individual variability in fear extinction. Journal of Neuroscience. 28:12147-12149.
Steru L, Chermat R, Thierry B, and Simon P. (1985) The tail suspension test: a new method for
screening antidepressants in mice. Psychopharmacology (Berl). 85:367-370.
Sweatt JD. (1999) Toward a molecular explanation for long-term potentiation. Learning and
Memory. 6:399-416.
Tassabehji M, Hammond P, Karmiloff-Smith A, Thompson P, Thorgeirsson SS, Durkin ME,
Popescu NC, Hutton T, Metcalfe K, Rucka A, Stewart H, Read AP, Maconochie M, and
Donnai D. (2005) GTF2IRD1 in craniofacial development of humans and mice. Science.
310:1184-1187.
Tauscher J, Bagby RM, Javanmard M, Christensen BK, Kasper S, and Kapur S (2001) Inverse
relationship between serotonin 5-HT(1A) receptor binding and anxiety: a [(11)C]WAY-
214
100635 PET investigation in healthy volunteers. The American Journal of Psychiatry.
158:1326–1328.
Thompson PD, Webb M, Beckett W, Hinsley T, Jowitt T, Sharrocks AD, and Tassabehji M
(2007) GTF2IRD1 regulates transcription by binding an evolutionarily conserved DNA
motif ‗GUCE‘. FEBS Letters. 581:1233-1242.
Tillfors M, Furmark T, Marteinsdottir I, Fischer H, Pissiota A, Långström B, and Fredrikson M
(2001) Cerebral blood flow in subjects with social phobia during stressful speaking tasks: a
PET study. The American Journal of Psychiatry. 158:1220–1226.
Tussié-Luna MI, Bayarsaihan D, Ruddle FH, and Roy AL. (2001) Repression of TFII-I-
dependent transcription by nuclear exclusion. Proceedings of the National Academy of
Sciences (USA). 98:7789-7794.
Vaidya VA, Marek GJ, Aghajanian GK, and Duman RS. (1997) 5-HT2A receptor-mediated
regulation of brain-derived neurotrophic factor mRNA in the hippocampus and the
neocortex. Journal of Neuroscience. 17:2785-2795.
van Hagen JM, van der Geest JN, van der Giessen RS, Lagers-van Haselen GC, Eussen HJ, Gille
JJ, Govaerts LC, Wouters CH, de Coo IF, Hoogenraad CC, Koekkoek SK, Frens MA, van
Camp N, van der Linden A, Jansweijer MC, Thorgeirsson SS, and De Zeeuw CI. (2007)
Contribution of CYLN2 and GTF2IRD1 to neurological and cognitive symptoms in
Williams Syndrome. Neurobiology of Disease. 26:112-124.
Veenema AH and Neumann ID. (2007) Neurobiological mechanisms of aggression and stress
coping: a comparative study in mouse and rat selection lines. Brain, Behavior and
Evolution. 70:274-285.
Vergnes M, Depaulis A, and Boehrer A. (1986) Parachlorophenylalanine-induced serotonin
depletion increases offensive but not defensive aggression in male rats. Physiology and
Behavior. 36:653–658.
Vertes, R (2004) Differential projections of the infralimbic and prelimbic cortex in the rat.
Synapse. 51:32–58.
Winslow JT, and Insel TR. (2002) The social deficits of the oxytocin knockout mouse.
Neuropeptides. 36:221-229.
Zald DH, and Pardo JV. (1997) Emotion, olfaction, and the human amygdala: amygdala
activation during aversive olfactory stimulation. Proceedings of the National Academy of
Sciences (USA). 97:4119-4124.
Zald DH, Lee JT, Fluegel KW, and Pardo JV. (1998) Aversive gustatory stimulation activates
limbic circuits in humans. Brain. 121:1143-1154.
Zhao C, Aviles C, Abel RA, Almli CR, McQuillen P, and Pleasure SJ (2005) Hippocampal and
visuo-spatial learning defects in mice with a deletion of frizzled 9, a gene in the Williams
syndrome deletion interval. Development. 132:2917-2927.
215
CHAPTER IV: MOUSE MODELS OF GTF2I GENE FAMILY MEMBERS:
216
4.1: Literature Review:
4.1.1: Mouse genome engineering:
A critical advancement in the study of human disease in the last three decades has been
the development of mouse models for genetic disorders. Over 80% of mouse genes have an
orthologous counterpart in humans (Mouse Genome Sequencing Consortium et al., 2002) and
although the engineering methods used in manipulating the mouse genome are also applicable to
other systems such as rat and zebra fish (Glaser et al., 2005), it is the isolation and development
in the late 1980s of totipotential embryonic stem (ES) cell lines, derived from the inner cell mass
of the mouse blastocyst (Robertson, 1987) that has revolutionized the generation of mouse
models of human disease. Mouse ES cells have the ability to undergo diapauses, a physiological
state of dormancy found only in a few mouse strains, with very specific triggering and releasing
conditions where no development takes place as long as the embryo remains unattached to the
uterine lining (Gardner and Brook, 1997; Buehr and Smith, 2003). Mouse ES cells have higher
frequency of homologous recombination than other cultured cells likely due to rapid growth and
high DNA replication (Glaser et al., 2005). Concurrent with the establishment of ES cells lines
was the development of gene targeting techniques that have allowed for the targeting of
numerous disease-related genes (Thomas and Capecchi, 1987). Since the initial single gene
mouse models first reported in 1989 (Koller and Smithies, 1989; Zijlstra et al., 1989),
improvements in targeting techniques have allowed for varying types of mutations, such as the
introduction of point mutations, deletion and lineage-specific and inducible inactivation of
targeted genes, the generation of chromosomal translocations as well as the deletions and
duplication of larger genomic segments. The vast majority of mouse models harbor null
mutations that have been created by removal of a coding exon using homologous recombination,
217
to disrupt normal gene function. Although valuable for creating null alleles, this method
required the targeting of the desired gene in ES cells, and therefore was not useful in generating
the lineage-specific and inducible inactivation of targeted genes and was not capable of
mimicking genomic deletions that encompassed regions over 30kb in size (Gu et al., 1993;
Zhang et al., 1994). Larger deletions around a defined locus were originally generated using
radiation-induced deletions (RID). A positive/negative selection cassette containing the
thymidine kinase (TK) and neomycin (NEO) genes were first integrated at a defined genomic
location by homologous recombination and properly targeted cells were then irradiated with
gamma radiation to induce deletions. Deletions of the initially targeted locus would result in the
removal and the TK cassette thereby allowing the cells to proliferate in media containing the
nucleoside analogs of deoxyguanosine (FIAU or ganciclovir) that are phosphorylated by TK and
become incorporated into growing DNA chains, interfering with DNA synthesis and eventually
resulting in cell death (Camper et al., 1995). This method however generated deletions of
varying sizes that required further characterization to map the extent and boundaries.
More recently, large-scale genomic rearrangements have been generated using Cre
recombinase (Cre) derived from bacteriophage P1. Cre is a 38 kDa protein that does not require
cofactors for proper functioning and can be stably expressed in mammalian cells, including ES
cells (Sauer and Henderson, 1988). Cre induces the desired rearrangement through site-specific
recombination between two 34 base pair (bp) recognition sequences, referred to as loxP sites,
each consisting of an asymmetric 8 bp core sequence flanked by 13 bp palindromic sequences
(Hamilton and Abremski, 1984). When the core sequences of the loxP sites are on the same
chromosome or fragment of DNA (in cis) and in the same orientation with respect to one
another, Cre deletes the intervening DNA fragment. When the core sequences are in opposite
218
orientation the fragment is inverted (Sauer and Henderson, 1988). Provided that the ES cells
tolerate the rearrangement, germ line transmitting chimeric mice possessing large chromosomal
deletions of up to 60 cM in size can be generated using this technique (Zheng et al., 2000).
When the loxP sites are on separate chromosomes (in trans), Cre-induced recombination can be
used to generate both deletion and duplication of the sequence flanked by the loxP sites, albeit at
an efficiency that is substantially less than when the loxP sites are in the cis configuration; 10%
to 0.1% for loxP site arranged in cis versus 0.1% to 0.01% for trans configuration (Liu et al.,
1998; Zheng et al., 2000)
An improvement in the creation of mouse models with genomic rearrangements came
from the development of Cre expressing transgenic mouse lines that allowed for in vivo Cre-
induced recombination. In a technique developed by Herault et al., (1998), targeted meiotic
recombination (TAMERE) used expression of Cre under the control of the synaptonemal
complex protein 1 (Sycp1) promoter in early prophase of male spermatogenesis to greatly
increase the efficiency of Cre-induced recombination between loxP sites in the trans
configuration. This method generated deletions as well as duplications with an efficiency of
between 1% and 10%. Other examples of transgenic lines that can be used to generate Cre-
induced recombination include the ZP3-Cre transgenic mouse that expresses high levels during
oogenesis before the first meiotic division (Lewandoski et al., 1997) and the CMV-Cre line
which expresses Cre before implantation during early embryogenesis, under the control of the
cytomegalovirus promoter (Dupe et al., 1997).
Another recent development in the mouse genomic engineering is the introduction of
high-throughput ―Gene Trapping‖. Linearized gene trap vectors containing a promoter-less
reporter gene and/or selectable genetic marker flanked by an upstream 3‘ splice site (splice
219
acceptor; SA) and a downstream transcriptional termination sequence (poly-adenylation
sequence; polyA) become randomly inserted into genomic DNA (Stanford et al., 2001). If
inserted into the intron of an expressed gene, the splice acceptor site within the gene trap cassette
causes the endogenous splicing machinery to splice the exon(s) upstream of the insertion site into
the cassette (Figure 4.1). The endogenous promoter of the trapped gene thereby produces a
fusion transcript in which the upstream exons are spliced in-frame to the reporter/selectable
marker gene. Since transcription is terminated prematurely by the polyA site within the cassette,
translation of the processed fusion transcript encodes a fusion protein of the truncated and non-
functional ‗trapped‘ protein and the reporter/selectable marker. Thus, gene traps can be used to
simultaneously inactivate and allow the study of gene expression, of the trapped gene. In
addition to generating standard loss-of-function alleles, newer gene trap vectors offer a variety of
post-insertional modification strategies such as the ability to turn off the trapping mechanism
through the Cre-induced deletion of the splice acceptor site, thereby allowing the proper
transcription of the gene to be restored in a temporally or spatially dependent manner. Presently,
gene trapped embryonic cell lines from approximately one-third of known genes are available for
a nominal handling fee through the International Gene Trap Consortium (IGTC) which
represents all publicly available gene trap cell lines.
220
4.1.2: Existing Mouse models of WBS:
Although it has been a difficult task to determine precise genotype/phenotype correlation
in WBS using human studies, great insight into the possible contribution made by several genes
has come from mouse models. Knockout mouse models of WBS region genes, including Eln,
Limk1, Lat2, Clip2, Fzd9, Baz1b, Mlxipl, Stx1a, Fkbp6, Ncf1, and Gtf2ird1, and Gtf2i have been
reported and are essential for identifying the contribution of these genes to the pathology of
WBS. The generation of high-resolution physical maps of human chromosome 7q11.23 and its
syntenic region of mouse chromosome 5G have provided a valuable comparative sequence
221
resource (DeSilva et al., 2002). The syntenic WBS region in mouse has the full complement of
genes but without the LCRs that flank the human WBS region, but interestingly, the genes
commonly deleted in WBS occur in an inverted orientation in the mouse with respect to the
human sequence suggesting that human 7q11.23 underwent inversion from the ancestral
222
chromosome (Figure 4.2).
Elastin (Eln) was the first gene to be targeted in the mouse and proved to be an excellent
model for most, if not all, of the cardiovascular symptoms associated with ELN hemizygosity in
humans (Li et al., 1998a). Eln null mice died shortly after birth due to obstructive arterial disease
223
caused by uncontrolled proliferation of sub-endothelial and reorganization of smooth muscle
cells. In a subsequent study, it was determined that although there was a 50 % reduction in the
expression of elastin in Eln+/-
mice, there was a 35% increase in the number of elastic lamellae
and smooth muscle suggesting that reduced elastin expression may result in the abnormal
vascular development and obstructive vascular disease seen in WBS patients (Li et al., 1998b).
Limk1 knockout mice exhibited significant abnormalities in spine morphology a well as
synaptic function, including enhanced hippocampal long-term potentiation, indicating that
LIMK1 may be a potent regulator of actin dynamics and is important for multiple cellular
processes such as cytokinesis, endocytosis and remodelling of neurite outgrowth needed for
dendritic spine morphogenesis in the central nervous system (Meng et al., 2002). Although no
heterozygous phenotype data was reported, Limk1 knockout mice exhibited increased locomotor
activity, enhanced cued fear response during fear conditioning (CFC), as well as impaired spatial
learning during reversal trials in the water maze test (Meng et al., 2002).
