Gil AstDep. of Human Molecular Genetics and Biochemistry

Room 1009, 10th floor

Tel: 6893 640

Sylabus

The Cell by B. Albertshttp://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=Books

Essential Cell Biology by Alberts

Genetics Science of genes  

Molecular Biology

Gene expression

Embryonic stem cells

Day 1 Day 2-3 Day 4 Day 5

Day 6-9

Day 14

nucleusGene - encodes for protein

Each cell in our body contains the same genetic information (DNA)

The pathway of gene expression

H

deoxy

A nucleotide

RNA DNA

The sugar of RNA and DNA

O

The base bind position 1

The bases

single strand DNA

ssDNA

ssDNA

)15-’to-3 ’Phosphodiester bond

2 )direction

3 )5 ’end3’end

4 )upstream and downstream

How to describe DNA

GAACCTGAGACCTACTGGTCCG

Base-paring

Base pair = bp

Double strandDNA = dsDNA

dsDNA

Anti-paralel

dsDNA

.1Anti-parallel

.2Complementary strand3. ladder4 .Each basepair is called 1bp

A:T and G:C

= 10-10

Gene – a DNA region that is transcribed to RNA, and the RNA with a biological function

Gene 3

Intron – a region in the DNA that is transcribed but removed from the mRNA precursor and is not part of the mature mRNA

Exons – part of the mature mRNA

Introns are found only in eukaryotes

2.91 billion base pairs

24,000 protein coding genes

(~32,000 non-coding genes)

1.5% exons (127 nucleotides)

24% introns (~3,000 nucleotides)

75% intergenic (no genes)

Average size of a gene is 27,894 bases

Contains an average of 8.8 exons

Titin contains 234 exons.

Human genome

We humans are 99.9% identical at the DNA sequence level

• There are still ~3 million nucleotide differences among us called SNPs (60,000 within the exons)---that presumably account for differences in disease susceptibility, drug responses, etc.

• Polymorphic variation between and within populations

• Implications for concepts of “race,” “individuality”

24,000

MOLECULAR BIOLOGY OF THE DISEASE

Duchenne Muscular Dystrophy is one of more than twenty different types of muscular dystrophy. The Duchenne type affects only boys and is known to result from a defect in a single important protein in muscle fibers called Dystrophin. The muscle fiber will break down if the Dystrophin is missing and is unable to function properly. As a result, the reduction in the number of good muscle fibers and the whole muscle becomes weak.

Duchenne Muscular Dystrophy

• DNA, Chromosome

• Centromere, telomere, replication origin

• Nucleosome, Chromatin,

• Histone: H1, H2A, H2B, H3, H4

• Histone octamer, DNA packaging

• DNA binding proteins, Histone modifications

Summary

Histone proteins

HDAC

HAT

HDAC activity

מבנה הנוקלאוזום

סיכת ביטחון

H2A H2B

H3 H4

Covalent Modification of core histone tails

Acetylation of lysines (K)Mythylation of lysines

Phosphorylation of serines (S)

Histone acetyl transferase (HAT)

Histone deacetylase (HDAC)

Acetylation

Mythylation

epigenetics

4Penicillin mold46Human

32Yeast42Macaque

40Mouse

38Cat

48Potato26Frog

20Algae16Planaria

20Corn8Fruit fly

SpeciesSpecies

Total number of chromosomes/somatic (body) cell

Dog 78

There is no connection between the number of chromosomes and the genome size, gene content, or any other feature of genomes. It is and essentially independent characteristic.

Cockayne syndrome group B (CSB) cells that fail to express CSB protein which causes profound neurological and developmental defects

Blue – DNAWhite - gene

Chromosomal fragile sites are loci that are especially prone to forming gaps or breaks on metaphase chromosomes when cells are cultured under conditions that inhibit DNA replication or repair. The relationship of "rare" folate sensitive fragile sites with (CCG)n expansion and, in some cases,

genetic disease is well established .

Fragile X syndrome

What is Fragile X syndrome?  Fragile X syndrome is the most common inherited cause of mental impairment, affecting approximately 1 in 2,000 males

and 1 in 4,000 females worldwide . Cytogenetic analysis of metaphase spreads demonstrates the presence of the fragile

site in less than 60% of cells in most affected individuals. .(In 1991, the fragile X gene (FMR1) was characterized and found to contain a tandem repeated trinucleotide sequence (CGG) near its 5' end. The mutation responsible for fragile X syndrome involves expansion of this repeat segment. The number of CGG repeats in the FMR1 genes of the normal population varies from six to approximately 50. There are two main categories of mutation, premutations of approximately 50 to 200 repeats and full mutations of more than approximately 200 repeats. There is no clear boundary between the upper limit of normal and the lower limit of the premutation range. For this reason, alleles with approximately 45-55 copies of the repeat are said to be in the "grey zone." Some alleles in this size range are unstable and expand from generation to generation, while others are stably inherited. A premutation is susceptible to expansion after passage through a female meiosis. The larger the size of a woman's

premutation, the more the risk of expansion to a full mutation in her offspring ..  

In man 104 to 105 sites a replication rate of 2 kb/minute

Origins of replication

• In E. coli only one site OriC

• In man 104 to 105 sites

• The direction of replication is bi-directional

OriC OriC

OriC

If this shoelace were a chromosome,

then these two protective tips would be its

The problem – DNA ends!

CHROMOSOME

TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG

AATCCCAATCCC5’

3’

TELOMERE

The solution: adding repetitive sequences to the ends

TnAmGo type of minisatellite repeat

TTAGGG – human

TTTAGGG – Arabidopsis

TTGGGG - Tetrahymena

TTAGG – Bombyx

TTTTAGGG – Chlamydomonas

TTTTGGGG – Oxytricha

TTAGGC - Ascaris

(TG)1-3 - Saccharomyces cereviceae

Telomere

• senescent cells have shorter telomeres• length differs between species• in humans 8-14kb long• telomere replication occurs late in the cell

cycle• Telomeres are shortened by 40-to-200 bases

between one cell division to the other.

• Provide protection from enzymatic degradation and maintain chromosome stability

• Organization of the cellular nucleus by serving as attaching points to the nuclear matrix

• Allows end of linear DNA to be replicated completely

Functions

End-to-end fusion

Telomerase

1. Telomerase binds to the telomer and the internal RNA component aligns with the existing telomer repeats.

2. Telomerase synthesizes new repeats using its own RNA component as a template

3. Telomerase repositions itself on the chromosome and the RNA template hybridizes with the DNA once more.

Telomerase is not active in most somatic cells

Cancer cells have telomerase

Dolly is aging too rapidly?….or was born 6 years old (telomers were 80% of normal sheep)Dolly has developed pre-mature arthritis

A Japanese-American Werner patient as a teenager (left), and at age 48 (Case #1 Epstein et al,1966, Medicine 45:177). She had eight children, two of whom were also affected. At 48, she hadhair loss and greying, thin extremities, chronic ulcerations of the ankles, atrophy of the skin and herthe right eye had been enucleated several years earlier due to acute glaucoma resulting from bilat-eral cateract extraction at the age of 27. She lived longer than many Werner patients, dying at 57.

Werner Patient

Teenager Age 48