1
Glucocorticoid receptor signaling activates TEAD4 to promote breast cancer progression
Lingli He1, Liang Yuan2, Yang Sun1, Pingyang Wang1, Hailin Zhang3, Xue Feng1, Zuoyun Wang1, Wenxiang Zhang1, Chuanyu Yang3, Yi Arial Zeng1, Yun Zhao1,2, Ceshi Chen3,4,5* & Lei Zhang1,2,*
Author affiliations� 1State Key Laboratory of Cell Biology, CAS Center for Excellence in Molecular Cell Science, Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences, University of Chinese Academy of Sciences, 320 Yueyang Road, Shanghai, 200031, People's Republic of China 2School of Life Science and Technology, ShanghaiTech University, Shanghai, 201210, People’s Republic of China 3Key Laboratory of Animal Models and Human Disease Mechanisms of Chinese Academy of Sciences & Yunnan Province, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, 650223, People’s Republic of China 4Institute of Stem Cell and Reproductive Biology, Chinese Academy of Sciences, Beijing, 100101, People’s Republic of China 5KIZ-CUHK Joint Laboratory of Bioresources and Molecular Research in Common Diseases, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming, 650223, People’s Republic of China *Corresponding author
Running title: GCs-activated TEAD4 contributes to breast cancer progression
Corresponding author: Lei Zhang or Ceshi Chen Phone: +8602145921336 Fax: +8602145921336 Address: 320 Yue Yang Road, New building Room 505, Shanghai 200031, China Email: [email protected] or [email protected]
Conflict of interest statement: The authors declare no potential conflicts of interest
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
2
Abstract Hippo pathway plays a critical role in cell growth and tumorigenesis. The activity of
TEA domain transcription factor 4 (TEAD4) determines the output of Hippo signaling,
however, the regulation and function of TEAD4 has not been explored extensively.
Here, we identified glucocorticoids (GCs) as novel activators of TEAD4. GC treatment
facilitated glucocorticoid receptor (GR)-dependent nuclear accumulation and
transcriptional activation of TEAD4. TEAD4 positively correlated with GR expression
in human breast cancer, and high expression of TEAD4 predicted poor survival of
breast cancer patients. Mechanistically, GC activation promoted GR interaction with
TEAD4, forming a complex that was recruited to the TEAD4 promoter to boost its own
expression. Functionally, the activation of TEAD4 by GC promoted breast cancer stem
cells maintenance, cell survival, metastasis and chemo-resistance both in vitro and in
vivo. Pharmacological inhibition of TEAD4 inhibited GC-induced breast cancer
chemo-resistance. In conclusion, our study reveals a novel regulation and functional
role of TEAD4 in breast cancer and proposes a potential new strategy for breast cancer
therapy.
Significance : This study provides new insight into the role of glucocorticoid signaling
in breast cancer with potential for clinical translation.
Introduction
The Hippo signaling pathway, originally discovered in Drosophila melanogaster and
highly conserved in mammals, plays key roles in cell proliferation, cell fate
determination, organ size control, and tumor suppression (1-3). Hippo pathway mainly
contains upstream kinase complex, transcriptional cofactor Yes associated-protein
(YAP) and its paralog WW domain containing transcription regulator 1 (TAZ), and
TEA domain transcription factors (TEAD1-4). Upstream core MST-LATS kinase
cascade phosphorylates YAP/TAZ and restricts their localization in the cytoplasm,
while unphosphorylated YAP/TAZ translocate into nucleus and binds with TEADs to
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
3
activate TEADs transcriptional activity (4,5). Activated TEADs stimulates the
expression of genes involved in cell proliferation and metastasis (CYR61, CTGF,
BIRC5, ANKRD1, Vimentin and N-cadherin) and then promote tumorigenesis and
progression (2,6). Regulators, such as energy/osmotic stress (7,8), cell
contact/mechanical force (9,10) and hormones (11) trigger Hippo pathway by
controlling YAP/TAZ activity, while YAP/TAZ require TEADs binding to regulate
target genes (12). Thus, it is of importance to understand the regulation and function of
TEADs.
TEADs have been reported to be phosphorylated by protein kinase A (PKA) and
protein kinase C (PKC), which impairs TEADs DNA binding ability (13,14). TEAD4
is also palmitoylated to enhance its association with YAP/TAZ and transcriptional
activity (15). RBM4-facilitated alternative splicing of TEAD4 generates a TEAD4-
shorter form to suppress cancer cell proliferation and migration (16). In addition, It has
been studied that p38 regulates TEADs nuclear–cytoplasmic shuttling in response to
osmotic stress (8). Moreover, TEAD4 nuclear localization is critical for establishing the
trophectoderm (TE)-specific transcriptional program and segregating TE from the inner
cell mass (ICM) (17). More importantly, TEAD4 nuclear localization positively auto-
regulates its own transcription and increases its protein level in the TE lineage, and the
high TEAD4 concentration facilitates its nuclear localization as a positive feedback
response (17). Recently, it has been reported that GR binds to the promoter of TEAD4
to regulate TEAD4 transcription during adipogenesis (18). The activity of TEADs is
also regulated by its cofactors. Besides the most well-known co-activators YAP/TAZ,
some other Hippo-independent cofactors have been also identified as TEADs-binding
partners, such as the vestigial-like protein family (VGLL1–4) (19), C-terminal binding
protein 2 (CtBP2) (20), transcription factor 4 (TCF4) (21), Krüppel-like factor 5 (KLF5)
(22) and activator protein-1 (AP-1) (23). Together with their cofactors, TEADs bind to
the conserved MCAT motif to regulate transcriptional activity involved in cancer
initiation and progression (24,25).
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
4
Glucocorticoids (GCs), as a kind of steroid hormones, function through
glucocorticoid receptor (GR) and play important roles in various biological processes,
such as cell growth, metabolism, immune and inflammatory reactions (26,27). Due to
its anti-proliferative and pro-apoptotic roles, GCs have been used in various diseases
therapies, such as acute lymphoblastic leukemia and multiple myeloma (27).
Nevertheless, GCs treatment has side effect for the emergence of GCs-induced
apoptosis resistance (28). It has been shown that GCs promote cancer cells survival and
protect cells from chemotherapy-induced apoptosis (29,30). For example,
Dexamethasone (Dex) treatment inhibits paclitaxel-induced apoptosis especially in
breast cancer (11,31,32). Consistently, high expression of GCs-related GR correlates
with poor survival and poor prognosis in breast cancer patients (11,33). However, the
molecular mechanism and the key mediators that respond to GCs-GR signaling and
induce cell growth, remain unclear.
Breast cancer is the most common malignancy in women. In clinical diagnosis, breast
cancers are divided into four subtypes based on the expression of the markers: oestrogen
receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor
2 (HER2). Among the different subtypes, patients with triple negative breast cancer
(TNBC), characterized by ER/HER2/PR negative, have the highest frequency of lymph
node metastasis and poorest prognosis (34). TNBC has a relatively good response to
chemotherapy, however, chemo-resistance is an alarming issue following treatment
(34). The Hippo signaling pathway has been linked to breast cancer progression. The
high expression of YAP and TAZ contribute to breast cancer cell survival and
metastasis dependent on TEAD4 interaction (35,36). Besides, TEAD4 also acts as an
oncogene in breast cancer (22).
In this study, we identify glucocorticoids as new regulators of TEAD4 in breast
cancer. GCs promote TEAD4 transcriptional levels, nuclear accumulation and TEAD4
transcriptional activity. These actions of GCs depend on glucocorticoid receptor (GR).
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
5
Specifically, GCs-activated GR is recruited to the promoter of TEAD4 and forms a
complex with TEAD4 to regulate TEAD4 transcription and auto-activation. The
activity of TEAD4 positively correlates with GR expression in clinical breast cancer
samples. Furthermore, high expression of TEAD4 and GR predicts poor survival in
patients with breast cancer. GCs-GR induced TEAD4 activity is involved in breast
cancer cells survival, metastasis and chemo-resistance in vitro and in vivo.