Mice heterozygously deleted for Clip2 display features reminiscent of WBS, including
mild growth deficiency, brain abnormalities, hippocampal dysfunction and particular deficits in
motor coordination (Hoogenraad et al., 2002). The human CLIP2 gene encodes for the 115 kDa
brain specific cytoplasmic linker protein CLIP-115 whose functions include the regulation of the
interactions between the growing ends of microtubules and various cellular structures
(Hoogenraad et al., 1998). CLIP-115 is most abundantly expressed in cell bodies and dendrites
of neurons (De Zeeuw et al., 1997) and is thought to directly or indirectly participate in dynein
motor-mediated transport and play an important role in cell polarity (Hoogenraad et al., 2004).
Neurological and behavioural changes seen in mice lacking Clip2 and Limk1 indicate that the
regulation of the actin and microtubule cytoskeleton plays an important role in the development
224
of the distinct neurological and behavioural aspects of WBS (Hoogenraad et al., 2002, Meng et
al., 2002).
Zhao et al., (2005) reported that both Fzd9+/-
and Fzd9
-/- mice displayed increases in
precursor proliferation and apoptotic cell death resulting in decreases in the number of granule
cells in the dentate gyrus as well as increases in the number of hilar mossy fibres in the
hippocampus. Fzd9+/-
and Fzd9
-/- mice also showed a decrease in seizure threshold to the
chemoconvulsant pentylenetetrazole (PTZ); reported to be a measure of integrity of the
hippocampal circuitry. The phenotypic expression in Fzd9+/-
mice was found to be intermediate
between the wild type and the Fzd9-/-
mice however, only the Fzd9-/-
mice had severe deficits
on tests of visuo-spatial learning/memory (Zhao et al., 2005). Independently, Ranheim et al.,
(2005) reported that although their Fzd9-/-
mice showed no obvious features of the WBS
phenotype no evaluation of the heterozygous phenotype was reported. It was suggested by the
authors that Fzd9 may play a role in lymphoid development and maturation, particularly at points
where B cells undergo self-renewal prior to further differentiation (Ranheim et al., 2005).
Several mouse knockout and transgenic models have been generated for syntaxin 1A
(Stx1a) over the past several years. (Lam et al., 2005; Fujiwara et al., 2006; Ohara-Imaizumi et
al., 2007). Lam et al., (2005) used a transgenic mouse model to over-express syntaxin 1A in
pancreatic islets. Transgenic mice displayed fasting hyperglycemia and had elevated plasma
glucose levels after a glucose tolerance test, with a corresponding reduction in plasma insulin
levels. The Stx1a transgenic mouse also exhibited reduced currents through calcium channels
but the voltage-gated or ATP-sensitive potassium channels remained unchanged, suggesting that
fluctuation syntaxin 1A levels in diabetes could affect the pathological and differential regulation
of ion channels and the exocytotic machinery, which may collectively contribute to the impaired
225
insulin secretion from pancreatic islet beta cells. In Stx1a knockout mice, Ohara-Imaizumi et al.,
(2007) showed that syntaxin 1A is essential for the docking and fusing of insulin granules during
exocytosis in pancreatic β cells. Although expected to be diabetic, Stx1a-/-
mice exhibited no
marked hyperglycemia only impaired oral glucose tolerance accompanied by decreased serum
insulin levels. Studying the role of syntaxin 1A in neurotransmitter release, Fugiwara et al.,
(2006) and found that Stx1a-/-
mice had impaired consolidation and extinction of both contextual
and cued fear conditioning as well as impaired LTP in the CA1 region of the hippocampus;
although surprisingly, Stx1a-/-
mice exhibited normal spatial memory in the Morris water maze.
It should be noted that due to the targeting strategy used by Fugiwara et al, the resulting model
likely produces a truncated protein rather than a true null allele. A subsequent report by McRory
et al., (2008) showed that mice heterozygous for the targeted allele showed no deficits in leaning
and memory, anxiety or locomotor activity, although only a small number of mice were tested,
whilst homozygotes had a high frequency of embryonic lethality.
Targeted inactivation of Fkbp6, and subsequent loss of FK506 binding protein, resulted
in sex-specific infertility with Fkbp6-/-
males unable to produce normal pachytene spermatocyte
resulting from the abnormal pairing and misalignment of homologous chromosomes, non-
homologous partner switches as well as autosynapsis of X chromosome cores in meiotic
spermatocytes (Crackower et al., 2003).
A Gtf2ird1 insertional mutant was generated through integration of a c-myc
transgene that has induced a 40kb deletion including the first non-coding exon of Gtf2ird1
(Durkin et al., 2001). Although the authors stated that the ―homozygous line 166.8 animals are
viable and have no obvious defects‖, no cognitive or behavioral testing was performed. It was
226
reported that levels of Gtf2ird1 mRNA were greatly reduced but that the locus may be
hypomorphic since a small amount of mRNA was detected on northern blot.
It is evident from the lack of a complete recapitulation of the WBS phenotype in the
individual existing mouse models for the genes within the commonly deleted region that WBS is
a contiguous gene deletion disorder. Even when considered collectively, the classic features of
WBS including the cardiovascular, craniofacial and behavioral abnormalities, are not strongly
evident in the heterozygotes of the Eln, Baz1b, Clip2, myc-Gtf2ird1 and Gtf2ird1 models,
indicating that haploinsufficiency of each gene alone is not sufficient to produce a phenotype, at
least not in a mouse model, and that the resulting WBS phenotype is the result of the
combinatorial effect of the deletion of multiple genes within the commonly deleted region.
Therefore generation of mouse models containing multiple gene deletions will be critical for
gaining insight to the collective contribution that these genes make to Williams-Beuren
Syndrome.
4.2: Methods:
4.2.1: Generation of Gtf2iloxP
mouse model:
The Gtf2iloxP
line was generated by Dr. Tuncer Onay by gap repair targeting in a HPRT-
deficient cell line using the 5‘/3‘ phage library established by Alan Bradley at Baylor College of
Medicine in Houston, Texas (Zheng et al., 1999). The loxP-containing targeting vector included
a 9 kb genomic fragment containing exons 25 to the 3‘UTR of the murine Gtf2i gene (Figure
4.3). A 1.1 kb SmaI fragment was removed to create a gap in the region of homology and was
subsequently used as a probe to identify correctly targeted ES clones. The linearized targeting
227
vector was electroporated into an HPRT-deficient ES cell line. The electroporation was
conducted with a Bio-Rad GenePulser and a Gene Pulser cuvette with a 0.4-cm electrode gap at
230 V and 500 mF. Cells (in PBS) were then mixed with medium containing leukemia inhibiting
factor (LIF) and plated.
228
229
4.2.2: Preparation of genomic DNA:
Genomic DNA was obtained using standard methods. Briefly, cell pellets were digested
in lysis buffer (10 mM Tris, 100 mM NaCl, 10 mM EDTA, 0.5% SDS, 0.4 ug/ml Proteinase K)
Overnight at 60oC. Potassium acetate was added to final concentration of 1.2M with an equal
volume of chloroform. The solution was incubated for 20 minutes at -20°C and then centrifuged
for 5 minutes at 12000xg at room temperature. The aqueous phase was transferred to fresh tube
and the DNA precipitated with 2 volumes of 100% ethanol. DNA was pelleted at 12000 x g at
room temperature, washed with 70% ethanol, re-suspended in nuclease free water and stored at -
20°C.
4.2.3: Genomic copy number analysis using conventional and quantitative PCR:
Sub-clones initially identified as being targeted for the Gtf2i locus were screened using
conventional PCR methods using primers that spanned the short arm of the targeting vector .
Sub-clones were also screened using quantitative PCR to determine the genomic copy number of
exons from single copy regions (exon 5) and exons contained within the targeting construct
(exon 30). All samples were run in triplicate and the experiment was repeated twice with
consistent results. Real-time PCR was carried out using a 7900HT genetic analyzer (Applied
Biosystems, Foster City, CA) with 11 ul reactions, performed in triplicate, containing 5 ng of
template for 40 cycles of amplification using Power®SYBR master mix (Applied Biosystems,
Foster City, CA). Primers used in the screening of Gtf2iloxP
–targeted ES clones are listed in
Table 4.1. The DNA copy number of each gene was obtained from a calibration curve that
230
assumes the reference genome is diploid. Genomic ratios were determined by comparing
absolute copy number of the test genes to the reference gene, Hmbs.
Table 4.1. Primers Used in qPCR Screening of Gtf2iloxP
Targeted Clones
Primer Name Sequence
mGtf2iRT-e5F CGCCGAGATGCATAAGATG
mGtf2iRT-e5R CAGAAATAGTCCTCCACCGTTT
mGtf2iRT-e30F CAGGAAGATCACCATCAACC
mGtf2iRT-e30R AGATCCTCCTCATGGAGCTG
mHMBSRT-F TCCAAGAGGAGCCCAGCTA
mHMBSRT-R ATTAAGCTGCCGTGCAACA
4.2.4: Re-deriving of parental Gtf2iloxP
G10 line:
One of these correctly targeted ES clones, 1-4-10, was aggregated at the University of
Connecticut Gene Targeting and Transgenic Facility (GTTF) producing 14 chimeras. Germ-line
transmission was verified by crossing male chimeric mice with CD-1 females. Genotyping was
performed using conventional PCR methods using primers listed in Table 4.1.
4.2.5: Identification and characterization of gene trap clones:
Gene trap clones derived from the parental embryonic stem cells 129P2/OlaHsd and
carrying an insertion of the gene trap vector pGT0lxf were identified from the International Gene
Trap Consortium (IGTC). The identified clones are: Gtf2ird1 - XS0608 (Sanger Institute Gene
Trap Resource - SIGTR) and Gtf2i - YTA369 (BayGenomics). Targeting was confirmed using
231
RT-PCR with primers located in the upstream exon of the trapped intron (Gtf2i: exon 3/Gtf2ird1:
exon 4) and a common primer located in the LacZ gene of the trapping cassette. PCR products
were sub-cloned into TA-cloning vectors (Invitrogen) and sequenced by The Centre of Applied
Genomics (Toronto). Genomic insertion points were identified in genomic DNA derived from
XS0608 and YTA369 ES cells using the same exon specific primers and the reverse primer
gtEn2i1R (Table 4.2). PCR products were sub-cloned into TA-cloning vectors (Invitrogen
Canada Inc., Burlington, ON) and sequenced by The Centre of Applied Genomics (Toronto).
232
Table 4.2. Primers Used in Genotyping of Gtf2iloxP
and Gene Trap Mice
Primer Name Sequence Amplicon Size (bp)
Primers Used to Confirm Targeting
mGTF2Ie3-F GCCTGCATTGCTGTGTATGA 245bp with gtGEO-R
mGTF2IRD1e4-F AGTGCTCGGATGTGTACCTG 195bp with gtGEO-R
gtGEO-R GTTTTCCCAGTCACGACGTT
Primers Used for Genotyping
BZP1-F CGGAAGAGCGCCCAATAC 350 bp
2i-GR CTTAGCATTCCAGGCCTCTG
GTloxP71-GF TGGGAACTCTACTGCCCTTG With gtGEO-R
Cre-F ATGTCCAATTTACTGACCG 420 bp
Cre-R CGCCGCATAACCAGTGAAAC
GT-DEL-GF AAGGGGAGATGCCAGAGACT 200 bp
GT-DEL-GR GCTGATCCGGAACCCTTAAT
GT-DUP-GF CAAGCACTGGCTATGCATGT 250 bp
GT-DUP-GR GTTTTCCCAGTCACGACGTT
mGTF2Igt-GF GGGAGTGGGACCCTTAAACT 210 bp with gtEN2i1-GR
mIRD1gt-GF CCCACCCACCTTATCTGAAC 470 bp with gtEN2i1-GR
gtEN2i1-GR GGGTCTCTTTGTCAGGGTCA
4.2.6: Expression analysis of gene trap ES cells:
Expression analysis was carried out using total RNA extracted from dissected adult
frontal cortex with TriReagent (Sigma-Aldrich Canada, Oakville, ON). Following DNase
233
treatment (Turbo DNA free, Ambion), 5 g of RNA was converted to cDNA using the
SuperScript™ First-Strand Synthesis System (Invitrogen Canada Inc., Burlington, ON) and
random hexamer primers Samples were diluted 1/100 with sterile water and used directly in real-
time assays using the Power SYBR Green PCR Master mix and ABI Prism 7900HT sequence
detection system (Applied Biosystems, Foster City, CA). Primers used in the expression analysis
of gene trap clones are listed in Table 4.1. Absolute quantification analysis was used with
expression levels normalized to the control genes Hmbs and Sdha. All samples were run in
triplicate and the experiment was repeated twice with consistent results.
