How Much Breast & Ovarian Cancer Is Hereditary?

Ovarian CancerBreast Cancer

10-25%

70-80%

5–10% 15-20%

Sporadic

Familial

Hereditary

Features of Hereditary and Sporadic Cancer in Hereditary Breast and Ovarian Cancer Syndrome (HBOC)

Hereditary Sporadic

• Multiple affected blood relatives in more than one generation

• Typically, earlier age of onset (<50)

• Individuals with bilateral or more than one cancer diagnosis (breast/ovarian)

•Males with breast cancer

• One or only a few affected blood relatives

• Typically, later age of onset

Br, 42

Br, 47Ov, 58

Br, 35Ov, 50

Br, 72

Chromosomes

BRCA1BRCA2

***~84% of HBOC is caused by BRCA1 & BRCA2

50% 50%

BRCA1 -chromosome 17

BRCA2 - chromosome 13

BRCA1 & BRCA2Lifetime Cancer Risks

Type

of Cancer

General Population

BRCA1 BRCA2

Female Breast Cancer

12% 56-87% 56-87%

2nd Breast Cancer 0.8-1.5%

(per year – 5y)

5 year: 20%

Lifetime: 64%

5 year: 12%

Lifetime: 50%

Ovarian Cancer 1.8% 44% 27%

Male Breast Cancer

0.1% ~1-2% 6-10%

Pancreatic Cancer <1% - - ~1.5-5%

Melanoma 1-2% - - Increased

Prostate Cancer 12% ~15-20% ~15-20%

Cancer Screening and Risk-Reduction Options

Increased Screening Risk-Reduction Surgery

Medications

Breast

• Monthly breast-self exam

• Clinical breast exam every 6 months

• Yearly mammogram

• Yearly MRI

Bilateral Mastectomy can reduce the risk of breast cancer by 96%

Tamoxifen/

Raloxifene can reduce the risk of breast cancer by

approximately 50%

Ovarian

• Transvaginal Ultrasound

• CA-125 blood tests every 6 months

* Limitations: Screening is not effective at picking up early stage cancer *

Bilateral Salpingo-Oophorectomy

(removing both the ovaries and fallopian tubes) can reduce the risk of ovarian cancer

by 96%

Oral Contraceptives (birth control pills) can reduce the risk

of ovarian cancer by approximately 50%

Genetic Testing for Breast CancerBRCA1

BRCA2

ATGCCGTATAGCTAGTCGATGTACG

• Blood Test• Misspellings, Deleted, or Added DNA [i.e., mutation]• Tests offered: -Analysis of BRCA1 & BRCA2 genes [3-4 weeks]

-Breast/Ovarian Panels [12 weeks]

-Targeted mutation analysis (when family mutation is known) [3 weeks]

Possible Test ResultsPositive Result Increased chance of certain cancers;

(implications for other family members ) (Known mutation detected)

Mutation has been identified in Negative Result family (True Negative)

(No mutation detected) - No increase in risk above the general population

Mutation has not been identified in family and patient has cancer

- Cancer most likely not due to BRCA1/2

Mutation has not been identified in family and patient does not have cancer

- Doesn’t rule out BRCA1/2

Variant of Uncertain Significance Cancer risk not yet known

(Mutation, but implications/management are not known)

Implications for other family

members

Breast/Ovarian Panels

**Includes BRCA1/2 & 19 additional genes that can increase the risk for breast cancer**High risk gene panel-BRCA1/2, CDH1, PTEN, STK11, TP53