Pharmacological inhibition of TEAD4 transcriptional activity by niflumic acid
inhibited GCs-induced breast cancer drug resistance. Our data identify a new GCs-GR-
TEAD4 axis and a novel mechanism of TEAD4 regulation in breast cancer, suggesting
a new strategy for breast cancer therapy.
Materials and Methods
Reagents and plasmids. The compounds and drugs were shown in Table S1. TEAD4,
TEAD4-VP16, GR and GR-2C2A were cloned to the pLEX-HA vector for stable
expression in cells. TEAD1/2/3/4, TEAD4-N, TEAD4-C and YAP were cloned to
vector pcDNA3.1. GR, GR-DBD, GR-△DBD and GR-2C2A were cloned to vector
pGEX-4T1-GST, and TEAD4 was cloned to pET28a-His-Sumo for protein purification
in E. coli. All constructs for short hairpin RNA (shRNA) were constructed in a modified
pLKO.1 vector. The shRNA target sequences as followings.
YAP-1: GACATCTTCTGGTCAGAGA;
TEAD4-1: GAGACAGAGTATGCTCGCTAT;
TEAD4-2: CCTTTCTCTCAGCAAACCTAT;
GR-1: TGGATAAGACCATGAGTATTG;
GR-2: CACAGGCTTCAGGTATCTTAT.
Scramble DNA duplex was also designed as a control: TTCTCCGAACGTGTCACGT.
Cell culture. HEK293T cells, MDA-MB-231, MDA-MB-453 and BT-549 were
cultured in DMEM (Invitrogen, Carlsbad, CA) supplemented with 10% FBS and
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
6
antibiotics at 37 °C with 5% CO2 in a humidified incubator (Thermo, Waltham, MA),
NIH/3T3 cells were cultured in DMEM with 10% NCS and antibiotics. MCF10A cells
were maintained in DMEM/F12 medium (Sigma D6421) containing 5% Horse Serum
(Sigma H1270), 10 µg/mL Insulin (Sigma I6634), 20 ng/mL hEGF (Sigma E4269), 100
ng/mL Cholera toxin (Sigma C8052), 0.5 µg/mL Hydrocortisone (Sigma H4001), and
antibiotics. Cells were obtained from Shanghai Life Academy of Sciences cell library
(Shanghai, China) in June 2016, then the short tandem repeat analysis was performed
to authenticate the cell lines. Multiple aliquots were frozen within 10 days when the
cells were purchased and thawed. For experimental use, aliquots were resuscitated and
cultured for about 20 passages (every two days for 6 weeks) before being discarded.
All cell lines were ensured to be negative for mycoplasma contamination.
Small interference RNAs (siRNAs). Duplexes of siRNA targeting TEAD4, GR, YAP,
TAZ and negative control were synthesized by Genepharma (Shanghai, China). The
siRNA target sequences in human are as followings:
GR-1: AAGTCAAGTTGTCATCTCC;
YAP-1: CCCAGTTAAATGTTCACCAAT;
TAZ: CAGCCAAATCTCGTGATGAA.
The siRNA target sequences in mouse:
YAP-1: GAAGCGCTGAGTTCCGAAAT;
TAZ-1: CAGCCGAATCTCGCAATGAAT;
TAZ-2: CCATGAGCACAGATATGAGAT;
For negative control: UUCUCCGAACGUGUCACGU.
DNA preparation for TEAD4 promoter luciferase reporter. The downstream
sequence of TEAD4 gene containing TEAD4 and GR binding site was amplified by
PCR. Target DNA was detected by agarose gel and purified by Gel Extraction Kit
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
7
(Tiangen). The primers used for PCR were as followings: TEAD4-F:
CGAGGTGCCGGTGGC; TEAD4-R: CTCTCACCTGGCGGGACG.
Chromatin immunoprecipitation (ChIP). Protocol of ChIP assay was previous
described in detail (20), Chromatin was immunoprecipitated with 2µg antibody of GR
(SC-8992, Cell Signaling), normal rabbit IgG (sc-2027, Santa Cruz), TEAD4 (58310,
Abcam) or normal mouse IgG (sc-2025, Santa Cruz). The immunoprecipitated DNA
was collected with QIAQIUCK PCR Purification Kit (250). Purified DNA was
performed with ChIP-PCR. The primers used were shown in Table S1.
Mammosphere formation assay. MDA-MB-231 cells were cultured with
MammoCult Human Medium Kit (05620, STEMCELL Technologies) supplemented
with 4 µg/mL Heparin (07980, STEMCELL Technologies) in 6-well ultralow
attachment plates (3471, Corning), 3×105 cells per well for 10 days. Fresh complete
medium was added into each well every 3 days. After culture, sphere number was
counted.
Immunohistochemistry. Tissues were embedded in paraffin before cutting into 5µm
sections. Immunohistochemistry (IHC) signals were developed using monoclonal
antibodies against human TAZ (1:200, 4883), GR (1:200, 12041) and Cleaved
Caspase3 (1:200, 9661) which were purchased from Cell Signaling Technology,
TEAD4 (1:100, sc-101184) and YAP (1:200, sc-15407) were purchased from Santa
Cruz Biotechnology. Ki67 (PA5-19462) was a product of Thermo Fisher.
Xenograft tumor formation and Lung seeding assay. Six-week-old healthy female
nude mice (BALB/cA-nu/nu) were obtained from the Shanghai Experimental Animal
Center and maintained in pathogen-free conditions. One million MDA-MB-231 cells
in 100µl of PBS was injected into the mammary fat pad of female nude mice for
xenograft tumor formation or injected into tail vein for metastatic analysis of lung.
Tumor growth at the injection site was monitored by caliper measurements 2 times a
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
8
week and tumor volume was calculated using the formula: Tumor volume (mm3)
=0.52*D*d2, where D and d is the longest and the shortest diameters, respectively. Mice
were killed after four weeks and tumor weight were then weighted. For lung seeding
assay, Lung of nude mice were analyzed after 40 days of tail vein injection. All animals
were used in accordance with the guidelines of the Institutional Animal Care and Use
Committee of the Institute of Biochemistry and Cell Biology.
Human breast cancer sample collection. All the human breast cancer samples were
collected from Yunnan Cancer Hospital and The First Affiliated Hospital of Kunming
Medical University, with patient written informed consent and the approval from the
Institute Research Ethics Committee. The patient studies were conducted according to
International Ethical Guidelines for Biomedical Research Involving Human Subjects
(CIOMS) ethical guidelines.
Statistical analysis. Statistical parameters including the definitions and exact values of
n, statistical test and statistical significance are reported in the Figures and Figure
Legends. Comparisons between groups were analyzed using an unpaired Student’s t-
test in less than three groups, and One-way ANOVA followed by Tukey’s multiple
comparison test in more than two groups by GraphPad Prism. SPSS 13.0 (SPSS, inc.,
Chicago, IL) was used to analyze the Pearson correlation between GR and TEAD4.
Survival curves were calculated according to the Kaplan-Meier method, and survival
analysis was performed using the logrank test. Differences are considered statistically
significant at *p < 0.05; **p < 0.01; ***p < 0.001; ****p < 0.0001. ns means no
significance. All data were presented as mean ± SD.
Results
Glucocorticoids up-regulate TEAD4 transcriptional levels in breast cancer cells
To study the regulation of GCs on Hippo signaling, we treated breast cancer cells
MDA-MB-231 with 1µM Dexamethasone (Dex) for different time. Consistent with
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
9
earlier findings (11), the total YAP protein levels were increased and phosphorylated
YAP protein levels were decreased at 8 hours and 12 hours. Surprisingly, the protein
level of TEAD4 were also up-regulated dramatically with the increase of treatment time
(Fig. 1a). The expression of TEAD4 and YAP were monitored after Dex treatment (Fig.