234
Table 4.3. Primers Used in Expression Analysis of Gene Trap Clones
Primer Name Sequence
mGtf2iRT-e3F TCATGGCCCAAGTAGTGATG
mGtf2iRT-e3R ATGAGGAAGGTCACCACCAT
mGtf2iRT-e4F AGAGCTGGCCAAGTCCAAG
mGtf2iRT-e4R CCTCTTTCGGTTCCAACAAC
mGtf2iRT-e5F CGCCGAGATGCATAAGATG
mGtf2iRT-e5R CAGAAATAGTCCTCCACCGTTT
mGtf2iRT-e24F CCAACAACAGCAGTCCTCAG
mGtf2iRT-e24R CTCGAGGCTTGAAGGGAAC
mGtf2iRT-e30F CAGGAAGATCACCATCAACC
mGtf2iRT-e30R AGATCCTCCTCATGGAGCTG
mGtf2iRT-e1F ACTGTGACATCCCCACCAAC
mGtf2ird1RT-e1R GAGTCTAAGGCGGACACCAG
mGtf2ird1RT-e8F CGAGGCTGTGGAAATTGTG
mGtf2ird1RT-e8R TGTGTCGCTCCTCCAGAATC
mHMBSRT-F TCCAAGAGGAGCCCAGCTA
mHMBSRT-R ATTAAGCTGCCGTGCAACA
mSdhaRT-F TGATCTTCGCTGGTGTGGATGTCA
mSdhaRT-R CCCACCCATGTTGTAATGCACAGT
235
4.2.7: Generation of gene trap mice:
Clone XS0608 (Gtf2ird1) and YTA369 (Gtf2i) were used to generate mutant mice after
injection into C57BL/6 blastocysts. The resulting chimeras were bred to CD1 females (albino) to
identify germ line transmitting mice by the presence of dark fur in the offspring. Mice were
genotyped using conventional PCR methods using primers listed in Table 4.4.
Table 4.4. Primers Used to Genotype Gene Trap Mice
Primer ID Sequence Amplicon size
gtIRD1i4F 5'-CCCACCGACCTTATCTGAAC-3'; 466 bp
gtEn2i1R 5'-GGGTCTCTTTGTCAGGGTCA-3'
mGTF2Ie3-F GCCTGCATTGCTGTGTATGA 364
gtGEO-R GTTTTCCCAGTCACGACGTT
To identify null mice as well as double heterozygous mice the resulting F1 Gtf2iGT+
and
Gtf2ird1GT+
mice, were inter-crossed.
4.2.8: Generation and characterization of Gtf2i gene family deletion mice:
To generate the intra-chromosomal deletion of Gtf2i and Gtf2ird1, mice carrying the
trapped Gtf2ird1 allele (Gtf2ird1GT+
) were crossed with Gtf2iloxP
mice that also carried the Cre
transgene under the control of the sycp1 promoter (Sycp1-Cre). ‗Trans-loxer‘ males carrying the
Gtf2ird1GT+
and Gtf2iloxP
alleles as well as the Sycp1-Cre transgene were crossed with wild type
females (Figure 4.4). Offspring were screened using conventional PCR methods with primers to
236
identify to presence of: Gtf2ird1GT+
, Gtf2iloxP
, Sycp1-Cre, as well as genomic rearrangements
resulting in a deletion or duplication (Table 4.5).
237
Table 4.5. Primers Used to Genotype Gtf2i Deletion Family Mice
Primer Sequence Amplicon size
BZP1-F CGGAAGAGCGCCCAATAC 350 bp
2i-GR CTTAGCATTCCAGGCCTCTG
gtIRD1i4F 5'-CCCACCGACCTTATCTGAAC-3'; 466
gtEn2i1R 5'-GGGTCTCTTTGTCAGGGTCA-3'
mGTF2Ie3-F GCCTGCATTGCTGTGTATGA 364
gtEn2i1R 5'-GGGTCTCTTTGTCAGGGTCA-3'
Cre-F ATGTCCAATTTACTGACCG 420 bp
Cre-R CGCCGCATAACCAGTGAAAC
GT-DEL-GF AAGGGGAGATGCCAGAGACT 200 bp
GT-DEL-GR GCTGATCCGGAACCCTTAAT
GT-DUP-GF CAAGCACTGGCTATGCATGT 250 bp
GT-DUP-GR GTTTTCCCAGTCACGACGTT
Mice identified as carrying the desired genomic rearrangements were further
characterized using quantitative PCR to identify changes in copy number of specific exons
within Gtf2i and Gtf2ird1. All samples were run in triplicate and the experiment was repeated
twice with consistent results. Real-time PCR was carried out using a 7900HT genetic analyzer
(Applied Biosystems, Foster City, CA) with 11 ul reactions, performed in triplicate, containing 5
ng of template for 40 cycles of amplification using Power®SYBR master mix (Applied
Biosystems, Foster City, CA). Primers used to identify genomic rearrangements in Gtf2i gene
family deletion and duplication mice are listed in Table 4.6. The DNA copy number of each
exon was obtained from a calibration curve that assumes the reference genome is diploid.
238
Genomic ratios were determined by comparing absolute copy number of the test genes to the
reference gene, Hmbs.
Table 4.6. qPCR Primers Used to Identify Genomic Rearrangements in Gtf2i Gene Family
Deletion and Duplication Mice
Primer Sequence
m2iRTe5-F CGCCGAGATGCATAAGATG
m2iRTe5-R CAGAAATAGTCCTCCACCGTTT
m2iRTe24-F CCAACAACAGCAGTCCTCAG
m2iRTe24-R CTCGAGGCTTGAAGGGAAC
m2iRTe30-F CAGGAAGATCACCATCAACC
m2iRTe30-R AGATCCTCCTCATGGAGCTG
m2iRTe35-F GCTGAAAGAGGCGGGAAT
m2iRTe35-R ATCTCACTGACGGGAACACG
mGtf2ird1-RTe1-F ACTGTGACATCCCCACCAAC
mGtf2ird1-RTe1-R GAGTCTAAGGCGGACACCAG
mGtf2ird1RT-e8F CGAGGCTGTGGAAATTGTG
mGtf2ird1RT-e8R TGTGTCGCTCCTCCAGAATC
mHMBSRT-F TCCAAGAGGAGCCCAGCTA
mHMBSRT-R ATTAAGCTGCCGTGCAACA
4.2.9: Determination of methylation status of loxP sites:
Bisulfite sequencing was used to determine the methylation status of cytosine residues
surrounding the loxP sites with the gene trap mice as well as the Gtf2iloxP
mice. The DNA was
extracted from the tail clippings of 3-4 week old mice using standard methods listed above.
239
DNA was processed using the EpiTeck Bisulfite Kit (Qiagen) following manufacturer‘s
instruction. Bisulfite treated DNA was amplified using standard PCR methods and primers
(Table 4.7) designed to amplify bisulfite–treated DNA (forward primer sequences did not
contain cytosine nucleotides and reverse primers did not contain Guanine nucleotides).
Amplified products were sub-cloned into TA-cloning vectors (Invitrogen Canada Inc.,
Burlington, ON) and sequenced by The Centre of Applied Genomics (Toronto).
Table 4.7. Primers Used in Bisulfite Sequencing
Primer Sequence Amplicon size
lox71-BS-F GGTTTTTTTTGGGAATTTTATTGTT 293 bp
lox71-BS-R AAAATCTAACTACTTATCCACAACCAAC
loxP-BS-F GTTTAATATTTGTATGGTTTTGGG 253 bp
loxP-BS-R AAATCCTCTAAAATCCAAATCTAC
p5‘loxP-BS-F AGTGTGTTTAGAGTTTGGGTTGTAG 230 bp
p5‘loxP-BS-R AAATATACATAAAACAAACAAAATAAC
lox71 site generated by Cre induced recombination of the lox71 and loxP sites within the gene trap cassette can be amplified using lox71-BS-F/loxP-BS-R (Amplicon size 206bp).
4.2.10: X-gal staining of the mouse cortex:
Mice were perfused with PBS containing 2mM MgCl2 (PBS+Mg) followed by freshly
made 2% PFA/0.2% glutaraldehyde in PBS+Mg. Tissues were frozen in isopentane on dry ice
and 50 uM sections were cut on a cryostat. Free-floating sections were rinsed in PBS+Mg then
fixed for 10 minutes in 2% PFA/0.2% glutaraldehyde in PBS+Mg. Sections were rinsed in
PBS+Mg several times and immersed in LacZ staining solution containing: 5mM Potassium
240
ferricyanide, 5mM potassium ferrocyanide, 0.01% sodium deoxycolate/0.02% NP40, 1mg/ml X-
Gal in PBS+Mg. Sections were incubated until sufficient staining could be observed. For TFII-
I-LacZ fusion proteins this was typically 4 hours at 37°C or overnight at room temperature. For
TFII-IRD1-LacZ fusion proteins, typically an overnight incubation at 37°C was required.
Sections were washed several times with PBS+Mg, transferred to slides, counterstained with
Eosin Y, dehydrated, and mounted in Cytoseal.
4.3: Results:
Data from this section has been included in the following publication:
Proulx E, Young EJ, Osborne LR, Lambe EK. Enhanced prefrontal serotonin 5-HT1A currents
in a mouse model of Williams-Beuren syndrome with low anxiety. Journal of
Neurodevelopmental Disorders. 2:99-108.
I performed X-gal staining of the mouse cortex in the Gtf2ird1 gene trap mouse that was
included in the above publication.
4.3.1: Generation and characterization of Gtf2iloxP
mice:
The murine Gtf2i locus was originally targeted using the 3‘/5‘ Hprt gene cassettes
developed by Alan Bradley (Zheng et al., 1999). Two independent mouse lines, G7 and G84,
were generated. Upon analysis, It was determined that the design of the targeting vector would
not have resulted in the disruption of the Gtf2i open reading frame (ORF) since the disrupted
sequence was downstream of both the termination codon and the poly-adenylation site.
Integration of the targeting vector would however have inserted a loxP site that could then be
used as an end point for the generation of the minimal critical region deletion using Cre-induced
241
genomic re-arrangements. 168 sub clones were isolated and screened by Southern blotting with
NheI and using the isolated SmaI fragment as a probe and 24 clones were initially identified as
being properly targeted for Gtf2i. The originally targeted ES cells lines were re-screened and
several correctly targeted clones identified. Correct targeting was verified using real time PCR
and analyzing gene copy number of exon 5 (single copy) and exon 30 (duplicated) (Figure 4.5).
One of these correctly targeted ES clones, 1-4-10, was aggregated at the University of
Connecticut Gene Targeting and Transgenic Facility (GTTF) producing 14 chimeras. Germ-line
transmission was verified by crossing male chimeric mice with CD-1 females. Germ-line
transmitting chimeras were identified and used to establish Gtf2iloxP
breeding lines. Correctly
identified ES clone 1-4-10 was used to generate multiple high quality chimeric mice at the
Toronto Centre for Phenogenomics (TCP).
242
4.3.2: Identification and characterization of gene trap mice:
LoxP-containing gene trap ES clones from the international gene trap consortium (IGTC)
were identified for both Gtf2i (YTA369) and Gtf2ird1 (XS0608). The trapping cassette had
inserted in intron three of the Gtf2i gene and in intron four of the Gtf2ird1 gene. Insertion points
were identified using forward primers in the immediate upstream exon three of Gtf2i and exon
243
four of Gtf2ird1 and a reverse primer generated within the 5‘ region of the trapping cassette.
PCR products were isolated, cloned in the TA-cloning vectors (Invitrogen) and directly
sequenced. Mice were generated from Gtf2i (YTA369) and Gtf2ird1 (XS0608) ES cells by
blastocyst injections were performed at the Toronto Centre for Phenogenomics (TCP) and germ
line transmitting chimeras were identified for both lines.
4.3.3: Gtf2ird1GT+
null mice are viable, Gtf2iGT+
null mice are embryonic lethal:
For each line, mice heterozygous for the targeted allele were mated together in order to
produce mice homozygous for the targeted allele. Mice homozygous for Gtf2ird1-trapped allele
have been identified but, to date, no mice homozygous for the Gtf2i-trapped allele have been
identified. Mice heterozygous for each of the Gtf2i and Gtf2ird1-trapped allele were also
successfully intercrossed to generate mice carrying both of the trapped alleles (double
heterozygotes) (Figure 4.6). Preliminary analysis of crosses between Gtf2ird1-trapped
heterozygotes produced offspring in the expected 1:2:1 Mendelian ratio (62:126:56; χ2= 0.56,
df=2, P>0.05). Assuming that homozygosity of the trapped Gtf2i allele results in embryonic
lethality, preliminary analysis of crosses between Gtf2i-trapped heterozygotes did not produce
offspring in the expected 1:2 ratio (94:141; χ2= 4.91, df=1, P<0.05). Consistent with the loss of
homozygous Gtf2i gene trapped mice, the average litter size for the heterozygous crosses
involving Gtf2i mice were significantly less than for Gtf2ird1 mice (Gtf2ird1, 6.7 ± 0.49, n=18;
Gtf2i, 4.8 ± 0.83, n=9; t=5.70, P<0.001).
