+ All Categories
Home > Documents > Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com...

Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com...

Date post: 25-Dec-2015
Category:
Upload: julian-garrett
View: 226 times
Download: 0 times
Share this document with a friend
Popular Tags:
36
Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes. Let’s look at a few of these…
Transcript
Page 1: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

Goal 3.04 Assess the impacts of genomics on individuals and society.

scrapetv.com

blog.makezine.comThere are many ways that humans have manipulated genes.

Let’s look at a few of these…

Page 2: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

1. ARTIFICIAL BREEDING/SELECTION1. ARTIFICIAL BREEDING/SELECTION

Artificial Breeding/Selection is …

z.about.commichaeldodsracing.co.uk

When humans select who mates to whom to improve the breed.

Page 3: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

Artificial Breeding/SelectionArtificial Breeding/Selection

Artificial Breeding/Selection is …

When humans select which plants to cross to improve the plant.

Wild mustard plantWild mustard plant

Wild rose plantWild rose plant

Wild corn called TEOSINTE was bred to create today’s corn

Wild corn called TEOSINTE was bred to create today’s corn

nescent.org

Page 5: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

2. BIOTECHNOLOGY2. BIOTECHNOLOGY

Biotechnology is …

The use of organisms or their products to improve human life.

HOW DO THEY DO IT?! biotechresearchandfinance.com

Page 6: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

The code is UNIVERSAL!

• Since all living organisms… – use the same DNA– use the same code

book– read their genes the

same way

• Since all living organisms… – use the same DNA– use the same code

book– read their genes the

same way

Remember that ALL organisms are made using

the same four DNA bases A,T,C,G.

AND

Those bases code the same way in ALL

organisms using A,U,C,G.Remember that ALL organisms are made using

the same four DNA bases A,T,C,G.

AND

Those bases code the same way in ALL

organisms using A,U,C,G.

Page 7: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

CLONING = making genetically identical copiesCLONING = making genetically identical copies

HSW: Genetics: Cloning Time: 03:20

Reversing Human Destruction through Cloning

http://player.discoveryeducation.com/index.cfm?guidAssetId=4CDB02CD-6421-42B4-AF9D-B940E1393F19&blnFromSearch=1&productcode=US

The ControversyThe Controversy

Page 8: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

Let’s look at Dolly

Page 9: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

Human Genome ProjectIdentified the entire sequence of DNA bases for humans.Human Genome ProjectIdentified the entire sequence of DNA bases for humans.

There are 3.2 billion bases in the human genome.There are 3.2 billion bases in the human genome.

What do you think can be done now that we

know the order (sequence) in which all 3.2 billion bases occur?

Human Genome Project Explained 15:24 min

http://www.5min.com/Video/The-Human-Genome-Project-Applications-151426688

Page 10: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

Now

, how

man

y ch

rom

osom

es d

o yo

u se

e?Is

this

a m

ale

or fe

mal

e?

How many chromosomes do you see?How many chromosomes do you see?

IT’S A GIRL!

KARYOTYPE = display of chromosomes laid out in pairs from largest to smallest. Sex chromosomes are always placed at the end.KARYOTYPE = display of chromosomes laid out in pairs from largest to smallest. Sex chromosomes are always placed at the end.

Page 11: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

How many chromosomes? Which gender (sex)?

How many chromosomes? Which gender (sex)?

It’s a BOY!

Page 12: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

How scientists and doctors use karyotypeshttp://learn.genetics.utah.edu/content/begin/traits/predictdisorder/

Karyotypes are a way or organizing chromosomes to make it easier to study and identify certain characteristics within an

individual’s DNA.

Karyotypes are a way or organizing chromosomes to make it easier to study and identify certain characteristics within an

individual’s DNA.

Make a Karyotype http://learn.genetics.utah.edu/content/begin/traits/karyotype/

Page 13: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

What do you get when you cross …

instanta.blogspot.com

i57.photobucket.comclouddragon.wordpress.com

smh.com.au

www.chemcases.comwww.scienceclarified.com

Genetic Engineering is…

Inserting genes from one organism into a different organism.

Genetic Engineering is…

Inserting genes from one organism into a different organism.

Page 14: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

How do we do mix genes??• Genetic engineering

– find gene– cut DNA in both organisms– paste gene from one creature into other creature’s

DNA– insert new chromosome into organism– organism copies new gene as if it were its own– organism reads gene as if it were its own– organism produces NEW protein:

Remember: we all use the same genetic code!

Page 15: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

Cutting DNA

• DNA “scissors”– enzymes that cut DNA– Restriction Enzymes

• used by bacteria to cut up DNA of attacking viruses

• EcoRI, HindIII, BamHI

– cut DNA at specific sites• enzymes look for specific base sequences

ACTGA ATTCGGATCA TGACTTAAGCC TAGT

Page 16: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

Restriction enzymes• Cut DNA at specific sites - leave “sticky ends”

GTAAC GAATTCACGCTTCATTGCTTAAG TGCGAA

GTAACGAATTCACGCTTCATTGCTTAAGTGCGAA

restriction enzyme cut site

restriction enzyme cut site

Locate the section of gene we want.Restriction EnzymeRestriction Enzyme

DNA double strand.

Page 17: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

Recombining DNA – Use the same enzymes for both pieces.– leave “sticky ends” on both– can glue DNA together at “sticky ends”

GTAAC GAATTCACGCTTCATTGCTTAAG TGCGAA

Cut the gene

you want.