1b). However, TEAD4 and YAP were not concurrently activated, and TEAD4 was
activated soon after Dex treatment, as well as Hippo target genes CYR61 and ANKRD1.
TEAD1 and TEAD2 showed no significant change, and TEAD3 expression was also
up-regulated but in a time-independent manner (Supplementary Fig. 1a). To confirm
the up-regulation of TEAD4 was triggered by GCs but not only Dex, 1µg/ml
Hydrocortisone (HC) was used in MDA-MB-231 cells. Consistently, HC also activated
TEAD4 in a time-dependent manner (Supplementary Fig. 1b). Regardless the change
in YAP/TAZ expression, TEAD4 was also activated in BT-549 and MDA-MB-453
cells (Fig. 1c), implying that the GCs-related regulation of TEAD4 is a general
phenomenon in breast cancer cells. In addition, we found that TEAD4 also responded
to GCs in NIH/3T3 cells, a mouse embryo fibroblast (MEF) cell line (Supplementary
Fig. 1c). Consistent with their protein results, TEAD4 and target genes mRNA levels
were also increased after GCs treatment in MDA-MB-231 (Fig. 1d) and BT-549 cells
(Fig. 1e), whereas the mRNA levels of YAP did not change (Fig. 1d,e). The lowest dose
that TEAD4 responded to Dex was 0.01µM (Supplementary Fig. 1d), and the GLIZ
was a GR-regulated gene as positive control (Supplementary Fig. 1e). Again, the
mRNAs of TEAD1/2/3 did not show a consistent change (Supplementary Fig. 1f).
Glucocorticoids promote TEAD4 nuclear accumulation
Since localization of TEAD is a critical determinant of Hippo signaling output (8),
we then investigated the regulation of TEAD4 localization by GCs. TEAD4 was mainly
located in cytoplasm in a normal control culture conditions in MDA-MB-231 (Fig. 1f),
MCF10A (Supplementary Fig. 2a), and NIH/3T3 cells (Supplementary Fig. 2b), and
GCs treatment induced obvious TEAD4 nuclear accumulation (Fig. 1f and
Supplementary Fig. 1a,b). Nuclear and cytoplasmic fraction extraction also confirmed
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
10
TEAD4 nuclear accumulation in MDA-MB-231 cells (Fig. 1g), MDA-MB-453 cells
(Fig. 1h), MCF10A cells (Supplementary Fig. 2c) and NIH/3T3 cells (Supplementary
Fig. 2d). Interestingly, the regulation was specific to TEAD4 rather than any other
TEADs. TEAD1/2/3 were always located in the nucleus with or without GCs treatment
(Supplementary Fig. 2e,f). 3×SD luciferase reporter was used to evaluate TEAD4
transcriptional activity (5). GC up-regulated the reporter activity both in MDA-MB-
231 cells (Fig. 1i) and MDA-MB-453 cells (Fig. 1j), and knockdown of TEAD4 almost
blocked the GC-induced reporter activity (Supplementary Fig. 2g). Taken together,
Glucocorticoids regulate TEAD4 not only by promoting its expression, but also nuclear
accumulation and transcriptional activity in breast cancer cells.
GCs-GR axis regulates TEAD4 independent of YAP/TAZ
GCs regulates the expression of target genes by binding to GR and activating its
transcriptional activity (37). To investigate the role of GR in regulating TEAD4, we
interfered GR expression by small interfering RNA (siRNA) in MDA-MB-231 cells.
Knockdown of GR totally blocked the nuclear up-regulation of TEAD4 triggered by
Dex or HC at both protein (Fig. 2a) and mRNA levels (Fig. 2b). While, GR mainly
located in nucleus in the absence of ligand treatment, which could be explained that
besides ligand, the nuclear localization of GR also appears to be dependent in large part
on nuclear retention mediated through the binding of the receptors to DNA(38). The
protein levels of GR in the nucleus were reduced as a negative feedback by GCs
treatment (39). Knockdown of GR also blocked the mRNA level up-regulation of GLIZ
(Supplementary Fig. 3a). These results were confirmed in NIH/3T3 cells. Knockdown
of GR totally blocked the TEAD4 cytoplasmic-nuclear shuttling and at the same time
decreased TEAD4 protein levels (Supplementary Fig. 3b,c) in NIH/3T3 cells. The
activation of TEAD4 induced by GCs was also completely blocked by co-treatment
with RU486 (GR antagonist) compared with only GCs treatment in MDA-MB-231
cells (Fig. 2c,d). Furthermore, GR silencing inhibited TEAD4 transcriptional activity
stimulated by GCs treatment in MDA-MB-231 cells (Fig. 2e) and MDA-MB-453 cells
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
11
(Supplementary Fig. 3d). Thus, our results indicate a critical role of GR in GC-induced
TEAD4 nuclear accumulation and transactivation.
TEAD4 exerts its function mainly by binding with YAP/TAZ (5,40). Since GCs-
GR axis also activates YAP in breast cancer cells (11), we then examined if there was
a correlation between YAP and TEAD4 in GCs-dependent regulation. Silencing of
YAP/TAZ was incapable of blocking the up-regulation of TEAD4 induced by GCs
treatment at both protein and mRNA levels in MDA-MB-231 cells (Fig. 2f,g) and
NIH/3T cells (Supplementary Fig. 3e). Moreover, we also disrupted TEAD4 and
YAP/TAZ binding by Verteporfin (VP) treatment, and there was no obvious influence
on GCs-regulated TEAD4 expression (Fig. 2h). To further exclude the effect of YAP
to TEAD4, we tested whether YAP influence the TEAD4 protein stability.
Overexpression of YAP or knockdown of YAP/TAZ did not change TEAD4 protein
stability followed by cyclohexane (CHX) treatment (Supplementary Fig. 3f,g). These
results indicate that YAP/TAZ are not responsible for GCs-triggered TEAD4 activation.
Altogether, our data demonstrate that GCs-GR axis regulates TEAD4 independent of
YAP/TAZ.
TEAD4 is a direct target of GR in response to GCs
The previous reported regulation of TEAD4 contains phosphorylation (13,14),
palmitoylation(15), nucleocytoplasmic shuttling (8), and nuclear transport in the inner
blastomere (ICM) (17). Our data showed that GCs-GR axis regulates TEAD4 at the
transcriptional levels (Fig. 2b,d). As GR regulates genes mainly by binding to their
promoters (26), and GR regulates TEAD4 transcription during adipogenesis(18). We
hypothesized that TEAD4 is also a direct target of GR during breast tumorigenesis.
There are three repeated CATTCC sequences in TEAD4 promoter region which
matched with the reported GR binding sites (41,42). The schematic diagram of TEAD4
promoter was shown in Fig. 3a. We then performed Chromatin immunoprecipitation
(ChIP) assay to detect the binding of GR on TEAD4 promoter in GCs-treated MDA-
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
12
MB-231 cells and MBA-MB-453 cells. Our results confirmed that GR bound to the
promoter region of TEAD4 (Fig. 3b and Supplementary Fig. 4a). A region without the
CATTCC sequences serves as a negative control (Fig. 3b). The wild type and core
base pair mutant of TEAD4 promoter luciferase reporters were both generated (Fig. 3a).
TEAD4 promoter luciferase activity was increased after GCs treatment, and decreased
after RU486 co-treatment with GCs (Fig. 3c). In contrast, GCs failed to activate the
mutant form of TEAD4 promoter luciferase reporter (Fig. 3c). Knockdown of GR
completely blocked the up-regulation of TEAD4 promoter luciferase activity triggered
by GCs (Fig. 3d). Still, knockdown of YAP/TAZ had no effect to the TEAD4
transcriptional activity (Supplementary Fig. 4b). These data suggest that TEAD4 is a
direct target of GR in response to GCs.