244
4.3.4: Reduced expression of “trapped” alleles:
It was determined using quantitative PCR (qPCR) that a 30% reduction in the expression
of the gene-trapped allele was detected (Gtf2ird1 exon 8 – Figure 4.7), in the brain of
heterozygous Gtf2ird1 gene trap mice. The increased expression observed using Gtf2ird1 exon 1
primers is due to the gene trap mechanism. There was no alteration in the expression of Gtf2i in
heterozygous Gtf2ird1 gene trap mice. Mice heterozygous for the Gtf2i gene trap allele display a
40-60% reduction in the expression of the targeted gene (Figure 4.7). Interestingly, a 20%
reduction in Gtf2ird1 expression was observed in heterozygous Gtf2i gene trap mice. The
reduction in gene expression also translates into a reduction in protein products TFII-I and TFII-
IRD1 in both lines (Figure 4.8).
245
246
4.3.5: TFII-IRD1 protein expression is predominantly in layer V of the frontal cortex:
Gene expression in the adult mouse brains of the resulting lacZ-fusion proteins from both
the Gtf2i and Gtf2ird1-trapped alleles was examined using X-Gal staining. Examination of
coronal sections from a similar location to that used for the electrophysiological recordings
showed that expression of the TFII-IRD1-LacZ fusion protein is predominantly in layer V of the
prefrontal cortex of the Gtf2ird1GT+
mice (Figure 4.9A-C). Some staining could also be seen in
layer I but was noticeably absent from layer II/III.
247
Distinct staining was also evident in the central nucleus of the thalamus (4.9D) the raphe
nucleus (4.9E), the hypothalamus (4.9F), in the Purkinje cell layer (4.9G) as well as the lateral
septum, brain stem regions and strong staining was observed in the olfactory bulbs. The
expression is relatively weak, with a long incubation time in the staining solution necessary to
develop appreciable staining. All cells possess endogenous β-galactosidase activity; however the
pH of the staining conditions used is suboptimal for endogenous activity. An area where TFII-
IRD1 expression was noticeably absent was the granule layer of the hippocampus.It should be
noted that diffuse staining was observed after staining of non-LacZ fusion expressing control
mice but that punctuate staining similar to that found in TFII-IRD1-LacZ fusion mice was not
seen in any areas with the exception of the piriform cortex where light punctuate staining was
identified.
248
249
4.3.6: TFII-I protein is strongly expressed throughout the brain:
TFII-I expression is strong throughout the brain (Figure 4.10). Consistent with
quantitative PCR results in previous chapters, staining for TFII-I-LacZ fusion protein required
only a short incubation time (4 hours). Of particular note is that TFII-I-LacZ is expressed in the
granule (pyramidal) cell layer of the hippocampus and dentate gyrus, including the outer
molecular layer of the dentate gyrus; the location of the basal dendrites of the pyramidal cells. In
cortical regions, TFII-I-LacZ expression was highest in cortical layers II/III and almost absent in
layer I.
250
4.3.7: Determination of methylation status of loxP sites:
It had been previously reported that the recombination efficiency of loxP sites that had
been exposed to Cre recombinase during spermatogenesis was greatly reduced (Rassoulzadegan
et al., 2002). Therefore the methylation states of the loxP sites in mice used in the generation of
the Gtf2i gene family deletion and reciprocal duplication were analyzed using bisulfate
sequencing (Figure 4.11). There were multiple cytosines that were identified to be methylated
and similar to promoter sequences, the methylation occurred at CpG dinucleotides. Surprisingly
methylation appears to have occurred even in animals that have never been exposed to Cre
recombinase. GT993 is an F1 heterozygote from one of the identified germ line transmitting
Gtf2ird1 gene trap chimeras. The gene trap cassette contains two loxP sites flanking the splice
acceptor site (―floxed‖ SA); a standard loxP and one that contains an altered 5‘ region (lox71).
Methylated CpG dinucleotides were found by bisulfite sequencing at both the loxP and lox71
sites. These sites would have been methylated before the exposure to the Scyp1-cre transgene.
GT993 was also crossed with Cre2i-11.2, a female targeted Gtf2iloxP
, Sycp1-Cre expressing
mouse, to generate the trans-loxer male GT26-11. Although all the loxP sites identified in
GT26-11 were determined to be methylated, Cre-induced recombination was observed (albeit
over a short distance) deleting the floxed splice acceptor site within the gene trapped allele
(Figure 4.11).
251
252
4.3.8: Identification of cre-induced genomic recombination:
Although breeding can produce double heterozygous mice, these double heterozygotes
cannot be maintained from generation to generation using this strategy. Therefore mice carrying
the trapped Gtf2ird1 allele were crossed with the previously existing Gtf2iloxP
endpoint line (1-4-
10) that also expresses the Cre recombinase gene under the male germ-line specific Sycp1
promoter (Sycp1-Cre). Four male mice (―trans-loxer‖ males) carrying the gene trap Gtf2ird1
allele (Gtf2ird1GT+
), the targeted Gtf2i-endpoint allele (Gtf2iloxP
) and the Cre recombinase
transgene (Sycp1-Cre) were mated with wild type females producing 20 litters and offspring
were screened for the presence of recombination. A recombination event generating an
approximately 200 kb deletion encompassing both of the Gtf2i and Gtf2ird1 genes (Gtf2i gene
family deletion) was identify in 1 of 238 offspring (0.42% - Table 4.8) and verified using real-
time PCR (Figure 4.12) and DNA sequencing (not shown). Since the gene trap allele contains a
floxed splice acceptor site (two loxP sites), and this may impede cre-induced recombination,
trans-loxer males carrying a single loxP site within the gene trap allele (Gtf2ird1GTΔ
) were
generated. Seven trans-loxer males were mated with wild type females producing 14 litters.
Mice carrying the deletion of Gtf2i and Gtf2ird1 or the reciprocal recombination product
resulting in the duplication of Gtf2i were identified in 7 of 128 offspring (5.5% - Table 4.8). An
approximately 50% reduction in TFII-I expression was also seen in the mouse carrying the
hemizygous deletion of the Gtf2i gene family (Figure 4.8). Determination of TFII-IRD1 levels
has yet to be verified.
253
Table 4.8. Trans-Loxer Males, Litter Sizes and Efficiency of Cre-Induced Recombination
# of mating pairs # of litters Recombination Rate
(trans) Efficiency
Trans-loxer with
intact gene-trap
allele (3 loxP
sites)
4 20 1 in 238 0.42%
Trans-loxer with
deleted gene-trap
allele (2 loxP
sites)
7 14 7 in 128 5.5%
254
4.4: Conclusion and Discussion:
Direct genotype/phenotype correlation in WBS is difficult due to the small number of
atypical deletion patients and the variable expression of many aspects of the WBS phenotype,
likely the result of genetic background within these individuals. What is clearly evident from the
existing mouse models for individual genes within the commonly deleted region is that WBS is a
contiguous gene deletion disorder and that haploinsufficiency for any one gene alone is not
sufficient to produce the full WBS phenotype. Therefore, the resulting WBS phenotype is likely
the result of the combinatorial effect of the deletion of multiple genes within the commonly
deleted region. A mouse model has recently been created that uses two overlapping Cre-induced
deletions from Gtf2i to Limk1 (proximal deletion, PD) and Limk1 to Trim50 (distal deletion, DD)
to generate a hemizygous deletion of the WBS syntenic region (chromosome 5G2) in the mouse
(P/D) (Li et al., 2009). It should be noted that in this model the deletions are contained on
separate chromosomes and therefore a mouse carrying one copy of each chromosome (P/D)
would be homozygously deleted for Limk1; inconsistent with what is seen in individuals with
WBS. Gene expression levels were reduced approximately 50% for all genes tested including
Limk1 that oddly was found also to be expressed at 10% of wild type levels in the P/D mice
although P/D mice are homozygous for the targeted Limk1 locus.
The endpoint loci are targeted using a similar gap repair strategy to the one used in this
report to target Gtf2i (Zhang et al., 1994). Using this method, it is still possible to produce full-
length transcripts, although the ORF within these transcripts will likely be disrupted by the
duplication of exons during the gap repair process. Detection of Limk1 expression in P/D mice
indicates that a transcript is still being produced although the authors do not indicate whether the
transcript generated is an intact wild-type or an aberrant transcript. Interestingly, Baz1b
255
expression was found in all deletions to be decreased by 40% even in the proximal deletion
containing two intact copies of Baz1b, suggesting a complex transcriptional regulatory system
that may contain trans-acting transcriptional mechanisms. Oddly, there are important
phenotypic aspects of WBS including hippocampal-based contextual fear conditioning; sound
sensitivity; as well as sensorimotor processing that are surprisingly absent in the complete
deletion of the WBS region (Li et al., 2009).
The generation of these large deletions of the syntenic WBS region is mice do not
provide a great deal of novel information about the contribution of specific genes within the
region to the WBS phenotype, particularly the GTF2I gene family. Studies of atypical human
deletions indicate that the GTF2I gene family members GTF2I and GTF2IRD1 are associated
with many of the cognitive and behavioral aspects of WBS (Morris et al., 2003; Gagliardi et al.
2003). The generation of mouse models individually targeted for Gtf2i and Gtf2ird1 as well as a
deletion of both Gtf2i and Gtf2ird1 would allow for the deciphering of contribution made by
these Gtf2i gene family members, individually and collectively.
Although generation of large chromosomal rearrangements in mice to recreate human
genomic diseases is an impressive technical achievement, important understanding of the
contribution of the associated genes is often better elucidated by studying smaller deletions of
specific genes. Smith-Magenis syndrome (SMS), characterized by multiple congenital
anomalies and mild mental retardation, is seen in individuals possessing a 3.7 Mb deletion of
17p11.2 (Greenberg et al., 1996; Chen et al., 1996). In Df(11)17 mice deleted for the 2 Mb
deletion of the syntenic region of the human SMS common deletion, the SMS phenotype is
largely recapitulated including craniofacial abnormalities, obesity, seizures and neurobehavioral
abnormalities (Walz et al., 2003; Walz et al., 2004). However, this model still does not provide
256
any further understanding of the contributions made by the deleted genes. Identification of
frame shift and nonsense mutations in RAI1 in 5 SMS patients and generation of Rai1+/-
mice
having a similar phenotype to Df(11)17 mice indicated that changes in the expression levels of
RAI1 is responsible the majority of the SMS phenotype. It was however noted that in these mice,
the genetic background and size of deletion of the mice strongly affected the craniofacial
phenotype indicating that modifiers exist that also govern the expression of the SMS phenotype.
Simply breeding Gtf2i and Gtf2ird1 models together could generate mice heterozygous
for Gtf2i and Gtf2ird1. However generating deletion of both genes on the same chromosome has
several advantages. Firstly, gene trap models are often hypomorphs with incomplete trapping of
the gene locus resulting only in a decrease in the expression of the trapped gene. Although the
preliminary expression analysis determined that the Gtf2i gene trap line does result in an
approximately 50% reduction in the expression of Gtf2i, the Gtf2ird1 gene trap line appears to
have a reduction of only about 30% of the regular expression of Gtf2ird1 in the heterozygotes
and a reduction of 60-70% in the homozygous mice resulting from the skipping of the gene trap
cassette (Figure 4.1). Therefore, a double heterozygous mouse would result in Gtf2ird1
expression levels that are inconsistent with 50% decrease in expression levels that are observed
in individuals with WBS (see chapter 2). Given that the existing targeted Gtf2ird1 mouse model
presented in chapter 3 expresses an aberrant transcript, the most relevant model to understand the
role of GTF2I and GTF2IRD1 in WBS would be a mouse containing an intra-chromosomal
deletion of both genes. It is interesting to note that the expression of Gtf2ird1 is affected in the
Gtf2i gene trap mice. Heterozygous Gtf2i gene trap mice showed a 20% reduction in the
expression of TFII-IRD1 (Figure 4.7). The cause of the reduced Gtf2ird1 expression is unknown
257
but given their proposed role in the co-regulation of gene expression (see Section 1.1.10 and
1.1.11), the decreased Gtf2i expression may lead to the suppression of Gtf2ird1 expression.