Cut the gene

you want.

GTAAC GAATTCACGCTTCATTGCTTAAG TGCGAA

GTAACCATTGCTTAAG

Cut the chromosome

you want to add

the gene to

.Cut th

e chromosome

you want to add

the gene to

.

Recombinant DNA:DNA with foreign genes inserted.

GAATTCACGCTT TGCGAA

Use “sticky ends” to glue

the two genes

together.

Use “sticky ends” to glue

the two genes

together.

DNA Ligase joins the ends.DNA Ligase joins the ends.

Page 18: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

Why use Bacteria??• Recombined Gene produces needed protein in a

different organism.• Use Bacteria because it reproduces rapidly and is

one-celled so easy to grow.

How can bacteria read human DNA?

10 bacteria

20 minutes

40 bacteria

60 minutes

160 bacteria

100 minutes

5120 bacteria

200 minutes

1,310,720 bacteria1,310,720 bacteria

6 hours

Page 19: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

Bacterial DNA and plasmids

• Single circular chromosome– only one copy = haploid– no nucleus

• Other DNA = plasmids! bacterialchromosome

plasmids

Page 20: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

How can plasmids help us?

• A way to get genes into bacteria easily– insert new gene into plasmid– insert plasmid into bacteria = vector– bacteria now expresses new gene

• bacteria make new protein

+

transformedbacteriagene from

other organism

plasmid

cut DNA

recombinantplasmid

vector

glue DNA

Page 21: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

Grow bacteria…make more

growbacteria

harvest (purify)protein

transformedbacteria

plasmid

gene fromother organism

+

recombinantplasmid

vector

Page 22: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

Virtual Lab 12:Bacterial Transformation-Ampicillin Resistance

Page 23: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

Other uses of Genetic Engineering:• Genetically modified organisms (GMO)

– enabling plants to produce new proteins• Produce medications: insulin

– Used by diabetics

• Extend growing season: fishberries – strawberries with an anti-freezing gene from flounder

• Improve quality of food: golden rice – rice producing vitamin A

Page 24: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

Genetic Engineering and MedicineGenetic Engineering and Medicine

Gene Therapy = using genetic engineering to combat disease.

Hemophilia – patients suffer from a lack of Factor VIII.

Hemophilia – patients suffer from a lack of Factor VIII.

Page 25: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

Stem Cells…the key to our future?Stem Cells…the key to our future?

Stem CellsStem Cells

Red Blood Cellsfor accident victimsand transfusions.

Red Blood Cellsfor accident victimsand transfusions.

Muscle Cellsto repair damaged or weak muscles.

Muscle Cellsto repair damaged or weak muscles.

Heart Cellsto repair damaged heart tissues.

Heart Cellsto repair damaged heart tissues.

Page 26: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

Stem Cells

Page 27: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

BiotechnologyGel Electrophoresis

http://videos.howstuffworks.com/hsw/11820-genetics-using-dna-evidence-to-solve-crimes-video.htm

Page 28: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

Many uses of restriction enzymes…• Now that we can cut DNA with restriction

enzymes…– we can cut up DNA from different people… or

different organisms… and compare it

– why?• forensics• medical diagnostics• paternity• evolutionary relationships • and more…

Page 29: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

Comparing cut up DNAGel Electrophoresis

• How do we compare DNA fragments?– separate fragments by size

• How do we separate DNA fragments?– run it through a gelatin – gel electrophoresis

• How does a gel work?

http://www.dnatube.com/video/701/DNA-Fingerprinting

Page 30: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

Gel electrophoresis

• A method of separating DNA in a gelatin-like material using an electrical field– DNA is negatively charged– when it’s in an electrical field it

moves toward the positive side

+–

DNA

“swimming through Jello”

Page 31: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

• DNA moves in an electrical field…– so how does that help you compare DNA

fragments?• size of DNA fragment affects how far it travels

– small pieces travel farther– large pieces travel slower & lag behind

Gel electrophoresis

+–

DNA

Page 32: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

Running a gel

1 2

cut DNA with restriction enzymes

fragments of DNAseparate out based on size

3

Stain DNA– ethidium bromide

binds to DNA– fluoresces under UV

light

Page 33: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

Virtual Lab 11Restriction Enzyme Cleavage and Electrophoresis

Lab: Electrophoresis

Page 34: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

DNA Fingerprinting

• Why is each person’s DNA pattern different?– sections of “junk” DNA

• doesn’t code for proteins• made up of repeated patterns

– CAT, GCC, and others

– each person may have different number of repeats• many sites on our 23 chromosomes with

different repeat patterns

GCTTGTAACGGCCTCATCATCATTCGCCGGCCTACGCTTCGAACATTGCCGGAGTAGTAGTAAGCGGCCGGATGCGAA

Page 35: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

Uses: Evolutionary relationshipsUses: Evolutionary relationships

• Comparing DNA samples from different organisms to measure evolutionary relationships

• Comparing DNA samples from different organisms to measure evolutionary relationships

+

DNA

1 32 4 51 2 3 4 5

turtle snake rat squirrel fruitfly

Page 36: Goal 3.04 Assess the impacts of genomics on individuals and society. scrapetv.com blog.makezine.com There are many ways that humans have manipulated genes.

Sequencing DNA: http://www.pbs.org/wgbh/nova/genome/sequ_flash.html


Recommended