GR-TEAD4 complex is required for TEAD4 transcriptional activation
TEAD4 positively auto-regulates its own transcription by binding to the promoter of
itself in the trophectoderm (TE) lineage, and high TEAD4 concentration facilitates its
nuclear localization (17). Interestingly, the DNA regions where TEAD4 binding
overlaps with the GR binding regions in the promoter of TEAD4. We speculated that
TEAD4 may bind with GR to regulate its own transcription in response to GCs. We
first detected the binding of TEAD4 to its own promoter by ChIP assay in GCs-treated
MDA-MB-231 cells. Our results showed that TEAD4 bound to its own promoter region
(Fig. 3e) and overexpression of wild type TEAD4 or TEAD4 active form (TEAD4-
VP16) (43) up-regulated TEAD4 promoter luciferase activity (Supplementary Fig. 4c),
which indicated an auto-regulation of TEAD4 upon GCs treatment.
We next examined the physical association between GR and TEAD4. TEAD4
contains an N-terminal TEA domain responsible for DNA binding, and a C-terminal
YAP-binding domain (YBD) responsible for YAP/TAZ binding. GR generates two
main isoforms: GR-α and GR-β. The longer isoform GR-α contains three distinct
domains: transaction domain in the N-terminal, ligand binding domain (LBD) in the C-
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
13
terminal and DNA binding domain (DBD) in the middle region responsible for specific
DNA sequence recognition and binding (44). The schematic diagram of TEAD4 and
GR main domains were shown in Fig. 3f. GST pull-down assay showed that GST-
tagged GR pulled down TEAD4, and the interaction was mediated by N-terminal TEA
domain but not the C-terminal YBD domain (Fig. 3g). Since the TEA domain of
TEADs proteins were conserved, GR could also pull-down TEAD1/2/3
(Supplementary Fig. 4d). GR full-length and DBD bind to TEAD4 but not the
truncation form GR-�DBD (Fig. 3h), suggesting a specific interaction between the
DNA binding domains of TEAD4 and GR. Purified protein-protein pull-down assay
also confirmed the direct interaction of GR-DBD and TEAD4 (Supplementary Fig. 4e).
While, YAP did not bind to GR in pull-down analysis (Supplementary Fig. 4f). Biotin-
labelled DNA from TEAD4 promoter region could pull down both TEAD4 and GR-
DBD protein (Supplementary Fig. 4g). Moreover, adding DNase in the pull-down
system decreased the interaction of TEAD4 and GR (Fig. 3i), indicating that the
interaction between TEAD4 and GR was enhanced by DNA again. ChIP-reChIP further
proved that TEAD4 and GR genetically interacted on TEAD4 and CYR61/CTGF
promoter (Fig. 3j).
We then asked whether TEAD4-GR interaction is required for GCs-induced TEAD4
transcriptional activation. We made GR-2C2A mutant (C463A and C473A) which was
unable to bind with TEAD4 (Supplementary Fig. 4h) but did not influence its ability of
DNA binding (Supplementary Fig. 4i). Overexpression of GR-2C2A mutant lost the
ability of enhancing the GCs-induced TEAD4 promoter luciferase activity compared
with GR-WT (Fig. 3k). Notably, knockdown of GR completely abolished GCs-induced
auto-binding of TEAD4 to its own promoter and also blocked TEAD4’s binding to the
promoter of CYR61 and CTGF (Fig. 3l). Taken together, these results suggest that GCs-
activated GR facilitates TEAD4 transcription by co-binding with TEAD4 to the
TEAD4 promoter, which further promotes TEAD4-GR transactivation.
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
14
The activity of TEAD4 positively correlates with GR expression in clinical breast
cancer
To investigate whether the expression of TEAD4 correlates with GR, we performed
immunohistochemistry (IHC) staining of TEAD4 and GR in human TNBC samples.
There were 9 GR positive and 9 TEAD4 positive samples in 30 total samples, and 8 of
these GR or TEAD4 positive samples were GR and TEAD4 double positive (Table S2).
The results showed that TEAD4 expression positively correlated with the expression of
GR (Fig. 4a,b). We also checked their correlation in Her2 positive�Her2+�and ERα
positive (ER+) human breast cancer samples, and found that no expression of TEAD4
was detected (Supplementary Fig. 5a,b), which was consistent with the previous study
(22). As TEAD4 and GR paly their function mainly in the nucleus, we then examined
the percentage of TEAD4 and GR nuclear localization in human TNBC samples,
respectively. The results showed that almost all of GR and TEAD4 had nuclear
expression (Fig. 4c). These results suggest that the activity of TEAD4 positively
correlate with GR in human breast cancer samples.
High expression of GR contributes to breast cancer progression and poor survival of
patients (33,45). Consistently, TEAD4 had higher expression in breast tumor compared
with normal tissue (Fig. 4d). We analyzed 3951 samples from 35 datasets and found
high TEAD4 mRNA levels were associated with poor survival of patients with breast
cancer (Fig. 4e). To further investigate the role of TEAD4 and GR in breast cancer, we
made shTEAD4 and shGR stable cell lines in MDA-MB-231 cells (Supplementary Fig.
5c,d). Knockdown of TEAD4 or GR, respectively, inhibited MDA-MB-231 cell
proliferation (Fig. 4f,g) and migration (Fig. 4h). TEAD4 re-expression based on
knockdown rescued the proliferation inhibition induced by TEAD4 knocking down
(Supplementary Fig. 5e,f). More importantly, knockdown of TEAD4 or GR repressed
cancer stem cells (CSCs) trait which is considered a major driver for cell proliferation,
migration and chemo-resistance (Fig. 4i). Subcutaneous xenotransplant in nude mice
was performed to study the function of TEAD4 and GR in vivo. The results showed
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
15
shTEAD4 or shGR significantly repressed tumor growth (Fig. 4j-l) and metastasis (Fig.
4l).
GR-TEAD4 mediates GCs-triggered CSCs trait, as well as cell survival and
metastasis in vitro and in vivo
GCs treatment promotes cancer cell growth and anti-apoptosis (11,30). We then
investigated the role of TEAD4 in GCs-induced tumor growth. Knockdown of TEAD4
blocked GCs-induced up-regulation of proliferation-related genes BIRC5/ANKRD1
and EMT-related genes N-cadherin/Vimentin (Fig. 5a), which consequently suppressed
the GCs-induced cell proliferation (Fig. 5b) and tumor growth (Fig. 5c-e). GCs
treatment also promoted metastasis from primary solid tumors, and knockdown of
TEAD4 inhibited GCs-induced metastasis (Fig. 5e). In line with this, the GCs treatment
increased the expression of Ki67 in a TEAD4-dependent manner in xenograft tumors
(Fig. 5f). Overexpression of TEAD4-mNLS (nuclear localization signal mutant)
blocked the function of GC in promoting proliferation (Supplementary Fig. 6a,b).
Additionally, TEAD4-VP16 overexpression completely mimicked the function of GCs
in promoting TEAD4 promoter luciferase activity (Supplementary Fig. 6c) and cell
migration (Supplementary Fig. 6d). To further dissect the function of TEAD4 in
promoting tumor progression, wound healing assay was performed. Knockdown of
TEAD4 resulted in suppression of GCs-induced cell migration (Supplementary Fig. 6e).
GR knockdown also blocked the GCs-induced up-regulation of CYR61, ANKRD1 and
Vimentin (Supplementary Fig. 6f), as well as promotion of cell proliferation
(Supplementary Fig. 6g) and cell migration (Supplementary Fig. 6h). Because of the
importance of CSCs trait, we tested whether GC triggered CSCs feature depends on
TEAD4 and GR. Knocking down TEAD4, as well as GR blocked GC treatment induced
CSCs marker Slug�Nanog and Oct4 expression (Fig. 5g, Supplementary Fig. 6i), and
blocked GC treatment induced tumorsphere formation (Fig. 5h). Lung seeding assay
assessing tumor migration ability in vivo showed that knockdown of TEAD4 or GR
blocked GCs-induced increase of the ratio of lung in the whole-body weight (Fig. 5i)
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
16
and the number of metastatic tumors (Fig. 5j,k). Besides the contribution of TEAD4
and GR, it is noticeable that YAP also contributed to the growth promotion function of
GCs (Supplementary Fig. 6j). It may be a synergistic result of TEAD4/YAP, and the
function of YAP/TEAD4 still depends on the transcriptional activity of TEAD4.