Recently, gene trap mouse models have also been reported for both Gtf2i and Gtf2ird1
(Enkhmandakh et al., 2009). The Gtf2i gene trap described in this paper (XE029) is similar in
targeting location (intron 3) to the gene trap clone used in the present work (YTA369) and
therefore although only limited phenotypic analysis was performed, the phenotypic effects are
predicted to be similar. Consistent with Enkhmandakh et al., no surviving Gtf2i-/-
pups were
found after genotyping of over 150 pups from an intercross of Gtf2i F1 heterozygous mice. In
the published report, development was found to be abnormal, with multiple manifestations
including brain hemorrhaging and neural tube deficits resulting in embryonic lethality of Gtf2i-/-
embryos between embryonic day 8.5 and 12.5 (Enkhmandakh et al., 2009). Similar phenotypic
results were also observed for Gtf2ird1 gene trap mice (XE465). However, unlike Enkhmandakh
et al., homozygosity for the Gtf2ird1 gene trap reported in this thesis (XS0608) did not result in
embryonic lethality. XS0608 Gtf2ird1-/-
gene trap mice are viable and do not show any of the
physical abnormalities reported by Enkhmandakh et al including microcephaly or skeletal and
craniofacial defects reported in a large number of XE465 Gtf2ird1 homozygotes. This
discrepancy is likely due to differences in the location and nature of the gene disruption between
the XE465 line and our XS0608 gene trap and targeted knockout lines. The trapping cassette in
the Gtf2ird1 gene trap reported by Enkhmandakh et al (XE465) would result in the generation of
an almost full length TFII-IRD1-LacZ fusion protein that would still contain four of the six I-
repeats and would reside exclusively in the cytoplasm instead of the predominant nuclear
localization of wild type TFII-IRD1 (See Chapter 3.4.1). Therefore the generation of an intra-
258
chromatidal deletion of both Gtf2i and Gtf2ird1 represents an improved model for the study of
the contribution made by Gtf2i and Gtf2ird1 to the WBS phenotype.
A deletion of Gtf2i and Gtf2ird1 was originally generated using traditional in vitro
techniques but we were unable to generate germ-line transmitting chimeras of the double
deletion (data not shown) likely due to the large amount of manipulation of the embryonic stem
cells during targeting and selective culturing. Therefore to avoid the problems associated with
the large amount of manipulation necessary to generate the deletion in vitro, an in vivo method
was used. The TAMARE strategy, previously used to create serial deletions within the HoxD
gene cluster (Hérault et al., 1998), was used to successfully generate a 225 kb deletion of
Gtf2ird1 and Grf2i as well as the reciprocal duplication of Gtf2i. It had been reported
(Rassoulzadegan et al., 2002) that Cre-induced recombination during spermatogenesis results in
the methylation of CpG dinucleotides within the loxP recognition site thereby rendering the site
refractory to further recombination. This finding is of great importance since the proximal
endpoint mice (Gene traps) contain a ―floxed‖ splice acceptor site. In order to generate the
deletion, the acceptor site would first be excised likely with great efficiency given the close
proximity of the loxP sites flanking the splice acceptor site. If in the process the loxP site was
methylated thereby preventing any further recombination the generation of the deletion and
reciprocal duplication would not be possible.
Although methylation of CpG dinucleotides was observed using bisulfite sequencing,
mice carrying the deleted and duplication regions were subsequently detected. Surprisingly,
unlike reports by Rassoulzadegan et al, methylation of loxP sites at this locus appears not be
dependent upon exposure to Cre recombinase since methylation of loxP sites was detected even
in the F1 offspring of chimeric gene trap mice. Methylation of CpG dinucleotides was also
259
detected in the F1 offspring (Cre2i) of distal Gtf2i endpoint mice that had been crossed to female
sycp1-Cre mice. Since it is believed that the sycp1 promoter is only active during
spermatogenesis in males, the loxP sites within Cre2i mice have also not been exposed to Cre
recombinase. Therefore, at least at this particular genomic locus, methylation of loxP sites does
not appear to hinder their ability to recombine. This may be due to the young age at which tail
biopsies were obtained in this study (three weeks), since methylation was reported previously to
increase with age from three weeks to three months (Rassoulzadegan et al., 2002).
The efficiency of in vivo recombination (0.4.2-5.5%) was at the low end of the expected
range of between 1% and 12% (Herault et al., 1998; Genoud et al., 2004). This may have been
due to the presence of the methylated loxP sites or because of the large interval (225 kb) between
the loxP sites. In addition, although the loxP sites that flank the splice acceptor sites within the
gene trap allele are separated only by 378 base pairs, the presence of multiple loxP sites results in
a ten fold decrease in the efficiency of cre-induced recombination between sister chromatids
(trans), although the deletion of the intervening 378 base pairs (cis) is highly efficient (data not
shown). If only trans-loxer containing two loxP sites (in trans) are considered, the efficiency is
consistent with previous reports.
Deletions of up to 28 Mb have been generated in vivo when the loxP sites were in the cis
configuration (Spitz et al., 2005). However, the deletion of Gtf2i/Gtf2ird1 and reciprocal
duplication of Gtf2i is the largest in vivo rearrangement reported using the TAMERE strategy
when loxP sites are in the trans configuration (Brault et al., 2006). Using a similar strategy,
further mouse models can be created either by the generation of new mouse models or the
identification of existing mouse models carrying loxP sites in the proper orientation and then
employing the TAMERE strategy to create the desired genomic rearrangements. The generation
260
of the Gtf2i/Gtf2ird1 deletion as well as the duplication of Gtf2i in this report will allow for
further elucidation of the roles that these genes play in the WBS and expressive language
impairment respectively.
The generation of a mouse model carrying a deletion of both Gtf2i and Gtf2ird1 on the
same chromosome as well as a second mouse model containing a duplication of Gtf2i is an
important technical advancement. An important step in elucidating the roles of Gtf2i and
Gtf2ird1 is to determine the temporal and spatial distribution of both genes. Fortunately the
strategy used to trap both Gtf2i and Gtf2ird1 results in the production of LacZ fusion protein that
is expressed under the control of the endogenous promoters of the trapped genes.
Consistent with the expression patterns observed in the previously generated LacZ-
Gtf2ird1 mouse model (Palmer et al., 2007), lacZ staining for TFII-IRD1 showed expression in
all regions including layer V pyramidal cells of the frontal cortex, the basolateral nucleus of the
amygdala (BLA), the dorsal raphe nucleus as well as thalamic and hypothalamic regions have all
been associated with alterations in both fear and aggression through lesion studies in both
rodents and humans (Nelson and Chiavegatto, 2000; Seiver, 2008). Layer V pyramidal cells are
the primary output neurons of the prefrontal cortex sending projections to the amygdala,
hypothalamus, and striatum and are the only source of cortical feedback to several key
neuromodulatory nuclei including the dorsal raphe nucleus which receives its only cortical
projection from layer V pyramidal cells of the prefrontal cortex (Gonçalves et al., 2009; Gabbott
et al., 2005; Peyron et al., 1998; Vertes et al., 2004). Expression of TFII-IRD1 in layer V also
correlates with TRPC4 expression that was shown by microarray analysis and western blotting to
be reduced in frontal cortexes of the targeted Gtf2ird1 mice. Consistent with previous reports
(Danoff et al., 2004; Palmer et al., 2007), significant staining was also observed in the Purkinje
261
cell layer of the cerebellum suggesting that the loss of TFII-IRD1 in the Purkinje cells may be
the underlying cause of the possible deficits in motor co-ordination seen in the Gtf2ird1 mice.
Expression levels of TFII-I were considerably higher throughout the brain relative to
TFII-IRD1 expression consistent with previous mRNA expression data (Enkhmandakh et al.,
2009). Of particular note are the regions where TFII-I and TFII-IRD1 expression differed.
Consistent with the lack of spatial memory deficits seen in Gtfi2rd1 targeted mice, very little
expression is detected in the hippocampus of Gtf2ird1 mice, whereas TFII-I is expressed strongly
in the hippocampal pyramidal cell layers as well as weaker diffuse staining in the molecular
layer of the dentate gyrus in Gtf2i gene trap mice. Given the high amount of TFII-I expression in
the hippocampus, it would be expected that the reduction of TFII-I could have a significant
impact on spatial abilities. TFII-I expression is also notably weaker in cortical layer V pyramidal
cells with cortical expression being greatest in layers 2/3, a region that shows little TFII-IRD1
expression. It has been proposed that TFII-I and TFII-IRD1 may perform opposing roles within
the same cell type, but from differences in expression levels in specific brain regions, it is clear
that each gene likely performs specific function in these regions that are independent of one
another. Comparison of the individual gene models with the double knockout will provide
important insight into the roles that these transcription factors play both individually and
collectively in WBS.
Although the ―proximal deletion‖ mouse generated by Li et al., (2009) contains a
hemizygous deletion of Gtf2i and Gtf2ird1, it also contains single copies each of Limk1 and
Clip2, both of which have also been implicated in the cognitive and behavioral aspects of WBS.
The generation of a double deletion of only Gtf2i and Gtf2ird1 will allow for the comparison of
the resulting phenotype of the existing proximal deletion mice to determine the contribution
262
made specifically by these genes to the WBS phenotype. Since the deletion of both genes were
generated on single chromosome, mice carrying the deletion of Gtf2i and Gtf2ird1 can also be
crossed with existing mouse lines carrying targeted genes of any of the remaining genes within
the commonly deleted region (e.g. Limk1 or Clip2 independently) to determine the combinatorial
effect of the loss of these genes.
In addition, analysis of the vocalization patterns in Gtf2i duplication mice will determine
whether the severe expressive language delay seen in individuals with the 7q11.23 duplication
results from increased Gtf2i expression. Initial analyses identified region-specific expression of
both TFII-I and TFII-IRD1 in adult brain and these can be extended to include detailed map of
expression in adults and during development. Since antibodies specific for TFII-IRD1 are not
available, LacZ/TFII-IRD1 fusion protein produced by the Gtf2ird1 gene trap mouse model will
allow for the study of the expression of TFII-IRD1 including the co-localization of TFII-IRD1
with prospective candidate genes.
263
4.5: References:
Aasland R, Gibson TJ, and Stewart AF. (1995) The PHD finger: implications for chromatin-
mediated transcriptional regulation. Trends in Biochemical Sciences. 20:56-59.
Ashe A, Morgan DK, Whitelaw NC, Bruxner TJ, Vickaryous NK, Cox LL, Butterfield NC,
Wicking C, Blewitt ME, Wilkins SJ, Anderson GJ, Cox TC, and Whitelaw E. (2008) A
genome-wide screen for modifiers of transgene variegation identifies genes with critical
roles in development. Genome Biology. 9:R182.
Buehr M, and Smith A. (2003) Genesis of embryonic stem cells. Philosophical Transactions of
the Royal Society B. 358:1397-1402.
Brault V, Pereira P, Duchon A, and Hérault Y. (2006) Modeling chromosomes in mouse to
explore the function of genes, genomic disorders, and chromosomal organization. PLoS
Genetics. 2:e86.
Camper SA, Saunders TL, Kendall SK, Keri RA, Seasholtz AF, Gordon DF, Birkmeier TS,
Keegan CE, Karolyi IJ, Roller ML, et al. (1995) Implementing transgenic and embryonic
stem cell technology to study gene expression, cell-cell interactions and gene function.
Biology of Reproduction. 52:246-257.
Chen KS, Potocki L, and Lupksi JR. (1996) The Smith-Magenis syndrome [del(17)p11.2]:
Clinical review and molecular advances. Mental Retardation and Developmental
Disabilities Research Reviews. 2:122-129.
Crackower MA, Kolas NK, Noguchi J, Sarao R, Kikuchi K, Kaneko H, Kobayashi E, Kawai Y,
Kozieradzki I, Landers R, Mo R, Hui CC, Nieves E, Cohen PE, Osborne LR, Wada T,
Kunieda T, Moens PB, and Penninger JM. (2003) Essential role of Fkbp6 in male fertility
and homologous chromosome pairing in meiosis. Science. 300:1291-1295.
Danoff SK, Taylor HE, Blackshaw S, and Desiderio S. (2004) TFII-I, a candidate gene for
Williams syndrome cognitive profile: parallels between regional expression in mouse brain
and human phenotype. Neuroscience. 123:931-938.
DeSilva U, Elnitski L, Idol JR, Doyle JL, Gan W, Thomas JW, Schwartz S, Dietrich NL,
Beckstrom-Sternberg SM, McDowell JC, Blakesley RW, Bouffard GG, Thomas PJ,
Touchman JW, Miller W, and Green ED. (2002) Generation and comparative analysis of
approximately 3.3 Mb of mouse genomic sequence orthologous to the region of human
chromosome 7q11.23 implicated in Williams syndrome. Genome Research. 12:3-15.
De Zeeuw CI, Hoogenraad CC, Goedknegt E, Hertzberg E, Neubauer A, Grosveld F, and Galjart
N. (1997) CLIP-115, a novel brain-specific cytoplasmic linker protein, mediates the
localization of dendritic lamellar bodies. Neuron. 19:1187-1199.
