+ All Categories
Home > Education > Ghent University Global Campus - Sungkyunkwan University: Workshop on Research and Academic...

Ghent University Global Campus - Sungkyunkwan University: Workshop on Research and Academic...

Date post: 16-Feb-2017
Category:
Upload: wesley-de-neve
View: 37 times
Download: 0 times
Share this document with a friend
10
Wesley De Neve [email protected] Ghent University – iMinds & KAIST Songdo, Incheon, Korea September 23, 2016 Ghent University Global Campus - Sungkyunkwan University Workshop on Research and Academic Development
Transcript
Page 1: Ghent University Global Campus - Sungkyunkwan University: Workshop on Research and Academic Development

Wesley De [email protected]

Ghent University – iMinds & KAIST

Songdo, Incheon, KoreaSeptember 23, 2016

Ghent University Global Campus - Sungkyunkwan University Workshop on Research and Academic Development

Page 2: Ghent University Global Campus - Sungkyunkwan University: Workshop on Research and Academic Development

2

• Academic credentials- Master’s degree in computer science (2002)

• at Ghent University, Belgium- Ph.D. degree in computer science engineering (2007)

• at Ghent University, Belgium

• Current employment- IDLab @ Ghent University – iMinds – imec, Belgium (since 2002)- Image and Video Systems Lab @ KAIST, Korea (since 2007)- Center for Biotech Data Science @ GUGC, Korea (since 2014)

Professional Background

Page 3: Ghent University Global Campus - Sungkyunkwan University: Workshop on Research and Academic Development

3

Teaching

Informatics(Fall and Spring term of BA1 – 10 credits)

Bioinformatics(Fall term of BA3 – MBT – 5 credits)

Page 4: Ghent University Global Campus - Sungkyunkwan University: Workshop on Research and Academic Development

4

• Main track- deep machine learning for analysis of

• multimedia data (Belgium)

• biotech data (Korea)

• Side track- compression of genomic data using

tools for video coding (Belgium)

Research

Page 5: Ghent University Global Campus - Sungkyunkwan University: Workshop on Research and Academic Development

5

Deep Machine Learning

Google DeepMind +Ghent University

Page 6: Ghent University Global Campus - Sungkyunkwan University: Workshop on Research and Academic Development

6

Breast Cancer Diagnosis and Segmentation (Mijung Kim)

Mammogram image

Normal

Benign

Malignant

1) Classify an input image as either normal (no lesion), benign, or malignant

2) Upon classification as either benignor malignant, segment the lesion

Upon classification asnormal, no segmentationis used

The red part of the heatmap below shows wherethe lesion is located

Targeted participation in the Digital Mammography DREAM challenge

Page 7: Ghent University Global Campus - Sungkyunkwan University: Workshop on Research and Academic Development

7

Prediction of Drug-Target Interaction (Mijung Kim)

PCBA-2326

Target enzyme CID 2827036

Target enzyme CID 1014390

Target enzyme CID 332939

. . .

1) Feed a new or an existing drugcompound into a neural network

2) The output of the neural network showswhich target interacts with the drug compound

On hold, due to a lack of data and expert knowledge

Page 8: Ghent University Global Campus - Sungkyunkwan University: Workshop on Research and Academic Development

8

Sleep Apnea Detection (Mijung Kim)

Normal Apnea Normal

1) Feature extraction fromraw data – synchronizedpolysomnography (PSG) data: EEG, EOG, EMG, …

2) Feed features into a neural network forclassification purposes

3) The result is one ofthree classes – normal,apnea, or hypopnea

Under discussion with imec (www2.imec.be)

Page 9: Ghent University Global Campus - Sungkyunkwan University: Workshop on Research and Academic Development

9

Splice Site Detection (Jasper Zuallaert)

… ACCAGGTAAGCGCATCCGACATCTCTCAACGAGTCGAC …

In cooperation with VIB (www.vib.be)

1) Search for patterns using convolutional windows

2) Combine patterns found to classify a candidate splice site as a true splice site or as a pseudo splice site

… ACCAGGTAAGCGCATCCGACATCTCTCAACGAGTCGAC …

True splice site


Recommended