Moreover, TEAD4 activated form TEAD4-VP16 overexpression satisfied metastasis
phenotype (Fig. 5l-n). Thus, several lines of evidence indicate that GR-TEAD4 is
essential for GCs induced CSCs feature, cell survival and metastasis in vitro and in vivo.
GR-TEAD4 pathway is involved in GCs-induced chemo-resistance
Breast cancer is sensitive to cytotoxic compounds like taxanes, and GCs promote
breast cancer cell drug resistance during cancer therapy (33,46). We then assessed
whether TEAD4 was involved in GCs-induced chemo-resistance. We monitored
proliferation in cells treated with vehicle, Paclitaxel (PX), or PX combined with Dex.
Dex treatment inhibited the cleaved PARP and cleaved caspase8 expressions and
protected the cells from apoptosis caused by PX treatment, but lost its function in
TEAD4 knockdown cells (Fig. 6a,b), suggesting that TEAD4 mediates GCs-induced
chemo-resistance. To further gain insight into the role of TEAD4 in GCs-triggered
chemo-resistance, we inhibited TEAD-dependent transcriptional activity using
niflumic acid (NA), a non-steroidal anti-inflammatory drug (NSAID) (47). PX
treatment promoted the expression of apoptosis marker cleaved PARP and inhibited
cell growth (Fig. 6c,d). Co-treatment PX with Dex inhibited the function of PX (Fig.
6c,d). NA co-treatment abolished Dex-induced expression changes of ANKRD1 and
cleaved PARP (Fig. 6c), also repressed Dex-induced cell proliferation (Fig. 6d). NA
lost its function in TEAD4 knockdown cells (Fig. 6e). These results indicate that
transcriptional activity of TEAD4 is required for GCs-induced chemo-resistance in
breast cancer cells. To investigate whether NA works in vivo, we intraperitoneally
injected different combined drugs after cells were subcutaneously transplanted into
nude mice. PX treatment dramatically repressed tumor growth as shown by reduced
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
17
tumor volume (Fig. 6f), decreased tumor weight and metastasis (Fig. 6g,h), reduced
Ki67 expression and elevated cleaved caspase3 expression (Fig. 6i) compared with
control group. Co-injection of Dex with PX inhibited the tumor suppression function
of PX, while NA treatment reversed Dex-induced tumor chemo-resistance (Fig. 6f-i).
Our data suggest that activity of TEAD4 is responsible for GCs-induced chemo-
resistance in vitro and in vivo.
Discussion
The Hippo signaling pathway plays critical roles in many biological processes. While
much has been learned about the regulation and function of the cofactors YAP/TAZ,
less is known about the transcription factors TEADs. In this report, we provided
evidence that GCs-GR positively regulated TEAD4. YAP/TAZ deletion was not able
to block the transcription regulation of TEAD4 induced by GCs, and overexpression of
YAP was not able to stabilize TEAD4. Besides, GR directly interacted with TEAD4
independent of YAP. These results revealed a YAP/TAZ-independent regulation of
TEAD4 by GCs-GR signaling. Even though, YAP still contributes to the function of
GCs. GCs-activated YAP-TEAD4 may bind with each other and play their function
synergistically in breast cancer.
Several genes have been identified as TEAD4 co-factors and involved in the function
of TEAD4. We previously reported that KLF5 forms a complex with TEAD4 and
promotes breast cancer progression (22), and GCs also induces KLF5 through GR, and
KLF5 partially mediated the GC-induced docetaxel and cisplatin resistance in TNBC
(32). In this study, we demonstrated that GR binds to TEAD4 to promote TEAD4
transcription and is involved in tumor growth and drug resistance. It is plausible that
GCs-stimulated GR form a ternary complex with TEAD4-KLF5 and play its function
through TEAD4-KLF5. Interestingly, it is reported that GCs-liganded GR regulates
target gene expression through binding to GC response elements (GREs), or tethering
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
18
to other transcription factors such as TEAD or AP1(41,42). These cues also suggest
that GR may be involved in the regulation of Hippo signaling.
Recently, several alternative splicing events were reporter to modulate Hippo
signaling activity. RBM4-facilitated TEAD4 alternative splicing produces a truncated
isoform: TEAD4 shorter isoform (TEAD4-S) (16). TEAD4-S lacks an N-terminal DNA
binding domain whereas maintains C-terminal YAP binding domain. Exogenous
TEAD4-S is located in both nucleus and cytoplasm, while TEAD4-FL is mainly located
in nucleus. TEAD4-FL functions as a tumor promoter, while TEAD4-S as a tumor
suppressor (16). Our data demonstrated that GCs trigger TEAD4-FL nuclear
accumulation in breast cancer cells. Endogenous TEAD4-FL was mainly located in
nucleus, and endogenous TEAD4-S was mainly located in cytoplasm by extraction of
nuclear and cytoplasmic fraction. GCs trigger nuclear TEAD4-FL accumulation, but
cytoplasmic TEAD4-S does not show obvious change in MDA-MB-231 and MDA-
MB-453 cells. The increased ratio of TEAD4-FL/TEAD4-S suggests that GCs could
also regulate TEAD4 alternative splicing and help TEAD4 produce more nuclear
TEAD4-FL to promote tumor progression.
TNBC is the most aggressive breast cancer subtype. Our work demonstrated the
oncogenic role and positive correlation of TEAD4 and GR in breast cancer. GCs-GR-
TEAD4 axis was involved in the tumor initiation, progression and drug resistance in
breast cancer especially in TNBC. Our findings illustrated a new molecular mechanism
in TNBC regulation, and shed insights in developing new breast cancer therapy.
Acknowledgments
We thank Xiaorui Zhang and Liping Kuai for the animal care. We acknowledge
Gaoxiang Ge, Zhenfei Li and Lijian Hui for the providing reagents and helpful
comments. This work was supported by National Key Research and Development
Program of China (2017YFA0103601 to L. Z.), National Natural Science Foundation
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
19
of China (No. 31530043 and 31625017 to L. Z. and U1602221 and 81830087,
31771516 to C. C.), “Strategic Priority Research Program” of Chinese Academy of
Sciences (XDB19000000 to L. Z. and XDA16010405 to C. C), “Shanghai Leading
Talents Program” to L. Z., Science and Technology Commission of Shanghai
Municipality (19ZR1466300 to Z. W.), and Youth Innovation Promotion Association
of the Chinese Academy of Sciences to Z. W..
References
1. WuS,HuangJ,DongJ,PanD.hippoencodesaSte-20familyproteinkinasethat
restrictscellproliferationandpromotesapoptosisinconjunctionwithsalvador
andwarts.Cell2003;114:445-56
2. YinMX,ZhangL.Hipposignaling inepithelial stemcells.Actabiochimicaet
biophysicaSinica2015;47:39-45
3. Yu FX, Zhao B, Guan KL. Hippo Pathway in Organ Size Control, Tissue
Homeostasis,andCancer.Cell2015;163:811-28
4. Hao Y, Chun A, Cheung K, Rashidi B, Yang X. Tumor suppressor LATS1 is a
negative regulator of oncogene YAP. The Journal of biological chemistry
2008;283:5496-509
5. Zhang L, Ren F, ZhangQ, Chen Y,Wang B, Jiang J. The TEAD/TEF family of
transcriptionfactorScallopedmediatesHipposignalinginorgansizecontrol.