264
Dupé V, Davenne M, Brocard J, Dollé P, Mark M, Dierich A, Chambon P, and Rijli FM. (1997)
In vivo functional analysis of the Hoxa-1 3' retinoic acid response element (3'RARE).
Development. 124:399-410.
Durkin ME, Keck-Waggoner CL, Popescu NC, and Thorgeirsson SS. (2001) Integration of a c-
myc transgene results in disruption of the mouse Gtf2ird1 gene, the homologue of the
human GTF2IRD1 gene hemizygously deleted in Williams-Beuren syndrome. Genomics.
73:20-27.
Enkhmandakh B, Makeyev AV, Erdenechimeg L, Ruddle FH, Chimge NO, Tussie-Luna MI,
Roy AL, and Bayarsaihan D. (2009) Essential functions of the Williams-Beuren syndrome-
associated TFII-I genes in embryonic development. Proceedings of the National Acaademy
of Sciences (USA). 106:181-186.
Fujiki R, Kim MS, Sasaki Y, Yoshimura K, Kitagawa H, and Kato S. (2005) Ligand-induced
transrepression by VDR through association of WSTF with acetylated histones. EMBO
Journal. 24:3881-3894.
Fujiwara T, Mishima T, Kofuji T, Chiba T, Tanaka K, Yamamoto A, and Akagawa K. (2006)
Analysis of knock-out mice to determine the role of HPC-1/syntaxin 1A in expressing
synaptic plasticity. Journal of Neuroscience. 26:5767-5776.
Gabbott PL, Warner T, Jays PR, Salway P, and Busby S. (2005) Prefrontal cortex in the rat:
projections to subcortical autonomic, motor, and limbic centers. Journal of Comparative
Neurology. 492:145–177.
Gagliardi C, Bonaglia MC, Selicorni A, Borgatti R, and Giorda R. (2003) Unusual cognitive and
behavioral profile in a Williams syndrome patient with atypical 7q11.23 deletion. Journal
of Medical Genetics. 40: 526-530.
Gallin JI, and Malech HL. (1990) Update on chronic granulomatous diseases of childhood.
Immunotherapy and potential for gene therapy. Journal of the American Medical.
Association. 263:1533-1537.
Gardner RL, and Brook FA. (1997) Reflections on the biology of embryonic stem (ES) cells.
International Journal of Developmental Biology. 41:235-243.
Genoud N, Behrens A, Miele G, Robay D, Heppner FL, Freigang S, and Aguzzi A. (2004)
Disruption of Doppel prevents neurodegeneration in mice with extensive Prnp deletions.
Proceedings of the National Academy of Sciences (USA). 101:4198-4203.
Glaser S, Anastassiadis K, and Stewart AF. (2005) Current issues in mouse genome engineering.
Nature Genetics. 37:1187-1193.
Gonçalves L, Nogueira MI, Shammah-Lagnado SJ, and Metzger M. (2009) Prefrontal afferents
to the dorsal raphe nucleus in the rat. Brain Research Bulletin. 78:240–247.
Greenberg F, Lewis RA, Potocki L, Glaze D, Parke J, Killian J, Murphy MA, Williamson D,
Brown F, Dutton R, McCluggage C, Friedman E, Sulek M, and Lupski JR. (1996) Multi-
265
disciplinary clinical study of Smith-Magenis syndrome (deletion 17p11.2) American
Journal of Medical Genetics. 62:247-254.
Gu H, Zou YR, and Rajewsky K. (1993) Independent control of immunoglobulin switch
recombination at individual switch regions evidenced through Cre-loxP-mediated gene
targeting. Cell. 73:1155-1164.
Gu H, Marth JD, Orban PC, Mossmann H, and Rajewsky K. (1994) Deletion of a DNA
polymerase beta gene segment in T cells using cell type-specific gene targeting. Science.
265:103-106.
Hamilton DL, and Abremski K. (1984) Site-specific recombination by the bacteriophage P1 lox-
Cre system. Cre-mediated synapsis of two lox sites. Journal of Molecular Biology.
178:481-486.
Harbord M, Novelli M, Canas B, Power D, Davis C, Godovac-Zimmermann J, Roes J, and Segal
AW. (2002) Ym1 is a neutrophil granule protein that crystallizes in p47phox-deficient
mice. Journal of Biologic al Chemistry. 277:5468-5475.
Hérault Y, Rassoulzadegan M, Cuzin F, and Duboule D. (1998) Engineering chromosomes in
mice through targeted meiotic recombination (TAMERE). Nature Genetics. 20:381-384.
Hoogenraad CC, Eussen BH, Langeveld A, van Haperen R, Winterberg S, Wouters CH,
Grosveld F, De Zeeuw CI, and Galjart N. (1998) The murine CYLN2 gene: genomic
organization, chromosome localization, and comparison to the human gene that is located
within the 7q11.23 Williams syndrome critical region. Genomics. 53:348-358.
Hoogenraad CC, Koekkoek B, Akhmanova A, Krugers H, Dortland B, Miedema M, van Alphen
A, Kistler WM, Jaegle M, Koutsourakis M, Van Camp N, Verhoye M, van der Linden A,
Kaverina I, Grosveld F, De Zeeuw CI, and Galjart N. (2002) Targeted mutation of Cyln2 in
the Williams syndrome critical region links CLIP-115 haploinsufficiency to
neurodevelopmental abnormalities in mice. Nature Genetics. 32:116-127.
Hoogenraad CC, Akhmanova A, Galjart N, and De Zeeuw CI (2004) LIMK1 and CLIP-115:
linking cytoskeletal defects to Williams syndrome. Bioessays. 26:141-150.
Hultqvist M, Olofsson P, Holmberg J, Bäckström BT, Tordsson J, and Holmdahl R. (2004)
Enhanced autoimmunity, arthritis, and encephalomyelitis in mice with a reduced oxidative
burst due to a mutation in the Ncf1 gene. Proceedings of the National Academy of Sciences
(USA). 101:12646-12651.
Iizuka K, Bruick RK, Liang G, Horton JD, and Uyeda K. (2004) Deficiency of carbohydrate
response element-binding protein (ChREBP) reduces lipogenesis as well as glycolysis.
Proceedings of the National Academy of Sciences (USA). 101:7281-7286.
Jackson SH, Gallin JI, and Holland SM. (1995) The p47phox mouse knock-out model of chronic
granulomatous disease. Journal of Experimental Medicine. 182:751-758.
266
Janssen E, Zhu M, Zhang W, Koonpaew S, and Zhang W. (2003) LAB: a new membrane-
associated adaptor molecule in B cell activation. Nature Immunology. 4:117-123.
Koller BH, and Smithies O. (1989) Inactivating the beta 2-microglobulin locus in mouse
embryonic stem cells by homologous recombination. Proceedings of the National Academy
of Sciences (USA). 86:8932-8935.
Lam PP, Leung YM, Sheu L, Ellis J, Tsushima RG, Osborne LR, and Gaisano HY. (2005)
Transgenic mouse overexpressing syntaxin-1A as a diabetes model. Diabetes. 54:2744-
2754.
Lewandoski M, Wassarman KM, and Martin GR. (1997) Zp3-cre, a transgenic mouse line for the
activation or inactivation of loxP-flanked target genes specifically in the female germ line.
Current Biology. 7:148-151.
Li DY, Brooke B, Davis EC, Mecham RP, Sorensen LK, Boak BB, Eichwald E, and Keating
MT. (1998a) Elastin is an essential determinant of arterial morphogenesis. Nature.
393:276-280.
Li DY, Faury G, Taylor DG, Davis EC, Boyle WA, Mecham RP, Stenzel P, Boak B, and
Keating MT (1998b) Novel arterial pathology in mice and humans hemizygous for elastin.
Journal of Clinical Investigation. 102:1783-1787.
Liu P, Zhang H, McLellan A, Vogel H, and Bradley A. (1998) Embryonic lethality and
tumorigenesis caused by segmental aneuploidy on mouse chromosome 11. Genetics.
150:1155-1168.
McRory JE, Rehak R, Simms B, Doering CJ, Chen L, Hermosilla T, Duke C, Dyck R, and
Zamponi GW. (2008) Syntaxin 1A is required for normal in utero development.
Biochemical and Biophysical Research Communications. 375:372-377.
Meng Y, Zhang Y, Tregoubov V, Janus C, Cruz L, Jackson M, Lu WY, MacDonald JF, Wang
JY, Falls DL, and Jia Z. (2002) Abnormal Spine Morphology and Enhanced LTP in LIMK-
1 Knockout Mice. Neuron. 35:121-133.
Morris CA, Mervis CB, Hobart HH, Gregg RG, Bertrand J, Ensing GJ, Sommer A, Moore CA,
Hopkin RJ, Spallone PA, Keating MT, Osborne L, Kimberley KW, and Stock AD. (2003)
GTF2I hemizygosity implicated in mental retardation in Williams syndrome: genotype-
phenotype analysis of five families with deletions in the Williams syndrome region.
American Journal of Medical Genetics A. 123A:45-59.
Mouse Genome Sequencing Consortium, Waterston RH, Lindblad-Toh K, Birney et al., (2002)
Initial sequencing and comparative analysis of the mouse genome. Nature. 420:520-562.
Nelson RJ, and Chiavegatto S. (2000) Aggression in Knockout Mice. ILAR Journal. 41:153-
162.
Ohara-Imaizumi M, Fujiwara T, Nakamichi Y, Okamura T, Akimoto Y, Kawai J, Matsushima S,
Kawakami H, Watanabe T, Akagawa K, and Nagamatsu S. (2007) Imaging analysis
267
reveals mechanistic differences between first- and second-phase insulin exocytosis. The
Journal of Cell Biology. 177:695-705.
Palmer SJ, Tay ES, Santucci N, Cuc Bach TT, Hook J, Lemckert FA, Jamieson RV, Gunnning
PW, and Hardeman EC. (2007) Expression of Gtf2ird1, the Williams syndrome-associated
gene, during mouse development. Gene Expression Patterns. 7:396–404.
Peyron C, Petit JM, Rampon C, Jouvet M, and Luppi PH. (1998) Forebrain afferents to the rat
dorsal raphe nucleus demonstrated by retrograde and anterograde tracing methods.
Neuroscience. 82:443–468.
Ranheim EA, Kwan HC, Reya T, Wang YK, Weissman IL, and Francke U. (2005) Frizzled 9
knock-out mice have abnormal B-cell development. Blood. 105:2487-2494.
Rassoulzadegan M, Magliano M, and Cuzin F. (2002) Transvection effects involving DNA
methylation during meiosis in the mouse. EMBO Journal. 21: 440-50.
Robertson EJ. (1986) in: Teratocarcinomas and Embryonic Stem Cells: A Practical Approach.
IRL Press. Oxford/Washington DC.
Sauer B, and Henderson N. (1988) Site-specific DNA recombination in mammalian cells by the
Cre recombinase of bacteriophage P1. Proceedings of the National Academy of Sciences
(USA). 85:5166-5170.
Siever LJ. (2008) Neurobiology of Aggression and Violence. Americal Journal of Psychiatry.
165:429-442.
Spitz F, Herkenne C, Morris MA, and Duboule D. (2005) Inversion-induced disruption of the
Hoxd cluster leads to the partition of regulatory landscapes. Nature Genetics. 37:889-893.
Stanford WL, Cohn JB, and Cordes SP (2001) Gene Trap Mutagenesis past, present & beyond.
Nature Reviews Genetics. 2:756–768.
Thomas KR, and Capecchi MR. (1987) Site-directed mutagenesis by gene targeting in mouse
embryo-derived stem cells. Cell. 51:503-512.
Tkaczyk C, Horejsi V, Iwaki S, Draber P, Samelson LE, Satterthwaite AB, Nahm DH, Metcalfe
DD, and Gilfillan AM. (2004) NTAL phosphorylation is a pivotal link between the
signaling cascades leading to human mast cell degranulation following Kit activation and
Fc epsilon RI aggregation. Blood. 104:207-214.
Tsien JZ, Huerta PT, and Tonegawa S. (1996) The essential role of hippocampal CA1 NMDA
receptor-dependent synaptic plasticity in spatial memory. Cell. 87:1327-1338.
Uyeda K, Yamashita H, and Kawaguchi T. (2002) Carbohydrate responsive element-binding
protein (ChREBP): a key regulator of glucose metabolism and fat storage. Biochemical
Pharmacology. 63:2075-2080.
Vertes R. (2004) Differential projections of the infralimbic and prelimbic cortex in the rat.
Synapse. 51:32–58.