Developmentalcell2008;14:377-87
6. Zhou Y, Huang T, Cheng AS, Yu J, KangW, To KF. The TEAD Family and Its
OncogenicRoleinPromotingTumorigenesis.Internationaljournalofmolecular
sciences2016;17
7. WangW,XiaoZD,LiX,AzizKE,GanB,JohnsonRL,etal.AMPKmodulatesHippo
pathway activity to regulate energy homeostasis. Nature cell biology
2015;17:490-9
8. LinKC,MoroishiT,MengZ,JeongHS,PlouffeSW,SekidoY,etal.Regulationof
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
20
Hippopathwaytranscription factorTEADbyp38MAPK-inducedcytoplasmic
translocation.Naturecellbiology2017;19:996-1002
9. Zhao B, Wei X, Li W, Udan RS, Yang Q, Kim J, et al. Inactivation of YAP
oncoproteinby theHippopathway is involved in cell contact inhibitionand
tissuegrowthcontrol.Genes&development2007;21:2747-61
10. GaoJ,HeL,ShiY,CaiM,XuH,JiangJ,etal.Cellcontactandpressurecontrol
of YAP localization and clustering revealed by super-resolution imaging.
Nanoscale2017;9:16993-7003
11. SorrentinoG,RuggeriN, ZanniniA, Ingallina E, BertolioR,MarottaC, et al.
Glucocorticoid receptor signalling activates YAP in breast cancer. Nature
communications2017;8:14073
12. ChenL,ChanSW,ZhangX,WalshM,LimCJ,HongW,etal.Structuralbasisof
YAP recognition by TEAD4 in the hippo pathway. Genes & development
2010;24:290-300
13. GuptaMP,KogutP,GuptaM.Proteinkinase-Adependentphosphorylationof
transcription enhancer factor-1 represses its DNA-binding activity but
enhancesitsgeneactivationability.Nucleicacidsresearch2000;28:3168-77
14. Jiang SW, Dong M, Trujillo MA, Miller LJ, Eberhardt NL. DNA binding of
TEA/ATTSdomainfactorsisregulatedbyproteinkinaseCphosphorylationin
human choriocarcinoma cells. The Journal of biological chemistry
2001;276:23464-70
15. Noland CL, Gierke S, Schnier PD,Murray J, SandovalWN, SagollaM, et al.
PalmitoylationofTEADTranscriptionFactorsIsRequiredforTheirStabilityand
FunctioninHippoPathwaySignaling.Structure2016;24:179-86
16. Qi Y, Yu J, HanW, Fan X,QianH,WeiH, et al. A splicing isoformof TEAD4
attenuates the Hippo-YAP signalling to inhibit tumour proliferation. Nature
communications2016;7:ncomms11840
17. HomeP,SahaB,RayS,DuttaD,GunewardenaS,YooB,etal.Alteredsubcellular
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
21
localization of transcription factor TEAD4 regulates first mammalian cell
lineagecommitment.ProceedingsoftheNationalAcademyofSciencesofthe
UnitedStatesofAmerica2012;109:7362-7
18. ParkB,ChangS, LeeGJ,KangB,Kim JK,ParkH.Wnt3adisruptsGR-TEAD4-
PPARgamma2 positive circuits and cytoskeletal rearrangement in a beta-
catenin-dependent manner during early adipogenesis. Cell Death Dis
2019;10:16
19. JiaoS,WangH,ShiZ,DongA,ZhangW,SongX,etal.Apeptidemimicking
VGLL4functionactsasaYAPantagonisttherapyagainstgastriccancer.Cancer
cell2014;25:166-80
20. Zhang W, Xu J, Li J, Guo T, Jiang D, Feng X, et al. The TEA domain family
transcription factor TEAD4 represses murine adipogenesis by recruiting
cofactors VGLL4 and CtBP2 into a transcriptional complex. The Journal of
biologicalchemistry2018
21. JiaoS,LiC,HaoQ,MiaoH,ZhangL,LiL,etal.VGLL4targetsaTCF4-TEAD4
complextocoregulateWntandHipposignalling incolorectalcancer.Nature
communications2017;8:14058
22. WangC,NieZ,ZhouZ,ZhangH,LiuR,WuJ,etal.TheinterplaybetweenTEAD4
andKLF5promotesbreastcancerpartiallythroughinhibitingthetranscription
ofp27Kip1.Oncotarget2015;6:17685-97
23. ZanconatoF, ForcatoM,BattilanaG,Azzolin L,QuarantaE,BodegaB, etal.
Genome-wide association between YAP/TAZ/TEAD and AP-1 at enhancers
drivesoncogenicgrowth.Naturecellbiology2015;17:1218-27
24. AnbanandamA,AlbaradoDC,NguyenCT,HalderG,GaoX,VeeraraghavanS.
Insightsintotranscriptionenhancerfactor1(TEF-1)activityfromthesolution
structureoftheTEAdomain.ProceedingsoftheNationalAcademyofSciences
oftheUnitedStatesofAmerica2006;103:17225-30
25. ShiZ,HeF,ChenM,HuaL,WangW,JiaoS,etal.DNA-bindingmechanismof
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
22
theHippopathwaytranscriptionfactorTEAD4.Oncogene2017;36:4362-9
26. ButtgereitF,ScheffoldA.Rapidglucocorticoideffectsonimmunecells.Steroids
2002;67:529-34
27. Smith LK, Cidlowski JA. Glucocorticoid-induced apoptosis of healthy and
malignantlymphocytes.Progressinbrainresearch2010;182:1-30
28. KoflerR,SchmidtS,KoflerA,AusserlechnerMJ.Resistancetoglucocorticoid-
induced apoptosis in lymphoblastic leukemia. The Journal of endocrinology
2003;178:19-27
29. MoranTJ,GrayS,MikoszCA,ConzenSD.Theglucocorticoidreceptormediates
a survival signal in human mammary epithelial cells. Cancer research
2000;60:867-72
30. Zhang C, Beckermann B, Kallifatidis G, Liu Z, Rittgen W, Edler L, et al.
Corticosteroidsinducechemotherapyresistanceinthemajorityoftumourcells
frombone,brain,breast,cervix,melanomaandneuroblastoma.International
journalofoncology2006;29:1295-301
31. Skor MN, Wonder EL, Kocherginsky M, Goyal A, Hall BA, Cai Y, et al.
Glucocorticoid receptor antagonism as a novel therapy for triple-negative
breast cancer. Clinical cancer research : an official journal of the American
AssociationforCancerResearch2013;19:6163-72
32. LiZ,DongJ,ZouT,DuC,LiS,ChenC,etal.Dexamethasoneinducesdocetaxel
andcisplatinresistancepartiallythroughup-regulatingKruppel-likefactor5in
triple-negativebreastcancer.Oncotarget2017;8:11555-65
33. ChenZ,LanX,WuD,SunkelB,YeZ,HuangJ,etal.Ligand-dependentgenomic
function of glucocorticoid receptor in triple-negative breast cancer. Nature
communications2015;6:8323
34. JamdadeVS,SethiN,MundheNA,KumarP,LahkarM,SinhaN.Therapeutic
targets of triple-negative breast cancer: a review. Br J Pharmacol
2015;172:4228-37
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
23
35. LamarJM,SternP,LiuH,SchindlerJW,JiangZG,HynesRO.TheHippopathway
target, YAP, promotes metastasis through its TEAD-interaction domain.
Proceedings of the National Academy of Sciences of the United States of
America2012;109:E2441-50
36. Shi P, Feng J, Chen C. Hippo pathway inmammary gland development and
breastcancer.ActabiochimicaetbiophysicaSinica2015;47:53-9
37. Biddie SC, Conway-Campbell BL, Lightman SL. Dynamic regulation of
glucocorticoidsignallinginhealthanddisease.Rheumatology2012;51:403-12
38. HacheRJ,TseR,ReichT,SavoryJG,LefebvreYA.Nucleocytoplasmictrafficking
of steroid-free glucocorticoid receptor. The Journal of biological chemistry
1999;274:1432-9
39. Kadmiel M, Cidlowski JA. Glucocorticoid receptor signaling in health and
disease.TrendsPharmacolSci2013;34:518-30
40. ZhaoB,YeX,YuJ,LiL,LiW,LiS,etal.TEADmediatesYAP-dependentgene
inductionandgrowthcontrol.Genes&development2008;22:1962-71
41. Biddie SC, John S, Sabo PJ, Thurman RE, Johnson TA, Schiltz RL, et al.
TranscriptionfactorAP1potentiateschromatinaccessibilityandglucocorticoid
receptorbinding.Molecularcell2011;43:145-55
42. StarickSR,Ibn-SalemJ,JurkM,HernandezC,LoveMI,ChungHR,etal.ChIP-
exo signal associated with DNA-binding motifs provides insight into the
genomicbindingoftheglucocorticoidreceptorandcooperatingtranscription
factors.Genomeresearch2015;25:825-35
43. NishiokaN,InoueK,AdachiK,KiyonariH,OtaM,RalstonA,etal.TheHippo
signaling pathway components Lats and Yap pattern Tead4 activity to
distinguishmouse trophectoderm from inner cellmass. Developmental cell
2009;16:398-410
44. Gruver-Yates AL, Cidlowski JA. Tissue-specific actions of glucocorticoids on
apoptosis:adouble-edgedsword.Cells2013;2:202-23
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
24
45. PanD,KocherginskyM,ConzenSD.Activationoftheglucocorticoidreceptoris
associatedwithpoorprognosis in estrogen receptor-negativebreast cancer.
Cancerresearch2011;71:6360-70
46. Herr I, Pfitzenmaier J.Glucocorticoiduse inprostate cancer andother solid
tumours:implicationsforeffectivenessofcytotoxictreatmentandmetastases.
TheLancetOncology2006;7:425-30
47. PobbatiAV,HanX,HungAW,WeiguangS,HudaN,ChenGY,etal.Targetingthe
Central Pocket in Human Transcription Factor TEAD as a Potential Cancer
TherapeuticStrategy.Structure2015;23:2076-86
Figure Legends
Figure 1. Glucocorticoids up-regulate TEAD4 transcriptional level and promote
TEAD4 nuclear accumulation in breast cancer cells. (a) Western blotting analysis
of the protein levels of Hippo components with indicated antibodies. MDA-MB-231
cells were treated with Dexamethasone (Dex) 1µM for 0h, 1h, 4h, 8h or 12 hours (h).
(b) Quantification of YAP and TEAD4 protein levels. The protein levels were
quantized by Image J. (c) Protein levels of Hippo signaling components. MDA-MB-
453 and BT-549 cells were treated with Dex 1µM for 0h, 4h or 12h. (d,e) Quantitative
PCR with reverse transcription (qRT–PCR) analysis of Hippo components message
RNA (mRNA) levels. MDA-MB-231 and BT-549 cells were treated with Dex 1µM for
4h or 12 h. Tow biological repeats per group. (f) Representative confocal
immunofluorescence images (left) of TEAD4 in MDA-MB-231 cells treated with Dex
1µM or Hydrocortisone (HC) 1µg/mL for 12h, Ethanol (Etha) was used as a control.
TEAD4 and DAPI were stained. Quantification of TEAD4 nuclear localization (N) and
cytoplasmic localization (C) was provided (right). Scale bar =10µm. (g,h) Nuclear and
cytoplasmic fraction analysis of TEAD4 expression. MDA-MB-231 or MDA-MB-453
cells were treated same with f. Subcellular fractionation was performed with NE-
PERTM nuclear and cytoplasmic extraction reagent (Thermo Fisher) according to the
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
25
instructions of the manufacturer. Both fractions were analyzed by western blotting with
indicated antibodies. (i,j) 3×SD luciferase reporter activity analysis of TEAD4
transcriptional activity. MDA-MB-231 and MDA-MB-453 cells were transfected with
vector of 3×SD luciferase reporter, and 24h later, cells were treated with Etha, Dex
1µM or HC 1µg/mL for 12h. The relative luciferase activities were determined by
calculating the ratio of firefly luciferase activities over Renilla luciferase activities.
Data was normalized to Etha. 3 biological repeats per group. Data in d-f, i and j
represent the mean±s.d.. One-way ANOVA were used to compare the difference
between groups. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, and ns means no
statistics significance. Significance was relative to control of each group.
Figure 2. GCs-GR axis regulates TEAD4 independent of YAP/TAZ. (a,b) Analysis
of TEAD4 subcellular localization and mRNA level in MDA-MB-231 cells transfected
with indicated siRNA for 36h and treated with Dex 1µM or HC 1µg/mL for 12h. siNC
was used as negative control. Nuclear and cytoplasmic extraction was analyzed by
western blotting (a) and mRNA level was analyzed by qRT–PCR (b). (c,d) Analysis of
TEAD4 subcellular localization and mRNA level in MDA-MB-231 cells treated with
Dex 1µM or HC 1ug/mL alone or in combination with RU486 1µM for 12 h.
Representative blots (c) and relative mRNA level (d) were shown. (e) Analysis of
transcriptional activity of TEAD4 by 3xSD luciferase reporter. MDA-MB-231cells
were transfected with 3×SD luciferase reporter and siRNA. After 24h, cells were treated
with Dex 1µM or HC 1µg/mL alone or in combination with RU486 1µM for 12h. Data
were normalized to Etha. (f) Analysis of protein levels with indicated antibodies in
YAP/TAZ deletion cells. MDA-MB-231 cells stably expressing shYAP were
transfected with siTAZ for 36h and treated with Dex 1µM or HC 1µg/mL for 12h. (g)
Analysis of mRNA levels with indicated RT-PCR primers in YAP/TAZ knockdown
cells. MDA-MB-231 cells were transfected with siTAZ and siYAP for 36 h and treated
with Dex 1µM or HC 1µg/mL for 12h. (h) MDA-MB-231were treated with VP
combined with Dex 1µM or HC 1µg/mL for 12h. Data in b, d, e and g represent the
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
26
mean±s.d. from two biological repeats. One-way ANOVA was used to compare the
difference between groups. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, and ns
means no statistics significance. Significance was relative to control of each group.
Figure 3. GR, forming a novel complex with TEAD4 is required for TEAD4
transcriptional activation. (a) Schematic diagram of TEAD4 promoter region with
conserved TEAD4 and GR binding sites. (b) Chromatin immunoprecipitation (ChIP)
analysis showed the binding of GR to the TEAD4 promoter. MDA-MB-231 cells were
treated with Dex 1µM for 12h. Protein-bound chromatin was immunoprecipitated with
the GR antibody, and IgG was used as a control. The immunoprecipitated DNA was
analyzed by Quantitative PCR (q-PCR) using primers of TEAD4 binding sequence, and
TEAD4-NC was as a negative control. (c) Luciferase reporter driven by wild-type or
mutant TEAD4 promoter (as shown in a) was transfected in the presence or absence of
Dex or Dex/RU486. (d) Luciferase reporter analysis of the TEAD4 transcriptional
activity with or without GR expression. Luciferase activity from TEAD4 promoter in
MDA-MB-231 cells was measured following treatment with Dex 1µM for 12h on the
background of siGR transfection. (e) ChIP analysis of the binding of TEAD4 to the
TEAD4 promoter. MDA-MB-231 cells were treated with Dex 1µM. (f) Schematic
diagram of main domains and sites of TEAD4 and GR. (g) GST pull-down assay to
detect the interaction of TEAD4 and GR. Purified GST-tagged GR recombinant
proteins were incubated with cell lysates overexpressed Flag-tagged TEAD4, TEAD4-
N or TEAD4-C. GST protein was used as a negative control. (h) GST pull-down assay
to detect the main domain of GR mediating the interaction of TEAD4 and GR. Purified
GST-tagged GR full length and truncations recombinant proteins were incubated with
cell lysates overexpressed Flag-tagged TEAD4. (i) GST pull-down assay to determine
the interaction of TEAD4 and GR with or without DNase. Digestion of DNA was
detected by agarose gel. (j) Two step ChIP-PCR analysis of the TEAD4 binding to the
TEAD4/CYR61/CTGF promoters with or without siGR transfection. MDA-MB-231
cells were treated with Dex. (k) Luciferase reporter analysis of TEAD4-GR complex to
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
27
enhance TEAD4 transcription. Luciferase reporter driven by TEAD4 promoter was
transfected with GR or GR-2C2A overexpression, then MDA-MB-231 cells were
treated with Etha or Dex. (l) ChIP analysis of the binding of TEAD4 to the
TEAD4/CYR61/CTGF promoter with or without siGR transfection. MDA-MB-231
cells were treated with Dex 1µM. Data in b-e and j-l represent the mean±s.d from three
biological repeats. One-way ANOVA was used to compare the difference between
groups. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, and ns means no statistics
significance. Significance was relative to control of each group.