268
Volná P, Lebduska P, Dráberová L, Símová S, Heneberg P, Boubelík M, Bugajev V, Malissen B,
Wilson BS, Horejsí V, Malissen M, and Dráber P. (2004) Negative regulation of mast cell
signaling and function by the adaptor LAB/NTAL. Journal of Experimental Medicine.
200:1001-1013.
Walther MM, Malech H, Berman A, Choyke P, Venzon DJ, Linehan WM, and Gallin JI. (1992)
The urological manifestations of chronic granulomatous disease. Journal of Urology.
147:1314-1318.
Walz K, Caratini-Rivera S, Bi W, Fonseca P, Mansouri DL, Lynch J, Vogel H, Noebels JL,
Bradley A, and Lupski JR. (2003) Modeling del(17)(p11.2p11.2) and dup(17)(p11.2p11.2)
contiguous gene syndromes by chromosome engineering in mice: phenotypic
consequences of gene dosage imbalance. Molecular Cell Biology. 23:3646-3655.
Walz K, Spencer C, Kaasik K, Lee CC, Lupski JR, and Paylor R. (2004) Behavioral
characterization of mouse models for Smith-Magenis syndrome and dup(17)(p11.2p11.2).
Human Molecular Genetics. 13:367-378.
Yoshimura K, Kitagawa H, Fujiki R, Tanabe M, Takezawa S, Takada I, Yamaoka I, Yonezawa
M, Kondo T, Furutani Y, Yagi H, Yoshinaga S, Masuda T, Fukuda T, Yamamoto Y,
Ebihara K, Li DY, Matsuoka R, Takeuchi JK, Matsumoto T, and Kato S. (2009) Distinct
function of 2 chromatin remodeling complexes that share a common subunit, Williams
syndrome transcription factor (WSTF). Proceedings of the National Academy of Sciences
(U S A). 106:9280-9285.
Zeng L, and Zhou MM. (2002) Bromodomain: an acetyl-lysine binding domain. FEBS Letters.
513:124–128.
Zhang H, Hasty P, and Bradley A. (1994) Targeting frequency for deletion vectors in embryonic
stem cells. Molecular Cell Biology. 14:2404-2410.
Zhao C, Avilés C, Abel RA, Almli CR, McQuillen P, and Pleasure SJ. (2005) Hippocampal and
visuo-spatial learning defects in mice with a deletion of frizzled 9, a gene in the Williams
syndrome deletion interval. Development. 132:2917-2927.
Zheng B, Mills AA, and Bradley A. (1999) A system for rapid generation of coat color-tagged
knockouts and defined chromosomal rearrangements in mice. Nucleic Acids Research.
27:2354–2360.
Zheng B, Sage M, Sheppeard EA, Jurecic V, and Bradley A. (2000) Engineering mouse
chromosomes with Cre-loxP: range, efficiency, and somatic applications. Molecular Cell
Biology. 20:648-655.
Zijlstra M, Li E, Sajjadi F, Subramani S, and Jaenisch R. (1989) Germ-line transmission of a
disrupted beta 2-microglobulin gene produced by homologous recombination in embryonic
stem cells. Nature. 342:435-438.
.
269
CHAPTER V: SUMMARY AND FUTURE DIRECTION:
270
5.1: Introduction:
5.1.1: Summary:
Williams-Beuren syndrome (WBS) is a rare autosomal dominant disorder presenting with
a unique spectrum of physical and behavioral features caused by a deletion within the 7q11.23
region that occurs at a frequency of 1/7500 to 1/20,000 (Greenberg, 1990; Pober and Dykens,
1996; Stromme et al., 2002). The human 7q11.23 region is prone to genomic rearrangements
due to the presence of large low copy repeats (LCR) that flank the commonly deleted WBS
region. Although the vast majority of individuals with WBS possess a common 1.5 Mb deletion
within the 7q11.23 locus, other chromosomal rearrangements including larger and smaller
deletions as well as duplications and inversions have also been identified, each exhibiting their
own unique phenotypes (Botta et al., 1999; Fragiskakis et al., 1996; Gagliardi et al., 2003; Heller
et al., 2003; Hirota et al., 2003 Morris et al., 2003; Tassabehji et al., 1999, 2005; Blyth et al.,
2008; Osborne et al., 2001; Somerville et al., 2005).
The present work has combined both identification and evaluation of human patients and
the generation of specific mouse models in an attempt to further elucidate the features associated
with the various genomic rearrangements of 7q11.23. In humans, large genomic rearrangements
including deletions encompassing MAGI2 and duplication of the 1.5 Mb commonly deleted
WBS region were found to be associated with infantile spasms and severe expressive language
delay respectively (Marshall et al., 2008; Somerville et al., 2005).
Individuals possessing atypical WBS deletion have implicated genes at the telomeric end
of the commonly deleted WBS region including the transcription factors GTF2I and GTF2IRD1
with involvement in the cognitive and behavioral aspects of WBS (Tassabehji et al., 2005). In
271
mice, the generation and characterization of a Gtf2ird1 mouse model for has identified a role for
this gene in behavioral features of WBS as well as reveling alterations in serotonergic function
and possible alterations in the expression of store-operated calcium channels that may underlie
the observed phenotype. The generation of additional mouse models including a gene trapped
Gtf2i knockout, an intra-chromatidal deletion of both Gtf2i and Gtf2ird1 as well as a duplication
of Gtf2i will allow for a greater understanding a the contribution these genes make to their
associated 7q11.23 chromosomal rearrangements.
5.1.2: Genomic rearrangements of the human 7q11.23-21.11 region:
Although language impairment is thought to be caused by the interaction of multiple
genes on different chromosomes, the identification of genomic duplications of the 7q11.23
region contributing to language impairment in this work implicates a specific location on
chromosome 7 providing a launching point for a greater understanding of the underlying genes
necessary for human speech and language. As was so essential in the deciphering of contribution
of genes to the WBS phenotype, further identification of additional patients for the common
duplication as well as atypical 7q11.23 duplications will be necessary to identify the genes
whose altered expression contributes to the language impairments seen in individuals with the
7q11.23 duplication. It has not yet been determined whether people with 7q11.23 duplication,
have a similar motor impairment to the developmental verbal dyspraxia seen in individuals
carrying heterozygous FOXP2 mutations (Lai et al., 2001; MacDermot et al., 2005), but careful
evaluation of multiple affected individuals by speech and language pathologists will help to
answer this question.
272
It is evident from the growing number of cases of 7q11.23 duplication, that like WBS, the
duplication of 7q11.23 results in a truly syndromic disorder, with other aspects distinct from
speech and language that are shared with both disorders although in a dissimilar and often
opposite manner including distinctive facial features and behavioral problems. The stark
differences in speech and cognitive abilities between children with WBS and those with the
duplication of the 7q11.23 region suggest that one or more genes in the WBS region are dosage
sensitive and that these genes, in association with other genes and the environment, are important
for speech and cognitive development.
The association of MAGI2 with infantile spasms also provides a critical starting point for
elucidating the underlying neuropathology of this disorder. However, further investigation is
necessary to confirm that the loss of MAGI2 function is indeed responsible for the observed
phenotype. Since to date, only individuals carrying large deletions encompassing MAGI2 have
been found to be unequivocally associated with IS. It is possible that it is the loss of a regulatory
element affecting the expression of a distant gene and not a decrease in MAGI2 expression that is
responsible for this rare epileptic disorder. The identification of patients with isolated IS,
carrying point mutations within MAGI2 will be necessary to confirm MAGI2‘s role in IS.
Although a mouse model does exist for Magi2, the targeting resulted in the disruption of
only the α isoform leaving the predominant neuronal isoform (β) intact (Iida et al 2007).
Therefore generation of a mouse model possessing a disruption of all three isoforms present in
mice is also necessary to properly evaluate to the role of MAGI2 in IS, and will provide a useful
tool for the study of both the pathophysiology and the efficacy of new medications.
273
5.1.3: Targeting of Gtf2ird1 results in increased sociability, reduced fear and aggression,
altered serotonin metabolism and deficits in motor function/co-ordination:
Analysis of individuals possessing atypical deletions encompassing the Gtf2i gene family
members GTF2I and GTF2IRD1 had implicated these genes in the behavioral aspects of WBS.
However, prior to this work only limited behavioral or cognitive analysis had been performed on
the existing Gtf2ird1 mouse model (Durkin et al., 2001; van Hagen et al., 2007; Tassabehji et al.,
2005). Gtf2ird1-/-
mice exhibited a phenotype that is reminiscent of individuals with WBS
including increases in sociability and a decrease in the natural fear response as well as
abnormalities in motor function. It was subsequently determined that neuronal activation and
serotonin levels were altered in regions previously shown to be associated with these behaviors
including the frontal cortex and the amygdala. Microarray analysis also on frontal cortex
identified a decrease in the expression of the transient receptor potential cation channel,
subfamily C, member 4, also known as TRPC4, a receptor-activated non-selective calcium
permeant cation channel operated by a phosphatidylinositol second messenger system activated
by receptor tyrosine kinases or G-protein coupled receptors (Schaefer et al., 2002).
The identification of Gtf2ird1‘s possible involvement in the motor co-ordination
abnormalities also provides an important starting point to elucidate the underlying causes of the
visual-motor integration deficits identified in individuals with WBS (Frangiskakis et al 1996).
Given TFII-IRD1‘s known association with the troponin 1 slow promoter, histological evaluation
will be necessary to determine if the decrease in Gtf2ird1 expression has altered the specific fibre
types in the skeletal muscle of Gtf2ird1-/-
mice and whether this alteration is responsible for the
observed deficits in motor co-ordination and muscle strength.
274
5.1.4: Generation of gene trap and deletion mouse models for the Gtf2i gene family:
Atypical deletions in humans have been identified implication the genes telomeric to
elastin in the major features of WBS, theses individual and their associated deletions are few in
number and variable in size making it difficult to precisely assign specific features of WBS with
individual genes. Even collectively, the previous generation of animal models for several genes
deleted in WBS has not recapitulated the human phenotype and a recently generated mouse
model containing large overlapping deletion of the commonly deleted WBS region (Li et al.,
2009) has failed to shed any novel insight into the contribution made by the genes, particularly
those telomeric to the elastin gene that are thought to be the major contributors to the WBS
phenotype. This may reflect the differences between men and mice, but it may also reflect strain
background since the non-deleted paralogous genes in the proximal (PD) and distal (DD)
deletion mice originated from a C57BL/6 background while in the double deletion (P/D) mice,
generated to mimic to commonly deleted WBS region, the non-deleted paralogous genes
originate from a 129/Sv/Ev background. Differences in strain background has been shown to
result in variability in the phenotypic expression [e.g. craniofacial (Tassabehji et al., 2005;
Enkhmandakh et al., 2009)] this could explain why the deletion mouse lines are not additive,
although a combinatorial effect also cannot be ruled out.
To elucidate the contribution to the WBS phenotype made by the commonly deleted
Gtf2i gene family members, individual models targeted for Gtf2i and Gtf2ird1 were generated.
In vivo Cre-induced recombination was used to create a 200 kb intra-chromatidal deletion of both
Gtf2i and Gtf2ird1 as well as the reciprocal duplication of Gtf2i. Analysis of the newly
generated models will parallel that of the existing targeted Gtf2ird1 mouse model including
identification of possible changes in sociability and aggression. Importantly, deficits in spatial
275
memory abilities, a trait characteristic of individuals with WBS that have been not been clearly
identified in existing WBS mouse models, may be identified in Gtf2i mice. More interestingly,
phenotypes may exist only in the double deletion that are absent in the single gene targeted mice
indicating that the phenotype results from a combinatorial loss of both Gtf2i gene family
members.
5.1.5: Future directions:
This work has provided a valuable insight into deciphering the role of the Gtf2i gene family
members in the etiology of WBS and in particular the importance of the use of genetically
engineered mouse mutants as a valuable tools to elucidate the genetic control of behaviour in
studying human disorders. Although human patients containing atypical deletions have provided
significant information about the genotype-phenotype correlations in WBS, these patients are too
few in numbers. Modeling of human disorders in mice has several advantages. There are
powerful techniques that exist for the manipulation of the mouse genome including the creation
of developmental stage- or tissue specific genetic alterations and access to tissue and embryonic
time points that are not possible in humans.
Although the efficiency of Cre-induced recombination reported in this work was at the
lower end of the reported range, the technical success in generating the double deletion of Gtf2i
and Gtf2ird1 also opens the door for the creation of further multiple gene deletions using a
similar strategy. Mice, either gene trap or those that have been targeted by other investigators,
which contain loxP sites in the proper orientation, can be used to produce successively larger
deletions/duplications within the commonly deleted region. In addition, these mice can
276
themselves be bred together to produce variable deletions such as a deletion of Limk1 to Clip2 as
well as the reciprocal duplication of Eif4h, Lat2 and Rfc2.