Figure 4. The activity of TEAD4 positively correlates with GR expression in
human breast cancer. (a) Representative IHC images of GR and TEAD4 staining in
the human triple negative breast cancer (TNBC) samples. Scale bar =100/25µm. (b)
Pearson correlation analysis of the expression correlation of GR and TEAD4 in 30
TNBC samples. (c) Percentage statistic of TEAD4 and GR nuclear expression in the
human TNBC samples. (d) TEAD4 mRNA expression in breast cancer and normal
tissue. The data was obtained from TCGA database. (e) Kaplan-Meier survival analysis
of TEAD4 mRNA levels with 3951 samples of 35 datasets from Kaplan-Meier Plotter
website using the logrank test. Survival curve were calculated according to the Kaplan-
Meier method. (f,g) MTT analysis of cell proliferation. MDA-MB-231 cells were stably
expressed shLuc, shTEAD4 or shGR and were performed the MTT assay daily for 6
days. Five biological repeats per group. (h) Transwell analysis of cell migration. MDA-
MB-231 cells stably express shLuc, shTEAD4 or shGR were serum starved. The
representative pictures of migrated cells were shown. Scale bar =500µm. (i)
Tumorsphere formation assay was conducted with shLuc, shTEAD4 or shGR in 3×105
MDA-MB-231 cells. Representative images were shown. Scale bars= 400µm based on
randomly selected 5 fields. (j) Xenograft assay of tumor growth. MDA-MB-231 cells
were stably expressed shLuc, shTEAD4 or shGR, and implanted subcutaneously in
nude mice. The average sizes of xenograft tumors were measured twice a week. Each
group contained eight biological replicates of four mice. (k) Weights of the tumors in
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
28
g removed after 24 days. (l) Representative images of removed tumors and the ratios of
metastatic mice were shown. Scale bar =1cm. Data in f-k represent the mean±s.d.. One-
way ANOVA was used to compare the difference between groups. *P<0.05, **P<0.01,
***P<0.001, ****P<0.0001, and ns means no statistics significance. Significance was
relative to control of each group.
Figure 5. GR-TEAD4 mediates GCs-triggered CSCs trait, as well as cell survival
and metastasis in vitro and in vivo. (a) Protein levels of GCs-induced genes with
shLuc or shTEAD4 transfection. MDA-MB-231 cells were treated with Dex 1 µM for
12h with shLuc or shTEAD4 expression. (b) MTT analysis of GCs-triggered cell
proliferation. MDA-MB-231 cells stably expressing shLuc or shTEAD4 were treated
with Etha, Dex 1µM or HC 1µg/mL when seeding cells. Five biological replicates per
group. (c) Xenograft analysis of GCs-promoted tumor growth. MDA-MB-231 cells
stably expressed shLuc or shTEAD4 were pre-treated with Etha or Dex 1µM for 24h,
and were implanted subcutaneously in nude mice. The average sizes of xenograft
tumors were measured twice a week. Each group contained eight biological replicates
of four mice. (d,e) Weights and pictures of the tumors in c removed after 22 days were
shown. Scale bar =1cm. (f) Statistics of Ki67 positive cells in e. (g) Protein level of
GCs-induced CSCs marker. (h) Tumorsphere formation assay was conducted with
shLuc, shTEAD4 or shGR in 3×105 MDA-MB-231 cells with or without GCs treatment.
Representative images were shown. Scale bars = 400µm based on randomly selected 5
fields. (i) Lung seeding assay of tumor metastasis in vivo. The ratio of lung in whole
body weight was shown. One million cells stably expressing shLuc, shTEAD4 or shGR
were pre-treated as c and injected into nude mice via tail vein. Mice were sacrificed
after 40 days. More than five mice per group. (j) Representative images of lung were
shown. Scale bar =1cm. (k) Statistical graph of tumor numbers in lung. (l-n) The
function of TEAD4 activation in tumor metastasis in vivo. One million MDA-MB-231
cells stably expressing Control or TEAD-VP16 were injected into nude mice via tail
vein, and the mice were analyzed as i-k. Data in b-d, f, h, i, k, l and n represent the
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
29
mean±s.d.. Unpaired t tests and One-way ANOVA were used to compare the difference
between groups. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, and ns means no
statistics significance. Significance was relative to control of each group.
Figure 6. TEAD4 activation is involved in GCs-induced chemo-resistance. (a)
Knockdown of TEAD4 blocked GCs-induced expression of apoptosis marker. MDA-
MB-231 cells were treated with control, paclitaxel (PX) 0.1µM or Dex 1µM as labelled
with shLuc or shTEAD4 transfection. (b) Inhibition of TEAD4 activity blocked GCs-
induced chemo-resistance. MDA-MB-231 cells were treated as a. Cell viability was
detected after 4 days. Five repeats each group. (c,d) MDA-MB-231 cells were treated
with DMSO, niflumic acid (NA) 100 µM or PX 1µM combined with Etha or Dex 1µM
and then analyzed of protein levels (c) and cell survival (d). (e) MDA-MB-231 cells
were treated with DMSO or 100µM NA combined with 1µM PX and 1µM Dex
treatment with or without shTEAD4 expression, and then analyzed of cell survival. (f)
Xenograft assay analysis the function of TEAD4 transcriptional activity in GC-induced
drug resistance. One million MDA-MB-231 cells were implanted subcutaneously in
nude mice, and PX combined with Dex or NA was intraperitoneally injected to the nude
mice when the tumor volume was up to 50mm3. The average sizes of xenograft tumors
were measured twice a week. The tumor growth curves were shown. Each group
contained six biological replicates. (g,h) Tumor weight (g) and pictures (h) removed
after 33 days were shown. Scale bar =1cm. (i) IHC analysis of Ki67 and Cleaved
Caspase3 expression in tumor of g. Representative images were shown. Scar bar =20µm.
Data in b and d-g represent the mean±s.d.. One-way ANOVA was used to compare the
difference between groups. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, and ns
means no statistics significance. Significance was relative to control of each group.
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
30
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
31
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
32
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
33
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
34
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
35
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012
Published OnlineFirst July 9, 2019.Cancer Res Lingli He, Liang Yuan, Yang Sun, et al. breast cancer progressionGlucocorticoid receptor signaling activates TEAD4 to promote
Updated version
10.1158/0008-5472.CAN-19-0012doi:
Access the most recent version of this article at:
Material
Supplementary
http://cancerres.aacrjournals.org/content/suppl/2019/07/09/0008-5472.CAN-19-0012.DC1
Access the most recent supplemental material at:
Manuscript
Authorbeen edited. Author manuscripts have been peer reviewed and accepted for publication but have not yet
E-mail alerts related to this article or journal.Sign up to receive free email-alerts
Subscriptions
Reprints and
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Permissions
Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)
.http://cancerres.aacrjournals.org/content/early/2019/07/09/0008-5472.CAN-19-0012To request permission to re-use all or part of this article, use this link
Research. on August 2, 2020. © 2019 American Association for Cancercancerres.aacrjournals.org Downloaded from
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on July 9, 2019; DOI: 10.1158/0008-5472.CAN-19-0012