A further benefit of in vivo Cre recombination is that the desired rearrangement can be
generated in a temporal or spatial-specific manner using a Cre transgene whose expression is
controlled by promoters active only in specific tissues or at a specified time during development.
Examples of spatially controlled gene deletions include the deletion of functional N-methyl-D-
asparate receptor 1 (NMDAR1) gene that was deleted using the forebrain-specific calcium
calmodulin dependent kinase IIa (CaMKIIα) gene promoter to drive Cre expression (Tsien et al.,
1996). Using this mechanism the deletion can be generated not only within specific cell types
but also at a specific time in development. It will be interesting to determine if the loss TFII-I
and TFII-IRD1 after a specific time point, for example birth, results is a similar phenotype as a
mouse constitutively lacking Gtf2i and Gtf2ird1. Since the splice acceptor site that directs the
gene trap mechanism is flanked by loxP sites, Cre-induced recombination will remove the splice
acceptor site thereby inactivating the trapping mechanism and allowing for restored expression
of the previously trapped gene. It therefore is possible to restore function of the trapped Gtf2i
and Gtf2ird1 genes in a spatial and/or temporal manner. This is of critical importance to the
possible treatment of WBS individuals. For example, amelioration of the phenotype in the adult
mice if the expression of trapped genes is restored in the early postnatal period would indicate
that therapeutic intervention at this early stage in humans might improve some of the negative
behavioral and cognitive aspects of the WBS phenotype. Therapeutic intervention has recently
been demonstrated involving a mouse model involving the elastin gene, known to be responsible
for the cardiac abnormalities seen in WBS. The cardiovascular abnormalities found in Eln-
targeted mice could be alleviated by the introduction of a human ELN transgene (Hirano et al.,
277
2007) providing evidence that pharmaceutical therapies aimed at restoring normal vessel
function may reduce the hypertension, smooth muscle cell proliferation and vascular stenosis
that are the main causes of mortality in WBS. The mouse models generated in this work will
provide the basis for manipulations, including access to prenatal and perinatal phenotypic
characterization that are not possible in human subjects and should prove a valuable model for
this truly intriguing human disorder.
278
5.2: References:
Antonell A, Del Campo M, Magano LF, Kaufmann L, Martínez de la Iglesia J, Gallastegui F,
Flores R, Schweigmann U, Fauth C, Kotzot D, and Pérez-Jurado LA. (2009) Partial
7q11.23 deletions further implicate GTF2I and GTF2IRD1 as the main genes responsible
for the Williams-Beuren syndrome neurocognitive profile. Journal of Medical Genetics.
47:312-320.
Beunders G, van de Kamp JM, Veenhoven RM, van Hagen JM, Nieuwint AW, and Sistermans
EA. (2009) A triplication of the Williams Beuren Syndrome region in a patient with
mental retardation, a severe expressive language delay, behavioral problems and
dysmorfisms. Journal of Medical Genetics. 47:271-275.
Blyth M, Beal S, Huang S, Crolla J, and Foulds N. (2008) A novel 2.43 Mb deletion of 7q11.22-
q11.23. American Journal of Medical Genetics A 146A:3206-3210.
Botta A, Novelli G, Mari A, Novelli A, Sabani M, Korenberg J, Osborne LR, Digilio MC,
Giannotti A, and Dallapiccola B. (1999) Detection of an atypical 7q11.23 deletion in
Williams syndrome patients which does not include the STX1A and FZD3 genes. Journal
of Medical Genetics. 36:478-480.
Durkin ME, Keck-Waggoner CL, Popescu NC, and Thorgeirsson SS. (2001) Integration of a c-
myc transgene results in disruption of the mouse Gtf2ird1 gene, the homologue of the
human GTF2IRD1 gene hemizygously deleted in Williams-Beuren syndrome. Genomics.
73:20-27.
Enkhmandakh B, Makeyev AV, Erdenechimeg L, Ruddle FH, Chimge NO, Tussie-Luna MI,
Roy AL, and Bayarsaihan D. (2009) Essential functions of the Williams-Beuren syndrome-
associated TFII-I genes in embryonic development. Proceedings of the National Academy
of Science (USA). 106:181-186.
Frangiskakis JM, Ewart AK, Morris CA, Mervis CB, Bertrand J, Robinson BF, Klein BP, Ensing
GJ, Everett LA, Green ED, Pröschel C, Gutowski NJ, Noble M, Atkinson DL, Odelberg SJ,
and Keating MT. (1996) LIM-kinase1 hemizygosity implicated in impaired visuo-spatial
constructive cognition. Cell. 86:59-69.
Gagliardi C, Bonaglia MC, Selicorni A, Borgatti R, and Giorda R. (2003) Unusual cognitive and
behavioral profile in a Williams syndrome patient with atypical 7q11.23 deletion. Journal
of Medical Genetics. 40:526-530.
Greenberg F. (1990) Williams syndrome professional symposium. American Journal of Medical
Genetics. 6(S):85-88.
Heller R, Rauch A, Lüttgen S, Schröder B and Winterpacht A. (2003) Partial deletion of the
critical 1.5 Mb interval in Williams-Beuren syndrome. Journal of Medical Genetics.
40:e99.
279
Hirano E, Knutsen RH, Sugitani H, Ciliberto CH, and Mecham RP. (2007) Functional rescue of
elastin insufficiency in mice by the human elastin gene: implications for mouse models of
human disease. Circulation Research. 101:523-531.
Hirota H, Matsuoka R, Chen XN, Salandanan LS, Lincoln A, Rose FE, Sunahara M, Osawa M,
Bellugi U, and Korenberg JR. (2003) Williams syndrome deficits in visual spatial
processing linked to GTF2IRD1 and GTF2I on chromosome 7q11.23. Genetics in
Medicine. 5:311–321.
Iida J, Ishizaki H, Okamoto-Tanaka M, Kawata A, Sumita K, Ohgake S, Sato Y, Yorifuji H,
Nukina N, Ohashi K, Mizuno K, Tsutsumi T, Mizoguchi A, Miyoshi J, Takai Y, and Hata
Y. (2007) Synaptic scaffolding molecule alpha is a scaffold to mediate N-methyl-D-
aspartate receptor-dependent RhoA activation in dendrites. Molecular Cell Biology.
27:4388-4405.
Lai CS, Fisher SE, Hurst JA, Vargha-Khadem F, and Monaco AP. (2001) A forkhead-domain
gene is mutated in a severe speech and language disorder. Nature. 413:519-523.
Li HH, Roy M, Kuscuoglu U, Spencer CM, Halm B, Harrison KC, Bayle JH, Splendore A, Ding
F, Meltzer LA, Wright E, Paylor R, Deisseroth K, and Francke U. (2009) Induced
chromosome deletions cause hypersociability and other features of Williams-Beuren
syndrome in mice. EMBO Molecular Medicine. 1:50-65.
MacDermot KD, Bonora E, Sykes N, Coupe AM, Lai CS, Vernes SC, Vargha-Khadem F,
McKenzie F, Smith RL, Monaco AP, and Fisher SE. (2005) Identification of FOXP2
truncation as a novel cause of developmental speech and language deficits. American
Journal of Human Genetics. 76:1074-1080.
Marshall CR, Young EJ, Pani AM, Freckmann ML, Lacassie Y, Howald C, Fitzgerald KK,
Peippo M, Morris CA, Shane K, Priolo M, Morimoto M, Kondo I, Manguoglu E, Berker-
Karauzum S, Edery P, Hobart HH, Mervis CB, Zuffardi O, Reymond A, Kaplan P,
Tassabehji M, Gregg RG, Scherer SW, and Osborne LR. (2008) Infantile spasms is
associated with deletion of the MAGI2 gene on chromosome 7q11.23-q21.11. American
Journal of Human Genetics. 83:106-111.
Morris CA, Mervis CB, Hobart HH, Gregg RG, Bertrand J, Ensing GJ, Sommer A, Moore CA,
Hopkin RJ, Spallone PA, Keating MT, Osborne L, Kimberley KW, and Stock AD. (2003)
GTF2I hemizygosity implicated in mental retardation in Williams syndrome: genotype-
phenotype analysis of five families with deletions in the Williams syndrome region.
American Journal of Medical Genetics, Part A. 123A:45-59.
Morris C, Mervis C, Velleman S, John A, Currier A, Rios C, Kimberley K, and Crawford N.
(2009) Phenotypic comparison of Williams syndrome and its reciprocal duplication
syndrome reveals significant differences in dysmorphic features, speech, cognitive ability,
and type of anxiety. ASHG General Meeting. abstract #2568.
280
Osborne LR, Li M, Pober B, Chitayat D, Bodurtha J, Mandel A, Costa T, Grebe T, Cox S, Tsui
LC, and Scherer SW. (2001) A 1.5 million-base pair inversion polymorphism in families
with Williams-Beuren syndrome. Nature Genetics. 29:321-325.
Pober BR, and Dykens EM. (1996) Williams syndrome: An overview of medical, cognitive and
behavioral features. Child and Adolescent Psychiatric Clinics of North America. 5:929-943.
Schaefer M, Plant TD, Stresow N, Albrecht N and Schultz G. (2002) Functional differences
between TRPC4 splice variants. Journal of Biological Chemistry. 277:3752-3759.
Somerville MJ, Mervis CB, Young EJ, Seo EJ, del Campo M, Bamforth S, Peregrine E, Loo W,
Lilley M, Pérez-Jurado LA, Morris CA, Scherer SW, and Osborne LR. (2005) Severe
expressive-language delay related to duplication of the Williams-Beuren locus. New
England Journal of Medicine. 353:1694-1701.
Stromme P, Bjornstad PG, and Ramstad K. (2002) Prevalence estimation of Williams syndrome.
Journal of Child Neurology. 17:269–271.
Tassabehji M, Metcalfe K, Karmiloff-Smith A, Carette MJ, Grant J, Dennis N, Reardon W, Splitt
M, Read AP, and Donnai D. (1999) Williams syndrome: use of chromosomal
microdeletions as a tool to dissect cognitive and physical phenotypes. American Journal of
Human Genetics. 64:118-25.
Tassabehji M, Hammond P, Karmiloff-Smith A, Thompson P, Thorgeirsson SS, Durkin ME,
Popescu NC, Hutton T, Metcalfe K, Rucka A, Stewart H, Read AP, Maconochie M, and
Donnai D. (2005) GTF2IRD1 in craniofacial development of humans and mice. Science.
310:1184-1187.
Torniero C, Dalla Bernardina B, Novara F, Cerini R, Bonaglia C, Pramparo T, Ciccone R,
Guerrini R, and Zuffardi O. (2008) Dysmorphic features, simplified gyral pattern and
7q11.23 duplication reciprocal to the Williams-Beuren deletion. European Journal of
Human Genetics. 16:880-887.
Tsien JZ, Huerta PT, and Tonegawa S. (1996) The essential role of hippocampal CA1 NMDA
receptor-dependent synaptic plasticity in spatial memory. Cell. 87:1327-1338.
Van der Aa N, Rooms L, Vandeweyer G, van den Ende J, Reyniers E, Fichera M, Romano C,
Delle Chiaie B, Mortier G, Menten B, Destrée A, Maystadt I, Männik K, Kurg A, Reimand
T, McMullan D, Oley C, Brueton L, Bongers EM, van Bon BW, Pfund R, Jacquemont S,
Ferrarini A, Martinet D, Schrander-Stumpel C, Stegmann AP, Frints SG, de Vries BB,
Ceulemans B, and Kooy RF. (2009) Fourteen new cases contribute to the characterization
of the 7q11.23 microduplication syndrome. European Journal of Human Genetics. 52:94-
100.
van Hagen JM, van der Geest JN, van der Giessen RS, Lagers-van Haselen GC, Eussen HJ, Gille
JJ, Govaerts LC, Wouters CH, de Coo IF, Hoogenraad CC, Koekkoek SK, Frens MA, van
Camp N, van der Linden A, Jansweijer MC, Thorgeirsson SS, and De Zeeuw CI. (2007)
281
Contribution of CYLN2 and GTF2IRD1 to neurological and cognitive symptoms in
Williams Syndrome. Neurobiology of Disease. 26:112-124.
282
REWARDS OF A SCIENTIST:
This quote appears on the last page of AJ Beuren‘s original article describing WBS. (Circulation,
Volume 26, Page 1240, December 1962)
―Though the scientific explorer has no prospect of becoming rich in the worldly sense, as a result
of his labors, he certainly enjoys a rich life. The enthralling pleasures of discovery, the
opportunity to do what he would rather do than anything else in the world...the freedom for study
and investigation, the world-wide friendships…the assurance that his efforts in teaching and
seeking have social value…all these satisfactions are his. No man could ask for better
recompense.‖
-WALTER B. CANNON, M.D. The Way of An Investigator. New York, W. W. Norton &
Company, Inc., 1945, p. 214.